WorldWideScience

Sample records for surface water results

  1. Surface-water surveillance

    Energy Technology Data Exchange (ETDEWEB)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995).

  2. Surface-water surveillance

    International Nuclear Information System (INIS)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995)

  3. Water at surfaces with tunable surface chemistries

    Science.gov (United States)

    Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

    2018-03-01

    Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

  4. Stable water isotope simulation by current land-surface schemes:Results of IPILPS phase 1

    Energy Technology Data Exchange (ETDEWEB)

    Henderson-Sellers, A.; Fischer, M.; Aleinov, I.; McGuffie, K.; Riley, W.J.; Schmidt, G.A.; Sturm, K.; Yoshimura, K.; Irannejad, P.

    2005-10-31

    Phase 1 of isotopes in the Project for Intercomparison of Land-surface Parameterization Schemes (iPILPS) compares the simulation of two stable water isotopologues ({sup 1}H{sub 2} {sup 18}O and {sup 1}H{sup 2}H{sup 16}O) at the land-atmosphere interface. The simulations are off-line, with forcing from an isotopically enabled regional model for three locations selected to offer contrasting climates and ecotypes: an evergreen tropical forest, a sclerophyll eucalypt forest and a mixed deciduous wood. Here we report on the experimental framework, the quality control undertaken on the simulation results and the method of intercomparisons employed. The small number of available isotopically-enabled land-surface schemes (ILSSs) limits the drawing of strong conclusions but, despite this, there is shown to be benefit in undertaking this type of isotopic intercomparison. Although validation of isotopic simulations at the land surface must await more, and much more complete, observational campaigns, we find that the empirically-based Craig-Gordon parameterization (of isotopic fractionation during evaporation) gives adequately realistic isotopic simulations when incorporated in a wide range of land-surface codes. By introducing two new tools for understanding isotopic variability from the land surface, the Isotope Transfer Function and the iPILPS plot, we show that different hydrological parameterizations cause very different isotopic responses. We show that ILSS-simulated isotopic equilibrium is independent of the total water and energy budget (with respect to both equilibration time and state), but interestingly the partitioning of available energy and water is a function of the models' complexity.

  5. Vapour explosions (fuel-coolant interactions) resulting from the sub-surface injection of water into molten metals: preliminary results

    International Nuclear Information System (INIS)

    Asher, R.C.; Bullen, D.; Davies, D.

    1976-03-01

    Preliminary experiments are reported on the relationship between the injection mode of contact and the occurrence and magnitude of vapour explosions. Water was injected beneath the surface of molten metals, chiefly tin at 250 to 900 0 C. Vapour explosions occurred in many, but not all, cases. The results are compared with Dullforce's observations (Culham Report (CLM-P424) on the dropping mode of contact and it appears that rather different behaviour is found; in particular, the present results suggest that the Temperature Interaction Zone is different for the two modes of contact. (author)

  6. Convergent surface water distributions in U.S. cities

    Science.gov (United States)

    M.K. Steele; J.B. Heffernan; N. Bettez; J. Cavender-Bares; P.M. Groffman; J.M. Grove; S. Hall; S.E. Hobbie; K. Larson; J.L. Morse; C. Neill; K.C. Nelson; J. O' Neil-Dunne; L. Ogden; D.E. Pataki; C. Polsky; R. Roy Chowdhury

    2014-01-01

    Earth's surface is rapidly urbanizing, resulting in dramatic changes in the abundance, distribution and character of surface water features in urban landscapes. However, the scope and consequences of surface water redistribution at broad spatial scales are not well understood. We hypothesized that urbanization would lead to convergent surface water abundance and...

  7. Surface Water & Surface Drainage

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This data set contains boundaries for all surface water and surface drainage for the state of New Mexico. It is in a vector digital data structure digitized from a...

  8. Indices of quality surface water bodies in the planning of water resources

    Directory of Open Access Journals (Sweden)

    Rodríguez-Miranda, Juan Pablo

    2016-12-01

    Full Text Available This paper considers a review of the literature major and significant methods of quality indices of water applied in surface water bodies, used and proposed for assessing the significance of parameters of water quality in the assessment of surface water currents and they are usually used in making decisions for intervention and strategic prevention measures for those responsible for the conservation and preservation of watersheds where these water bodies belong. An exploratory methodology was applied to realize the conceptualization of each water quality index. As a result, it is observed that there are several important methods for determining the water quality index applied in surface water bodies.

  9. Drugs of abuse and tranquilizers in Dutch surface waters, drinking water and wastewater: Results of screening monitoring 2009

    NARCIS (Netherlands)

    van der Aa, N.G.F.M.; Dijkman, E.; Bijlsma, L.; Emke, E.; van de Ven, B.M.; van Nuijs, A.L.N.; de Voogt, P.

    2011-01-01

    In the surface waters of the rivers Rhine and Meuse, twelve drugs that are listed in the Dutch Opium act were detected at low concentrations. They are from the groups amphetamines, tranquilizers (barbiturates and benzodiazepines) opiates and cocaine. During drinking water production, most compounds

  10. Anomalous water dynamics at surfaces and interfaces: synergistic effects of confinement and surface interactions

    Science.gov (United States)

    Biswas, Rajib; Bagchi, Biman

    2018-01-01

    In nature, water is often found in contact with surfaces that are extended on the scale of molecule size but small on a macroscopic scale. Examples include lipid bilayers and reverse micelles as well as biomolecules like proteins, DNA and zeolites, to name a few. While the presence of surfaces and interfaces interrupts the continuous hydrogen bond network of liquid water, confinement on a mesoscopic scale introduces new features. Even when extended on a molecular scale, natural and biological surfaces often have features (like charge, hydrophobicity) that vary on the scale of the molecular diameter of water. As a result, many new and exotic features, which are not seen in the bulk, appear in the dynamics of water close to the surface. These different behaviors bear the signature of both water-surface interactions and of confinement. In other words, the altered properties are the result of the synergistic effects of surface-water interactions and confinement. Ultrafast spectroscopy, theoretical modeling and computer simulations together form powerful synergistic approaches towards an understanding of the properties of confined water in such systems as nanocavities, reverse micelles (RMs), water inside and outside biomolecules like proteins and DNA, and also between two hydrophobic walls. We shall review the experimental results and place them in the context of theory and simulations. For water confined within RMs, we discuss the possible interference effects propagating from opposite surfaces. Similar interference is found to give rise to an effective attractive force between two hydrophobic surfaces immersed and kept fixed at a separation of d, with the force showing an exponential dependence on this distance. For protein and DNA hydration, we shall examine a multitude of timescales that arise from frustration effects due to the inherent heterogeneity of these surfaces. We pay particular attention to the role of orientational correlations and modification of the

  11. Surface freezing of water

    OpenAIRE

    P?rez-D?az, J. L.; ?lvarez-Valenzuela, M. A.; Rodr?guez-Celis, F.

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered?exclusively?by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on ...

  12. Surface freezing of water.

    Science.gov (United States)

    Pérez-Díaz, J L; Álvarez-Valenzuela, M A; Rodríguez-Celis, F

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered-exclusively-by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on humidity, presenting at least three different types of surface crystals. Humidity triggers surface freezing as soon as it overpasses a defined value for a given temperature, generating a plurality of nucleation nodes. An evidence of simultaneous nucleation of surface ice crystals is also provided.

  13. Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

    KAUST Repository

    Jin, Yong

    2017-06-23

    Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH) to elucidate their roles on water mass collection efficiency. The experimental results indicate that a hydrophilic surface promotes nucleation and individual droplets growth, and a surface with a low CAH tends to let a smaller droplet to slide down, but the overall water mass collection efficiency is independent of both surface contact angle and CAH. The experimental results agree well with our theoretical calculations. During water condensation, a balance has to be struck between single droplet growth and droplet density on a surface so as to maintain a constant water droplet surface coverage ratio, which renders the role of both surface wettability and hysteresis insignificant to the ultimate water mass collection. Moreover, water droplets on the edges of a surface grow much faster than those on the non-edge areas and thus dominate the contribution to the water mass collection by the entire surface, directly pointing out the very important role of edge effect on water condensation and collection.

  14. Oxide/water interfaces: how the surface chemistry modifies interfacial water properties

    International Nuclear Information System (INIS)

    Gaigeot, Marie-Pierre; Sprik, Michiel; Sulpizi, Marialore

    2012-01-01

    The organization of water at the interface with silica and alumina oxides is analysed using density functional theory-based molecular dynamics simulation (DFT-MD). The interfacial hydrogen bonding is investigated in detail and related to the chemistry of the oxide surfaces by computing the surface charge density and acidity. We find that water molecules hydrogen-bonded to the surface have different orientations depending on the strength of the hydrogen bonds and use this observation to explain the features in the surface vibrational spectra measured by sum frequency generation spectroscopy. In particular, ‘ice-like’ and ‘liquid-like’ features in these spectra are interpreted as the result of hydrogen bonds of different strengths between surface silanols/aluminols and water. (paper)

  15. Insight into Chemistry on Cloud/Aerosol Water Surfaces.

    Science.gov (United States)

    Zhong, Jie; Kumar, Manoj; Francisco, Joseph S; Zeng, Xiao Cheng

    2018-05-15

    Cloud/aerosol water surfaces exert significant influence over atmospheric chemical processes. Atmospheric processes at the water surface are observed to follow mechanisms that are quite different from those in the gas phase. This Account summarizes our recent findings of new reaction pathways on the water surface. We have studied these surface reactions using Born-Oppenheimer molecular dynamics simulations. These studies provide useful information on the reaction time scale, the underlying mechanism of surface reactions, and the dynamic behavior of the product formed on the aqueous surface. According to these studies, the aerosol water surfaces confine the atmospheric species into a specific orientation depending on the hydrophilicity of atmospheric species or the hydrogen-bonding interactions between atmospheric species and interfacial water. As a result, atmospheric species are activated toward a particular reaction on the aerosol water surface. For example, the simplest Criegee intermediate (CH 2 OO) exhibits high reactivity toward the interfacial water and hydrogen sulfide, with the reaction times being a few picoseconds, 2-3 orders of magnitude faster than that in the gas phase. The presence of interfacial water molecules induces proton-transfer-based stepwise pathways for these reactions, which are not possible in the gas phase. The strong hydrophobicity of methyl substituents in larger Criegee intermediates (>C1), such as CH 3 CHOO and (CH 3 ) 2 COO, blocks the formation of the necessary prereaction complexes for the Criegee-water reaction to occur at the water droplet surface, which lowers their proton-transfer ability and hampers the reaction. The aerosol water surface provides a solvent medium for acids (e.g., HNO 3 and HCOOH) to participate in reactions via mechanisms that are different from those in the gas and bulk aqueous phases. For example, the anti-CH 3 CHOO-HNO 3 reaction in the gas phase follows a direct reaction between anti-CH 3 CHOO and HNO 3

  16. chemical and microbiological assessment of surface water samples

    African Journals Online (AJOL)

    PROF EKWUEME

    concentrations and bacteriological content. Evaluation of the results ... and Aninri local government areas of Enugu state. Surface water ... surface water bodies are prone to impacts from ... Coal Measures (Akamigbo, 1987). The geologic map ...

  17. Water surface coverage effects on reactivity of plasma oxidized Ti films

    International Nuclear Information System (INIS)

    Pranevicius, L.; Pranevicius, L.L.; Vilkinis, P.; Baltaragis, S.; Gedvilas, K.

    2014-01-01

    Highlights: • The reactivity of Ti films immersed in water vapor plasma depends on the surface water coverage. • The adsorbed water monolayers are disintegrated into atomic constituents on the hydrophilic TiO 2 under plasma radiation. • The TiO 2 surface covered by water multilayer loses its ability to split adsorbed water molecules under plasma radiation. - Abstract: The behavior of the adsorbed water on the surface of thin sputter deposited Ti films maintained at room temperature was investigated in dependence on the thickness of the resulting adsorbed water layer, controllably injecting water vapor into plasma. The surface morphology and microstructure were used to characterize the surfaces of plasma treated titanium films. Presented experimental results showed that titanium films immersed in water vapor plasma at pressure of 10–100 Pa promoted the photocatalytic activity of overall water splitting. The surfaces of plasma oxidized titanium covered by an adsorbed hydroxyl-rich island structure water layer and activated by plasma radiation became highly chemically reactive. As water vapor pressure increased up to 300–500 Pa, the formed water multilayer diminished the water oxidation and, consequently, water splitting efficiency decreased. Analysis of the experimental results gave important insights into the role an adsorbed water layer on surface of titanium exposed to water vapor plasma on its chemical activity and plasma activated electrochemical processes, and elucidated the surface reactions that could lead to the split of water molecules

  18. Total Nitrogen in Surface Water

    Data.gov (United States)

    U.S. Environmental Protection Agency — Excess nitrogen in surface water can result in eutrophication. TOTALN is reported in kilograms/hectare/year. More information about these resources, including the...

  19. Total Phosphorus in Surface Water

    Data.gov (United States)

    U.S. Environmental Protection Agency — Excess phosphorus in surface water can result in eutrophication. TOTALP is reported in kilograms/hectare/year. More information about these resources, including the...

  20. Sustaining dry surfaces under water

    DEFF Research Database (Denmark)

    Jones, Paul R.; Hao, Xiuqing; Cruz-Chu, Eduardo R.

    2015-01-01

    Rough surfaces immersed under water remain practically dry if the liquid-solid contact is on roughness peaks, while the roughness valleys are filled with gas. Mechanisms that prevent water from invading the valleys are well studied. However, to remain practically dry under water, additional...... mechanisms need consideration. This is because trapped gas (e.g. air) in the roughness valleys can dissolve into the water pool, leading to invasion. Additionally, water vapor can also occupy the roughness valleys of immersed surfaces. If water vapor condenses, that too leads to invasion. These effects have...... not been investigated, and are critically important to maintain surfaces dry under water.In this work, we identify the critical roughness scale, below which it is possible to sustain the vapor phase of water and/or trapped gases in roughness valleys – thus keeping the immersed surface dry. Theoretical...

  1. Effective use of surface-water management to control saltwater intrusion

    Science.gov (United States)

    Hughes, J. D.; White, J.

    2012-12-01

    The Biscayne aquifer in southeast Florida is susceptible to saltwater intrusion and inundation from rising sea-level as a result of high groundwater withdrawal rates and low topographic relief. Groundwater levels in the Biscayne aquifer are managed by an extensive canal system that is designed to control flooding, supply recharge to municipal well fields, and control saltwater intrusion. We present results from an integrated surface-water/groundwater model of a portion of the Biscayne aquifer to evaluate the ability of the existing managed surface-water control network to control saltwater intrusion. Surface-water stage and flow are simulated using a hydrodynamic model that solves the diffusive-wave approximation of the depth-integrated shallow surface-water equations. Variable-density groundwater flow and fluid density are solved using the Oberbeck--Boussinesq approximation of the three-dimensional variable-density groundwater flow equation and a sharp interface approximation, respectively. The surface-water and variable-density groundwater domains are implicitly coupled during each Picard iteration. The Biscayne aquifer is discretized into a multi-layer model having a 500-m square horizontal grid spacing. All primary and secondary surface-water features in the active model domain are discretized into segments using the 500-m square horizontal grid. A 15-year period of time is simulated and the model includes 66 operable surface-water control structures, 127 municipal production wells, and spatially-distributed daily internal and external hydrologic stresses. Numerical results indicate that the existing surface-water system can be effectively used in many locations to control saltwater intrusion in the Biscayne aquifer resulting from increases in groundwater withdrawals or sea-level rise expected to occur over the next 25 years. In other locations, numerical results indicate surface-water control structures and/or operations may need to be modified to control

  2. Surface Water in Hawaii

    Science.gov (United States)

    Oki, Delwyn S.

    2003-01-01

    Surface water in Hawaii is a valued resource as well as a potential threat to human lives and property. The surface-water resources of Hawaii are of significant economic, ecologic, cultural, and aesthetic importance. Streams supply more than 50 percent of the irrigation water in Hawaii, and although streams supply only a few percent of the drinking water statewide, surface water is the main source of drinking water in some places. Streams also are a source of hydroelectric power, provide important riparian and instream habitats for many unique native species, support traditional and customary Hawaiian gathering rights and the practice of taro cultivation, and possess valued aesthetic qualities. Streams affect the physical, chemical, and aesthetic quality of receiving waters, such as estuaries, bays, and nearshore waters, which are critical to the tourism-based economy of the islands. Streams in Hawaii pose a danger because of their flashy nature; a stream's stage, or water level, can rise several feet in less than an hour during periods of intense rainfall. Streams in Hawaii are flashy because rainfall is intense, drainage basins are small, basins and streams are steep, and channel storage is limited. Streamflow generated during periods of heavy rainfall has led to loss of property and human lives in Hawaii. Most Hawaiian streams originate in the mountainous interiors of the islands and terminate at the coast. Streams are significant sculptors of the Hawaiian landscape because of the erosive power of the water they convey. In geologically young areas, such as much of the southern part of the island of Hawaii, well-defined stream channels have not developed because the permeability of the surface rocks generally is so high that rainfall infiltrates before flowing for significant distances on the surface. In geologically older areas that have received significant rainfall, streams and mass wasting have carved out large valleys.

  3. A robust Multi-Band Water Index (MBWI) for automated extraction of surface water from Landsat 8 OLI imagery

    Science.gov (United States)

    Wang, Xiaobiao; Xie, Shunping; Zhang, Xueliang; Chen, Cheng; Guo, Hao; Du, Jinkang; Duan, Zheng

    2018-06-01

    Surface water is vital resources for terrestrial life, while the rapid development of urbanization results in diverse changes in sizes, amounts, and quality of surface water. To accurately extract surface water from remote sensing imagery is very important for water environment conservations and water resource management. In this study, a new Multi-Band Water Index (MBWI) for Landsat 8 Operational Land Imager (OLI) images is proposed by maximizing the spectral difference between water and non-water surfaces using pure pixels. Based on the MBWI map, the K-means cluster method is applied to automatically extract surface water. The performance of MBWI is validated and compared with six widely used water indices in 29 sites of China. Results show that our proposed MBWI performs best with the highest accuracy in 26 out of the 29 test sites. Compared with other water indices, the MBWI results in lower mean water total errors by a range of 9.31%-25.99%, and higher mean overall accuracies and kappa coefficients by 0.87%-3.73% and 0.06-0.18, respectively. It is also demonstrated for MBWI in terms of robustly discriminating surface water from confused backgrounds that are usually sources of surface water extraction errors, e.g., mountainous shadows and dark built-up areas. In addition, the new index is validated to be able to mitigate the seasonal and daily influences resulting from the variations of the solar condition. MBWI holds the potential to be a useful surface water extraction technology for water resource studies and applications.

  4. How to repel hot water from a superhydrophobic surface?

    KAUST Repository

    Yu, Zhejun

    2014-01-01

    Superhydrophobic surfaces, with water contact angles greater than 150° and slide angles less than 10°, have attracted a great deal of attention due to their self-cleaning ability and excellent water-repellency. It is commonly accepted that a superhydrophobic surface loses its superhydrophobicity in contact with water hotter than 50 °C. Such a phenomenon was recently demonstrated by Liu et al. [J. Mater. Chem., 2009, 19, 5602], using both natural lotus leaf and artificial leaf-like surfaces. However, our work has shown that superhydrophobic surfaces maintained their superhydrophobicity, even in water at 80 °C, provided that the leaf temperature is greater than that of the water droplet. In this paper, we report on the wettability of water droplets on superhydrophobic thin films, as a function of both their temperatures. The results have shown that both the water contact and slide angles on the surfaces will remain unchanged when the temperature of the water droplet is greater than that of the surface. The water contact angle, or the slide angle, will decrease or increase, however, with droplet temperatures increasingly greater than that of the surfaces. We propose that, in such cases, the loss of superhydrophobicity of the surfaces is caused by evaporation of the hot water molecules and their condensation on the cooler surface. © 2014 the Partner Organisations.

  5. Water on a Hydrophobic surface

    Science.gov (United States)

    Scruggs, Ryan; Zhu, Mengjue; Poynor, Adele

    2012-02-01

    Hydrophobicity, meaning literally fear of water, is exhibited on the surfaces of non-stick cooking pans and water resistant clothing, on the leaves of the lotus plan, or even during the protein folding process in our bodies. Hydrophobicity is directly measured by determining a contact angle between water and an objects surface. Associated with a hydrophobic surface is the depletion layer, a low density region approximately 0.2 nm thick. We study this region by comparing data found in lab using surface plasmon resonance techniques to theoretical calculations. Experiments use gold slides coated in ODT and Mercapto solutions to model both hydrophobic and hydrophilic surfaces respectively.

  6. Adsorption of surface functionalized silica nanoparticles onto mineral surfaces and decane/water interface

    International Nuclear Information System (INIS)

    Metin, Cigdem O.; Baran, Jimmie R.; Nguyen, Quoc P.

    2012-01-01

    The adsorption of silica nanoparticles onto representative mineral surfaces and at the decane/water interface was studied. The effects of particle size (the mean diameters from 5 to 75 nm), concentration and surface type on the adsorption were studied in detail. Silica nanoparticles with four different surfaces [unmodified, surface modified with anionic (sulfonate), cationic (quaternary ammonium (quat)) or nonionic (polyethylene glycol (PEG)) surfactant] were used. The zeta potential of these silica nanoparticles ranges from −79.8 to 15.3 mV. The shape of silica particles examined by a Hitachi-S5500 scanning transmission electron microscope (STEM) is quite spherical. The adsorption of all the nanoparticles (unmodified or surface modified) on quartz and calcite surfaces was found to be insignificant. We used interfacial tension (IFT) measurements to investigate the adsorption of silica nanoparticles at the decane/water interface. Unmodified nanoparticles or surface modified ones with sulfonate or quat do not significantly affect the IFT of the decane/water interface. It also does not appear that the particle size or concentration influences the IFT. However, the presence of PEG as a surface modifying material significantly reduces the IFT. The PEG surface modifier alone in an aqueous solution, without the nanoparticles, yields the same IFT reduction for an equivalent PEG concentration as that used for modifying the surface of nanoparticles. Contact angle measurements of a decane droplet on quartz or calcite plate immersed in water (or aqueous nanoparticle dispersion) showed a slight change in the contact angle in the presence of the studied nanoparticles. The results of contact angle measurements are in good agreement with experiments of adsorption of nanoparticles on mineral surfaces or decane/water interface. This study brings new insights into the understanding and modeling of the adsorption of surface-modified silica nanoparticles onto mineral surfaces and

  7. Surface-Water and Ground-Water Interactions in the Central Everglades, Florida

    Science.gov (United States)

    Harvey, Judson W.; Newlin, Jessica T.; Krest, James M.; Choi, Jungyill; Nemeth, Eric A.; Krupa, Steven L.

    2004-01-01

    Recharge and discharge are hydrological processes that cause Everglades surface water to be exchanged for subsurface water in the peat soil and the underlying sand and limestone aquifer. These interactions are thought to be important to water budgets, water quality, and ecology in the Everglades. Nonetheless, relatively few studies of surface water and ground water interactions have been conducted in the Everglades, especially in its vast interior areas. This report is a product of a cooperative investigation conducted by the USGS and the South Florida Water Management District (SFWMD) aimed at developing and testing techniques that would provide reliable estimates of recharge and discharge in interior areas of WCA-2A (Water Conservation Area 2A) and several other sites in the central Everglades. The new techniques quantified flow from surface water to the subsurface (recharge) and the opposite (discharge) using (1) Darcy-flux calculations based on measured vertical gradients in hydraulic head and hydraulic conductivity of peat; (2) modeling transport through peat and decay of the naturally occurring isotopes 224Ra and 223Ra (with half-lives of 4 and 11 days, respectively); and (3) modeling transport and decay of naturally occurring and 'bomb-pulse' tritium (half-life of 12.4 years) in ground water. Advantages and disadvantages of each method for quantifying recharge and discharge were compared. In addition, spatial and temporal variability of recharge and discharge were evaluated and controlling factors identified. A final goal was to develop appropriately simplified (that is, time averaged) expressions of the results that will be useful in addressing a broad range of hydrological and ecological problems in the Everglades. Results were compared with existing information about water budgets from the South Florida Water Management Model (SFWMM), a principal tool used by the South Florida Water Management District to plan many of the hydrological aspects of the

  8. Impact of Water Recovery from Wastes on the Lunar Surface Mission Water Balance

    Science.gov (United States)

    Fisher, John W.; Hogan, John Andrew; Wignarajah, Kanapathipi; Pace, Gregory S.

    2010-01-01

    Future extended lunar surface missions will require extensive recovery of resources to reduce mission costs and enable self-sufficiency. Water is of particular importance due to its potential use for human consumption and hygiene, general cleaning, clothes washing, radiation shielding, cooling for extravehicular activity suits, and oxygen and hydrogen production. Various water sources are inherently present or are generated in lunar surface missions, and subject to recovery. They include: initial water stores, water contained in food, human and other solid wastes, wastewaters and associated brines, ISRU water, and scavenging from residual propellant in landers. This paper presents the results of an analysis of the contribution of water recovery from life support wastes on the overall water balance for lunar surface missions. Water in human wastes, metabolic activity and survival needs are well characterized and dependable figures are available. A detailed life support waste model was developed that summarizes the composition of life support wastes and their water content. Waste processing technologies were reviewed for their potential to recover that water. The recoverable water in waste is a significant contribution to the overall water balance. The value of this contribution is discussed in the context of the other major sources and loses of water. Combined with other analyses these results provide guidance for research and technology development and down-selection.

  9. WATER SURFACE RECONSTRUCTION IN AIRBORNE LASER BATHYMETRY FROM REDUNDANT BED OBSERVATIONS

    Directory of Open Access Journals (Sweden)

    G. Mandlburger

    2017-09-01

    Full Text Available In airborne laser bathymetry knowledge of exact water level heights is a precondition for applying run-time and refraction correction of the raw laser beam travel path in the medium water. However, due to specular reflection especially at very smooth water surfaces often no echoes from the water surface itself are recorded (drop outs. In this paper, we first discuss the feasibility of reconstructing the water surface from redundant observations of the water bottom in theory. Furthermore, we provide a first practical approach for solving this problem, suitable for static and locally planar water surfaces. It minimizes the bottom surface deviations of point clouds from individual flight strips after refraction correction. Both theoretical estimations and practical results confirm the potential of the presented method to reconstruct water level heights in dm precision. Achieving good results requires enough morphological details in the scene and that the water bottom topography is captured from different directions.

  10. A GPU-based mipmapping method for water surface visualization

    Science.gov (United States)

    Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan

    2018-03-01

    Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

  11. Roles of surface water areas for water and solute cycle in Hanoi city, Viet Nam

    Science.gov (United States)

    Hayashi, Takeshi; Kuroda, Keisuke; Do Thuan, An; Tran Thi Viet, Nga; Takizawa, Satoshi

    2013-04-01

    Hanoi city, the capital of Viet Nam, has developed beside the Red river. Recent rapid urbanization of this city has reduced a large number of natural water areas such as lakes, ponds and canals not only in the central area but the suburban area. Contrary, the urbanization has increased artificial water areas such as pond for fish cultivation and landscaping. On the other hand, the urbanization has induced the inflow of waste water from households and various kinds of factories to these water areas because of delay of sewerage system development. Inflow of the waste water has induced eutrophication and pollution of these water areas. Also, there is a possibility of groundwater pollution by infiltration of polluted surface water. However, the role of these water areas for water cycle and solute transport is not clarified. Therefore, this study focuses on the interaction between surface water areas and groundwater in Hanoi city to evaluate appropriate land development and groundwater resource management. We are carrying out three approaches: a) understanding of geochemical characteristics of surface water and groundwater, b) monitoring of water levels of pond and groundwater, c) sampling of soil and pond sediment. Correlation between d18O and dD of precipitation (after GNIP), the Red River (after GNIR) and the water samples of this study showed that the groundwater is composed of precipitation, the Red River and surface water that has evaporation process. Contribution of the surface water with evaporation process was widely found in the study area. As for groundwater monitoring, the Holocene aquifers at two sites were in unconfined condition in dry season and the groundwater levels in the aquifer continued to increase through rainy season. The results of isotopic analysis and groundwater level monitoring showed that the surface water areas are one of the major groundwater sources. On the other hand, concentrations of dissolved Arsenic (filtered by 0.45um) in the pore

  12. Modelling surface-water depression storage in a Prairie Pothole Region

    Science.gov (United States)

    Hay, Lauren E.; Norton, Parker A.; Viger, Roland; Markstrom, Steven; Regan, R. Steven; Vanderhoof, Melanie

    2018-01-01

    In this study, the Precipitation-Runoff Modelling System (PRMS) was used to simulate changes in surface-water depression storage in the 1,126-km2 Upper Pipestem Creek basin located within the Prairie Pothole Region of North Dakota, USA. The Prairie Pothole Region is characterized by millions of small water bodies (or surface-water depressions) that provide numerous ecosystem services and are considered an important contribution to the hydrologic cycle. The Upper Pipestem PRMS model was extracted from the U.S. Geological Survey's (USGS) National Hydrologic Model (NHM), developed to support consistent hydrologic modelling across the conterminous United States. The Geospatial Fabric database, created for the USGS NHM, contains hydrologic model parameter values derived from datasets that characterize the physical features of the entire conterminous United States for 109,951 hydrologic response units. Each hydrologic response unit in the Geospatial Fabric was parameterized using aggregated surface-water depression area derived from the National Hydrography Dataset Plus, an integrated suite of application-ready geospatial datasets. This paper presents a calibration strategy for the Upper Pipestem PRMS model that uses normalized lake elevation measurements to calibrate the parameters influencing simulated fractional surface-water depression storage. Results indicate that inclusion of measurements that give an indication of the change in surface-water depression storage in the calibration procedure resulted in accurate changes in surface-water depression storage in the water balance. Regionalized parameterization of the USGS NHM will require a proxy for change in surface-storage to accurately parameterize surface-water depression storage within the USGS NHM.

  13. Desert Beetle-Inspired Superwettable Patterned Surfaces for Water Harvesting.

    Science.gov (United States)

    Yu, Zhenwei; Yun, Frank F; Wang, Yanqin; Yao, Li; Dou, Shixue; Liu, Kesong; Jiang, Lei; Wang, Xiaolin

    2017-09-01

    With the impacts of climate change and impending crisis of clean drinking water, designing functional materials for water harvesting from fog with large water capacity has received much attention in recent years. Nature has evolved different strategies for surviving dry, arid, and xeric conditions. Nature is a school for human beings. In this contribution, inspired by the Stenocara beetle, superhydrophilic/superhydrophobic patterned surfaces are fabricated on the silica poly(dimethylsiloxane) (PDMS)-coated superhydrophobic surfaces using a pulsed laser deposition approach with masks. The resultant samples with patterned wettability demonstrate water-harvesting efficiency in comparison with the silica PDMS-coated superhydrophobic surface and the Pt nanoparticles-coated superhydrophilic surface. The maximum water-harvesting efficiency can reach about 5.3 g cm -2 h -1 . Both the size and the percentage of the Pt-coated superhydrophilic square regions on the patterned surface affect the condensation and coalescence of the water droplet, as well as the final water-harvesting efficiency. The present water-harvesting strategy should provide an avenue to alleviate the water crisis facing mankind in certain arid regions of the world. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Global modelling of Cryptosporidium in surface water

    Science.gov (United States)

    Vermeulen, Lucie; Hofstra, Nynke

    2016-04-01

    Introduction Waterborne pathogens that cause diarrhoea, such as Cryptosporidium, pose a health risk all over the world. In many regions quantitative information on pathogens in surface water is unavailable. Our main objective is to model Cryptosporidium concentrations in surface waters worldwide. We present the GloWPa-Crypto model and use the model in a scenario analysis. A first exploration of global Cryptosporidium emissions to surface waters has been published by Hofstra et al. (2013). Further work has focused on modelling emissions of Cryptosporidium and Rotavirus to surface waters from human sources (Vermeulen et al 2015, Kiulia et al 2015). A global waterborne pathogen model can provide valuable insights by (1) providing quantitative information on pathogen levels in data-sparse regions, (2) identifying pathogen hotspots, (3) enabling future projections under global change scenarios and (4) supporting decision making. Material and Methods GloWPa-Crypto runs on a monthly time step and represents conditions for approximately the year 2010. The spatial resolution is a 0.5 x 0.5 degree latitude x longitude grid for the world. We use livestock maps (http://livestock.geo-wiki.org/) combined with literature estimates to calculate spatially explicit livestock Cryptosporidium emissions. For human Cryptosporidium emissions, we use UN population estimates, the WHO/UNICEF JMP sanitation country data and literature estimates of wastewater treatment. We combine our emissions model with a river routing model and data from the VIC hydrological model (http://vic.readthedocs.org/en/master/) to calculate concentrations in surface water. Cryptosporidium survival during transport depends on UV radiation and water temperature. We explore pathogen emissions and concentrations in 2050 with the new Shared Socio-economic Pathways (SSPs) 1 and 3. These scenarios describe plausible future trends in demographics, economic development and the degree of global integration. Results and

  15. Distribution of {sup 129}I in terrestrial surface water environments

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xuegao [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Gong, Meng [College of Hydrology and Water Resources, Hohai University, Nanjing (China); Yi, Peng, E-mail: pengyi1915@163.com [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Aldahan, Ala [Department of Earth Sciences, Uppsala University, Uppsala (Sweden); Department of Geology, United Arab Emirates University, Al Ain (United Arab Emirates); Yu, Zhongbo [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Possnert, Göran [Tandem Laboratory, Uppsala University, Uppsala (Sweden); Chen, Li [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China)

    2015-10-15

    The global distribution of the radioactive isotope iodine-129 in surface waters (lakes and rivers) is presented here and compared with the atmospheric deposition and distribution in surface marine waters. The results indicate relatively high concentrations in surface water systems in close vicinity of the anthropogenic release sources as well as in parts of Western Europe, North America and Central Asia. {sup 129}I level is generally higher in the terrestrial surface water of the Northern hemisphere compared to the southern hemisphere. The highest values of {sup 129}I appear around 50°N and 40°S in the northern and southern hemisphere, separately. Direct gaseous and marine atmospheric emissions are the most likely avenues for the transport of {sup 129}I from the sources to the terrestrial surface waters. To apply iodine-129 as process tracer in terrestrial surface water environment, more data are needed on {sup 129}I distribution patterns both locally and globally.

  16. Foulant characteristics comparison in recycling cooling water system makeup by municipal reclaimed water and surface water in power plant.

    Science.gov (United States)

    Ping, Xu; Jing, Wang; Yajun, Zhang; Jie, Wang; Shuai, Si

    2015-01-01

    Due to water shortage, municipal reclaimed water rather than surface water was replenished into recycling cooling water system in power plants in some cities in China. In order to understand the effects of the measure on carbon steel corrosion, characteristics of two kinds of foulant produced in different systems were studied in the paper. Differences between municipal reclaimed water and surface water were analyzed firstly. Then, the weight and the morphology of two kinds of foulant were compared. Moreover, other characteristics including the total number of bacteria, sulfate reducing bacteria, iron bacteria, extracellular polymeric substance (EPS), protein (PN), and polysaccharide (PS) in foulant were analyzed. Based on results, it could be concluded that microbial and corrosive risk would be increased when the system replenished by municipal reclaimed water instead of surface water.

  17. Contamination levels of human pharmaceutical compounds in French surface and drinking water.

    Science.gov (United States)

    Mompelat, S; Thomas, O; Le Bot, B

    2011-10-01

    The occurrence of 20 human pharmaceutical compounds and metabolites from 10 representative therapeutic classes was analysed from resource and drinking water in two catchment basins located in north-west France. 98 samples were analysed from 63 stations (surface water and drinking water produced from surface water). Of the 20 human pharmaceutical compounds selected, 16 were quantified in both the surface water and drinking water, with 22% of the values above the limit of quantification for surface water and 14% for drinking water). Psychostimulants, non-steroidal anti-inflammatory drugs, iodinated contrast media and anxiolytic drugs were the main therapeutic classes of human pharmaceutical compounds detected in the surface water and drinking water. The results for surface water were close to results from previous studies in spite of differences in prescription rates of human pharmaceutical compounds in different countries. The removal rate of human pharmaceutical compounds at 11 water treatment units was also determined. Only caffeine proved to be resistant to drinking water treatment processes (with a minimum rate of 5%). Other human pharmaceutical compounds seemed to be removed more efficiently (average elimination rate of over 50%) by adsorption onto activated carbon and oxidation/disinfection with ozone or chlorine (not taking account of the disinfection by-products). These results add to the increasing evidence of the occurrence of human pharmaceutical compounds in drinking water that may represent a threat to human beings exposed to a cocktail of human pharmaceutical compounds and related metabolites and by-products in drinking water.

  18. Chlorine stress mediates microbial surface attachment in drinking water systems.

    Science.gov (United States)

    Liu, Li; Le, Yang; Jin, Juliang; Zhou, Yuliang; Chen, Guowei

    2015-03-01

    Microbial attachment to drinking water pipe surfaces facilitates pathogen survival and deteriorates disinfection performance, directly threatening the safety of drinking water. Notwithstanding that the formation of biofilm has been studied for decades, the underlying mechanisms for the origins of microbial surface attachment in biofilm development in drinking water pipelines remain largely elusive. We combined experimental and mathematical methods to investigate the role of environmental stress-mediated cell motility on microbial surface attachment in chlorination-stressed drinking water distribution systems. Results show that at low levels of disinfectant (0.0-1.0 mg/L), the presence of chlorine promotes initiation of microbial surface attachment, while higher amounts of disinfectant (>1.0 mg/L) inhibit microbial attachment. The proposed mathematical model further demonstrates that chlorination stress (0.0-5.0 mg/L)-mediated microbial cell motility regulates the frequency of cell-wall collision and thereby controls initial microbial surface attachment. The results reveal that transport processes and decay patterns of chlorine in drinking water pipelines regulate microbial cell motility and, thus, control initial surface cell attachment. It provides a mechanistic understanding of microbial attachment shaped by environmental disinfection stress and leads to new insights into microbial safety protocols in water distribution systems.

  19. Surface water, particulate matter, and sediments of inland waters

    International Nuclear Information System (INIS)

    Mundschenk, H.

    1985-01-01

    The Bundesanstalt fuer Gewaesserkunde (BfG) since 1958 runs a system for monitoring the surface water and sediments of Federal German waterways in its capacity as a directing water monitoring centre. The data recorded over the years show that the radioactivity released by the various emission sources leads to radionuclide concentrations in water, particulate matter, or sediments that generally are below the detection limits defined in the relevant legal provisions governing monitoring and surveillance of nuclear facilities effluents. Representative examples of measuring methods and results (as for e.g. for H-3) are given. (DG) [de

  20. Effect of water table dynamics on land surface hydrologic memory

    Science.gov (United States)

    Lo, Min-Hui; Famiglietti, James S.

    2010-11-01

    The representation of groundwater dynamics in land surface models has received considerable attention in recent years. Most studies have found that soil moisture increases after adding a groundwater component because of the additional supply of water to the root zone. However, the effect of groundwater on land surface hydrologic memory (persistence) has not been explored thoroughly. In this study we investigate the effect of water table dynamics on National Center for Atmospheric Research Community Land Model hydrologic simulations in terms of land surface hydrologic memory. Unlike soil water or evapotranspiration, results show that land surface hydrologic memory does not always increase after adding a groundwater component. In regions where the water table level is intermediate, land surface hydrologic memory can even decrease, which occurs when soil moisture and capillary rise from groundwater are not in phase with each other. Further, we explore the hypothesis that in addition to atmospheric forcing, groundwater variations may also play an important role in affecting land surface hydrologic memory. Analyses show that feedbacks of groundwater on land surface hydrologic memory can be positive, negative, or neutral, depending on water table dynamics. In regions where the water table is shallow, the damping process of soil moisture variations by groundwater is not significant, and soil moisture variations are mostly controlled by random noise from atmospheric forcing. In contrast, in regions where the water table is very deep, capillary fluxes from groundwater are small, having limited potential to affect soil moisture variations. Therefore, a positive feedback of groundwater to land surface hydrologic memory is observed in a transition zone between deep and shallow water tables, where capillary fluxes act as a buffer by reducing high-frequency soil moisture variations resulting in longer land surface hydrologic memory.

  1. Eco-hydrological process simulations within an integrated surface water-groundwater model

    DEFF Research Database (Denmark)

    Butts, Michael; Loinaz, Maria Christina; Bauer-Gottwein, Peter

    2014-01-01

    Integrated water resources management requires tools that can quantify changes in groundwater, surface water, water quality and ecosystem health, as a result of changes in catchment management. To address these requirements we have developed an integrated eco-hydrological modelling framework...... that allows hydrologists and ecologists to represent the complex and dynamic interactions occurring between surface water, ground water, water quality and freshwater ecosystems within a catchment. We demonstrate here the practical application of this tool to two case studies where the interaction of surface...... water and ground water are important for the ecosystem. In the first, simulations are performed to understand the importance of surface water-groundwater interactions for a restored riparian wetland on the Odense River in Denmark as part of a larger investigation of water quality and nitrate retention...

  2. Surface Water Quality Assessment and Prioritize the Factors Pollute This Water Using Topsis Fuzzy Hierarchical Analysis

    Directory of Open Access Journals (Sweden)

    Mehdi Komasi

    2017-03-01

    Full Text Available Background & Objective: Nowadays, according to growth of industry and increasing population, water resources are seriousely shortened. This lack of water resources will require special management to be considered in industry and agriculture. Among the various sources of water, surface waters are more susceptible to infection. The most important of these sources of pollution are industrial pollution, detergent, pesticides, radioactive materials, heat and salt concentration.  Materials & methods: In this article, at first the importance of each pollutant will be evaluated base on the effects and its results and then quality evaluation of surface water will be studied. In order to assess the relative importance of these pollutants primarily using TOPSIS software, prioritize these factors as one of the hierarchical analysis and then is modeled with decision tree method using Weka software, the importance of each factor is evaluated and if it does not meet the minimal importance of the decision tree will be removed. Results: The results obtained from the Topsis fuzzy analysis indicate that surface water and groundwater are exposed to pollution about 74% and 26% respectively among the six pollutants examined in this study. In addition, results obtaned from the hierarchical tree in software Weka has shown that the heat factor, soluble salts and industrial pollutants give impac factor or purity about 0.1338, 0.0523 and 1.2694 respectively. Conclusion: Surface water is at greater risk of being polluted compared with groundwater. The heat factor and low concentration of dissolved salts have the low impact and industrial pollutants are considered as the most influential factors in surface water pollution.

  3. Water Adsorption on Clean and Defective Anatase TiO2 (001) Nanotube Surfaces: A Surface Science Approach.

    Science.gov (United States)

    Kenmoe, Stephane; Lisovski, Oleg; Piskunov, Sergei; Bocharov, Dmitry; Zhukovskii, Yuri F; Spohr, Eckhard

    2018-04-11

    We use ab initio molecular dynamics simulations to study the adsorption of thin water films with 1 and 2 ML coverage on anatase TiO 2 (001) nanotubes. The nanotubes are modeled as 2D slabs, which consist of partially constrained and partially relaxed structural motifs from nanotubes. The effect of anion doping on the adsorption is investigated by substituting O atoms with N and S impurities on the nanotube slab surface. Due to strain-induced curvature effects, water adsorbs molecularly on defect-free surfaces via weak bonds on Ti sites and H bonds to surface oxygens. While the introduction of an S atom weakens the interaction of the surface with water, which adsorbs molecularly, the presence of an N impurity renders the surface more reactive to water, with a proton transfer from the water film and the formation of an NH group at the N site. At 2 ML coverage, a further surface-assisted proton transfer takes place in the water film, resulting in the formation of an OH - group and an NH 2 + cationic site on the surface.

  4. Controllability of Surface Water Networks

    Science.gov (United States)

    Riasi, M. Sadegh; Yeghiazarian, Lilit

    2017-12-01

    To sustainably manage water resources, we must understand how to control complex networked systems. In this paper, we study surface water networks from the perspective of structural controllability, a concept that integrates classical control theory with graph-theoretic formalism. We present structural controllability theory and compute four metrics: full and target controllability, control centrality and control profile (FTCP) that collectively determine the structural boundaries of the system's control space. We use these metrics to answer the following questions: How does the structure of a surface water network affect its controllability? How to efficiently control a preselected subset of the network? Which nodes have the highest control power? What types of topological structures dominate controllability? Finally, we demonstrate the structural controllability theory in the analysis of a wide range of surface water networks, such as tributary, deltaic, and braided river systems.

  5. Electrodialysis and nanofiltration of surface water for subsequent use as infiltration water.

    Science.gov (United States)

    Van der Bruggen, B; Milis, R; Vandecasteele, C; Bielen, P; Van San, E; Huysman, K

    2003-09-01

    In order to achieve stable groundwater levels, an equilibrium between the use of groundwater for drinking water production and natural or artificial groundwater recharge by infiltration is needed. Local governments usually require that the composition of the water used for artificial recharge is similar to the surface water that is naturally present in the specific recharge area. In this paper, electrodialysis (ED) and nanofiltration were evaluated as possible treatment technologies for surface water from a canal in Flanders, the North of Belgium, in view of infiltration at critical places on heathlands. Both methods were evaluated on the basis of a comparison between the water composition after treatment and the composition of local surface waters. The treatment generally consists of a tuning of pH and the removal of contaminants originating from industrial and agricultural activity, e.g., nitrates and pesticides. Further evaluation of the influence of the composition of the water on the characteristics of the artificial recharge, however, was not envisaged. In a case study of water from the canal Schoten-Dessel, satisfactory concentration reductions of Cl(-), SO(4)(2-), NO(3)(-), HCO(3)(-), Na(+), Mg(2+), K(+) and Ca(2+) were obtained by ultrafiltration pretreatment followed by ED. Nanofiltration with UTC-20, N30F, Desal 51 HL, UTC-60 and Desal 5 DL membranes resulted in an insufficient removal level, especially for the monovalent ions.

  6. Partitioning of water between surface and mantle on terrestrial exoplanets: effect of surface-mantle water exchange parameterizations on ocean depth

    Science.gov (United States)

    Komacek, T. D.; Abbot, D. S.

    2016-12-01

    Terrestrial exoplanets in the canonical habitable zone may have a variety of initial water fractions due to their volatile delivery rate via planetesimals. If the total planetary water complement is high, the entire surface may be covered in water, forming a "waterworld". The habitable zone for waterworlds is likely smaller than that for planets with partial land coverage because waterworlds lack the stabilizing silicate-weathering feedback. On a planet with active tectonics, competing mechanisms act to regulate the abundance of water on the surface by determining the partitioning of water between interior and surface. We have explored how the incorporation of different mechanisms for the outgassing and regassing of water changes the volatile evolution of a planet. Specifically, we have examined three models for volatile cycling: a model with degassing and regassing both determined by the seafloor pressure, one with mantle temperature-dependent degassing and regassing rates, and a hybrid model that has the degassing rate driven by seafloor pressure and the regassing rate determined by the mantle temperature. We find that the volatile cycling in all three of these scenarios reaches a steady-state after a few billion years. Using these steady-states, we can make predictions from each model for how much water is needed to flood the surface and make a waterworld. We find that if volatile cycling is either solely temperature-dependent or pressure-dependent, exoplanets require a high abundance (more than 0.3% by mass) of water to have fully inundated surfaces. This is because the waterworld boundary for these models is regulated by how much water can be stuffed into the mantle. However, if degassing is more dependent on the seafloor pressure and regassing mainly dependent on mantle temperature, super-Earth mass planets with a total water fraction similar to that of the Earth (approximately 0.05% by mass) can become waterworlds. As a result, further understanding of the

  7. Groundwater–Surface Water Exchange

    DEFF Research Database (Denmark)

    Karan, Sachin

    The exchange of groundwater-surface water has been invetigated in the western part of Denmark. Holtum AA provides the framework for all the performed investigations. Several methods are used, primarily eld based measurements ombined with numerical models to achieve insight to the governing...... processes of interaction between groundwater and surface water. By using heat as a tracer it has been possible to use temperature directly as calibrationtargets in a groundwater and heat transport model. Thus, it is possible to use heat investigate the change in groundwater discharge in dynamic conditions...... by using simple temperature devices along a stream to delineate the areas of interest in regard to GW{SW exchange. Thus, at several locations in a stream a temperature data logger was placed in the water column and right at the streambed-water interface. By looking at the correlation of streambed...

  8. The study of dynamic force acted on water strider leg departing from water surface

    Science.gov (United States)

    Sun, Peiyuan; Zhao, Meirong; Jiang, Jile; Zheng, Yelong

    2018-01-01

    Water-walking insects such as water striders can skate on the water surface easily with the help of the hierarchical structure on legs. Numerous theoretical and experimental studies show that the hierarchical structure would help water strider in quasi-static case such as load-bearing capacity. However, the advantage of the hierarchical structure in the dynamic stage has not been reported yet. In this paper, the function of super hydrophobicity and the hierarchical structure was investigated by measuring the adhesion force of legs departing from the water surface at different lifting speed by a dynamic force sensor. The results show that the adhesion force decreased with the increase of lifting speed from 0.02 m/s to 0.4 m/s, whose mechanic is investigated by Energy analysis. In addition, it can be found that the needle shape setae on water strider leg can help them depart from water surface easily. Thus, it can serve as a starting point to understand how the hierarchical structure on the legs help water-walking insects to jump upward rapidly to avoid preying by other insects.

  9. Evaporation of tiny water aggregation on solid surfaces with different wetting properties.

    Science.gov (United States)

    Wang, Shen; Tu, Yusong; Wan, Rongzheng; Fang, Haiping

    2012-11-29

    The evaporation of a tiny amount of water on the solid surface with different wettabilities has been studied by molecular dynamics simulations. From nonequilibrium MD simulations, we found that, as the surface changed from hydrophobic to hydrophilic, the evaporation speed did not show a monotonic decrease as intuitively expected, but increased first, and then decreased after it reached a maximum value. The analysis of the simulation trajectory and calculation of the surface water interaction illustrate that the competition between the number of water molecules on the water-gas surface from where the water molecules can evaporate and the potential barrier to prevent those water molecules from evaporating results in the unexpected behavior of the evaporation. This finding is helpful in understanding the evaporation on biological surfaces, designing artificial surfaces of ultrafast water evaporating, or preserving water in soil.

  10. Bulk water freezing dynamics on superhydrophobic surfaces

    Science.gov (United States)

    Chavan, S.; Carpenter, J.; Nallapaneni, M.; Chen, J. Y.; Miljkovic, N.

    2017-01-01

    In this study, we elucidate the mechanisms governing the heat-transfer mediated, non-thermodynamic limited, freezing delay on non-wetting surfaces for a variety of characteristic length scales, Lc (volume/surface area, 3 mm commercial superhydrophobic spray coatings, showing a monotonic increase in freezing time with coating thickness. The added thermal resistance of thicker coatings was much larger than that of the nanoscale superhydrophobic features, which reduced the droplet heat transfer and increased the total freezing time. Transient finite element method heat transfer simulations of the water slab freezing process were performed to calculate the overall heat transfer coefficient at the substrate-water/ice interface during freezing, and shown to be in the range of 1-2.5 kW/m2K for these experiments. The results shown here suggest that in order to exploit the heat-transfer mediated freezing delay, thicker superhydrophobic coatings must be deposited on the surface, where the coating resistance is comparable to the bulk water/ice conduction resistance.

  11. Impact of Water Withdrawals from Groundwater and Surface Water on Continental Water Storage Variations

    Science.gov (United States)

    Doell, Petra; Hoffmann-Dobrev, Heike; Portmann, Felix T.; Siebert, Stefan; Eicker, Annette; Rodell, Matthew; Strassberg, Gil

    2011-01-01

    Humans have strongly impacted the global water cycle, not only water flows but also water storage. We have performed a first global-scale analysis of the impact of water withdrawals on water storage variations, using the global water resources and use model WaterGAP. This required estimation of fractions of total water withdrawals from groundwater, considering five water use sectors. According to our assessment, the source of 35% of the water withdrawn worldwide (4300 cubic km/yr during 1998-2002) is groundwater. Groundwater contributes 42%, 36% and 27% of water used for irrigation, households and manufacturing, respectively, while we assume that only surface water is used for livestock and for cooling of thermal power plants. Consumptive water use was 1400 cubic km/yr during 1998-2002. It is the sum of the net abstraction of 250 cubic km/yr of groundwater (taking into account evapotranspiration and return flows of withdrawn surface water and groundwater) and the net abstraction of 1150 km3/yr of surface water. Computed net abstractions indicate, for the first time at the global scale, where and when human water withdrawals decrease or increase groundwater or surface water storage. In regions with extensive surface water irrigation, such as Southern China, net abstractions from groundwater are negative, i.e. groundwater is recharged by irrigation. The opposite is true for areas dominated by groundwater irrigation, such as in the High Plains aquifer of the central USA, where net abstraction of surface water is negative because return flow of withdrawn groundwater recharges the surface water compartments. In intensively irrigated areas, the amplitude of seasonal total water storage variations is generally increased due to human water use; however, in some areas, it is decreased. For the High Plains aquifer and the whole Mississippi basin, modeled groundwater and total water storage variations were compared with estimates of groundwater storage variations based on

  12. Surface composition and surface properties of water hyacinth ...

    African Journals Online (AJOL)

    Surface composition and surface properties of water hyacinth ( Eichhornia ... (2/1, v/v) followed by ethanol, using Fourier Transform Infra-red (FT-IR) spectroscopy, ... polar organic solvents and non-polar n-alkane hydrocarbons is discussed.

  13. Infiltration of pesticides in surface water into nearby drinking water supply wells

    DEFF Research Database (Denmark)

    Malaguerra, Flavio; Albrechtsen, Hans-Jørgen; Binning, Philip John

    Drinking water wells are often placed near streams because streams often overly permeable sediments and the water table is near the surface in valleys, and so pumping costs are reduced. The lowering of the water table by pumping wells can reverse the natural flow from the groundwater to the stream......, inducing infiltration of surface water to groundwater and consequently to the drinking water well. Many attenuation processes can take place in the riparian zone, mainly due to mixing, biodegradation and sorption. However, if the water travel time from the surface water to the pumping well is too short......, or if the compounds are poorly degradable, contaminants can reach the drinking water well at high concentrations, jeopardizing drinking water quality. Here we developed a reactive transport model to evaluate the risk of contamination of drinking water wells by surface water pollution. The model was validated using...

  14. Water reactivity with mixed oxide (U,Pu)O2 surfaces

    International Nuclear Information System (INIS)

    Gaillard, Jeremy

    2013-01-01

    The interaction of water with actinides oxide surfaces remains poorly understood. The adsorption of water on PuO 2 surface and (U,Pu)O 2 surface leads to hydrogen generation through radiolysis but also surface evolution. The study of water interaction with mixed oxide (U,Pu)O 2 and PuO 2 surfaces requires the implementation of non intrusive techniques. The study of the hydration of CeO 2 surface is used to study the effectiveness of different techniques. The results show that the water adsorption leads to the surface evolution through the formation of a hydroxide superficial layer. The reactivity of water on the surface depends on the calcination temperature of the oxide precursor. The thermal treatment of hydrated surfaces can regenerate the surface. The study on CeO 2 hydration emphasizes the relevancies of these techniques in studying the hydration of surfaces. The hydrogen generation through water radiolysis is studied with an experimental methodology based on constant relative humidity in the radiolysis cell. The hydrogen accumulation is linear for the first hours and then tends to a steady state content. A mechanism of hydrogen consumption is proposed to explain the existence of the steady state of hydrogen content. This mechanism enables to explain also the evolution of the oxide surface during hydrogen generation experiments as shown by the evolution of hydrogen accumulation kinetics. The accumulation kinetics depends on the dose rate, specific surface area and the relative humidity but also on the oxide aging. The plutonium percentage appears to be a crucial parameter in hydrogen accumulation kinetics. (author) [fr

  15. Quantifying dust input to the Subarctic North Pacific - Results from surface sediments and sea water thorium isotope measurements

    Science.gov (United States)

    Winckler, G.; Serno, S.; Hayes, C.; Anderson, R. F.; Gersonde, R.; Haug, G. H.

    2012-12-01

    The Subarctic North Pacific is one of the three primary high-nutrient-low chlorophyll regions of the modern ocean, where the biological pump is relatively inefficient at transferring carbon from the atmosphere to the deep sea. The system is thought to be iron-limited. Aeolian dust is a significant source of iron and other nutrients that are essential for the health of marine ecosystems and potentially a controlling factor of the high-nutrient-low chlorophyll status of the Subarctic North Pacific. However, constraining the size of the dust flux to the surface ocean remains difficult. Here we apply two different approaches, based on surface sediment and water column samples, respectively, obtained during the SO202/INOPEX research cruise to the Subarctic North Pacific in 2009. We map the spatial patterns of Th/U isotopes, helium isotopes and rare earth elements across surface sediments from 37 multi-core core-top sediments across the Subarctic North Pacific. In order to deconvolve the detrital endmembers in regions of the North Pacific affected by volcanic material, IRD and hemipelagic input, we use a combination of trace elements with distinct characteristics in the different endmembers. This approach allows us to calculate the relative aeolian fraction, and in combination with Thorium230-normalized mass flux data, to quantify the dust supply. Secondly, we present an innovative approach to use paired Thorium-232 and Thorium-230 concentrations of upper-ocean seawater at 7 stations along the INOPEX track. Thorium-232 in the upper water column is dominantly derived from dissolution of aeolian dust, whereas Thorium-230 data provide a measure of the thorium removal from the surface waters and, thus, allow us to derive Thorium-232 fluxes. Combined with a mean Thorium-232 concentration in dust and estimate of the thorium solubility, the Thorium-232 flux can be translated in a dust flux to the surface ocean. Dust flux estimates for the Subarctic North Pacific will be

  16. Forsmark site investigation. Hydrochemical monitoring of groundwaters and surface waters. Results from water sampling in the Forsmark area, January-December 2009

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson, Ann-Chatrin (ed.); Berg, Cecilia; Harrstroem, Johan; Joensson, Stig; Thur, Pernilla (Geosigma AB (Sweden)); Borgiel, Micke; Qvarfordt, Susanne (Sveriges Vattenekologer AB (Sweden))

    2010-09-15

    The fifth year (2009) of hydrochemical monitoring of groundwaters, surface waters and precipitation in Forsmark is documented in the report. The hydrochemical monitoring programme 2009 included water sampling from: - percussion- and core boreholes equipped with installations for long-term pressure monitoring, tracer tests and water sampling in packed off borehole sections, sampling and analysis performed twice (spring and autumn), - near surface groundwaters (sampling four times a year), - private wells (once per year in October), - surface waters (eleven sampling occasions per year). Due to the somewhat different performance of the hydrogeochemical monitoring of the deep groundwaters during the autumn 2009 compared to previous years, some new findings and knowledge were obtained: 1) Removal of water volumes corresponding to three to five times the volume of the borehole section (the routine procedure) is seldom enough to obtain a complete exchange of the water present in the borehole section when the pumping starts. 2) It is likely that the elevated sulphide concentrations observed in the monitoring programme /1/ is due to contamination from initial water present in the borehole sections when the pumping starts. This water may have a very high sulphide concentration. Dirty water in tubes and in stand pipes may also contribute to the enhanced sulphide concentration. 3) Plug flow calculations will be introduced in the future as a new routine procedure to estimate the water volumes to be removed, in order to exchange the section water volume, prior to groundwater sampling in delimited borehole sections. During the autumn sampling, sample series of five samples per sampling location were collected during continuous pumping in thirteen selected borehole sections. Furthermore, special efforts were put on cleaning of stand pipes and exchange of water prior to sampling. The analytical protocol was rather extensive and included sulphide and uranium analyses for each sample

  17. Forsmark site investigation. Hydrochemical monitoring of groundwaters and surface waters. Results from water sampling in the Forsmark area, January-December 2009

    International Nuclear Information System (INIS)

    Nilsson, Ann-Chatrin; Borgiel, Micke; Qvarfordt, Susanne

    2010-09-01

    The fifth year (2009) of hydrochemical monitoring of groundwaters, surface waters and precipitation in Forsmark is documented in the report. The hydrochemical monitoring programme 2009 included water sampling from: - percussion- and core boreholes equipped with installations for long-term pressure monitoring, tracer tests and water sampling in packed off borehole sections, sampling and analysis performed twice (spring and autumn), - near surface groundwaters (sampling four times a year), - private wells (once per year in October), - surface waters (eleven sampling occasions per year). Due to the somewhat different performance of the hydrogeochemical monitoring of the deep groundwaters during the autumn 2009 compared to previous years, some new findings and knowledge were obtained: 1) Removal of water volumes corresponding to three to five times the volume of the borehole section (the routine procedure) is seldom enough to obtain a complete exchange of the water present in the borehole section when the pumping starts. 2) It is likely that the elevated sulphide concentrations observed in the monitoring programme /1/ is due to contamination from initial water present in the borehole sections when the pumping starts. This water may have a very high sulphide concentration. Dirty water in tubes and in stand pipes may also contribute to the enhanced sulphide concentration. 3) Plug flow calculations will be introduced in the future as a new routine procedure to estimate the water volumes to be removed, in order to exchange the section water volume, prior to groundwater sampling in delimited borehole sections. During the autumn sampling, sample series of five samples per sampling location were collected during continuous pumping in thirteen selected borehole sections. Furthermore, special efforts were put on cleaning of stand pipes and exchange of water prior to sampling. The analytical protocol was rather extensive and included sulphide and uranium analyses for each sample

  18. Molecular dynamics study of room temperature ionic liquids with water at mica surface

    Directory of Open Access Journals (Sweden)

    Huanhuan Zhang

    2018-04-01

    Full Text Available Water in room temperature ionic liquids (RTILs could impose significant effects on their interfacial properties at a charged surface. Although the interfaces between RTILs and mica surfaces exhibit rich microstructure, the influence of water content on such interfaces is little understood, in particular, considering the fact that RTILs are always associated with water due to their hygroscopicity. In this work, we studied how different types of RTILs and different amounts of water molecules affect the RTIL-mica interfaces, especially the water distribution at mica surfaces, using molecular dynamics (MD simulation. MD results showed that (1 there is more water and a thicker water layer adsorbed on the mica surface as the water content increases, and correspondingly the average location of K+ ions is farther from mica surface; (2 more water accumulated at the interface with the hydrophobic [Emim][TFSI] than in case of the hydrophilic [Emim][BF4] due to the respective RTIL hydrophobicity and ion size. A similar trend was also observed in the hydrogen bonds formed between water molecules. Moreover, the 2D number density map of adsorbed water revealed that the high-density areas of water seem to be related to K+ ions and silicon/aluminum atoms on mica surface. These results are of great importance to understand the effects of hydrophobicity/hydrophicility of RTIL and water on the interfacial microstructure at electrified surfaces. Keywords: Room temperature ionic liquids, Hydrophobicity/hydrophicility, Water content, Electrical double layer, Mica surface

  19. Modeling decadal timescale interactions between surface water and ground water in the central Everglades, Florida, USA

    Science.gov (United States)

    Harvey, Judson W.; Newlin, Jessica T.; Krupa, Steven L.

    2006-04-01

    Surface-water and ground-water flow are coupled in the central Everglades, although the remoteness of this system has hindered many previous attempts to quantify interactions between surface water and ground water. We modeled flow through a 43,000 ha basin in the central Everglades called Water Conservation Area 2A. The purpose of the model was to quantify recharge and discharge in the basin's vast interior areas. The presence and distribution of tritium in ground water was the principal constraint on the modeling, based on measurements in 25 research wells ranging in depth from 2 to 37 m. In addition to average characteristics of surface-water flow, the model parameters included depth of the layer of 'interactive' ground water that is actively exchanged with surface water, average residence time of interactive ground water, and the associated recharge and discharge fluxes across the wetland ground surface. Results indicated that only a relatively thin (8 m) layer of the 60 m deep surfical aquifer actively exchanges surface water and ground water on a decadal timescale. The calculated storage depth of interactive ground water was 3.1 m after adjustment for the porosity of peat and sandy limestone. Modeling of the tritium data yielded an average residence time of 90 years in interactive ground water, with associated recharge and discharge fluxes equal to 0.01 cm d -1. 3H/ 3He isotopic ratio measurements (which correct for effects of vertical mixing in the aquifer with deeper, tritium-dead water) were available from several wells, and these indicated an average residence time of 25 years, suggesting that residence time was overestimated using tritium measurements alone. Indeed, both residence time and storage depth would be expected to be overestimated due to vertical mixing. The estimate of recharge and discharge (0.01 cm d -1) that resulted from tritium modeling therefore is still considered reliable, because the ratio of residence time and storage depth (used to

  20. Near-field Oblique Remote Sensing of Stream Water-surface Elevation, Slope, and Surface Velocity

    Science.gov (United States)

    Minear, J. T.; Kinzel, P. J.; Nelson, J. M.; McDonald, R.; Wright, S. A.

    2014-12-01

    A major challenge for estimating discharges during flood events or in steep channels is the difficulty and hazard inherent in obtaining in-stream measurements. One possible solution is to use near-field remote sensing to obtain simultaneous water-surface elevations, slope, and surface velocities. In this test case, we utilized Terrestrial Laser Scanning (TLS) to remotely measure water-surface elevations and slope in combination with surface velocities estimated from particle image velocimetry (PIV) obtained by video-camera and/or infrared camera. We tested this method at several sites in New Mexico and Colorado using independent validation data consisting of in-channel measurements from survey-grade GPS and Acoustic Doppler Current Profiler (ADCP) instruments. Preliminary results indicate that for relatively turbid or steep streams, TLS collects tens of thousands of water-surface elevations and slopes in minutes, much faster than conventional means and at relatively high precision, at least as good as continuous survey-grade GPS measurements. Estimated surface velocities from this technique are within 15% of measured velocity magnitudes and within 10 degrees from the measured velocity direction (using extrapolation from the shallowest bin of the ADCP measurements). Accurately aligning the PIV results into Cartesian coordinates appears to be one of the main sources of error, primarily due to the sensitivity at these shallow oblique look angles and the low numbers of stationary objects for rectification. Combining remotely-sensed water-surface elevations, slope, and surface velocities produces simultaneous velocity measurements from a large number of locations in the channel and is more spatially extensive than traditional velocity measurements. These factors make this technique useful for improving estimates of flow measurements during flood flows and in steep channels while also decreasing the difficulty and hazard associated with making measurements in these

  1. RISK ASSESSMENT OF SURFACE WATERS ASSOCIATED WITH WATER CIRCULATION TECHNOLOGIES ON TROUT FARMS

    Directory of Open Access Journals (Sweden)

    Marcin Sidoruk

    2014-07-01

    Full Text Available Dynamic development of aquaculture has led to an increasing impact on the status of surface waters. Fish production generates wastes that, at high concentrations, may present a serious risk to the aquatic environment. Studies on the assessment of the impact of water management technologies in trout production on the quality of surface waters were conducted in 2011. Six farms were selected for the studies and were divided into two groups based on water management solutions (n = 3: farms with a flow through system (FTS and farms with a recirculation aquaculture system (RAS. On all farms, water measurement points were set and they depicted the quality of inflow water, the quality of water in ponds and the quality of outflow water. The studies did not demonstrate any impact of applied technology on electrolyte conductivity or calcium and magnesium concentrations in outflow water from a trout operation. In addition, it was found that the use of water for production purposes resulted in a slight increase in phosphorus and total nitrogen concentrations in waste waters.

  2. Water on graphene surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Gordillo, M C [Departamento de Sistemas Fisicos, Quimicos y Naturales, Facultad de Ciencias Experimentales, Universidad Pablo de Olavide, Carretera de Utrera, km 1, E-41013 Sevilla (Spain); Marti, J, E-mail: cgorbar@upo.e, E-mail: jordi.marti@upc.ed [Departament de Fisica i Enginyeria Nuclear, Universitat Politecnica de Catalunya, B4-B5 Campus Nord, E-08034 Barcelona, Catalonia (Spain)

    2010-07-21

    In this paper, we summarize the main results obtained in our group about the behavior of water confined inside or close to different graphene surfaces by means of molecular dynamics simulations. These include the inside and outside of carbon nanotubes, and the confinement inside a slit pore or a single graphene sheet. We paid special attention to some thermodynamical (binding energies), structural (hydrogen-bond distributions) and dynamic (infrared spectra) properties, and their comparison to their bulk counterparts.

  3. Studies Concerning Water-Surface Deposits in Recovery Boilers

    Energy Technology Data Exchange (ETDEWEB)

    Strandberg, O; Arvesen, J; Dahl, L

    1971-11-15

    The Feed-water Committee of the Stiftelsen Svensk Cellulosaforskning (Foundation for Swedish Cellulose Research) has initiated research and investigations which aim to increase knowledge about water-surface deposits in boiler tubes, and the resulting risks of gas-surface corrosion in chemical recovery boilers (sulphate pulp industry). The Committee has arranged with AB Atomenergi, Studsvik, for investigations into the water-surface deposits on tubes from six Scandinavian boilers. These investigations have included direct measurements of the thermal conductivity of the deposits, and determinations of their quantity, thickness and structure have been carried out. Previous investigations have shown that gas-surface corrosion can occur at tube temperatures above 330 deg C. The measured values for the thermal conductivity of the deposits indicate that even with small quantities of deposit (c. 1 g/dm2 ) and a moderate boiler pressure (40 atm), certain types of deposit can give rise to the above-mentioned surface temperature, at which the risk of gas-surface corrosion becomes appreciable. For higher boiler pressures the risk is great even with a minimal layer of deposit. The critical deposit thickness can be as low as 0.1 mm

  4. Water in contact with extended hydrophobic surfaces: Direct evidence of weak dewetting

    International Nuclear Information System (INIS)

    Jensen, Torben R.; Kjaer, Kristian; Oestergaard Jensen, Morten; Peters, Guenther H.; Reitzel, Niels; Balashev, Konstantin; Bjoernholm, Thomas

    2003-01-01

    X-ray reflectivity measurements reveal a significant dewetting of a large hydrophobic paraffin surface floating on water. The dewetting phenomenon extends less than 15 A into the bulk water phase and results in an integrated density deficit of about one water molecule per 25-30 A 2 of water in contact with the paraffin surface. The results are supported by molecular dynamics simulations and related to the hydrophobic effect

  5. Waste water treatment in surface mines

    Energy Technology Data Exchange (ETDEWEB)

    Navasardyants, M A; Esipov, V Z; Ryzhkov, Yu A

    1981-01-01

    This paper evaluates problems associated with waste water from coal surface mines of the Kemerovougol' association in the Kuzbass. Waste water treatment in the Kuzbass is of major importance as the region is supplied with water from only one river, the Tom river. Water influx to Kemerovougol' surface mines in a year amounts to 136 million m/sup 3/. The water is used during technological processes, for fire fighting, and spraying to prevent dusting; the rest, about 82.1 million m/sup 3/, is discharged into surface waters. Of this amount, 25.1 million m/sup 3/ is heavily polluted water, 46.6 million m3 are polluted but within limits, and 10.4 million m/sup 3/ are characterized as relatively clean. Waste water is polluted with: suspended matters, oils and oil products, nitrates, nitrides and chlorides. Suspended matter content sometimes reaches 4,000 and 5,000 mg/l, and oil product content in water amounts to 2.17 mg/l. Water treatment in surface mines is two-staged: sumps and sedimentation tanks are used. Water with suspended matter content of 50 to 100 mg/l in winter and summer, and 200 to 250 mg/l in spring and autumn is reduced in sumps to 25 to 30 mg/l in summer and winter and to 40 to 50 mg/l in autumn and spring. During the first stage water treatment efficiency ranges from 50 to 80%. During the second stage water is collected in sedimentation tanks. It is noted that so-called secondary pollution is one of the causes of the relatively high level of suspended matter in discharged water. Water discharged from sedimentation tanks carries clay and loam particles from the bottom and walls of water tanks and channels.

  6. A Facile All-Solution-Processed Surface with High Water Contact Angle and High Water Adhesive Force.

    Science.gov (United States)

    Chen, Mei; Hu, Wei; Liang, Xiao; Zou, Cheng; Li, Fasheng; Zhang, Lanying; Chen, Feiwu; Yang, Huai

    2017-07-12

    A series of sticky superhydrophobicity surfaces with high water contact angle and high water adhesive force is facilely prepared via an all-solution-processed method based on polymerization-induced phase separation between liquid crystals (LCs) and epoxy resin, which produces layers of epoxy microspheres (EMSs) with nanofolds on the surface of a substrate. The morphologies and size distributions of EMSs are confirmed by scanning electron microscopy. Results reveal that the obtained EMS coated-surface exhibits high apparent contact angle of 152.0° and high water adhesive force up to 117.6 μN. By varying the composition of the sample or preparing conditions, the sizes of the produced EMSs can be artificially regulated and, thus, control the wetting properties and water adhesive behaviors. Also, the sticky superhydrophobic surface exhibits excellent chemical stability, as well as long-term durability. Water droplet transportation experiments further prove that the as-made surface can be effectively used as a mechanical hand for water transportation applications. Based on this, it is believed that the simple method proposed in this paper will pave a new way for producing a sticky superhydrophobic surface and obtain a wide range of use.

  7. Water Reclamation Using a Ceramic Nanofiltration Membrane and Surface Flushing with Ozonated Water

    Science.gov (United States)

    Hoang, Anh T.; Okuda, Tetsuji; Takeuchi, Haruka; Tanaka, Hiroaki; Nghiem, Long D.

    2018-01-01

    A new membrane fouling control technique using ozonated water flushing was evaluated for direct nanofiltration (NF) of secondary wastewater effluent using a ceramic NF membrane. Experiments were conducted at a permeate flux of 44 L/m2h to evaluate the ozonated water flushing technique for fouling mitigation. Surface flushing with clean water did not effectively remove foulants from the NF membrane. In contrast, surface flushing with ozonated water (4 mg/L dissolved ozone) could effectively remove most foulants to restore the membrane permeability. This surface flushing technique using ozonated water was able to limit the progression of fouling to 35% in transmembrane pressure increase over five filtration cycles. Results from this study also heighten the need for further development of ceramic NF membrane to ensure adequate removal of pharmaceuticals and personal care products (PPCPs) for water recycling applications. The ceramic NF membrane used in this study showed approximately 40% TOC rejection, and the rejection of PPCPs was generally low and highly variable. It is expected that the fouling mitigation technique developed here is even more important for ceramic NF membranes with smaller pore size and thus better PPCP rejection. PMID:29671797

  8. Water Reclamation Using a Ceramic Nanofiltration Membrane and Surface Flushing with Ozonated Water

    Directory of Open Access Journals (Sweden)

    Takahiro Fujioka

    2018-04-01

    Full Text Available A new membrane fouling control technique using ozonated water flushing was evaluated for direct nanofiltration (NF of secondary wastewater effluent using a ceramic NF membrane. Experiments were conducted at a permeate flux of 44 L/m2h to evaluate the ozonated water flushing technique for fouling mitigation. Surface flushing with clean water did not effectively remove foulants from the NF membrane. In contrast, surface flushing with ozonated water (4 mg/L dissolved ozone could effectively remove most foulants to restore the membrane permeability. This surface flushing technique using ozonated water was able to limit the progression of fouling to 35% in transmembrane pressure increase over five filtration cycles. Results from this study also heighten the need for further development of ceramic NF membrane to ensure adequate removal of pharmaceuticals and personal care products (PPCPs for water recycling applications. The ceramic NF membrane used in this study showed approximately 40% TOC rejection, and the rejection of PPCPs was generally low and highly variable. It is expected that the fouling mitigation technique developed here is even more important for ceramic NF membranes with smaller pore size and thus better PPCP rejection.

  9. Turbulent flow over an interactive alternating land-water surface

    Science.gov (United States)

    Van Heerwaarden, C.; Mellado, J. P.

    2014-12-01

    The alternating land-water surface is a challenging surface to represent accurately in weather and climate models, but it is of great importance for the surface energy balance in polar regions. The complexity of this surface lies in the fact that secondary circulations, which form at the boundary of water and land, interact strongly with the surface energy balance. Due to its large heat capacity, the water temperature adapts slowly to the flow, thus the properties of the atmosphere determine the uptake of energy from the water. In order to study this complex system in a simpler way, retaining only the most essential physics, we have simplified the full surface energy balance including radiation. We have derived a boundary condition that mimics the full balance and can be formulated as a so-called Robin boundary condition: a linear combination of Dirichlet (fixed temperature) and Neumann (fixed temperature gradient) ones. By spatially varying the coefficients, we are able to express land and water using this boundary condition. We have done a series of direct numerical simulations in which we generate artificial land-water patterns from noise created from a Gaussian spectrum centered around a dominant wave number. This method creates realistic random patterns, but we are still in control of the length scales. We show that the system can manifest itself in three regimes: micro-, meso- and macro-scale. In the micro-scale, we find perfect mixing of the near-surface atmosphere that results in identical air properties over water and land. In the meso-scale, secondary circulations alter the heat exchange considerably by advecting air between land and water. In addition, they bring the surface temperature of the land closer to that of the air, thereby modulating the energy loss due to outgoing longwave radiation. In the macro-scale regime, the flow over land and water become independent of each other and only the large scale forcings determine the energy balance.

  10. The study of dynamic force acted on water strider leg departing from water surface

    Directory of Open Access Journals (Sweden)

    Peiyuan Sun

    2018-01-01

    Full Text Available Water-walking insects such as water striders can skate on the water surface easily with the help of the hierarchical structure on legs. Numerous theoretical and experimental studies show that the hierarchical structure would help water strider in quasi-static case such as load-bearing capacity. However, the advantage of the hierarchical structure in the dynamic stage has not been reported yet. In this paper, the function of super hydrophobicity and the hierarchical structure was investigated by measuring the adhesion force of legs departing from the water surface at different lifting speed by a dynamic force sensor. The results show that the adhesion force decreased with the increase of lifting speed from 0.02 m/s to 0.4 m/s, whose mechanic is investigated by Energy analysis. In addition, it can be found that the needle shape setae on water strider leg can help them depart from water surface easily. Thus, it can serve as a starting point to understand how the hierarchical structure on the legs help water-walking insects to jump upward rapidly to avoid preying by other insects.

  11. Monitoring of Water and Contaminant Migration at the Groundwater-Surface Water Interface

    Science.gov (United States)

    2008-08-01

    seepage is occurring in a freshwater lake environment and to map the lateral extent of any subsurface contamination at the groundwater –surface water ...and Contaminant Migration at the Groundwater -Surface Water Interface August 2008 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public...4. TITLE AND SUBTITLE Monitoring of Water and Contaminant Migration at the Groundwater -Surface Water Interface 5a. CONTRACT NUMBER 5b. GRANT NUMBER

  12. Boron content of South African surface waters: prelimenary assessment for irrigation

    International Nuclear Information System (INIS)

    Reid, P.C.; Davies, E.

    1989-01-01

    Boron, a naturally occuring constituent of surface and ground water, is an essential plant nutrient. However, at relatively low concentrations, boron becomes toxic to plant growth. In order to assess the boron status in South African surface waters, the Department of Water Affairs launched a long-term boron water quality assessment programme in 1985, encompassing the analysis of water samples taken at 91 sites throughout South Africa. Results to date indicate that the boron concentration in South African surface waters varies between 0,02 to 0,33 mg l -1 . At these concentrations even the most boron sensitive crops can be grown without fear of boron toxicity. 3 refs., 1 fig., 2 tabs

  13. How well Can We Classify SWOT-derived Water Surface Profiles?

    Science.gov (United States)

    Frasson, R. P. M.; Wei, R.; Picamilh, C.; Durand, M. T.

    2015-12-01

    The upcoming Surface Water Ocean Topography (SWOT) mission will detect water bodies and measure water surface elevation throughout the globe. Within its continental high resolution mask, SWOT is expected to deliver measurements of river width, water elevation and slope of rivers wider than ~50 m. The definition of river reaches is an integral step of the computation of discharge based on SWOT's observables. As poorly defined reaches can negatively affect the accuracy of discharge estimations, we seek strategies to break up rivers into physically meaningful sections. In the present work, we investigate how accurately we can classify water surface profiles based on simulated SWOT observations. We assume that most river sections can be classified as either M1 (mild slope, with depth larger than the normal depth), or A1 (adverse slope with depth larger than the critical depth). This assumption allows the classification to be based solely on the second derivative of water surface profiles, with convex profiles being classified as A1 and concave profiles as M1. We consider a HEC-RAS model of the Sacramento River as a representation of the true state of the river. We employ the SWOT instrument simulator to generate a synthetic pass of the river, which includes our best estimates of height measurement noise and geolocation errors. We process the resulting point cloud of water surface heights with the RiverObs package, which delineates the river center line and draws the water surface profile. Next, we identify inflection points in the water surface profile and classify the sections between the inflection points. Finally, we compare our limited classification of simulated SWOT-derived water surface profile to the "exact" classification of the modeled Sacramento River. With this exercise, we expect to determine if SWOT observations can be used to find inflection points in water surface profiles, which would bring knowledge of flow regimes into the definition of river reaches.

  14. Sound Wave Energy Resulting from the Impact of Water Drops on the Soil Surface.

    Science.gov (United States)

    Ryżak, Magdalena; Bieganowski, Andrzej; Korbiel, Tomasz

    2016-01-01

    The splashing of water drops on a soil surface is the first step of water erosion. There have been many investigations into splashing-most are based on recording and analysing images taken with high-speed cameras, or measuring the mass of the soil moved by splashing. Here, we present a new aspect of the splash phenomenon's characterization the measurement of the sound pressure level and the sound energy of the wave that propagates in the air. The measurements were carried out for 10 consecutive water drop impacts on the soil surface. Three soils were tested (Endogleyic Umbrisol, Fluvic Endogleyic Cambisol and Haplic Chernozem) with four initial moisture levels (pressure heads: 0.1 kPa, 1 kPa, 3.16 kPa and 16 kPa). We found that the values of the sound pressure and sound wave energy were dependent on the particle size distribution of the soil, less dependent on the initial pressure head, and practically the same for subsequent water drops (from the first to the tenth drop). The highest sound pressure level (and the greatest variability) was for Endogleyic Umbrisol, which had the highest sand fraction content. The sound pressure for this soil increased from 29 dB to 42 dB with the next incidence of drops falling on the sample The smallest (and the lowest variability) was for Fluvic Endogleyic Cambisol which had the highest clay fraction. For all experiments the sound pressure level ranged from ~27 to ~42 dB and the energy emitted in the form of sound waves was within the range of 0.14 μJ to 5.26 μJ. This was from 0.03 to 1.07% of the energy of the incident drops.

  15. Sound Wave Energy Resulting from the Impact of Water Drops on the Soil Surface.

    Directory of Open Access Journals (Sweden)

    Magdalena Ryżak

    Full Text Available The splashing of water drops on a soil surface is the first step of water erosion. There have been many investigations into splashing-most are based on recording and analysing images taken with high-speed cameras, or measuring the mass of the soil moved by splashing. Here, we present a new aspect of the splash phenomenon's characterization the measurement of the sound pressure level and the sound energy of the wave that propagates in the air. The measurements were carried out for 10 consecutive water drop impacts on the soil surface. Three soils were tested (Endogleyic Umbrisol, Fluvic Endogleyic Cambisol and Haplic Chernozem with four initial moisture levels (pressure heads: 0.1 kPa, 1 kPa, 3.16 kPa and 16 kPa. We found that the values of the sound pressure and sound wave energy were dependent on the particle size distribution of the soil, less dependent on the initial pressure head, and practically the same for subsequent water drops (from the first to the tenth drop. The highest sound pressure level (and the greatest variability was for Endogleyic Umbrisol, which had the highest sand fraction content. The sound pressure for this soil increased from 29 dB to 42 dB with the next incidence of drops falling on the sample The smallest (and the lowest variability was for Fluvic Endogleyic Cambisol which had the highest clay fraction. For all experiments the sound pressure level ranged from ~27 to ~42 dB and the energy emitted in the form of sound waves was within the range of 0.14 μJ to 5.26 μJ. This was from 0.03 to 1.07% of the energy of the incident drops.

  16. Water evaporation from substrate tooth surface during dentin treatments.

    Science.gov (United States)

    Kusunoki, Mizuho; Itoh, Kazuo; Gokan, Yuka; Nagai, Yoshitaka; Tani, Chihiro; Hisamitsu, Hisashi

    2011-01-01

    The purpose of this study was to evaluate changes in the quantity of water evaporation from tooth surfaces. The amount of water evaporation was measured using Multi probe adapter MPA5 and Tewameter TM300 (Courage+Khazaka Electric GmbH, Köln, Germany) after acid etching and GM priming of enamel; and after EDTA conditioning and GM priming of dentin. The results indicated that the amount of water evaporation from the enamel surface was significantly less than that from the dentin. Acid etching did not affect the water evaporation from enamel, though GM priming significantly decreased the evaporation (83.48 ± 15.14% of that before priming). The evaporation from dentin was significantly increased by EDTA conditioning (131.38 ± 42.08% of that before conditioning) and significantly reduced by GM priming (80.26 ± 7.43% of that before priming). It was concluded that dentin priming reduced water evaporation from the dentin surface.

  17. UV sensitivity of planktonic net community production in ocean surface waters

    Science.gov (United States)

    Regaudie-de-Gioux, Aurore; Agustí, Susana; Duarte, Carlos M.

    2014-05-01

    The net plankton community metabolism of oceanic surface waters is particularly important as it more directly affects the partial pressure of CO2 in surface waters and thus the air-sea fluxes of CO2. Plankton communities in surface waters are exposed to high irradiance that includes significant ultraviolet blue (UVB, 280-315 nm) radiation. UVB radiation affects both photosynthetic and respiration rates, increase plankton mortality rates, and other metabolic and chemical processes. Here we test the sensitivity of net community production (NCP) to UVB of planktonic communities in surface waters across contrasting regions of the ocean. We observed here that UVB radiation affects net plankton community production at the ocean surface, imposing a shift in NCP by, on average, 50% relative to the values measured when excluding partly UVB. Our results show that under full solar radiation, the metabolic balance shows the prevalence of net heterotrophic community production. The demonstration of an important effect of UVB radiation on NCP in surface waters presented here is of particular relevance in relation to the increased UVB radiation derived from the erosion of the stratospheric ozone layer. Our results encourage design future research to further our understanding of UVB effects on the metabolic balance of plankton communities.

  18. Relation between 234Th scavenging and zooplankton biomass in Mediterranean surface waters

    International Nuclear Information System (INIS)

    Schmidt, S.; Reyss, J.L.; Buat-Menard, P.; Nival, P.; Baker, M.

    1992-01-01

    Dissolved and particulate 234 Th activities were determined and phyto-and zooplankton biomass were periodically measured 8 miles off Nice (Mediterranean Sea) during spring 1987. The results show a strong variability of 234 Th distribution on short time scales in northwestern Mediterranean surface waters. The good correlation observed the zooplankton biomass and the rate of 234 Th export to deep water in particulate form is agreement with the assumption that the residence time of particulate 234 Th in oceanic surface waters is controlled by zooplankton grazing. Moreover, our results indicate the importance of salps in particular as efficient removers of small suspended particles in surface waters

  19. Properties of water surface discharge at different pulse repetition rates

    International Nuclear Information System (INIS)

    Ruma,; Yoshihara, K.; Hosseini, S. H. R.; Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-01-01

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H 2 O 2 ) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H 2 O 2 and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  20. Underground coal mine subsidence impacts on surface water

    International Nuclear Information System (INIS)

    Stump, D.E. Jr.

    1992-01-01

    This paper reports that subsidence from underground coal mining alters surface water discharge and availability. The magnitude and areal extent of these impacts are dependent on many factors, including the amount of subsidence, topography, geology, climate, surface water - ground water interactions, and fractures in the overburden. There alterations may have positive and/or negative impacts. One of the most significant surface water impacts occurred in July 1957 near West Pittston, Pennsylvania. Subsidence in the Knox Mine under the Coxton Yards of the Lehigh Valley Railroad allowed part of the discharge in the Susquehanna River to flow into the mine and create a crater 200 feet in diameter and 300 feet deep. Fourteen railroad gondola cars fell into the hole which was eventually filled with rock, sand, and gravel. Other surface water impacts from subsidence may include the loss of water to the ground water system, the gaining of water from the ground water system, the creation of flooded subsidence troughs, the increasing of impoundment storage capacity, the relocation of water sources (springs), and the alteration of surface drainage patterns

  1. Analysis of water microdroplet condensation on silicon surfaces

    Science.gov (United States)

    Honda, Takuya; Fujimoto, Kenya; Yoshimoto, Yuta; Mogi, Katsuo; Kinefuchi, Ikuya; Sugii, Yasuhiko; Takagi, Shu; Univ. of Tokyo Team; Tokyo Inst. of Tech. Team

    2016-11-01

    We observed the condensation process of water microdroplets on flat silicon (100) surfaces by means of the sequential visualization of the droplets using an environmental scanning electron microscope. As previously reported for nanostructured surfaces, the condensation process of water microdroplets on the flat silicon surfaces also exhibits two modes: the constant base (CB) area mode and the constant contact angle (CCA) mode. In the CB mode, the contact angle increases with time while the base diameter is constant. Subsequently, in the CCA mode, the base diameter increases with time while the contact angle remains constant. The dropwise condensation model regulated by subcooling temperature does not reproduce the experimental results. Because the subcooling temperature is not constant in the case of a slow condensation rate, this model is not applicable to the condensation of the long time scale ( several tens of minutes). The contact angle of water microdroplets ( several μm) tended to be smaller than the macro contact angle. Two hypotheses are proposed as the cause of small contact angles: electrowetting and the coalescence of sub- μm water droplets.

  2. Molecular Structure and Dynamics in Thin Water Films at the Silica and Graphite Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Argyris, Dr. Dimitrios [University of Oklahoma; Tummala, Dr. Naga Rajesh [University of Oklahoma; StrioloDr., A [Vanderbilt University; Cole, David R [ORNL

    2008-01-01

    The structure and dynamic properties of interfacial water at the graphite and silica solid surfaces were investigated using molecular dynamics simulations. The effect of surface properties on the characteristics of interfacial water was quantified by computing density profiles, radial distribution functions, surface density distributions, orientation order parameters, and residence and reorientation correlation functions. In brief, our results show that the surface roughness, chemical heterogeneity, and surface heterogeneous charge distribution affect the structural and dynamic properties of the interfacial water molecules, as well as their rate of exchange with bulk water. Most importantly, our results indicate the formation of two distinct water layers at the SiO2 surface covered by a large density of hydroxyl groups. Further analysis of the data suggests a highly confined first layer where the water molecules assume preferential hydrogen-down orientation and a second layer whose behavior and characteristics are highly dependent on those of the first layer through a well-organized hydrogen bond network. The results suggest that water-water interactions, in particular hydrogen bonds, may be largely responsible for macroscopic interfacial properties such as adsorption and contact angle.

  3. Heterogeneous Ice Nucleation: Interplay of Surface Properties and Their Impact on Water Orientations.

    Science.gov (United States)

    Glatz, Brittany; Sarupria, Sapna

    2018-01-23

    Ice is ubiquitous in nature, and heterogeneous ice nucleation is the most common pathway of ice formation. How surface properties affect the propensity to observe ice nucleation on that surface remains an open question. We present results of molecular dynamics studies of heterogeneous ice nucleation on model surfaces. The models surfaces considered emulate the chemistry of kaolinite, an abundant component of mineral dust. We investigate the interplay of surface lattice and hydrogen bonding properties in affecting ice nucleation. We find that lattice matching and hydrogen bonding are necessary but not sufficient conditions for observing ice nucleation at these surfaces. We correlate this behavior to the orientations sampled by the metastable supercooled water in contact with the surfaces. We find that ice is observed in cases where water molecules not only sample orientations favorable for bilayer formation but also do not sample unfavorable orientations. This distribution depends on both surface-water and water-water interactions and can change with subtle modifications to the surface properties. Our results provide insights into the diverse behavior of ice nucleation observed at different surfaces and highlight the complexity in elucidating heterogeneous ice nucleation.

  4. Multi-objective analysis of the conjunctive use of surface water and groundwater in a multisource water supply system

    Science.gov (United States)

    Vieira, João; da Conceição Cunha, Maria

    2017-04-01

    each water source in each time step (i.e., reservoir diversion and groundwater pumping). The results provide valuable information for analysing the impacts of the conjunctive use of surface water and groundwater. For example, considering a drought scenario, the results show how the same level of total water supplied can be achieved by different management alternatives with different impact on the water quality, costs, and the state of the water sources at the end of the time horizon. The results allow also the clear understanding of the potential benefits from the conjunctive use of surface water and groundwater thorough the mitigation of the variation in the availability of surface water, improving the water quantity and/or water quality delivered to the users, or the better adaptation of such systems to a changing world.

  5. Concentration data for anthropogenic organic compounds in ground water, surface water, and finished water of selected community water systems in the United States, 2002-05

    Science.gov (United States)

    Carter, Janet M.; Delzer, Gregory C.; Kingsbury, James A.; Hopple, Jessica A.

    2007-01-01

    combustion-derived compounds; (10) personal care and domestic use products; (11) plant- or animal-derived biochemicals; (12) refrigerants and propellants; and (13) solvents. Source and finished water samples were collected during phase 2 and analyzed for constituents that were detected frequently during phase 1. This report presents concentration data for AOCs in ground water, surface water, and finished water of CWSs sampled for SWQA studies during 2002-05. Specifically, this report presents the analytical results of samples collected during phase 1 including (1) samples from 221 wells that were analyzed for 258 AOCs; (2) monthly samples from 9 surface-water sites that were analyzed for 258 AOCs during phase 1; and (3) samples from a subset of the wells and surface-water sites located in areas with substantial agricultural production that were analyzed for 3 additional pesticides and 16 pesticide degradates. Samples collected during phase 2 were analyzed for selected AOCs that were detected most frequently in source water during phase 1 sampling; analytical results for phase 2 are presented for (1) samples of source water and finished water from 94 wells; and (2) samples of source water and finished water samples that were collected monthly and during selected flow conditions at 8 surface-water sites. Results of quality-assurance/quality-control samples collected for SWQA studies during 2002-05 also are presented.

  6. CryoSat-2 radar altimetry for monitoring surface water in China

    DEFF Research Database (Denmark)

    Jiang, Liguang; Bauer-Gottwein, Peter; Nielsen, Karina

    storage (SWS) changes to terrestrial water storage (TWS) was evaluated in combination with results from the Gravity Recovery and Climate Experiment (GRACE). Moreover, water level dynamics in the Yangtze and Yellow Rivers were mapped. Results show that 1) surface water levels change significantly...

  7. Two-dimensional LIF measurements of humidity and OH density resulting from evaporated water from a wet surface in plasma for medical use

    International Nuclear Information System (INIS)

    Yagi, Ippei; Ono, Ryo; Oda, Tetsuji; Takaki, Koichi

    2015-01-01

    In plasma medicine, plasma is applied to a wet surface and is often accompanied by dry-gas flow. The dry-gas flow affects water evaporation from the wet surface and influences production of reactive species derived from water vapor, such as OH radicals. In this study, the effect of the dry-gas flow on two-dimensional distributions of humidity and OH radical density are examined by measuring them using laser-induced fluorescence (LIF). First, humidity is measured when nitrogen flows from a quartz tube of 4 mm inner diameter onto distilled water and agar media from 5 mm distance. NO gas is added to the nitrogen as a tracer and humidity is obtained from the quenching rate of NO molecules measured using LIF. This measurement has a spatial resolution of 0.2 mm 3 and a temporal resolution of less than 220 ns. The two-dimensional humidity distribution shows that the dry-gas flow pushes away water vapor evaporating from the wet surface. As a result, a low-humidity region is formed near the quartz tube nozzle and a high-humidity region is formed near the wet surface. The thickness of the low-humidity region reduces with increasing gas flow rate. It is 0.1–0.5 mm for the flow rate of higher than 0.3 l min −1 . Next, the OH density is measured when a nanosecond pulsed streamer discharge is applied to a distilled water surface with dry-air flow. The OH density decreases with increasing gas flow rate due to decreased humidity. When the flow rate is lower than 0.1 l min −1 , the OH distribution is approximately uniform in the plasma region, while the humidity distribution shows a large gradient. The importance of the thin high-humidity region on the flux of reactive species onto the wet surface is discussed. (paper)

  8. Subsurface watering resulted in reduced soil N2O and CO2 emissions and their global warming potentials than surface watering

    Science.gov (United States)

    Wei, Qi; Xu, Junzeng; Yang, Shihong; Liao, Linxian; Jin, Guangqiu; Li, Yawei; Hameed, Fazli

    2018-01-01

    Water management is an important practice with significant effect on greenhouse gases (GHG) emission from soils. Nitrous oxide (N2O) and carbon dioxide (CO2) emissions and their global warming potentials (GWPs) from subsurface watering soil (SUW) were investigated, with surface watering (SW) as a control. Results indicated that the N2O and CO2 emissions from SUW soils were somewhat different to those from SW soil, with the peak N2O and CO2 fluxes from SUW soil reduced by 28.9% and 19.4%, and appeared 72 h and 168 h later compared with SW. The fluxes of N2O and CO2 from SUW soils were lower than those from SW soil in both pulse and post-pulse periods, and the reduction was significantly (p0.1) lower that from SW soil. Moreover, N2O and CO2 fluxes from both watering treatments increased exponentially with increase of soil water-filled pore space (WFPS) and temperature. Our results suggest that watering soil from subsurface could significantly reduce the integrative greenhouse effect caused by N2O and CO2 and is a promising strategy for soil greenhouse gases (GHGs) mitigation. And the pulse period, contributed most to the reduction in emissions of N2O and CO2 from soils between SW and SUW, should be a key period for mitigating GHGs emissions. Response of N2O and CO2 emissions to soil WFPS and temperature illustrated that moisture was the dominant parameters that triggering GHG pulse emissions (especially for N2O), and temperature had a greater effect on the soil microorganism activity than moisture in drier soil. Avoiding moisture and temperature are appropriate for GHG emission at the same time is essential for GHGs mitigation, because peak N2O and CO2 emission were observed only when moisture and temperature are both appropriate.

  9. Presence of active pharmaceutical ingredients in the continuum of surface and ground water used in drinking water production.

    Science.gov (United States)

    Ahkola, Heidi; Tuominen, Sirkku; Karlsson, Sanja; Perkola, Noora; Huttula, Timo; Saraperä, Sami; Artimo, Aki; Korpiharju, Taina; Äystö, Lauri; Fjäder, Päivi; Assmuth, Timo; Rosendahl, Kirsi; Nysten, Taina

    2017-12-01

    Anthropogenic chemicals in surface water and groundwater cause concern especially when the water is used in drinking water production. Due to their continuous release or spill-over at waste water treatment plants, active pharmaceutical ingredients (APIs) are constantly present in aquatic environment and despite their low concentrations, APIs can still cause effects on the organisms. In the present study, Chemcatcher passive sampling was applied in surface water, surface water intake site, and groundwater observation wells to estimate whether the selected APIs are able to end up in drinking water supply through an artificial groundwater recharge system. The API concentrations measured in conventional wastewater, surface water, and groundwater grab samples were assessed with the results obtained with passive samplers. Out of the 25 APIs studied with passive sampling, four were observed in groundwater and 21 in surface water. This suggests that many anthropogenic APIs released to waste water proceed downstream and can be detectable in groundwater recharge. Chemcatcher passive samplers have previously been used in monitoring several harmful chemicals in surface and wastewaters, but the path of chemicals to groundwater has not been studied. This study provides novel information on the suitability of the Chemcatcher passive samplers for detecting APIs in groundwater wells.

  10. Water-quality assessment of the Kentucky River basin, Kentucky; results of investigations of surface-water quality, 1987-90

    Science.gov (United States)

    Haag, K.H.; Garcia, Rene; Jarrett, G.L.; Porter, S.D.

    1995-01-01

    The U.S. Geological Survey investigated the water quality of the Kentucky River Basin in Kentucky as part of the National Water-Quality Assessment program. Data collected during 1987-90 were used to describe the spatial and temporal variability of water-quality constituents including metals and trace elements, nutrients, sediments, pesticides, dissolved oxygen, and fecal-coliform bacteria. Oil-production activities were the source of barium, bromide, chloride, magnesium, and sodium in several watersheds. High concentrations of aluminum, iron, and zinc were related to surface mining in the Eastern Coal Field Region. High concentrations of lead and zinc occurred in streambed sediments in urban areas, whereas concentrations of arsenic, strontium, and uranium were associated with natural geologic sources. Concentrations of phosphorus were significantly correlated with urban and agricultural land use. The high phosphorus content of Bluegrass Region soils was an important source of phosphorus in streams. At many sites in urban areas, most of the stream nitrogen load was attributable to wastewater-treatment-plant effluent. Average suspended-sediment concentrations were positively correlated with discharge. There was a downward trend in suspended-sediment concentrations downstream in the Kentucky River main stem during the study. The most frequently detected herbicides in water samples were atrazine, 2,4-D, alachlor, metolachlor, and dicamba. Diazinon, malathion, and parathion were the most frequently detected organophosphate insecticides in water samples. Detectable concentrations of aldrin, chlordane, DDT, DDE, dieldrin, endrin, endosulfan, heptachlor, and lindane were found in streambed-sediment samples. Dissolved-oxygen concentrations were sometimes below the minimum concentration needed to sustain aquatic life. At some sites, high concentrations of fecal-indicator bacteria were found and water samples did not meet sanitary water-quality criteria.

  11. Enhanced load-carrying capacity of hairy surfaces floating on water.

    Science.gov (United States)

    Xue, Yahui; Yuan, Huijing; Su, Weidong; Shi, Yipeng; Duan, Huiling

    2014-05-08

    Water repellency of hairy surfaces depends on the geometric arrangement of these hairs and enables different applications in both nature and engineering. We investigate the mechanism and optimization of a hairy surface floating on water to obtain its maximum load-carrying capacity by the free energy and force analyses. It is demonstrated that there is an optimum cylinder spacing, as a result of the compromise between the vertical capillary force and the gravity, so that the hairy surface has both high load-carrying capacity and mechanical stability. Our analysis makes it clear that the setae on water striders' legs or some insects' wings are in such an optimized geometry. Moreover, it is shown that surface hydrophobicity can further increase the capacity of a hairy surface with thick cylinders, while the influence is negligible when the cylinders are thin.

  12. Water's Interfacial Hydrogen Bonding Structure Reveals the Effective Strength of Surface-Water Interactions.

    Science.gov (United States)

    Shin, Sucheol; Willard, Adam P

    2018-06-05

    We combine all-atom molecular dynamics simulations with a mean field model of interfacial hydrogen bonding to analyze the effect of surface-water interactions on the structural and energetic properties of the liquid water interface. We show that the molecular structure of water at a weakly interacting ( i.e., hydrophobic) surface is resistant to change unless the strength of surface-water interactions are above a certain threshold. We find that below this threshold water's interfacial structure is homogeneous and insensitive to the details of the disordered surface, however, above this threshold water's interfacial structure is heterogeneous. Despite this heterogeneity, we demonstrate that the equilibrium distribution of molecular orientations can be used to quantify the energetic component of the surface-water interactions that contribute specifically to modifying the interfacial hydrogen bonding network. We identify this specific energetic component as a new measure of hydrophilicity, which we refer to as the intrinsic hydropathy.

  13. Simulation and analysis on thermodynamic performance of surface water source heat pump system

    Institute of Scientific and Technical Information of China (English)

    Nan Lv; Qing Zhang; Zhenqian Chen; Dongsheng Wu

    2017-01-01

    This work established a thermodynamic performance model of a heat pump system containing a heat pump unit model, an air conditioning cooling and heating load calculation model, a heat exchanger model and a water pump performance model based on mass and energy balances. The thermodynamic performance of a surface water source heat pump air conditioning system was simulated and verified by comparing the simulation results to an actual engineering project. In addition, the effects of the surface water temperature, heat exchanger structure and surface water pipeline transportation system on the thermodynamic performance of the heat pump air conditioning system were analyzed. Under the simulated conditions in this paper with a cooling load of 3400 kW, the results showed that a 1 ℃ decrease in the surface water temperature leads to a 2.3 percent increase in the coefficient of performance; furthermore, an additional 100 m of length for the closed-loop surface water heat exchanger tube leads to a 0.08 percent increase in the coefficient of performance. To decrease the system energy consumption, the optimal working point should be specified according to the surface water transportation length.

  14. The significant surface-water connectivity of "geographically isolated wetlands"

    Science.gov (United States)

    Calhoun, Aram J.K.; Mushet, David M.; Alexander, Laurie C.; DeKeyser, Edward S.; Fowler, Laurie; Lane, Charles R.; Lang, Megan W.; Rains, Mark C.; Richter, Stephen; Walls, Susan

    2017-01-01

    We evaluated the current literature, coupled with our collective research expertise, on surface-water connectivity of wetlands considered to be “geographically isolated” (sensu Tiner Wetlands 23:494–516, 2003a) to critically assess the scientific foundation of grouping wetlands based on the singular condition of being surrounded by uplands. The most recent research on wetlands considered to be “geographically isolated” shows the difficulties in grouping an ecological resource that does not reliably indicate lack of surface water connectivity in order to meet legal, regulatory, or scientific needs. Additionally, the practice of identifying “geographically isolated wetlands” based on distance from a stream can result in gross overestimates of the number of wetlands lacking ecologically important surface-water connections. Our findings do not support use of the overly simplistic label of “geographically isolated wetlands”. Wetlands surrounded by uplands vary in function and surface-water connections based on wetland landscape setting, context, climate, and geographic region and should be evaluated as such. We found that the “geographically isolated” grouping does not reflect our understanding of the hydrologic variability of these wetlands and hence does not benefit conservation of the Nation’s diverse wetland resources. Therefore, we strongly discourage use of categorizations that provide overly simplistic views of surface-water connectivity of wetlands fully embedded in upland landscapes.

  15. Tracer experiment by using radioisotope in surface water environment

    International Nuclear Information System (INIS)

    Suh, K.S.; Kim, K.C.; Chun, I.Y.; Jung, S.H.; Lee, C.W.

    2007-01-01

    Complete text of publication follows. 1. Objective An expansion of industrial activities and urbanization result in still increasing amount of pollutants discharged into surface water. Discharged pollutants in surface water have harmful effects on the ecology of a river system and human beings. Pollutants discharged into surface water is transported and dispersed under conditions characteristic to particular natural water receiver. Radiotracer method is a useful tool for monitoring the pollutant dispersion and description of mixing process taking place in natural streams. A tracer experiment using radioisotope was carried out to investigate the characteristics of a pollutant transport and a determination of the diffusion coefficients in a river system. 2. Methods The upper area of the Keum river was selected for the tracer experiment, which is located in a mid west of Korea. The measurements of the velocity and bathymetry before a tracer experiment were performed to select the sampling lines for a detection of the radioisotope. The radioisotope was instantaneously injected into a flow as a point source by an underwater glass-vial crusher. The detection was made with 60 2inch NaI(Tl) scintillation detectors at 3 transverse lines at a downstream position. The multi-channel data acquisition systems were used to collect and process the signals transmitted from the detectors. Two-dimensional numerical models were used to simulate the hydraulic parameters and the concentration distributions of the radioisotope injected into the river. 3. Results and Conclusion The calculated results such as velocity and concentrations were compared with the measured ones. The dispersion characteristics of the radioisotope were analyzed according to a variation of the flow rate, water level and diffusion coefficients. Also, the diffusion coefficients were calculated by using the measured concentrations and the coefficients obtained from the field experiment were compared with the ones

  16. Water surface modeling from a single viewpoint video.

    Science.gov (United States)

    Li, Chuan; Pickup, David; Saunders, Thomas; Cosker, Darren; Marshall, David; Hall, Peter; Willis, Philip

    2013-07-01

    We introduce a video-based approach for producing water surface models. Recent advances in this field output high-quality results but require dedicated capturing devices and only work in limited conditions. In contrast, our method achieves a good tradeoff between the visual quality and the production cost: It automatically produces a visually plausible animation using a single viewpoint video as the input. Our approach is based on two discoveries: first, shape from shading (SFS) is adequate to capture the appearance and dynamic behavior of the example water; second, shallow water model can be used to estimate a velocity field that produces complex surface dynamics. We will provide qualitative evaluation of our method and demonstrate its good performance across a wide range of scenes.

  17. An ontology design pattern for surface water features

    Science.gov (United States)

    Sinha, Gaurav; Mark, David; Kolas, Dave; Varanka, Dalia; Romero, Boleslo E.; Feng, Chen-Chieh; Usery, E. Lynn; Liebermann, Joshua; Sorokine, Alexandre

    2014-01-01

    Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities exist due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology for other more context-dependent ontologies. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex or specialized surface water ontologies. A fundamental distinction is made in this ontology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is implemented in OWL, but Description Logic axioms and a detailed explanation is provided in this paper. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. Also provided is a discussion of why there is a need to complement the pattern with other ontologies, especially the previously developed Surface Network pattern. Finally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through an annotated geospatial dataset and sample queries using the classes of the Surface Water pattern.

  18. Radioactivity in the Dutch surface waters after Chernobylsk

    International Nuclear Information System (INIS)

    Kroesbergen, J.; Ballegooijen, L. van; Uunk, E.J.B.

    1988-12-01

    A survey is given of the impact of the nuclear accident in Chernobylsk upon the Dutch surface waters. With this the measurements, which have been performed in the various compartments (water, suspended matter, bottom, biota) are presented. Since the investigation is still going, the period from May 1986 - December 1987 has been chosen. This period is long enough in order to obtain an impression of the long-term effects. In chapter 2 a description is given of the measuring program performed and the analyzing methods employed. In chapter 3 the activation measurements in the surface waters, the suspended matter and the bottom are considered. Also the contamination of biologic matter and the purification mud is discussed. Chapter 4 gives a survey of the amount of radionuclides, which have been accumulated in the Dutch surface waters as a result of the Chernobylsk accident. The investigation of the processes are discussed in chapter 5. Since the study of the effects of radionuclides in the aquatic environment is still going, only some aspects are treated. Chapter 6 gives a general discussion of the results. Also an estimation is presented towards the future development of the contamination of the aquatic environment. Finally in chapter 7 the most important conclusions are summarized. Also some recommendations are made with regard to future measurements to be taken. (author). 72 refs.; 36 figs.; 26 tabs

  19. Bio-inspired water repellent surfaces produced by ultrafast laser structuring of silicon

    International Nuclear Information System (INIS)

    Barberoglou, M.; Zorba, V.; Stratakis, E.; Spanakis, E.; Tzanetakis, P.; Anastasiadis, S.H.; Fotakis, C.

    2009-01-01

    We report here an efficient method for preparing stable superhydrophobic and highly water repellent surfaces by irradiating silicon wafers with femtosecond laser pulses and subsequently coating them with chloroalkylsilane monolayers. By varying the laser pulse fluence on the surface one can successfully control its wetting properties via a systematic and reproducible variation of roughness at micro- and nano-scale, which mimics the topology of natural superhydrophobic surfaces. The self-cleaning and water repellent properties of these artificial surfaces are investigated. It is found that the processed surfaces are among the most water repellent surfaces ever reported. These results may pave the way for the implementation of laser surface microstructuring techniques for the fabrication of superhydrophobic and self-cleaning surfaces in different kinds of materials as well

  20. Horizon effects with surface waves on moving water

    Energy Technology Data Exchange (ETDEWEB)

    Rousseaux, Germain; Maissa, Philippe; Mathis, Christian; Coullet, Pierre [Universite de Nice-Sophia Antipolis, Laboratoire J-A Dieudonne, UMR CNRS-UNS 6621, Parc Valrose, 06108 Nice Cedex 02 (France); Philbin, Thomas G; Leonhardt, Ulf, E-mail: Germain.Rousseaux@unice.f [School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews KY16 9SS (United Kingdom)

    2010-09-15

    Surface waves on a stationary flow of water are considered in a linear model that includes the surface tension of the fluid. The resulting gravity-capillary waves experience a rich array of horizon effects when propagating against the flow. In some cases, three horizons (points where the group velocity of the wave reverses) exist for waves with a single laboratory frequency. Some of these effects are familiar in fluid mechanics under the name of wave blocking, but other aspects, in particular waves with negative co-moving frequency and the Hawking effect, were overlooked until surface waves were investigated as examples of analogue gravity (Schuetzhold R and Unruh W G 2002 Phys. Rev. D 66 044019). A comprehensive presentation of the various horizon effects for gravity-capillary waves is given, with emphasis on the deep water/ short wavelength case kh>>1, where many analytical results can be derived. A similarity of the state space of the waves to that of a thermodynamic system is pointed out.

  1. Radioactivity in surface waters and its effects

    International Nuclear Information System (INIS)

    Stoeber, I.

    1987-01-01

    In consequence of the reactor accident in Chernobyl, the State Office for Water and Waste Disposal of North-Rhine Westphalia implemented immediate programmes for monitoring radioactivity in surface waters, including their sediments and organisms. Of the initially-measured radionuclides, only cesium-137, with its long half-life of 30 years, is of interest. Only trace amounts of the almost equally long-lived strontium 90 (half-life 28 years) were present in rainfall. Cs-137 is a non-natural-radionuclide, occurring solely as a by-product of nuclear installations and atomic bomb tests. Following the ban on surface testing of nuclear weapons, the Cs-137 content of surface waters had fallen significantly up to April 1986. The load due to the reactor disaster is of the same order of magnitude as that produced by atomic testing at the end of the nineteen-sixties. The paper surveys radioactive pollution of surface waters in North-Rhine Westphalia and its effects on water use, especially in regard to potable water supplies and the fish population. (orig./HSCH) [de

  2. Effects of blending of desalinated and conventionally treated surface water on iron corrosion and its release from corroding surfaces and pre-existing scales.

    Science.gov (United States)

    Liu, Haizhou; Schonberger, Kenneth D; Peng, Ching-Yu; Ferguson, John F; Desormeaux, Erik; Meyerhofer, Paul; Luckenbach, Heidi; Korshin, Gregory V

    2013-07-01

    This study examined effects of blending desalinated water with conventionally treated surface water on iron corrosion and release from corroding metal surfaces and pre-existing scales exposed to waters having varying fractions of desalinated water, alkalinities, pH values and orthophosphate levels. The presence of desalinated water resulted in markedly decreased 0.45 μm-filtered soluble iron concentrations. However, higher fractions of desalinated water in the blends were also associated with more fragile corroding surfaces, lower retention of iron oxidation products and release of larger iron particles in the bulk water. SEM, XRD and XANES data showed that in surface water, a dense layer of amorphous ferrihydrite phase predominated in the corrosion products. More crystalline surface phases developed in the presence of desalinated water. These solid phases transformed from goethite to lepidocrocite with increased fraction of desalinated water. These effects are likely to result from a combination of chemical parameters, notably variations of the concentrations of natural organic matter, calcium, chloride and sulfate when desalinated and conventionally treated waters are blended. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. The influence of lithology on surface water sources | Science ...

    Science.gov (United States)

    Understanding the temporal and spatial variability of surface water sources within a basin is vital to our ability to manage the impacts of climate variability and land cover change. Water stable isotopes can be used as a tool to determine geographic and seasonal sources of water at the basin scale. Previous studies in the Coastal Range of Oregon reported that the variation in the isotopic signatures of surface water does not conform to the commonly observed “rainout effect”, which exhibits a trend of increasing isotopic depletion with rising elevation. The primary purpose of this research is to investigate the mechanisms governing seasonal and spatial variations in the isotopic signature of surface waters within the Marys River Basin, located in the leeward side of the Oregon Coastal Range. Surface water and precipitation samples were collected every 2-3 weeks for isotopic analysis of δ18O and δ2H for one year. Results indicate a significant difference in isotopic signature between watersheds underlain by basalt and sandstone. The degree of separation was the most distinct during the summer when low flows reflect deeper groundwater sources, whereas isotopic signatures during the rainy season (fall and winter) showed a greater degree of similarity between the two lithologies. This indicates that baseflow within streams drained by sandstone versus basalt is being supplied from two distinctly separate water sources. In addition, Marys River flow at the outle

  4. Surface-Water Data, Georgia, Water Year 1999

    Science.gov (United States)

    Alhadeff, S. Jack; Landers, Mark N.; McCallum, Brian E.

    1999-01-01

    Water resources data for the 1999 water year for Georgia consists of records of stage, discharge, and water quality of streams; and the stage and contents of lakes and reservoirs published in one volume in a digital format on a CD-ROM. This volume contains discharge records of 121 gaging stations; stage for 13 gaging stations; stage and contents for 18 lakes and reservoirs; continuous water quality records for 10 stations; and the annual peak stage and annual peak discharge for 75 crest-stage partial-record stations. These data represent that part of the National Water Data System collected by the U.S. Geological Survey and cooperating State and Federal agencies in Georgia. Records of discharge and stage of streams, and contents or stage of lakes and reservoirs were first published in a series of U.S. Geological water-supply papers entitled, 'Surface-Water Supply of the United States.' Through September 30, 1960, these water-supply papers were in an annual series and then in a 5-year series for 1961-65 and 1966-70. Records of chemical quality, water temperature, and suspended sediment were published from 1941 to 1970 in an annual series of water-supply papers entitled, 'Quality of Surface Waters of the United States.' Records of ground-water levels were published from 1935 to 1974 in a series of water-supply papers entitled, 'Ground-Water Levels in the United States.' Water-supply papers may be consulted in the libraries of the principal cities in the United States or may be purchased from the U.S. Geological Survey, Branch of Information Services, Federal Center, Box 25286, Denver, CO 80225. For water years 1961 through 1970, streamflow data were released by the U.S. Geological Survey in annual reports on a State-boundary basis prior to the two 5-year series water-supply papers, which cover this period. The data contained in the water-supply papers are considered the official record. Water-quality records for water years 1964 through 1970 were similarly released

  5. Salinization and arsenic contamination of surface water in southwest Bangladesh.

    Science.gov (United States)

    Ayers, John C; George, Gregory; Fry, David; Benneyworth, Laura; Wilson, Carol; Auerbach, Leslie; Roy, Kushal; Karim, Md Rezaul; Akter, Farjana; Goodbred, Steven

    2017-09-11

    concentrations show that all surface water types lie on mixing lines between dry season tidal channel water and rainwater, i.e., all are related by varying degrees of salinization. High As concentrations in dry season tidal channel water and shrimp ponds likely result from groundwater exfiltration and upstream irrigation in the dry season. Arsenic is transferred from tidal channels to rice paddies through irrigation. Including groundwater samples from the same area (Ayers et al. in Geochem Trans 17:1-22, 2016), principal components analysis and correlation analysis reveal that salinization explains most variation in surface water compositions, whereas progressive reduction of buried surface water by dissolved organic carbon is responsible for the nonconservative behavior of S, Fe, and As and changes in Eh and alkalinity of groundwater.

  6. Lithium content in potable water, surface water, ground water, and mineral water on the territory of Republic of Macedonia

    OpenAIRE

    Kostik, Vesna; Bauer, Biljana; Kavrakovski, Zoran

    2014-01-01

    The aim of this study was to determine lithium concentration in potable water, surface water, ground, and mineral water on the territory of the Republic of Macedonia. Water samples were collected from water bodies such as multiple public water supply systems located in 13 cities, wells boreholes located in 12 areas, lakes and rivers located in three different areas. Determination of lithium concentration in potable water, surface water was performed by the technique of inductively coupl...

  7. Presence and risk assessment of pharmaceuticals in surface water and drinking water

    DEFF Research Database (Denmark)

    Sanderson, Hans

    2011-01-01

    Trace amounts of pharmaceuticals have been detected in surface waters in the nano- to microgram per liter range, and in drinking water in the nanogram/L range. The environmental risks of pharmaceuticals in surface waters have been evaluated and generally found to be low if the wastewater is treated...

  8. Water droplet evaporation from sticky superhydrophobic surfaces

    Science.gov (United States)

    Lee, Moonchan; Kim, Wuseok; Lee, Sanghee; Baek, Seunghyeon; Yong, Kijung; Jeon, Sangmin

    2017-07-01

    The evaporation dynamics of water from sticky superhydrophobic surfaces was investigated using a quartz crystal microresonator and an optical microscope. Anodic aluminum oxide (AAO) layers with different pore sizes were directly fabricated onto quartz crystal substrates and hydrophobized via chemical modification. The resulting AAO layers exhibited hydrophobic or superhydrophobic characteristics with strong adhesion to water due to the presence of sealed air pockets inside the nanopores. After placing a water droplet on the AAO membranes, variations in the resonance frequency and Q-factor were measured throughout the evaporation process, which were related to changes in mass and viscous damping, respectively. It was found that droplet evaporation from a sticky superhydrophobic surface followed a constant contact radius (CCR) mode in the early stage of evaporation and a combination of CCR and constant contact angle modes without a Cassie-Wenzel transition in the final stage. Furthermore, AAO membranes with larger pore sizes exhibited longer evaporation times, which were attributed to evaporative cooling at the droplet interface.

  9. Village-level supply reliability of surface water irrigation in rural China: effects of climate change

    Science.gov (United States)

    Li, Yanrong; Wang, Jinxia

    2018-06-01

    Surface water, as the largest part of water resources, plays an important role on China's agricultural production and food security. And surface water is vulnerable to climate change. This paper aims to examine the status of the supply reliability of surface water irrigation, and discusses how it is affected by climate change in rural China. The field data we used in this study was collected from a nine-province field survey during 2012 and 2013. Climate data are offered by China's National Meteorological Information Center which contains temperature and precipitation in the past 30 years. A Tobit model (or censored regression model) was used to estimate the influence of climate change on supply reliability of surface water irrigation. Descriptive results showed that, surface water supply reliability was 74 % in the past 3 years. Econometric results revealed that climate variables significantly influenced the supply reliability of surface water irrigation. Specifically, temperature is negatively related with the supply reliability of surface water irrigation; but precipitation positively influences the supply reliability of surface water irrigation. Besides, climate influence differs by seasons. In a word, this paper improves our understanding of the impact of climate change on agriculture irrigation and water supply reliability in the micro scale, and provides a scientific basis for relevant policy making.

  10. 40 CFR 257.3-3 - Surface water.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Surface water. 257.3-3 Section 257.3-3... and Practices § 257.3-3 Surface water. (a) For purposes of section 4004(a) of the Act, a facility... Water Act, as amended. (b) For purposes of section 4004(a) of the Act, a facility shall not cause a...

  11. Recycling of drinking water treatment residue as an additional medium in columns for effective P removal from eutrophic surface water.

    Science.gov (United States)

    Wang, Changhui; Wu, Yu; Bai, Leilei; Zhao, Yaqian; Yan, Zaisheng; Jiang, Helong; Liu, Xin

    2018-07-01

    This study assesses the feasibility of recycling drinking water treatment residue (DWTR) to treat eutrophic surface water in a one-year continuous flow column test. Heat-treated DWTR was used as an additional medium (2%-4%) in columns in case excessive organic matter and N were released from the DWTR to surface water. The results indicated that with minimal undesirable effects on other water properties, DWTR addition substantially enhanced P removal, rendering P concentrations in treated water oligotrophic and treated water unsuitable for Microcystis aeruginosa breeding. Long-term stable P removal by DWTR-column treatment was mainly attributed to the relatively low P levels in raw water (cycles and multiple pollution control (e.g., Dechloromonas, Geobacter, Leucobacter, Nitrospira, Rhodoplanes, and Sulfuritalea); an apparent decrease in Mycobacterium with potential pathogenicity was observed in DWTR-columns. Regardless, limited denitrification of DWTR-columns was observed as a result of low bioavailability of C in surface water. This finding indicates that DWTR can be used with other methods to ensure denitrification for enhanced treatment effects. Overall, the use of DWTR as an additional medium in column systems can potentially treat eutrophic surface water. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Surface water classification and monitoring using polarimetric synthetic aperture radar

    Science.gov (United States)

    Irwin, Katherine Elizabeth

    Surface water classification using synthetic aperture radar (SAR) is an established practice for monitoring flood hazards due to the high temporal and spatial resolution it provides. Surface water change is a dynamic process that varies both spatially and temporally, and can occur on various scales resulting in significant impacts on affected areas. Small-scale flooding hazards, caused by beaver dam failure, is an example of surface water change, which can impact nearby infrastructure and ecosystems. Assessing these hazards is essential to transportation and infrastructure maintenance. With current satellite missions operating in multiple polarizations, spatio-temporal resolutions, and frequencies, a comprehensive comparison between SAR products for surface water monitoring is necessary. In this thesis, surface water extent models derived from high resolution single-polarization TerraSAR-X (TSX) data, medium resolution dual-polarization TSX data and low resolution quad-polarization RADARSAT-2 (RS-2) data are compared. There exists a compromise between acquiring SAR data with a high resolution or high information content. Multi-polarization data provides additional phase and intensity information, which makes it possible to better classify areas of flooded vegetation and wetlands. These locations are often where fluctuations in surface water occur and are essential for understanding dynamic underlying processes. However, often multi-polarized data is acquired at a low resolution, which cannot image these zones effectively. High spatial resolution, single-polarization TSX data provides the best model of open water. However, these single-polarization observations have limited information content and are affected by shadow and layover errors. This often hinders the classification of other land cover types. The dual-polarization TSX data allows for the classification of flooded vegetation, but classification is less accurate compared to the quad-polarization RS-2 data

  13. Modelling global fresh surface water temperature

    NARCIS (Netherlands)

    Beek, L.P.H. van; Eikelboom, T.; Vliet, M.T.H. van; Bierkens, M.F.P.

    2011-01-01

    Temperature directly determines a range of water physical properties including vapour pressure, surface tension, density and viscosity, and the solubility of oxygen and other gases. Indirectly water temperature acts as a strong control on fresh water biogeochemistry, influencing sediment

  14. Effect of Surface-mantle Water Exchange Parameterizations on Exoplanet Ocean Depths

    Science.gov (United States)

    Komacek, Thaddeus D.; Abbot, Dorian S.

    2016-11-01

    Terrestrial exoplanets in the canonical habitable zone may have a variety of initial water fractions due to random volatile delivery by planetesimals. If the total planetary water complement is high, the entire surface may be covered in water, forming a “waterworld.” On a planet with active tectonics, competing mechanisms act to regulate the abundance of water on the surface by determining the partitioning of water between interior and surface. Here we explore how the incorporation of different mechanisms for the degassing and regassing of water changes the volatile evolution of a planet. For all of the models considered, volatile cycling reaches an approximate steady state after ∼ 2 {Gyr}. Using these steady states, we find that if volatile cycling is either solely dependent on temperature or seafloor pressure, exoplanets require a high abundance (≳ 0.3 % of total mass) of water to have fully inundated surfaces. However, if degassing is more dependent on seafloor pressure and regassing mainly dependent on mantle temperature, the degassing rate is relatively large at late times and a steady state between degassing and regassing is reached with a substantial surface water fraction. If this hybrid model is physical, super-Earths with a total water fraction similar to that of the Earth can become waterworlds. As a result, further understanding of the processes that drive volatile cycling on terrestrial planets is needed to determine the water fraction at which they are likely to become waterworlds.

  15. An Ontology Design Pattern for Surface Water Features

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, Gaurav [Ohio University; Mark, David [University at Buffalo (SUNY); Kolas, Dave [Raytheon BBN Technologies; Varanka, Dalia [U.S. Geological Survey, Rolla, MO; Romero, Boleslo E [University of California, Santa Barbara; Feng, Chen-Chieh [National University of Singapore; Usery, Lynn [U.S. Geological Survey, Rolla, MO; Liebermann, Joshua [Tumbling Walls, LLC; Sorokine, Alexandre [ORNL

    2014-01-01

    Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities can be found due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology. It can then be used to systematically incor-porate concepts that are specific to a culture, language, or scientific domain. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex surface water ontologies. A fundamental distinction is made in this on-tology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is imple-mented in OWL, but Description Logic axioms and a detailed explanation is provided. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. A discussion about why there is a need to complement the pattern with other ontologies, es-pecially the previously developed Surface Network pattern is also provided. Fi-nally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through a few queries and annotated geospatial datasets.

  16. Surface water and atmospheric carbon dioxide and nitrous oxide observations by shipboard automated gas chromatography: Results from expeditions between 1977 and 1990

    International Nuclear Information System (INIS)

    Weiss, R.F.; Van Woy, F.A.; Salameh, P.K.; Sepanski, R.J.

    1992-12-01

    This document presents the results of surface water and atmospheric carbon dioxide (CO 2 ) and nitrous oxide (N 2 O) measurements carried out by shipboard gas chromatography over the period 1977--1990. These data include results from 11 different oceanic surveys for a total of 41 expedition legs. Collectively, they represent a globally distributed sampling that includes locations in the Atlantic, Pacific, Indian, and Southern Oceans, as well as the Mediterranean and Red Seas. The measurements were made by an automated high-precision shipboard gas chromatographic system developed during the late 1970s and used extensively over the intervening years. This instrument measures CO 2 by flame ionization after quantitative reaction to methane in a stream of hydrogen. Nitrous oxide is measured by a separate electron capture detector. The chromatographic system measures 196 dry-gas samples a day, divided equally among the atmosphere, gas equilibrated with surface water, a low-range gas standard, and a high-range gas standard

  17. Surface-Water Conditions in Georgia, Water Year 2005

    Science.gov (United States)

    Painter, Jaime A.; Landers, Mark N.

    2007-01-01

    INTRODUCTION The U.S. Geological Survey (USGS) Georgia Water Science Center-in cooperation with Federal, State, and local agencies-collected surface-water streamflow, water-quality, and ecological data during the 2005 Water Year (October 1, 2004-September 30, 2005). These data were compiled into layers of an interactive ArcReaderTM published map document (pmf). ArcReaderTM is a product of Environmental Systems Research Institute, Inc (ESRI?). Datasets represented on the interactive map are * continuous daily mean streamflow * continuous daily mean water levels * continuous daily total precipitation * continuous daily water quality (water temperature, specific conductance dissolved oxygen, pH, and turbidity) * noncontinuous peak streamflow * miscellaneous streamflow measurements * lake or reservoir elevation * periodic surface-water quality * periodic ecological data * historical continuous daily mean streamflow discontinued prior to the 2005 water year The map interface provides the ability to identify a station in spatial reference to the political boundaries of the State of Georgia and other features-such as major streams, major roads, and other collection stations. Each station is hyperlinked to a station summary showing seasonal and annual stream characteristics for the current year and for the period of record. For continuous discharge stations, the station summary includes a one page graphical summary page containing five graphs, a station map, and a photograph of the station. The graphs provide a quick overview of the current and period-of-record hydrologic conditions of the station by providing a daily mean discharge graph for the water year, monthly statistics graph for the water year and period of record, an annual mean streamflow graph for the period of record, an annual minimum 7-day average streamflow graph for the period of record, and an annual peak streamflow graph for the period of record. Additionally, data can be accessed through the layer's link

  18. Numerical Simulation of the Effects of Water Surface in Building Environment

    Science.gov (United States)

    Li, Guangyao; Pan, Yuqing; Yang, Li

    2018-03-01

    Water body could affect the thermal environment and airflow field in the building districts, because of its special thermal characteristics, evaporation and flat surface. The thermal influence of water body in Tongji University Jiading Campus front area was evaluated. First, a suitable evaporation model was selected and then was applied to calculate the boundary conditions of the water surface in the Fluent software. Next, the computational fluid dynamics (CFD) simulations were conducted on the models both with and without water, following the CFD practices guidelines. Finally, the outputs of the two simulations were compared with each other. Results showed that the effect of evaporative cooling from water surface strongly depends on the wind direction and temperature decrease was about 2∼5°C. The relative humidity within the enclosing area was affected by both the building arrangement and surrounding water. An increase of about 0.1∼0.2m/s of wind speed induced by the water evaporation was observed in the open space.

  19. Emissivity Measurements of Foam-Covered Water Surface at L-Band for Low Water Temperatures

    Directory of Open Access Journals (Sweden)

    En-Bo Wei

    2014-11-01

    Full Text Available For a foam-covered sea surface, it is difficult to retrieve sea surface salinity (SSS with L-band brightness temperature (1.4 GHz because of the effect of a foam layer with wind speeds stronger than 7 m/s, especially at low sea surface temperature (SST. With foam-controlled experiments, emissivities of a foam-covered water surface at low SST (−1.4 °C to 1.7 °C are measured for varying SSS, foam thickness, incidence angle, and polarization. Furthermore, a theoretical model of emissivity is introduced by combining wave approach theory with the effective medium approximation method. Good agreement is obtained upon comparing theoretical emissivities with those of experiments. The results indicate that foam parameters have a strong influence on increasing emissivity of a foam-covered water surface. Increments of experimental emissivities caused by foam thickness of 1 cm increase from about 0.014 to 0.131 for horizontal polarization and 0.022 to 0.150 for vertical polarization with SSS increase and SST decrease. Contributions of the interface between the foam layer and water surface to the foam layer emissivity increments are discussed for frequencies between 1 and 37 GHz.

  20. Surface Water Connectivity, Flow Pathways and Water Level Fluctuation in a Cold Region Deltaic Ecosystem

    Science.gov (United States)

    Peters, D. L.; Niemann, O.; Skelly, R.; Monk, W. A.; Baird, D. J.

    2017-12-01

    The Peace-Athabasca Delta (PAD) is a 6000 km2 deltaic floodplain ecosystem of international importance (Wood Buffalo National Park, Ramsar Convention, UNESCO World Heritage, and SWOT satellite water level calibration/validation site). The low-relief floodplain formed at the confluence of the Peace, Athabasca and Birch rivers with Lake Athabasca. More than 1000 wetland and lake basins have varying degrees of connectivity to the main flow system. Hydroperiod and water storage is influenced by ice-jam and open-water inundations and prevailing semi-arid climate that control water drawdown. Prior studies have identified pathways of river-to-wetland floodwater connection and historical water level fluctuation/trends as a key knowledge gaps, limiting our knowledge of deltaic ecosystem status and potential hydroecological responses to climate change and upstream water alterations to flow contributions. To address this knowledge gap, surface elevation mapping of the PAD has been conducted since 2012 using aerial remote sensing Light Detection and Ranging (LiDAR), plus thousands of ground based surface and bathymetric survey points tied to Global Positioning System (GPS) were obtained. The elevation information was used to develop a high resolution digital terrain model to simulate and investigate surface water connectivity. Importantly, the surveyed areas contain a set of wetland monitoring sites where ground-based surface water connectivity, water level/depth, water quality, and aquatic ecology (eg, vegetation, macroinvertebrate and muskrat) have been examined. The goal of this presentation is to present an assessment of: i) surface water fluctuation and connectivity for PAD wetland sites; ii) 40+ year inter-annual hydroperiod reconstruction for a perched basin using a combination of field measurements, remote sensing estimates, and historical documents; and iii) outline an approach to integrate newly available hydro-bio-geophysical information into a novel, multi

  1. Transport and transformation of surface water masses across the ...

    African Journals Online (AJOL)

    Transport and transformation of surface water masses across the Mascarene Plateau during the Northeast Monsoon season. ... Mixing occurs in the central gap between intermediate water masses (Red Sea Water [RSW] and Antarctic Intermediate Water [AAIW]) as well as in the upper waters (Subtropical Surface Water ...

  2. Molecular insight into nanoscale water films dewetting on modified silica surfaces.

    Science.gov (United States)

    Zhang, Jun; Li, Wen; Yan, Youguo; Wang, Yefei; Liu, Bing; Shen, Yue; Chen, Haixiang; Liu, Liang

    2015-01-07

    In this work, molecular dynamics simulations are adopted to investigate the microscopic dewetting mechanism of nanoscale water films on methylated silica surfaces. The simulation results show that the dewetting process is divided into two stages: the appearance of dry patches and the quick contraction of the water film. First, the appearance of dry patches is due to the fluctuation in the film thickness originating from capillary wave instability. Second, for the fast contraction of water film, the unsaturated electrostatic and hydrogen bond interactions among water molecules are the driving forces, which induce the quick contraction of the water film. Finally, the effect of film thickness on water films dewetting is studied. Research results suggest that upon increasing the water film thickness from 6 to 8 Å, the final dewetting patterns experience separate droplets and striation-shaped structures, respectively. But upon further increasing the water film thickness, the water film is stable and there are no dry patches. The microscopic dewetting behaviors of water films on methylated silica surfaces discussed here are helpful in understanding many phenomena in scientific and industrial processes better.

  3. Surface water quality assessment using factor analysis

    African Journals Online (AJOL)

    2006-01-16

    Jan 16, 2006 ... Surface water, groundwater quality assessment and environ- .... Urbanisation influences the water cycle through changes in flow and water ..... tion of aquatic life, CCME water quality Index 1, 0. User`s ... Water, Air Soil Pollut.

  4. Surface-water, water-quality, and ground-water assessment of the Municipio of Carolina, Puerto Rico, 1997-99

    Science.gov (United States)

    Rodríguez-Martínez, Jesús; Gómez-Gómez, Fernando; Santiago-Rivera, Luis; Oliveras-Feliciano, M. L.

    2001-01-01

    To meet the increasing need for a safe and adequate supply of water in the municipio of Carolina, an integrated surface-water, water-quality, and ground-water assessment of the area was conducted. The major results of this study and other important hydrologic and water-quality features were compiled in a Geographic Information System and are presented in two 1:30,000-scale map plates to facilitate interpretation and use of the diverse water-resources data. Because the supply of safe drinking water was a critical issue during recent dry periods, the surface-water assessment portion of this study focused on analysis of low-flow characteristics in local streams and rivers. Low-flow characteristics were evaluated for one continuous-record gaging station, based on graphical curve-fitting techniques and log-Pearson Type III frequency analysis. Estimates of low-flow characteristics for seven partial-record stations were generated using graphical-correlation techniques. Flow-duration characteristics were computed for the one continuous-record gaging station and were estimated for the partial-record stations using the relation curves developed from the low-flow study. Stream low-flow statistics document the general hydrology under current land and water use. Low-flow statistics may substantially change as a result of streamflow diversions for public supply, and an increase in ground-water development, waste-water discharges, and flood-control measures; the current analysis provides baseline information to evaluate these impacts and develop water budgets. A sanitary quality survey of streams utilized 29 sampling stations to evaluate the sanitary quality of about 87 miles of stream channels. River and stream samples were collected on two occasions during base-flow conditions and were analyzed for fecal coliform and fecal streptococcus. Bacteriological analyses indicate that a significant portion of the stream reaches within the municipio of Carolina may have fecal coliform

  5. Impinging Water Droplets on Inclined Glass Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Armijo, Kenneth Miguel [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lance, Blake [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ho, Clifford K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-09-01

    Multiphase computational models and tests of falling water droplets on inclined glass surfaces were developed to investigate the physics of impingement and potential of these droplets to self-clean glass surfaces for photovoltaic modules and heliostats. A multiphase volume-of-fluid model was developed in ANSYS Fluent to simulate the impinging droplets. The simulations considered different droplet sizes (1 mm and 3 mm), tilt angles (0°, 10°, and 45°), droplet velocities (1 m/s and 3 m/s), and wetting characteristics (wetting=47° contact angle and non-wetting = 93° contact angle). Results showed that the spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) decreased with increasing inclination angle due to the reduced normal force on the surface. The hydrophilic surface yielded greater spread factors than the hydrophobic surface in all cases. With regard to impact forces, the greater surface tilt angles yielded lower normal forces, but higher shear forces. Experiments showed that the experimentally observed spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) was significantly larger than the simulated spread factor. Observed spread factors were on the order of 5 - 6 for droplet velocities of ~3 m/s, whereas the simulated spread factors were on the order of 2. Droplets were observed to be mobile following impact only for the cases with 45° tilt angle, which matched the simulations. An interesting phenomenon that was observed was that shortly after being released from the nozzle, the water droplet oscillated (like a trampoline) due to the "snapback" caused by the surface tension of the water droplet being released from the nozzle. This oscillation impacted the velocity immediately after the release. Future work should evaluate the impact of parameters such as tilt angle and surface wettability on the impact of particle/soiling uptake and removal to investigate ways that

  6. Radionuclide transfer onto ground surface in surface water flow. 2. Undisturbed tuff rock

    International Nuclear Information System (INIS)

    Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu

    1994-09-01

    Radionuclide migration with ground surface water flow is considered to be one of path ways in the scenario for environmental migration of the radionuclide leaked from LLRW depository. To study the radionuclide migration demonstratively, a ground surface radionuclide migration test was carried out by simulating radioactive solution flowing on the sloped tuff rock surface. Tuff rock sample of 240 cm in length taken from the Shimokita district was used to test the transfer of 60 Co, 85 Sr and 137 Cs onto the sample surface from the flowing radioactive solution under restricted infiltration condition at flow rates of 25, 80, 160ml/min and duration of 56h. The concentration change of the radionuclides in effluent was nearly constant as a function of elapsed time during the experimental period, but decreased with lower flow rates. Among the three radionuclides, 137 Cs was greatly decreased its concentration to 30% of the inflow. Adsorbed distribution of the radionuclides concentration on the ground surface decreased gradually with the distance from the inlet, and showed greater gradient at lower flow rate. Analyzing the result by the migration model, where a vertical advection distribution and two-dimensional diffusion in surface water are adopted with a first order adsorption reaction, value of migration parameters was obtained relating to the radionuclide adsorption and the surface water flow, and the measured distribution could be well simulated by adopting the value to the model. By comparing the values with the case of loamy soil layer, all values of the migration parameters showed not so great difference between two samples for 60 Co and 85 Sr. For 137 Cs, reflecting a few larger value of adsorption to the tuff rock, larger ability to reduce the concentration of flowing radioactive solution could be indicated than that to the loamy soil surface by estimation for long flowed distance. (author)

  7. Surface properties and water treatment capacity of surface engineered silica coated with 3-(2-aminoethyl) aminopropyltrimethoxysilane

    Energy Technology Data Exchange (ETDEWEB)

    Majewski, Peter, E-mail: peter.majewski@unisa.edu.au [School of Advanced Manufacturing and Mechanical Engineering, Mawson Institute, University of South Australia, Adelaide (Australia); Keegan, Alexandra [Microbiology Research, Australian Water Quality Centre, South Australian Water Corporation, Adelaide (Australia)

    2012-01-15

    This study's focus was on the water-based, one-pot preparation and characterisation of silica particles coated with 3-(2-aminoethyl)aminopropyltrimethoxysilane (Diamo) and the efficiency of the material in removing the pathogens Escherichia coli, Pseudomonas aeruginosa, Mycobacterium immunogenum, Vibrio cholerae, poliovirus, and Cryptosporidium parvum. The water-based processing resulted in Diamo coated silica particles with significantly increased positive surface charge as determined by zeta potential measurements. In addition, X-ray photoelectron spectrometry of pure and Diamo coated silica confirmed the presence of Diamo on the surface of the particles. Thermogravimetric measurements and chemical analysis of the silica indicated a surface concentration of amine groups of about 1 mmol/g{sub silica}. Water treatment tests with the pathogens showed that a dose of about 10 g appeared to be sufficient to remove pathogens from pure water samples which were spiked with pathogen concentrations between about 10{sup 2} and 10{sup 4} cfu/mL.

  8. Surface properties and water treatment capacity of surface engineered silica coated with 3-(2-aminoethyl) aminopropyltrimethoxysilane

    International Nuclear Information System (INIS)

    Majewski, Peter; Keegan, Alexandra

    2012-01-01

    This study's focus was on the water-based, one-pot preparation and characterisation of silica particles coated with 3-(2-aminoethyl)aminopropyltrimethoxysilane (Diamo) and the efficiency of the material in removing the pathogens Escherichia coli, Pseudomonas aeruginosa, Mycobacterium immunogenum, Vibrio cholerae, poliovirus, and Cryptosporidium parvum. The water-based processing resulted in Diamo coated silica particles with significantly increased positive surface charge as determined by zeta potential measurements. In addition, X-ray photoelectron spectrometry of pure and Diamo coated silica confirmed the presence of Diamo on the surface of the particles. Thermogravimetric measurements and chemical analysis of the silica indicated a surface concentration of amine groups of about 1 mmol/g silica . Water treatment tests with the pathogens showed that a dose of about 10 g appeared to be sufficient to remove pathogens from pure water samples which were spiked with pathogen concentrations between about 10 2 and 10 4 cfu/mL.

  9. Rapid surface-water volume estimations in beaver ponds

    Science.gov (United States)

    Karran, Daniel J.; Westbrook, Cherie J.; Wheaton, Joseph M.; Johnston, Carol A.; Bedard-Haughn, Angela

    2017-02-01

    Beaver ponds are surface-water features that are transient through space and time. Such qualities complicate the inclusion of beaver ponds in local and regional water balances, and in hydrological models, as reliable estimates of surface-water storage are difficult to acquire without time- and labour-intensive topographic surveys. A simpler approach to overcome this challenge is needed, given the abundance of the beaver ponds in North America, Eurasia, and southern South America. We investigated whether simple morphometric characteristics derived from readily available aerial imagery or quickly measured field attributes of beaver ponds can be used to approximate surface-water storage among the range of environmental settings in which beaver ponds are found. Studied were a total of 40 beaver ponds from four different sites in North and South America. The simplified volume-area-depth (V-A-h) approach, originally developed for prairie potholes, was tested. With only two measurements of pond depth and corresponding surface area, this method estimated surface-water storage in beaver ponds within 5 % on average. Beaver pond morphometry was characterized by a median basin coefficient of 0.91, and dam length and pond surface area were strongly correlated with beaver pond storage capacity, regardless of geographic setting. These attributes provide a means for coarsely estimating surface-water storage capacity in beaver ponds. Overall, this research demonstrates that reliable estimates of surface-water storage in beaver ponds only requires simple measurements derived from aerial imagery and/or brief visits to the field. Future research efforts should be directed at incorporating these simple methods into both broader beaver-related tools and catchment-scale hydrological models.

  10. Biphilic Surfaces for Enhanced Water Collection from Humid Air

    Science.gov (United States)

    Benkoski, Jason; Gerasopoulos, Konstantinos; Luedeman, William

    Surface wettability plays an important role in water recovery, distillation, dehumidification, and heat transfer. The efficiency of each process depends on the rate of droplet nucleation, droplet growth, and mass transfer. Unfortunately, hydrophilic surfaces are good at nucleation but poor at shedding. Hydrophobic surfaces are the reverse. Many plants and animals overcome this tradeoff through biphilic surfaces with patterned wettability. For example, the Stenocara beetle uses hydrophilic patches on a superhydrophobic background to collect fog from air. Cribellate spiders similarly collect fog on their webs through periodic spindle-knot structures. In this study, we investigate the effects of wettability patterns on the rate of water collection from humid air. The steady state rate of water collection per unit area is measured as a function of undercooling, angle of inclination, water contact angle, hydrophilic patch size, patch spacing, area fraction, and patch height relative to the hydrophobic background. We then model each pattern by comparing the potential and kinetic energy of a droplet as it rolls downwards at a fixed angle. The results indicate that the design rules for collecting fog differ from those for condensation from humid air. The authors gratefully acknowledge the Office of Naval Research for financial support through Grant Number N00014-15-1-2107.

  11. Water structure and aqueous uranyl(VI) adsorption equilibria onto external surfaces of beidellite, montmorillonite, and pyrophyllite: results from molecular simulations.

    Science.gov (United States)

    Greathouse, Jeffery A; Cygan, Randall T

    2006-06-15

    Molecular dynamics simulations were performed to provide a systematic study of aqueous uranyl adsorption onto the external surface of 2:1 dioctahedral clays. Our understanding of this key process is critical in predicting the fate of radioactive contaminants in natural groundwaters. These simulations provide atomistic detail to help explain experimental trends in uranyl adsorption onto natural media containing smectite clays. Aqueous uranyl concentrations ranged from 0.027 to 0.162 M. Sodium ions and carbonate ions (0.027-0.243 M) were also present in the aqueous regions to more faithfully model a stream of uranyl-containing groundwater contacting a mineral system comprised of Na-smectite. No adsorption occurred near the pyrophyllite surface, and there was little difference in uranyl adsorption onto the beidellite and montmorillonite, despite the difference in location of clay layer charge between the two. At low uranyl concentration, the pentaaquouranyl complex dominates in solution and readily adsorbs to the clay basal plane. At higher uranyl (and carbonate) concentrations, the mono(carbonato) complex forms in solution, and uranyl adsorption decreases. Sodium adsorption onto beidellite occurred both as inner- and outer-sphere surface complexes, again with little effect on uranyl adsorption. Uranyl surface complexes consisted primarily of the pentaaquo cation (85%) and to a lesser extent the mono(carbonato) species (15%). Speciation diagrams of the aqueous region indicate that the mono(carbonato)uranyl complex is abundant at high ionic strength. Oligomeric uranyl complexes are observed at high ionic strength, particularly near the pyrophyllite and montmorillonite surfaces. Atomic density profiles of water oxygen and hydrogen atoms are nearly identical near the beidellite and montmorillonite surfaces. Water structure therefore appears to be governed by the presence of adsorbed ions and not by the location of layer charge associated with the substrate. The water

  12. Simulation of the Regional Ground-Water-Flow System and Ground-Water/Surface-Water Interaction in the Rock River Basin, Wisconsin

    Science.gov (United States)

    Juckem, Paul F.

    2009-01-01

    , the model routes tributary base flow through the river network to the Rock River. The parameter-estimation code PEST was linked to the GFLOW model to select the combination of parameter values best able to match more than 8,000 water-level measurements and base-flow estimates at 9 streamgages. Results from the calibrated GFLOW model show simulated (1) ground-water-flow directions, (2) ground-water/surface-water interactions, as depicted in a map of gaining and losing river and lake sections, (3) ground-water contributing areas for selected tributary rivers, and (4) areas of relatively local ground water captured by rivers. Ground-water flow patterns are controlled primarily by river geometries, with most river sections gaining water from the ground-water-flow system; losing sections are most common on the downgradient shore of lakes and reservoirs or near major pumping centers. Ground-water contributing areas to tributary rivers generally coincide with surface watersheds; however the locations of ground-water divides are controlled by the water table, whereas surface-water divides are controlled by surface topography. Finally, areas of relatively local ground water captured by rivers generally extend upgradient from rivers but are modified by the regional flow pattern, such that these areas tend to shift toward regional ground-water divides for relatively small rivers. It is important to recognize the limitations of this regional-scale model. Heterogeneities in subsurface properties and in recharge rates are considered only at a very broad scale (miles to tens of miles). No account is taken of vertical variations in properties or pumping rates, and no provision is made to account for stacked ground-water-flow systems that have different flow patterns at different depths. Small-scale flow systems (hundreds to thousands of feet) associated with minor water bodies are not considered; as a result, the model is not currently designed for simulating site-specifi

  13. Using IR Imaging of Water Surfaces for Estimating Piston Velocities

    Science.gov (United States)

    Gålfalk, M.; Bastviken, D.; Arneborg, L.

    2013-12-01

    The transport of gasses dissolved in surface waters across the water-atmosphere interface is controlled by the piston velocity (k). This coefficient has large implications for, e.g., greenhouse gas fluxes but is challenging to quantify in situ. At present, empirical k-wind speed relationships from a small number of studies and systems are often extrapolated without knowledge of model performance. It is therefore of interest to search for new methods for estimating k, and to compare the pros and cons of existing and new methods. Wind speeds in such models are often measured at a height of 10 meters. In smaller bodies of water such as lakes, wind speeds can vary dramatically across the surface through varying degrees of wind shadow from e.g. trees at the shoreline. More local measurements of the water surface, through wave heights or surface motion mapping, could give improved k-estimates over a surface, also taking into account wind fetch. At thermal infrared (IR) wavelengths water has very low reflectivity (depending on viewing angle) than can go below 1%, meaning that more than 99% is heat radiation giving a direct measurement of surface temperature variations. Using an IR camera at about 100 frames/s one could map surface temperature structures at a fraction of a mm depth even with waves present. In this presentation I will focus on IR imaging as a possible tool for estimating piston velocities. Results will be presented from IR field measurements, relating the motions of surface temperature structures to k calculated from other simultaneous measurements (flux chamber and ADV-Based Dissipation Rate), but also attempting to calculate k directly from the IR surface divergence. A relation between wave height and k will also be presented.

  14. Shale gas development impacts on surface water quality in Pennsylvania

    Science.gov (United States)

    Olmstead, Sheila M.; Muehlenbachs, Lucija A.; Shih, Jhih-Shyang; Chu, Ziyan; Krupnick, Alan J.

    2013-01-01

    Concern has been raised in the scientific literature about the environmental implications of extracting natural gas from deep shale formations, and published studies suggest that shale gas development may affect local groundwater quality. The potential for surface water quality degradation has been discussed in prior work, although no empirical analysis of this issue has been published. The potential for large-scale surface water quality degradation has affected regulatory approaches to shale gas development in some US states, despite the dearth of evidence. This paper conducts a large-scale examination of the extent to which shale gas development activities affect surface water quality. Focusing on the Marcellus Shale in Pennsylvania, we estimate the effect of shale gas wells and the release of treated shale gas waste by permitted treatment facilities on observed downstream concentrations of chloride (Cl−) and total suspended solids (TSS), controlling for other factors. Results suggest that (i) the treatment of shale gas waste by treatment plants in a watershed raises downstream Cl− concentrations but not TSS concentrations, and (ii) the presence of shale gas wells in a watershed raises downstream TSS concentrations but not Cl− concentrations. These results can inform future voluntary measures taken by shale gas operators and policy approaches taken by regulators to protect surface water quality as the scale of this economically important activity increases. PMID:23479604

  15. Tracing transfer processes of metal pollutants from soils to surface water using environmental magnetic techniques - results from Paris suburbia (France)

    Science.gov (United States)

    Franke, Christine; Lamy, Isabelle; van Oort, Folkert; Thiesson, Julien; Barsalini, Luca

    2015-04-01

    Major river systems in Europe are potential sinks for environmental pollutions and therefore reflect the consequences of European industrialization and urbanization. Surface water pollution is a major concern for the health of the population and its related ecosystems as well as for the water quality. Within the variety of different typical pollutants in a river watershed, the metallic fraction embraces many toxic/dangerous contaminants. Each of these elements comprises different sources and follows specific processes throughout its pathways from its origin to and within the river system. But the detection, estimation and follow up of the different contaminants is highly complex. Physico-chemical techniques such as environmental and rock magnetics are powerful complementary tools to traditional methods because they comprise the possibility to trace the entire metal fraction and do offer the possibility to perform spatio-temporal analyze campaigns directly in the field and on a relative high number of samples from both the river and the adjacent areas (suspended particular matter, soils, dust, sediments, etc). In this study, we took advantages of the recent results on the Seine river (France) that have shown the high potential of environmental magnetic methods to estimate the metal fraction in suspended particular matter samples, and to allow the discrimination of its natural detrital, biogenic or anthropogenic origin (see parallel EGU abstract of Kayvantash et al. in this session). We focused on a suburban agricultural area west of Paris (Pierrelaye-Bessancourt) adjacent to the Seine river, which suffers from a high accumulation of heavy metal pollutants caused by long-term historical irrigation with urban waste waters. For the time being, these heavy metals seem to be geochemically fixed in the surface layer mainly by the soil organic matter. Future land use planning, however, arises questions on the fate of these pollutants and their potential remobilization by

  16. Deuterium content on surface waters VI to X Chile regions

    International Nuclear Information System (INIS)

    Aravena C, R; Pollastri J, A.; Suzuki S, O.

    1984-01-01

    One important parameter on any sitting study for a heavy water plant installation is the deuterium content of the feed water. Deuterium data on surface waters from differents areas located in the south of Chile, are presented. These results allow to idently some potential areas for a future heavy water plant. One of these areas, Lago Llanquihue, was sampled more in detail to study the vertical distribution and spatial variations. (Author)

  17. A review of diazinon use, contamination in surface waters, and regulatory actions in California across water years 1992-2014.

    Science.gov (United States)

    Wang, Dan; Singhasemanon, Nan; Goh, Kean S

    2017-07-01

    Diazinon is an organophosphorus insecticide that has been widely used in the USA and in California resulting in contamination of surface waters. Several federal and state regulations have been implemented with the aim of reducing its impact to human health and the environment, e.g., the cancellation of residential use products by the USEPA and dormant spray regulations by the California Department of Pesticide Regulation. This study reviewed the change in diazinon use and surface water contamination in accordance with the regulatory actions implemented in California over water years 1992-2014. We observed that use amounts began declining when agencies announced the intention to regulate certain use patterns and continued to decline after the implementation of those programs and regulations. The reduction in use amounts led to a downward trend in concentration data and exceedance frequencies in surface waters. Moreover, we concluded that diazinon concentrations in California's surface waters in recent years (i.e., water years 2012-2014) posed a de minimis risk to aquatic organisms.

  18. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  19. Interaction of ethanol and water with the {1014} surface of calcite

    DEFF Research Database (Denmark)

    Cooke, David; Gray, R J; Sand, K K

    2010-01-01

    Molecular dynamics simulations have been used to model the interaction between ethanol, water, and the {1014} surface of calcite. Our results demonstrate that a single ethanol molecule is able to form two interactions with the mineral surface (both Ca-O and O-H), resulting in a highly ordered, st...

  20. Environmetric data interpretation to assess surface water quality

    International Nuclear Information System (INIS)

    Simeonova, P.; Papazova, P.; Lovchinov, V.

    2013-01-01

    Two multivariate statistical methods (Cluster analysis /CA/ and Principal components analysis /PCA/) were applied for model assessment of the water quality of Maritsa River and Tundja River on Bulgarian territory. The study used long-term monitoring data from many sampling sites characterized by various surface water quality indicators. The application of CA to the indicators results in formation of clusters showing the impact of biological, anthropogenic and eutrophication sources. For further assessment of the monitoring data, PCA was implemented, which identified, again, latent factors confirming, in principle, the clustering output. Their identification coincide correctly to the location of real pollution sources along the rivers catchments. The linkage of the sampling sites along the river flow by CA identified several special patterns separated by specific tracers levels. The apportionment models of the pollution determined the contribution of each one of identified pollution factors to the total concentration of each one of the water quality parameters. Thus, a better risk management of the surface water quality is achieved both on local and national level

  1. Rectification of Image Velocity Results (RIVeR): A simple and user-friendly toolbox for large scale water surface Particle Image Velocimetry (PIV) and Particle Tracking Velocimetry (PTV)

    Science.gov (United States)

    Patalano, Antoine; García, Carlos Marcelo; Rodríguez, Andrés

    2017-12-01

    LSPIV (Large Scale Particle Image Velocimetry) and LSPTV (Large Scale Particle Tracking Velocimetry) are used as relatively low-cost and non-intrusive techniques for water-surface velocity analysis and flow discharge measurements in rivers or large-scale hydraulic models. This paper describes a methodology based on state-of-the-art tools (for example, that apply classical PIV/PTV analysis) resulting in large-scale surface-flow characterization according to the first operational version of the RIVeR (Rectification of Image Velocity Results). RIVeR is developed in Matlab and is designed to be user-friendly. RIVeR processes large-scale water-surface characterization such as velocity fields or individual trajectories of floating tracers. This work describes the wide range of application of the techniques for comparing measured surface flows in hydraulic physical models to flow discharge estimates for a wide range of flow events in rivers (for example, low and high flows).

  2. Water Entry and Exit of Horizontal Cylinder in Free Surface Flow

    International Nuclear Information System (INIS)

    Hafsia, Zouhaier; Maalel, Khlifa; Mnasri, Chokri; Mohamed, Omri

    2009-01-01

    This paper describes two-dimensional numerical simulations of the water entry and exit of horizontal circular cylinder at constant velocity. The deformation of free surface is described by Navier-Stokes (N S) equations of incompressible and viscous fluid with additional transport equation of the volume-of-fluid (VOF). The motion of the cylinder is modeled by the associated momentum source term implemented in the Phoenicis (Parabolic Hyperbolic Or Elliptic Numerical Integration Code Series) code. The domain is discretized by a fixed Cartesian grid using a finite volume method and the cylinder is represented and cut cell method. The simulated results are compared with the numerical results of Lin (2007). This comparison shows good agreement in terms of free surface evolution for water exit and sinking. However, for water entry, the jet flow simulated by Lin is not reproduced. The free surface deformation around the cylinder in downward direction is accurately predicted

  3. Ions, metabolites, and cells: Water as a reporter of surface conditions during bacterial growth

    Science.gov (United States)

    Jarisz, Tasha A.; Lane, Sarah; Gozdzialski, Lea; Hore, Dennis K.

    2018-06-01

    Surface-specific nonlinear vibrational spectroscopy, combined with bulk solution measurements and imaging, is used to study the surface conditions during the growth of E. coli. As a result of the silica high surface charge density, the water structure at the silica-aqueous interface is known to be especially sensitive to pH and ionic strength, and surface concentration profiles develop that can be appreciably different from the bulk solution conditions. We illustrate that, in the presence of growing cells, a unique surface micro-environment is established as a result of metabolites accumulating on the silica surface. Even in the subsequent absence of the cells, this surface layer works to reduce the interfacial ionic strength as revealed by the enhanced signal from surface water molecules. In the presence of growing cells, an additional boost in surface water signal is attributed to a local pH that is higher than that of the bulk solution.

  4. Characterizing water-metal interfaces and machine learning potential energy surfaces

    Science.gov (United States)

    Ryczko, Kevin

    In this thesis, we first discuss the fundamentals of ab initio electronic structure theory and density functional theory (DFT). We also discuss statistics related to computing thermodynamic averages of molecular dynamics (MD). We then use this theory to analyze and compare the structural, dynamical, and electronic properties of liquid water next to prototypical metals including platinum, graphite, and graphene. Our results are built on Born-Oppenheimer molecular dynamics (BOMD) generated using density functional theory (DFT) which explicitly include van der Waals (vdW) interactions within a first principles approach. All calculations reported use large simulation cells, allowing for an accurate treatment of the water-electrode interfaces. We have included vdW interactions through the use of the optB86b-vdW exchange correlation functional. Comparisons with the Perdew-Burke-Ernzerhof (PBE) exchange correlation functional are also shown. We find an initial peak, due to chemisorption, in the density profile of the liquid water-Pt interface not seen in the liquid water-graphite interface, liquid watergraphene interface, nor interfaces studied previously. To further investigate this chemisorption peak, we also report differences in the electronic structure of single water molecules on both Pt and graphite surfaces. We find that a covalent bond forms between the single water molecule and the platinum surface, but not between the single water molecule and the graphite surface. We also discuss the effects that defects and dopants in the graphite and graphene surfaces have on the structure and dynamics of liquid water. Lastly, we introduce artificial neural networks (ANNs), and demonstrate how they can be used to machine learn electronic structure calculations. As a proof of principle, we show the success of an ANN potential energy surfaces for a dimer molecule with a Lennard-Jones potential.

  5. Studies on the treatment of surface water using rajma seeds

    Directory of Open Access Journals (Sweden)

    Merlin S. Babitha

    2018-03-01

    Full Text Available Indiscriminate disposal of wastewater with suspended solids have led to higher amount of pollution to the natural water bodies. Turbidity removal becomes an essential part in the water treatment when surface water is used for drinking purpose, this can be achieved by means of coagulation process. Coagulation process is the dosing of a coagulant in water, resulting in the destabilization of negatively charged particles. Commercial coagulants which were widely used can synthesize by-products in turn may pollute the environment and deteriorate the ecosystem at a slow rate. So, now-a-days natural coagulants are used as a potential substitute because it’s biodegradable, ecofriendly and non-toxic. In this study, the turbid surface water samples were treated using powdered seeds of Rajma (natural coagulant followed by variations in dosage, settling time and pH were also studied. From the results obtained, it was found that the Rajma seeds powder achieved 48.80% efficiency for 0.5 g/l of optimum dose at pH 6 for 20 min settling time respectively.

  6. Studies on the treatment of surface water using rajma seeds

    Science.gov (United States)

    Merlin, S. Babitha; Abirami, M.; Kumar, R. Suresh

    2018-03-01

    Indiscriminate disposal of wastewater with suspended solids have led to higher amount of pollution to the natural water bodies. Turbidity removal becomes an essential part in the water treatment when surface water is used for drinking purpose, this can be achieved by means of coagulation process. Coagulation process is the dosing of a coagulant in water, resulting in the destabilization of negatively charged particles. Commercial coagulants which were widely used can synthesize by-products in turn may pollute the environment and deteriorate the ecosystem at a slow rate. So, now-a-days natural coagulants are used as a potential substitute because it's biodegradable, ecofriendly and non-toxic. In this study, the turbid surface water samples were treated using powdered seeds of Rajma (natural coagulant) followed by variations in dosage, settling time and pH were also studied. From the results obtained, it was found that the Rajma seeds powder achieved 48.80% efficiency for 0.5 g/l of optimum dose at pH 6 for 20 min settling time respectively.

  7. A deformable surface model for real-time water drop animation.

    Science.gov (United States)

    Zhang, Yizhong; Wang, Huamin; Wang, Shuai; Tong, Yiying; Zhou, Kun

    2012-08-01

    A water drop behaves differently from a large water body because of its strong viscosity and surface tension under the small scale. Surface tension causes the motion of a water drop to be largely determined by its boundary surface. Meanwhile, viscosity makes the interior of a water drop less relevant to its motion, as the smooth velocity field can be well approximated by an interpolation of the velocity on the boundary. Consequently, we propose a fast deformable surface model to realistically animate water drops and their flowing behaviors on solid surfaces. Our system efficiently simulates water drop motions in a Lagrangian fashion, by reducing 3D fluid dynamics over the whole liquid volume to a deformable surface model. In each time step, the model uses an implicit mean curvature flow operator to produce surface tension effects, a contact angle operator to change droplet shapes on solid surfaces, and a set of mesh connectivity updates to handle topological changes and improve mesh quality over time. Our numerical experiments demonstrate a variety of physically plausible water drop phenomena at a real-time rate, including capillary waves when water drops collide, pinch-off of water jets, and droplets flowing over solid materials. The whole system performs orders-of-magnitude faster than existing simulation approaches that generate comparable water drop effects.

  8. Water adsorption induced in-plane domain switching on BaTiO{sub 3} surface

    Energy Technology Data Exchange (ETDEWEB)

    Li, X.; Bai, Y.; Su, Y. J., E-mail: yjsu@ustb.edu.cn [Corrosion and Protection Center, Key Laboratory for Environmental Fracture (MOE), University of Science and Technology Beijing, Beijing 100083 (China); Wang, B. C. [Corrosion and Protection Center, Key Laboratory for Environmental Fracture (MOE), University of Science and Technology Beijing, Beijing 100083 (China); Multiscale Materials Modelling group, Department of Materials and Engineering, Royal Institute of Technology, SE-10044 Stockholm (Sweden)

    2015-09-07

    In this study, the influences of the adsorption of water molecules on the changes in the atomic and electric structures of BaTiO{sub 3} surface were investigated using ab initio calculation. Water molecules are molecularly and dissociatively adsorbed on the BaTiO{sub 3} surface, which makes electrons transfer from water molecules to the BaTiO{sub 3} surface. The redistribution of electrons in the BaTiO{sub 3} surface layers weakens the Ba-O interactions and strengthens the Ti-O interactions, so that the Ti atom shifts in TiO{sub 2} plane, i.e., an in-plane domain switching. The adsorption of water molecules on BaTiO{sub 3} surfaces also results in a reduction in the surface rumpling.

  9. Wetlands inform how climate extremes influence surface water expansion and contraction

    Science.gov (United States)

    Vanderhoof, Melanie K.; Lane, Charles R.; McManus, Michael G.; Alexander, Laurie C.; Christensen, Jay R.

    2018-03-01

    Effective monitoring and prediction of flood and drought events requires an improved understanding of how and why surface water expansion and contraction in response to climate varies across space. This paper sought to (1) quantify how interannual patterns of surface water expansion and contraction vary spatially across the Prairie Pothole Region (PPR) and adjacent Northern Prairie (NP) in the United States, and (2) explore how landscape characteristics influence the relationship between climate inputs and surface water dynamics. Due to differences in glacial history, the PPR and NP show distinct patterns in regards to drainage development and wetland density, together providing a diversity of conditions to examine surface water dynamics. We used Landsat imagery to characterize variability in surface water extent across 11 Landsat path/rows representing the PPR and NP (images spanned 1985-2015). The PPR not only experienced a 2.6-fold greater surface water extent under median conditions relative to the NP, but also showed a 3.4-fold greater change in surface water extent between drought and deluge conditions. The relationship between surface water extent and accumulated water availability (precipitation minus potential evapotranspiration) was quantified per watershed and statistically related to variables representing hydrology-related landscape characteristics (e.g., infiltration capacity, surface storage capacity, stream density). To investigate the influence stream connectivity has on the rate at which surface water leaves a given location, we modeled stream-connected and stream-disconnected surface water separately. Stream-connected surface water showed a greater expansion with wetter climatic conditions in landscapes with greater total wetland area, but lower total wetland density. Disconnected surface water showed a greater expansion with wetter climatic conditions in landscapes with higher wetland density, lower infiltration and less anthropogenic drainage

  10. Wetlands inform how climate extremes influence surface water expansion and contraction

    Science.gov (United States)

    Vanderhoof, Melanie; Lane, Charles R.; McManus, Michael L.; Alexander, Laurie C.; Christensen, Jay R.

    2018-01-01

    Effective monitoring and prediction of flood and drought events requires an improved understanding of how and why surface water expansion and contraction in response to climate varies across space. This paper sought to (1) quantify how interannual patterns of surface water expansion and contraction vary spatially across the Prairie Pothole Region (PPR) and adjacent Northern Prairie (NP) in the United States, and (2) explore how landscape characteristics influence the relationship between climate inputs and surface water dynamics. Due to differences in glacial history, the PPR and NP show distinct patterns in regards to drainage development and wetland density, together providing a diversity of conditions to examine surface water dynamics. We used Landsat imagery to characterize variability in surface water extent across 11 Landsat path/rows representing the PPR and NP (images spanned 1985–2015). The PPR not only experienced a 2.6-fold greater surface water extent under median conditions relative to the NP, but also showed a 3.4-fold greater change in surface water extent between drought and deluge conditions. The relationship between surface water extent and accumulated water availability (precipitation minus potential evapotranspiration) was quantified per watershed and statistically related to variables representing hydrology-related landscape characteristics (e.g., infiltration capacity, surface storage capacity, stream density). To investigate the influence stream connectivity has on the rate at which surface water leaves a given location, we modeled stream-connected and stream-disconnected surface water separately. Stream-connected surface water showed a greater expansion with wetter climatic conditions in landscapes with greater total wetland area, but lower total wetland density. Disconnected surface water showed a greater expansion with wetter climatic conditions in landscapes with higher wetland density, lower infiltration and less anthropogenic

  11. Wetlands inform how climate extremes influence surface water expansion and contraction

    Directory of Open Access Journals (Sweden)

    M. K. Vanderhoof

    2018-03-01

    Full Text Available Effective monitoring and prediction of flood and drought events requires an improved understanding of how and why surface water expansion and contraction in response to climate varies across space. This paper sought to (1 quantify how interannual patterns of surface water expansion and contraction vary spatially across the Prairie Pothole Region (PPR and adjacent Northern Prairie (NP in the United States, and (2 explore how landscape characteristics influence the relationship between climate inputs and surface water dynamics. Due to differences in glacial history, the PPR and NP show distinct patterns in regards to drainage development and wetland density, together providing a diversity of conditions to examine surface water dynamics. We used Landsat imagery to characterize variability in surface water extent across 11 Landsat path/rows representing the PPR and NP (images spanned 1985–2015. The PPR not only experienced a 2.6-fold greater surface water extent under median conditions relative to the NP, but also showed a 3.4-fold greater change in surface water extent between drought and deluge conditions. The relationship between surface water extent and accumulated water availability (precipitation minus potential evapotranspiration was quantified per watershed and statistically related to variables representing hydrology-related landscape characteristics (e.g., infiltration capacity, surface storage capacity, stream density. To investigate the influence stream connectivity has on the rate at which surface water leaves a given location, we modeled stream-connected and stream-disconnected surface water separately. Stream-connected surface water showed a greater expansion with wetter climatic conditions in landscapes with greater total wetland area, but lower total wetland density. Disconnected surface water showed a greater expansion with wetter climatic conditions in landscapes with higher wetland density, lower infiltration and less

  12. Surface water risk assessment of pesticides in Ethiopia

    NARCIS (Netherlands)

    Teklu, B.M.; Adriaanse, P.I.; Horst, ter M.M.S.; Deneer, J.W.; Brink, van den P.J.

    2015-01-01

    Scenarios for future use in the pesticide registration procedure in Ethiopia were designed for 3 separate Ethiopian locations, which are aimed to be protective for the whole of Ethiopia. The scenarios estimate concentrations in surface water resulting from agricultural use of pesticides for a small

  13. Potentially hazardous substances in surface waters. II. Cholinesterase inhibitors in Dutch surface waters

    NARCIS (Netherlands)

    Greve, P.A.; Freudenthal, J.; Wit, S.L.

    1972-01-01

    Several analytical methods were employed to determine the concentrations of cholinesterase inhibitors in several Dutch surface waters. An Auto-Analyzer method was used for screening purposes; thin-layer chromatography and gas-liquid chromatography-mass spectrometry were used for identification and

  14. Cooperativity in Surface Bonding and Hydrogen Bonding of Water and Hydroxyl at Metal Surfaces

    DEFF Research Database (Denmark)

    Schiros, T.; Ogasawara, H.; Naslund, L. A.

    2010-01-01

    of the mixed phase at metal surfaces. The surface bonding can be considered to be similar to accepting a hydrogen bond, and we can thereby apply general cooperativity rules developed for hydrogen-bonded systems. This provides a simple understanding of why water molecules become more strongly bonded...... to the surface upon hydrogen bonding to OH and why the OH surface bonding is instead weakened through hydrogen bonding to water. We extend the application of this simple model to other observed cooperativity effects for pure water adsorption systems and H3O+ on metal surfaces.......We examine the balance of surface bonding and hydrogen bonding in the mixed OH + H2O overlayer on Pt(111), Cu(111), and Cu(110) via density functional theory calculations. We find that there is a cooperativity effect between surface bonding and hydrogen bonding that underlies the stability...

  15. Lawrence Livermore National Laboratory Surface Water Protection: A Watershed Approach

    Energy Technology Data Exchange (ETDEWEB)

    Coty, J

    2009-03-16

    is largely developed yet its surface water system encompasses two arroyos, an engineered detention basin (Lake Haussmann), storm channels, and wetlands. Conversely, the more rural Site 300 includes approximately 7,000 acres of largely undeveloped land with many natural tributaries, riparian habitats, and wetland areas. These wetlands include vernal pools, perennial seeps, and emergent wetlands. The watersheds within which the Laboratory's sites lie provide local and community ecological functions and services which require protection. These functions and services include water supply, flood attenuation, groundwater recharge, water quality improvement, wildlife and aquatic habitats, erosion control, and (downstream) recreational opportunities. The Laboratory employs a watershed approach to protect these surface water systems. The intent of this approach, presented in this document, is to provide an integrated effort to eliminate or minimize any adverse environmental impacts of the Laboratory's operations and enhance the attributes of these surface water systems, as possible and when reasonable, to protect their value to the community and watershed. The Laboratory's watershed approach to surface water protection will use the U.S. Environmental Protection Agency's Watershed Framework and guiding principles of geographic focus, scientifically based management and partnerships1 as a foundation. While the Laboratory's unique site characteristics result in objectives and priorities that may differ from other industrial sites, these underlying guiding principles provide a structure for surface water protection to ensure the Laboratory's role in environmental stewardship and as a community partner in watershed protection. The approach includes pollution prevention, continual environmental improvement, and supporting, as possible, community objectives (e.g., protection of the San Francisco Bay watershed).

  16. Surface wastewater in Samara and their impact on water basins as water supply sources

    Science.gov (United States)

    Strelkov, Alexander; Shuvalov, Mikhail; Gridneva, Marina

    2017-10-01

    The paper gives an overview of surface wastewater outlets in Samara through the rainwater sewer system into the Saratov water reservoir and the Samara river. The rainwater sewer system in Samara is designed and executed according to a separate scheme, except for the old part of the city, where surface run-off is dumped into the sewer system through siphoned drain. The rainwater system disposes of surface, drainage, industrial clean-contamined waters, emergency and technology discharges from the city’s heat supply and water supply systems. The effluent discharge is carried out by means of separate wastewater outlets into ravines or directly into the Samara river and the Saratov water reservoir without cleaning. The effluent discharge is carried out through the rainwater sewer system with 17 wastewater outlets into the Saratov water reservoir. In the Samara river, surface runoff drainage and clean-contamined water of industrial enterprises is carried out through 14 wastewater outlets. This study emphasizes the demand to arrange effluent discharge and construction of sewage treatment plants to prevent contamination of water objects by surface run-off from residential areas and industrial territories.

  17. Escape jumping by three age-classes of water striders from smooth, wavy and bubbling water surfaces.

    Science.gov (United States)

    Ortega-Jimenez, Victor Manuel; von Rabenau, Lisa; Dudley, Robert

    2017-08-01

    Surface roughness is a ubiquitous phenomenon in both oceanic and terrestrial waters. For insects that live at the air-water interface, such as water striders, non-linear and multi-scale perturbations produce dynamic surface deformations which may impair locomotion. We studied escape jumps of adults, juveniles and first-instar larvae of the water strider Aquarius remigis on smooth, wave-dominated and bubble-dominated water surfaces. Effects of substrate on takeoff jumps were substantial, with significant reductions in takeoff angles, peak translational speeds, attained heights and power expenditure on more perturbed water surfaces. Age effects were similarly pronounced, with the first-instar larvae experiencing the greatest degradation in performance; age-by-treatment effects were also significant for many kinematic variables. Although commonplace in nature, perturbed water surfaces thus have significant and age-dependent effects on water strider locomotion, and on behavior more generally of surface-dwelling insects. © 2017. Published by The Company of Biologists Ltd.

  18. Integrating remotely sensed surface water extent into continental scale hydrology.

    Science.gov (United States)

    Revilla-Romero, Beatriz; Wanders, Niko; Burek, Peter; Salamon, Peter; de Roo, Ad

    2016-12-01

    In hydrological forecasting, data assimilation techniques are employed to improve estimates of initial conditions to update incorrect model states with observational data. However, the limited availability of continuous and up-to-date ground streamflow data is one of the main constraints for large-scale flood forecasting models. This is the first study that assess the impact of assimilating daily remotely sensed surface water extent at a 0.1° × 0.1° spatial resolution derived from the Global Flood Detection System (GFDS) into a global rainfall-runoff including large ungauged areas at the continental spatial scale in Africa and South America. Surface water extent is observed using a range of passive microwave remote sensors. The methodology uses the brightness temperature as water bodies have a lower emissivity. In a time series, the satellite signal is expected to vary with changes in water surface, and anomalies can be correlated with flood events. The Ensemble Kalman Filter (EnKF) is a Monte-Carlo implementation of data assimilation and used here by applying random sampling perturbations to the precipitation inputs to account for uncertainty obtaining ensemble streamflow simulations from the LISFLOOD model. Results of the updated streamflow simulation are compared to baseline simulations, without assimilation of the satellite-derived surface water extent. Validation is done in over 100 in situ river gauges using daily streamflow observations in the African and South American continent over a one year period. Some of the more commonly used metrics in hydrology were calculated: KGE', NSE, PBIAS%, R 2 , RMSE, and VE. Results show that, for example, NSE score improved on 61 out of 101 stations obtaining significant improvements in both the timing and volume of the flow peaks. Whereas the validation at gauges located in lowland jungle obtained poorest performance mainly due to the closed forest influence on the satellite signal retrieval. The conclusion is that

  19. The interplay between surface-water and hydrogen bonding in a water adlayer on Pt(111) and Ag(111)

    Energy Technology Data Exchange (ETDEWEB)

    Delle Site, Luigi [Max-Planck-Institut fuer Polymerforschung, Ackermannweg 10, D-55128 Mainz (Germany); Ghiringhelli, Luca M [Max-Planck-Institut fuer Polymerforschung, Ackermannweg 10, D-55128 Mainz (Germany); Andreussi, Oliviero [Scuola Normale Superiore, Piazza dei Cavalieri 7, 56100 Pisa (Italy); Donadio, Davide [Computational Science, Department of Chemistry and Applied Biosciences, ETH Zurich, USI-Campus, via Giuseppe Buffi 13, CH-6900 Lugano (Switzerland); Parrinello, Michele [Scuola Normale Superiore, Piazza dei Cavalieri 7, 56100 Pisa (Italy)

    2007-06-20

    The structure of a water adlayer on a Pt(111) surface is investigated by means of extensive first-principles calculations. Allowing for proton disorder, the ground state energy for the {radical}3 x {radical}3R30{sup o} structure can be found. This results from an interplay between water/metal chemical bonding and the hydrogen bonding of the water network. This picture is supported by substituting Pt(111) with Ag(111): the almost inert surface allows for the reconstruction of the hydrogen network. (fast track communication)

  20. The interplay between surface-water and hydrogen bonding in a water adlayer on Pt(111) and Ag(111)

    International Nuclear Information System (INIS)

    Delle Site, Luigi; Ghiringhelli, Luca M; Andreussi, Oliviero; Donadio, Davide; Parrinello, Michele

    2007-01-01

    The structure of a water adlayer on a Pt(111) surface is investigated by means of extensive first-principles calculations. Allowing for proton disorder, the ground state energy for the √3 x √3R30 o structure can be found. This results from an interplay between water/metal chemical bonding and the hydrogen bonding of the water network. This picture is supported by substituting Pt(111) with Ag(111): the almost inert surface allows for the reconstruction of the hydrogen network. (fast track communication)

  1. Water vapor retrieval over many surface types

    Energy Technology Data Exchange (ETDEWEB)

    Borel, C.C.; Clodius, W.C.; Johnson, J.

    1996-04-01

    In this paper we present a study of of the water vapor retrieval for many natural surface types which would be valuable for multi-spectral instruments using the existing Continuum Interpolated Band Ratio (CIBR) for the 940 nm water vapor absorption feature. An atmospheric code (6S) and 562 spectra were used to compute the top of the atmosphere radiance near the 940 nm water vapor absorption feature in steps of 2.5 nm as a function of precipitable water (PW). We derive a novel technique called ``Atmospheric Pre-corrected Differential Absorption`` (APDA) and show that APDA performs better than the CIBR over many surface types.

  2. Thermodynamic properties of water solvating biomolecular surfaces

    Science.gov (United States)

    Heyden, Matthias

    Changes in the potential energy and entropy of water molecules hydrating biomolecular interfaces play a significant role for biomolecular solubility and association. Free energy perturbation and thermodynamic integration methods allow calculations of free energy differences between two states from simulations. However, these methods are computationally demanding and do not provide insights into individual thermodynamic contributions, i.e. changes in the solvent energy or entropy. Here, we employ methods to spatially resolve distributions of hydration water thermodynamic properties in the vicinity of biomolecular surfaces. This allows direct insights into thermodynamic signatures of the hydration of hydrophobic and hydrophilic solvent accessible sites of proteins and small molecules and comparisons to ideal model surfaces. We correlate dynamic properties of hydration water molecules, i.e. translational and rotational mobility, to their thermodynamics. The latter can be used as a guide to extract thermodynamic information from experimental measurements of site-resolved water dynamics. Further, we study energy-entropy compensations of water at different hydration sites of biomolecular surfaces. This work is supported by the Cluster of Excellence RESOLV (EXC 1069) funded by the Deutsche Forschungsgemeinschaft.

  3. Nanofiltration in Transforming Surface Water into Healthy Water: Comparison with Reverse Osmosis

    Directory of Open Access Journals (Sweden)

    L. D. Naidu

    2015-01-01

    Full Text Available The natural surface water, especially available through rivers, is the main source of healthy water for the living beings throughout the world from ancient days as it consists of all essential minerals. With the advent of industrialization, gradually even the most prominent rivers have been polluted in all parts of the world. Although there are lots of technologies, nanofiltration (NF has been chosen to transform river water into healthy water due to its unique advantages of retaining optimum TDS (with essential minerals required for human body, consuming of lower energy, and no usage of any chemicals. The prominent parameters of surface water and macro/microminerals of treated water have been analyzed. It is shown that NF is better in producing healthy water with high flux by consuming low energy.

  4. Surface Water Quality Trends from EPA's LTM Network

    Science.gov (United States)

    Funk, C.; Lynch, J. A.

    2013-12-01

    in all sensitivity classes. Information from long-term monitoring has shown that emission reductions have resulted in improved environmental conditions and increased ecosystem protection. However, despite some ecological recovery, lakes and streams in these regions remain at risk due to current acid deposition levels. The TIME/LTM programs, along with other monitoring networks, will continue to monitor surface water trends for effects of acid deposition and other anthropogenic impacts.

  5. An isotope-aided study on the interaction of surface water and groundwater

    International Nuclear Information System (INIS)

    Ahn, Jong Sung; Kim, Jong Hoon; Yun, Si Tae; Jeong, Chan Ho; Kim, Kae Nam

    1987-12-01

    The interaction between surface water and groundwater was studied by isotope-aided techniques in the vicinity of the KAERI area. The understanding of surface water and groundwater flow systems and the analysis of geomaterials which provide the pathway of groundwater is important for the hydrogeological safety assessment of the radioactive waste disposal. The results of the analyses of environmental isotopes have shown that the shallow groundwater in this area was originated from the meteoric water which is infiltrated rapidly into the subsurface materials. The higher content of the environmental isotopes in some groundwater samples indicate that this anomalous values is attributed to impermeable, fine-grained materials. Also, the results of hydrochemical analyses of water samples indicate that shallow groundwater and precipitation are well mixed. (Author)

  6. Dynamics of ice nucleation on water repellent surfaces.

    Science.gov (United States)

    Alizadeh, Azar; Yamada, Masako; Li, Ri; Shang, Wen; Otta, Shourya; Zhong, Sheng; Ge, Liehui; Dhinojwala, Ali; Conway, Ken R; Bahadur, Vaibhav; Vinciquerra, A Joseph; Stephens, Brian; Blohm, Margaret L

    2012-02-14

    Prevention of ice accretion and adhesion on surfaces is relevant to many applications, leading to improved operation safety, increased energy efficiency, and cost reduction. Development of passive nonicing coatings is highly desirable, since current antiicing strategies are energy and cost intensive. Superhydrophobicity has been proposed as a lead passive nonicing strategy, yet the exact mechanism of delayed icing on these surfaces is not clearly understood. In this work, we present an in-depth analysis of ice formation dynamics upon water droplet impact on surfaces with different wettabilities. We experimentally demonstrate that ice nucleation under low-humidity conditions can be delayed through control of surface chemistry and texture. Combining infrared (IR) thermometry and high-speed photography, we observe that the reduction of water-surface contact area on superhydrophobic surfaces plays a dual role in delaying nucleation: first by reducing heat transfer and second by reducing the probability of heterogeneous nucleation at the water-substrate interface. This work also includes an analysis (based on classical nucleation theory) to estimate various homogeneous and heterogeneous nucleation rates in icing situations. The key finding is that ice nucleation delay on superhydrophobic surfaces is more prominent at moderate degrees of supercooling, while closer to the homogeneous nucleation temperature, bulk and air-water interface nucleation effects become equally important. The study presented here offers a comprehensive perspective on the efficacy of textured surfaces for nonicing applications.

  7. Concentration data for anthropogenic organic compounds in groundwater, surface water, and finished water of selected community water systems in the United States, 2002-10

    Science.gov (United States)

    Carter, Janet M.; Kingsbury, James A.; Hopple, Jessica A.; Delzer, Gregory C.

    2010-01-01

    The National Water-Quality Assessment Program of the U.S. Geological Survey began implementing Source Water-Quality Assessments (SWQAs) in 2001 that focus on characterizing the quality of source water and finished water of aquifers and major rivers used by some of the larger community water systems in the United States. As used in SWQA studies, source water is the raw (ambient) water collected at the supply well before water treatment (for groundwater) or the raw (ambient) water collected from the river near the intake (for surface water), and finished water is the water that has been treated and is ready to be delivered to consumers. Finished-water samples are collected before the water enters the distribution system. The primary objective of SWQAs is to determine the occurrence of more than 250 anthropogenic organic compounds in source water used by community water systems, many of which currently are unregulated in drinking water by the U.S. Environmental Protection Agency. A secondary objective is to understand recurrence patterns in source water and determine if these patterns also occur in finished water before distribution. SWQA studies were conducted in two phases for most studies completed by 2005, and in one phase for most studies completed since 2005. Analytical results are reported for a total of 295 different anthropogenic organic compounds monitored in source-water and finished-water samples collected during 2002-10. The 295 compounds were classified according to the following 13 primary use or source groups: (1) disinfection by-products; (2) fumigant-related compounds; (3) fungicides; (4) gasoline hydrocarbons, oxygenates, and oxygenate degradates; (5) herbicides and herbicide degradates; (6) insecticides and insecticide degradates; (7) manufacturing additives; (8) organic synthesis compounds; (9) pavement- and combustion-derived compounds; (10) personal-care and domestic-use products; (11) plant- or animal-derived biochemicals; (12) refrigerants and

  8. A nested observation and model approach to non linear groundwater surface water interactions.

    Science.gov (United States)

    van der Velde, Y.; Rozemeijer, J. C.; de Rooij, G. H.

    2009-04-01

    Surface water quality measurements in The Netherlands are scattered in time and space. Therefore, water quality status and its variations and trends are difficult to determine. In order to reach the water quality goals according to the European Water Framework Directive, we need to improve our understanding of the dynamics of surface water quality and the processes that affect it. In heavily drained lowland catchment groundwater influences the discharge towards the surface water network in many complex ways. Especially a strong seasonal contracting and expanding system of discharging ditches and streams affects discharge and solute transport. At a tube drained field site the tube drain flux and the combined flux of all other flow routes toward a stretch of 45 m of surface water have been measured for a year. Also the groundwater levels at various locations in the field and the discharge at two nested catchment scales have been monitored. The unique reaction of individual flow routes on rainfall events at the field site allowed us to separate the discharge at a 4 ha catchment and at a 6 km2 into flow route contributions. The results of this nested experimental setup combined with the results of a distributed hydrological model has lead to the formulation of a process model approach that focuses on the spatial variability of discharge generation driven by temporal and spatial variations in groundwater levels. The main idea of this approach is that discharge is not generated by catchment average storages or groundwater heads, but is mainly generated by points scale extremes i.e. extreme low permeability, extreme high groundwater heads or extreme low surface elevations, all leading to catchment discharge. We focused on describing the spatial extremes in point scale storages and this led to a simple and measurable expression that governs the non-linear groundwater surface water interaction. We will present the analysis of the field site data to demonstrate the potential

  9. The Effect of Water Repellent Surface Impregnation on Durability of Cement-Based Materials

    Directory of Open Access Journals (Sweden)

    Peng Zhang

    2017-01-01

    Full Text Available In many cases, service life of reinforced concrete structures is severely limited by chloride penetration until the steel reinforcement or by carbonation of the covercrete. Water repellent treatment on the surfaces of cement-based materials has often been considered to protect concrete from these deteriorations. In this paper, three types of water repellent agents have been applied on the surface of concrete specimens. Penetration profiles of silicon resin in treated concrete have been determined by FT-IR spectroscopy. Water capillary suction, chloride penetration, carbonation, and reinforcement corrosion in both surface impregnated and untreated specimens have been measured. Results indicate that surface impregnation reduced the coefficient of capillary suction of concrete substantially. An efficient chloride barrier can be established by deep impregnation. Water repellent surface impregnation by silanes also can make the process of carbonation action slow. In addition, it also has been concluded that surface impregnation can provide effective corrosion protection to reinforcing steel in concrete with migrating chloride. The improvement of durability and extension of service life for reinforced concrete structures, therefore, can be expected through the applications of appropriate water repellent surface impregnation.

  10. Capillary condensation of water between mica surfaces above and below zero-effect of surface ions.

    Science.gov (United States)

    Nowak, Dominika; Christenson, Hugo K

    2009-09-01

    We have studied the capillary condensation of water from saturated vapor below 0 degrees C in the annular wedge-pore formed around two mica surfaces in contact in a surface force apparatus. The condensed water remains liquid down to at least -9 degrees C, and the measured condensate size is close to the predictions of a recent model for the dependence of the interfacial curvature of supercooled capillary condensates on temperature and surface tension. The small deviation observed may be accounted for by assuming that solute as K(2)CO(3) from the mica-condensate interface dissolves in the condensates and gives rise to an additional depression of the freezing point apart from that caused by the interface curvature. By contrast, measurements of the interface curvature at relative vapor pressures of 0.95-0.99 at 20 degrees C confirm a significantly larger deviation from the Kelvin equation. The magnitude of the deviation is in remarkable agreement with that calculated from the results of an earlier study of capillary condensation of water from a nonpolar liquid, also at T = 20 degrees C. Evidently, additional solute from the surrounding mica surface migrates into the condensates at room temperature. We conclude that the surface diffusion of ions on mica is much slower at subzero temperatures than at room temperature.

  11. Characteristics of pulse corona discharge over water surface

    Science.gov (United States)

    Fujii, Tomio; Arao, Yasushi; Rea, Massimo

    2008-12-01

    Production of ozone and OH radical is required to advance the plasma chemical reactions in the NOx removal processes for combustion gas treatment. The corona discharge to the water surface is expected to induce the good conditions for the proceeding of the NO oxidation and the NO2 dissolution removal into water. In order to get the fundamental data of the corona discharge over the water surface, the positive and negative V-I characteristics and the ozone production were measured with the multi needle and the saw-edge type of the discharge electrodes. The pulse corona characteristics were also measured with some different waveforms of the applied pulse voltage. The experiments were carried out under the atmospheric pressure and room temperature. Both the DC and the pulse corona to the water surface showed a stable and almost the same V-I characteristics as to plate electrodes though the surface of water was waved by corona wind. The positive streamer corona showed more ozone production than the negative one both in the DC and in the pulse corona.

  12. Characteristics of pulse corona discharge over water surface

    International Nuclear Information System (INIS)

    Fujii, Tomio; Arao, Yasushi; Rea, Massimo

    2008-01-01

    Production of ozone and OH radical is required to advance the plasma chemical reactions in the NOx removal processes for combustion gas treatment. The corona discharge to the water surface is expected to induce the good conditions for the proceeding of the NO oxidation and the NO 2 dissolution removal into water. In order to get the fundamental data of the corona discharge over the water surface, the positive and negative V-I characteristics and the ozone production were measured with the multi needle and the saw-edge type of the discharge electrodes. The pulse corona characteristics were also measured with some different waveforms of the applied pulse voltage. The experiments were carried out under the atmospheric pressure and room temperature. Both the DC and the pulse corona to the water surface showed a stable and almost the same V-I characteristics as to plate electrodes though the surface of water was waved by corona wind. The positive streamer corona showed more ozone production than the negative one both in the DC and in the pulse corona.

  13. Novel Americium Treatment Process for Surface Water and Dust Suppression Water

    International Nuclear Information System (INIS)

    Tiepel, E.W.; Pigeon, P.; Nesta, S.; Anderson, J.

    2006-01-01

    The Rocky Flats Environmental Technology Site (RFETS), a former nuclear weapons production plant, has been remediated under CERCLA and decommissioned to become a National Wildlife Refuge. The site conducted this cleanup effort under the Rocky Flats Cleanup Agreement (RFCA) that established limits for the discharge of surface and process waters from the site. At the end of 2004, while a number of process buildings were undergoing decommissioning, routine monitoring of a discharge pond (Pond A-4) containing approximately 28 million gallons of water was discovered to have been contaminated with a trace amount of Americium-241 (Am-241). While the amount of Am-241 in the pond waters was very low (0.5 - 0.7 pCi/l), it was above the established Colorado stream standard of 0.15 pCi/l for release to off site drainage waters. The rapid successful treatment of these waters to the regulatory limit was important to the site for two reasons. The first was that the pond was approaching its hold-up limit. Without rapid treatment and release of the Pond A-4 water, typical spring run-off would require water management actions to other drainages onsite or a mass shuttling of water for disposal. The second reason was that this type of contaminated water had not been treated to the stringent stream standard at Rocky Flats before. Technical challenges in treatment could translate to impacts on water and secondary waste management, and ultimately, cost impacts. All of the technical challenges and specific site criteria led to the conclusion that a different approach to the treatment of this problem was necessary and a crash treatability program to identify applicable treatment techniques was undertaken. The goal of this program was to develop treatment options that could be implemented very quickly and would result in the generation of no high volume secondary waste that would be costly to dispose. A novel chemical treatment system was developed and implemented at the RFETS to treat Am

  14. Monitoring for Pesticides in Groundwater and Surface Water in Nevada, 2008

    Science.gov (United States)

    Thodal, Carl E.; Carpenter, Jon; Moses, Charles W.

    2009-01-01

    Commercial pesticide applicators, farmers, and homeowners apply about 1 billion pounds of pesticides annually to agricultural land, non-crop land, and urban areas throughout the United States (Gilliom and others, 2006, p. 1). The U.S. Environmental Protection Agency (USEPA) defines a pesticide as any substance used to kill or control insects, weeds, plant diseases, and other pest organisms. Although there are important benefits from the proper use of pesticides, like crop protection and prevention of human disease outbreaks, there are also risks. One risk is the contamination of groundwater and surface-water resources. Data collected during 1992-2001 from 51 major hydrologic systems across the United States indicate that one or more pesticide or pesticide breakdown product was detected in more than 50 percent of 5,057 shallow (less than 20 feet below land surface) wells and in all of the 186 stream sites that were sampled in agricultural and urban areas (Gilliom and others, 2006, p. 2-4). Pesticides can contaminate surface water and groundwater from both point sources and non-point sources. Point sources are from specific locations such as spill sites, disposal sites, pesticide drift during application, and application of pesticides to control aquatic pests. Non-point sources represent the dominant source of surface water and groundwater contamination and may include agricultural and urban runoff, erosion, leaching from application sites, and precipitation that has become contaminated by upwind applications. Pesticides typically enter surface water when rainfall or irrigation exceeds the infiltration capacity of soil and resulting runoff then transports pesticides to streams, rivers, and other surface-water bodies. Contamination of groundwater may result directly from spills near poorly sealed well heads and from pesticide applications through improperly designed or malfunctioning irrigation systems that also are used to apply pesticides (chemigation; Carpenter and

  15. Surface-water-quality assessment of the lower Kansas River basin, Kansas and Nebraska; results of investigations, 1987-90

    Science.gov (United States)

    Helgesen, J.O.

    1995-01-01

    Surface-water-quality conditions and trends were assessed in the lower Kansas River Basin, which drains about 15,300 square miles of mainly agricultural land in southeast Nebraska and northeast Kansas. On the basis of established water-quality criteria, most streams in the basin were suitable for uses such as public-water supply, irrigation, and maintenance of aquatic life. However, most concerns identified from a previous analysis of available data through 1986 are substantiated by analysis of data for May 1987 through April 1990. Less-than-normal precipitation and runoff during 1987-90 affected surface-water quality and are important factors in the interpretation of results.Dissolved-solids concentrations in the main stem Kansas River during May 1987 through April 1990 commonly exceeded 500 milligrams per liter, which may be of concern for public-water supplies and for the irrigation of sensitive crops. Large concentrations of chloride in the Kansas River are derived from ground water discharging in the Smoky Hill River Basin west of the study unit. Trends of increasing concentrations of some dissolved major ions were statistically significant in the northwestern part of the study unit, which could reflect substantial increases in irrigated acreage.The largest concentrations of suspended sediment in streams during May 1987 through April 1990 were associated with high-density cropland in areas of little local relief and medium-density irrigated cropland in more dissected areas. The smallest concentrations were measured downstream from large reservoirs and in streams draining areas having little or no row-crop cultivation. Mean annual suspended-sediment transport rates in the main stem Kansas River increased substantially in the downstream direction. No conclusions could be reached concerning the relations of suspended-sediment transport, yields, or trends to natural and human factors.The largest sources of nitrogen and phosphorus in the study unit were fertilizer

  16. Thermophoretically driven water droplets on graphene and boron nitride surfaces

    Science.gov (United States)

    Rajegowda, Rakesh; Kannam, Sridhar Kumar; Hartkamp, Remco; Sathian, Sarith P.

    2018-05-01

    We investigate thermally driven water droplet transport on graphene and hexagonal boron nitride (h-BN) surfaces using molecular dynamics simulations. The two surfaces considered here have different wettabilities with a significant difference in the mode of droplet transport. The water droplet travels along a straighter path on the h-BN sheet than on graphene. The h-BN surface produced a higher driving force on the droplet than the graphene surface. The water droplet is found to move faster on h-BN surface compared to graphene surface. The instantaneous contact angle was monitored as a measure of droplet deformation during thermal transport. The characteristics of the droplet motion on both surfaces is determined through the moment scaling spectrum. The water droplet on h-BN surface showed the attributes of the super-diffusive process, whereas it was sub-diffusive on the graphene surface.

  17. Mechanically durable underwater superoleophobic surfaces based on hydrophilic bulk metals for oil/water separation

    Science.gov (United States)

    Yu, Huadong; Lian, Zhongxu; Xu, Jinkai; Wan, Yanling; Wang, Zuobin; Li, Yiquan; Yu, Zhanjiang; Weng, Zhankun

    2018-04-01

    Despite the success of previous methods for fabricating underwater superoleophobic surfaces, most of the surfaces based on soft materials are prone to collapse and deformation due to their mechanically fragile nature, and they fail to perform their designed functions after the surface materials are damaged in water. In this work, the nanosecond laser-induced oxide coatings on hydrophilic bulk metals are reported which overcomes the limitation and shows the robust underwater superoleophobicity to a mechanical challenge encountered by surfaces deployed in water environment. The results show that the surface materials have the advantage that the underwater superoleophobicity is still preserved after the surfaces are scratched by knife or sandpaper and even completely destroyed because of the hydrophilic property of damaged materials in water. It is important that the results provide a guide for the design of durable underwater superoleophobic surfaces, and the development of superoleophobic materials in many potential applications such as the oil-repellent and the oil/water separation. Additionally, the nanosecond laser technology is simple, cost-effective and suitable for the large-area and mass fabrication of mechanically durable underwater superoleophobic metal materials.

  18. Total mercury concentrations in surface water and sediments from Danube Delta lakes

    Directory of Open Access Journals (Sweden)

    TEODOROF Liliana

    2007-10-01

    Full Text Available The samples were collected from surface water and sediments of Danube Delta lakes, during april and may 2006. The sediments were digested with nitric acid, and the surface water with real aqua, at Microwave Oven Anton Paar and analised at FIMS 400 Perkin Elmer. The results show that the total mercury is compared with the maximum allowed limits according with Normative 161/2006.

  19. Adsorption of ethyl xanthate on ZnS(110) surface in the presence of water molecules: A DFT study

    Energy Technology Data Exchange (ETDEWEB)

    Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Guangxi Colleges and University Key Laboratory of Minerals Engineering, 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China)

    2016-05-01

    Graphical abstract: - Highlights: • Adsorption of water molecules decreases the reactivity of surface Zn atom. • Copper impurities decrease the band gap of ZnS surface. • Copper impurities enhance the adsorption of xanthate on the ZnS surface. • Water molecules have little influence on the properties of Cu-substituted ZnS surface. • The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface. - Abstracts: The interaction of collector with the mineral surface plays a very important role in the froth flotation of sphalerite. The adsorptions occurred at the interface between the mineral surface and waters; however most of DFT simulations are performed in vacuum, without consideration of water effect. Semiconductor surface has an obvious proximity effect, which will greatly influence the surface reactivity. To understand the mechanism of xanthate interacting with sphalerite surface in the presence of water molecules, the ethyl xanthate molecule adsorption on un-activated and Cu-activated ZnS(110) surface in the absence and presence of water molecules were performed using the density functional theory (DFT) method. The calculated results show that the adsorption of water molecules dramatically changes the properties of ZnS surface, resulting in decreasing the reactivity of surface Zn atoms with xanthate. Copper activation of ZnS surface changes the surface properties, leading to the totally different adsorption behaviors of xanthate. The presence of waters has little influence on the properties of Cu-activated ZnS surface. The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface, which would result in the formation of dixanthogen.

  20. Radionuclide transfer onto ground surface in surface water flow, 1

    International Nuclear Information System (INIS)

    Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

    1991-07-01

    Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

  1. Occurrence of Surface Water Contaminations: An Overview

    Science.gov (United States)

    Shahabudin, M. M.; Musa, S.

    2018-04-01

    Water is a part of our life and needed by all organisms. As time goes by, the needs by human increased transforming water quality into bad conditions. Surface water contaminated in various ways which is pointed sources and non-pointed sources. Pointed sources means the source are distinguished from the source such from drains or factory but the non-pointed always occurred in mixed of elements of pollutants. This paper is reviewing the occurrence of the contaminations with effects that occurred around us. Pollutant factors from natural or anthropology factors such nutrients, pathogens, and chemical elements contributed to contaminations. Most of the effects from contaminated surface water contributed to the public health effects also to the environments.

  2. Reducing phosphorus loading of surface water using iron-coated sand

    NARCIS (Netherlands)

    Groenenberg, J.E.; Chardon, W.J.; Koopmans, G.F.

    2013-01-01

    Phosphorus losses from agricultural soils is an important source of P in surface waters leading to surface water quality impairment. In addition to reducing P inputs, mitigation measures are needed to reduce P enrichment of surface waters. Because drainage of agricultural land by pipe drainage is an

  3. Free Surface Water Tunnel (FSWT)

    Data.gov (United States)

    Federal Laboratory Consortium — Description: The Free Surface Water Tunnel consists of the intake plenum, the test section and the exit plenum. The intake plenum starts with a perforated pipe that...

  4. Instability of confined water films between elastic surfaces

    NARCIS (Netherlands)

    de Beer, Sissi; 't Mannetje, Dieter; Zantema, Sietske; Mugele, Friedrich

    2010-01-01

    We investigated the dynamics of nanometer thin water films at controlled ambient humidity adsorbed onto two atomically smooth mica sheets upon rapidly bringing the surfaces into contact. Using a surface forces apparatus (SFA) in imaging mode, we found that the water films break up into a

  5. Documentation of the Surface-Water Routing (SWR1) Process for modeling surface-water flow with the U.S. Geological Survey Modular Ground-Water Model (MODFLOW-2005)

    Science.gov (United States)

    Hughes, Joseph D.; Langevin, Christian D.; Chartier, Kevin L.; White, Jeremy T.

    2012-01-01

    A flexible Surface-Water Routing (SWR1) Process that solves the continuity equation for one-dimensional and two-dimensional surface-water flow routing has been developed for the U.S. Geological Survey three-dimensional groundwater model, MODFLOW-2005. Simple level- and tilted-pool reservoir routing and a diffusive-wave approximation of the Saint-Venant equations have been implemented. Both methods can be implemented in the same model and the solution method can be simplified to represent constant-stage elements that are functionally equivalent to the standard MODFLOW River or Drain Package boundary conditions. A generic approach has been used to represent surface-water features (reaches) and allows implementation of a variety of geometric forms. One-dimensional geometric forms include rectangular, trapezoidal, and irregular cross section reaches to simulate one-dimensional surface-water features, such as canals and streams. Two-dimensional geometric forms include reaches defined using specified stage-volume-area-perimeter (SVAP) tables and reaches covering entire finite-difference grid cells to simulate two-dimensional surface-water features, such as wetlands and lakes. Specified SVAP tables can be used to represent reaches that are smaller than the finite-difference grid cell (for example, isolated lakes), or reaches that cannot be represented accurately using the defined top of the model. Specified lateral flows (which can represent point and distributed flows) and stage-dependent rainfall and evaporation can be applied to each reach. The SWR1 Process can be used with the MODFLOW Unsaturated Zone Flow (UZF1) Package to permit dynamic simulation of runoff from the land surface to specified reaches. Surface-water/groundwater interactions in the SWR1 Process are mathematically defined to be a function of the difference between simulated stages and groundwater levels, and the specific form of the reach conductance equation used in each reach. Conductance can be

  6. Water in contact with extended hydrophobic surfaces: Direct evidence of weak dewetting

    DEFF Research Database (Denmark)

    Jensen, Torben René; Jensen, Morten Østergaard; Reitzel, Niels

    2003-01-01

    X-ray reflectivity measurements reveal a significant dewetting of a large hydrophobic paraffin surface floating on water. The dewetting phenomenon extends less than 15 Angstrom into the bulk water phase and results in an integrated density deficit of about one water molecule per 25-30 Angstrom(2...

  7. Groundwater-surface water interaction

    International Nuclear Information System (INIS)

    White, P.A.; Clausen, B.; Hunt, B.; Cameron, S.; Weir, J.J.

    2001-01-01

    This chapter discusses natural and modified interactions between groundwater and surface water. Theory on recharge to groundwater from rivers is introduced, and the relative importance of groundwater recharge from rivers is illustrated with an example from the Ngaruroro River, Hawke's Bay. Some of the techniques used to identify and measure recharge to groundwater from gravel-bed rivers will be outlined, with examples from the Ngaruroro River, where the recharge reach is relatively well defined, and from the Rakaia River, where it is poorly defined. Groundwater recharged from rivers can have characteristic chemical and isotopic signatures, as shown by Waimakariri River water in the Christchurch-West Melton groundwater system. The incorporation of groundwater-river interaction in a regional groundwater flow model is outlined for the Waimea Plains, and relationships between river scour and groundwater recharge are examined for the Waimakariri River. Springs are the result of natural discharge from groundwater systems and are important water sources. The interactions between groundwater systems, springs, and river flow for the Avon River in New Zealand will be outlined. The theory of depletion of stream flow by groundwater pumpage will be introduced with a case study from Canterbury, and salt-water intrusion into groundwater systems with examples from Nelson and Christchurch. The theory of artificial recharge to groundwater systems is introduced with a case study from Hawke's Bay. Wetlands are important to flora, and the relationship of the wetland environment to groundwater hydrology will be discussed, with an example from the South Taupo wetland. (author). 56 refs., 25 figs., 3 tabs

  8. The scaling of urban surface water abundance and impairment with city size

    Science.gov (United States)

    Steele, M. K.

    2018-03-01

    Urbanization alters surface water compared to nonurban landscapes, yet little is known regarding how basic aquatic ecosystem characteristics, such as the abundance and impairment of surface water, differ with population size or regional context. This study examined the abundance, scaling, and impairment of surface water by quantifying the stream length, water body area, and impaired stream length for 3520 cities in the United States with populations from 2500 to 18 million. Stream length, water body area, and impaired stream length were quantified using the National Hydrography Dataset and the EPA's 303(d) list. These metrics were scaled with population and city area using single and piecewise power-law models and related to biophysical factors (precipitation, topography) and land cover. Results show that abundance of stream length and water body area in cities actually increases with city area; however, the per person abundance decreases with population size. Relative to population, impaired stream length did not increase until city populations were > 25,000 people, then scaled linearly with population. Some variation in abundance and impairment was explained by biophysical context and land cover. Development intensity correlated with stream density and impairment; however, those relationships depended on the orientation of the land covers. When high intensity development occupied the local elevation highs (+ 15 m) and undeveloped land the elevation lows, the percentage of impaired streams was less than the opposite land cover orientation (- 15 m) or very flat land. These results show that surface water abundance and impairment across contiguous US cities are influenced by city size and by biophysical setting interacting with land cover intensity.

  9. Incorporating human-water dynamics in a hyper-resolution land surface model

    Science.gov (United States)

    Vergopolan, N.; Chaney, N.; Wanders, N.; Sheffield, J.; Wood, E. F.

    2017-12-01

    The increasing demand for water, energy, and food is leading to unsustainable groundwater and surface water exploitation. As a result, the human interactions with the environment, through alteration of land and water resources dynamics, need to be reflected in hydrologic and land surface models (LSMs). Advancements in representing human-water dynamics still leave challenges related to the lack of water use data, water allocation algorithms, and modeling scales. This leads to an over-simplistic representation of human water use in large-scale models; this is in turn leads to an inability to capture extreme events signatures and to provide reliable information at stakeholder-level spatial scales. The emergence of hyper-resolution models allows one to address these challenges by simulating the hydrological processes and interactions with the human impacts at field scales. We integrated human-water dynamics into HydroBlocks - a hyper-resolution, field-scale resolving LSM. HydroBlocks explicitly solves the field-scale spatial heterogeneity of land surface processes through interacting hydrologic response units (HRUs); and its HRU-based model parallelization allows computationally efficient long-term simulations as well as ensemble predictions. The implemented human-water dynamics include groundwater and surface water abstraction to meet agricultural, domestic and industrial water demands. Furthermore, a supply-demand water allocation scheme based on relative costs helps to determine sectoral water use requirements and tradeoffs. A set of HydroBlocks simulations over the Midwest United States (daily, at 30-m spatial resolution for 30 years) are used to quantify the irrigation impacts on water availability. The model captures large reductions in total soil moisture and water table levels, as well as spatiotemporal changes in evapotranspiration and runoff peaks, with their intensity related to the adopted water management strategy. By incorporating human-water dynamics in

  10. Bacterial community diversity and variation in spray water sources and the tomato fruit surface

    Directory of Open Access Journals (Sweden)

    Ottesen Andrea R

    2011-04-01

    Full Text Available Abstract Background Tomato (Solanum lycopersicum consumption has been one of the most common causes of produce-associated salmonellosis in the United States. Contamination may originate from animal waste, insects, soil or water. Current guidelines for fresh tomato production recommend the use of potable water for applications coming in direct contact with the fruit, but due to high demand, water from other sources is frequently used. We sought to describe the overall bacterial diversity on the surface of tomato fruit and the effect of two different water sources (ground and surface water when used for direct crop applications by generating a 454-pyrosequencing 16S rRNA dataset of these different environments. This study represents the first in depth characterization of bacterial communities in the tomato fruit surface and the water sources commonly used in commercial vegetable production. Results The two water sources tested had a significantly different bacterial composition. Proteobacteria was predominant in groundwater samples, whereas in the significantly more diverse surface water, abundant phyla also included Firmicutes, Actinobacteria and Verrucomicrobia. The fruit surface bacterial communities on tomatoes sprayed with both water sources could not be differentiated using various statistical methods. Both fruit surface environments had a high representation of Gammaproteobacteria, and within this class the genera Pantoea and Enterobacter were the most abundant. Conclusions Despite the major differences observed in the bacterial composition of ground and surface water, the season long use of these very different water sources did not have a significant impact on the bacterial composition of the tomato fruit surface. This study has provided the first next-generation sequencing database describing the bacterial communities living in the fruit surface of a tomato crop under two different spray water regimes, and therefore represents an

  11. Exciton-Promoted Desorption From Solid Water Surfaces A2

    DEFF Research Database (Denmark)

    McCoustra, M.R.S.; Thrower, J.D.

    2018-01-01

    Abstract Desorption from solid water surfaces resulting from interaction with electromagnetic and particle radiation is reviewed in the context of the role of nonthermal desorption in astrophysical environments. Experimental observations are interpreted in terms of mechanisms sharing a common basis...

  12. Patterned gradient surface for spontaneous droplet transportation and water collection: simulation and experiment

    International Nuclear Information System (INIS)

    Tan, Xianhua; Zhu, Yiying; Shi, Tielin; Tang, Zirong; Liao, Guanglan

    2016-01-01

    We demonstrate spontaneous droplet transportation and water collection on wedge-shaped gradient surfaces consisting of alternating hydrophilic and hydrophobic regions. Droplets on the surfaces are modeled and simulated to analyze the Gibbs free energy and free energy gradient distributions. Big half-apex angle and great wettability difference result in considerable free energy gradient, corresponding to large driving force for spontaneous droplet transportation, thus causing the droplets to move towards the open end of the wedge-shaped hydrophilic regions, where the Gibbs free energy is low. Gradient surfaces are then fabricated and tested. Filmwise condensation begins on the hydrophilic regions, forming wedge-shaped tracks for water collection. Dropwise condensation occurs on the hydrophobic regions, where the droplet size distribution and departure diameters are controlled by the width of the regions. Condensate water from both the hydrophilic and hydrophobic regions are collected directionally to the open end of the wedge-shaped hydrophilic regions, agreeing with the simulations. Directional droplet transport and controllable departure diameters make the branched gradient surfaces more efficient than smooth surfaces for water collection, which proves that gradient surfaces are potential in water collection, microfluidic devices, anti-fogging and self-cleaning. (paper)

  13. Water adsorption on amorphous silica surfaces: a Car-Parrinello simulation study

    International Nuclear Information System (INIS)

    Mischler, Claus; Horbach, Juergen; Kob, Walter; Binder, Kurt

    2005-01-01

    A combination of classical molecular dynamics (MD) and ab initio Car-Parrinello molecular dynamics (CPMD) simulations is used to investigate the adsorption of water on a free amorphous silica surface. From the classical MD, SiO 2 configurations with a free surface are generated which are then used as starting configurations for the CPMD. We study the reaction of a water molecule with a two-membered ring at the temperature T = 300 K. We show that the result of this reaction is the formation of two silanol groups on the surface. The activation energy of the reaction is estimated and it is shown that the reaction is exothermic

  14. Coastal surface water suitability analysis for irrigation in Bangladesh

    Science.gov (United States)

    Mahtab, Mohammad Hossain; Zahid, Anwar

    2018-03-01

    Water with adequate quality and quantity is very important for irrigation to ensure the crop yields. Salinity is common problem in the coastal waters in Bangladesh. The intensity of salinity in the coastal zone in Bangladesh is not same. It fluctuates over the year. Sodium is another hazard which may hamper permeability and ultimately affects the fertility. It can reduce the crop yields. Although surface water is available in the coastal zone of Bangladesh, but its quality for irrigation needs to be monitored over the year. This paper will investigate the overall quality of coastal surface waters. Thirty-three water samples from different rivers were collected both in wet period (October-December) and in dry period (February-April). Different physical and chemical parameters are considered for investigation of the adequacy of water with respect to international irrigation water quality standards and Bangladesh standards. A comparison between the dry and wet period coastal surface water quality in Bangladesh will also be drawn here. The analysis shows that coastal surface water in Bangladesh is overall suitable for irrigation during wet period, while it needs treatment (which will increase the irrigation cost) for using for irrigation during dry period. Adaptation to this situation can improve the scenario. An integrated plan should be taken to increase the water storing capacity in the coastal area to harvest water during wet period.

  15. Surface Water Protection by Productive Buffers

    DEFF Research Database (Denmark)

    Christen, Benjamin

    Vegetated riparian buffer zones are a widely recommended best management practice in agriculture for protecting surface and coastal waters from diffuse nutrient pollution. On the background of the EU funded research project NitroEurope (NEU; www.NitroEurope.eu), this study concentrates...... on the mitigation of nitrogen pollution in surface and groundwater, using riparian buffer zones for biomass production. The objectives are to map suitable areas for buffer implementation across the six NEU study landscapes, model tentative N-loss mitigation, calculate biomass production potential and economic...... designed for local conditions could be a way of protecting water quality attractive to many stakeholders....

  16. A method for screening for the risk of chronic effects of surface water pollution.

    Science.gov (United States)

    Soldán, Přemysl; Badurová, Jana

    2013-01-01

    The article describes a method for screening for the risk of chronic surface water pollution which was developed at the T. G. Masaryk Water Research Institute. The approach, which is based on exotoxicological analyses, can be classed as a rapid method of assessment. The degree of risk of chronic effects surface water pollution is determined from an evaluation of two major parameters-toxicity and genotoxicity. As the method utilizes relative simple procedures for sample collection, pretreatment of the sample, chemical analyses, bioassays and results assessment, this approach is suitable for widespread practical use. Extensive utilization of this approach for assessing river basins in the Czech Republic has proved its suitability for a more sophisticated detection of the biological impact of surface water pollution. This is documented in the article where the method is used in a study of the Bílina River, and in the overview of the results of the risk assessment of chronic effects of surface water pollution in selected sections of three international river basins in the Czech Republic.

  17. Analysis of ONKALO water leakage mapping results

    Energy Technology Data Exchange (ETDEWEB)

    Ahokas, H.; Nummela, J; Turku, J. [Poeyry Finland Oy, Vantaa (Finland)

    2014-04-15

    As part of the programme for the final disposal of spent nuclear fuel, an analysis has been compiled of water leakage mapping performed in ONKALO. Leakage mapping is part of the Olkiluoto Monitoring Programme (OMO) and the field work has been carried out by Posiva Oy. The main objective of the study is to analyse differences detected between mapping campaigns carried out typically twice a year in 2005-2012. Differences were estimated to be caused by the differences in groundwater conditions caused by seasonal effects or by differences between the years. The effect of technical changes like shotcreting, postgrouting, ventilation etc. on the results was also studied. The development of the visualisation of mapping results was also an objective of this work. Leakage mapping results have been reported yearly in the monitoring reports of Hydrology with some brief comments on the detected differences. In this study, the development of the total area and the number of different leakages as well as the correlation of changes with shotcreting and grouting operations were studied. In addition, traces of fractures on tunnel surfaces, and the location of rock bolts and drain pipes were illustrated together with leakage mapping. In water leakage mapping, the tunnel surfaces are visually mapped to five categories: dry, damp, wet, dripping and flowing. Major changes were detected in the total area of damp leakages. It is likely that the increase has been caused by the condensation of warm ventilation air on the tunnel surfaces and the corresponding decrease by the evaporation of moisture into the dry ventilation air. Shotcreting deep in ONKALO may also have decreased the total area of damp leakages. Changes in the total area and number of wet leakages correlate at least near the surface with differences in yearly precipitation. It is possible that strong rains have also caused a temporary increase in wet leakages. Dripping and wet leakages have been observed on average more

  18. Analysis of ONKALO water leakage mapping results

    International Nuclear Information System (INIS)

    Ahokas, H.; Nummela, J; Turku, J.

    2014-04-01

    As part of the programme for the final disposal of spent nuclear fuel, an analysis has been compiled of water leakage mapping performed in ONKALO. Leakage mapping is part of the Olkiluoto Monitoring Programme (OMO) and the field work has been carried out by Posiva Oy. The main objective of the study is to analyse differences detected between mapping campaigns carried out typically twice a year in 2005-2012. Differences were estimated to be caused by the differences in groundwater conditions caused by seasonal effects or by differences between the years. The effect of technical changes like shotcreting, postgrouting, ventilation etc. on the results was also studied. The development of the visualisation of mapping results was also an objective of this work. Leakage mapping results have been reported yearly in the monitoring reports of Hydrology with some brief comments on the detected differences. In this study, the development of the total area and the number of different leakages as well as the correlation of changes with shotcreting and grouting operations were studied. In addition, traces of fractures on tunnel surfaces, and the location of rock bolts and drain pipes were illustrated together with leakage mapping. In water leakage mapping, the tunnel surfaces are visually mapped to five categories: dry, damp, wet, dripping and flowing. Major changes were detected in the total area of damp leakages. It is likely that the increase has been caused by the condensation of warm ventilation air on the tunnel surfaces and the corresponding decrease by the evaporation of moisture into the dry ventilation air. Shotcreting deep in ONKALO may also have decreased the total area of damp leakages. Changes in the total area and number of wet leakages correlate at least near the surface with differences in yearly precipitation. It is possible that strong rains have also caused a temporary increase in wet leakages. Dripping and wet leakages have been observed on average more

  19. Effect of surface modification on the corrosion resistivity in supercritical water

    International Nuclear Information System (INIS)

    Penttila, S.; Horvath, A.; Toivonen, A.; Zolnai, Z.

    2011-01-01

    This paper summarizes the results of high temperature corrosion studies of the candidate austenitic alloys at relevant operating conditions for SCWR. The high temperature and pressure above the thermodynamic critical point of water result in higher oxidation rate which might be critical for thin-wall components like fuel cladding. The goal of this work was to study the effect of surface preparation on the oxidation rate on Ti-stabilized austenitic alloy 1.4970. Surfaces were prepared with ion implantation using He"+- and N"+-ions. Samples were immersed in supercritical water at 650"oC/25 MPa, for up to 2000 hours. Added to this, conventional surface treatments were conducted for austenitic alloy 316L tube samples in order to study the effect of cold work in sample surface on corrosion resistance. The corrosion rate was evaluated by measuring the weight change of the samples. The compositions of the oxide layers were analyzed using scanning electron microscope (SEM) in conjunction with Energy Dispersive Spectroscopy (EDS). (author)

  20. Existence of Insecticides in Tap Drinking Surface and Ground Water in Dakahlyia Governorate, Egypt in 2011

    Directory of Open Access Journals (Sweden)

    RA Mandour

    2011-12-01

    Full Text Available Background: The environmental degradation products of pesticides may enter drinking water and result in serious health problems. Objective: To evaluate the occurrence of insecticides in drinking surface and ground water in Dakahlyia Governorate, northern Egypt in 2011. Methods: We studied blood samples collected from 36 consecutive patients diagnosed with pesticides poisoning and 36 tap drinking water (surface and ground. Blood and water samples were analyzed for pesticides using gas chromatography-electron captured detector (GC-ECD. In addition, blood samples were analyzed for plasma pseudo-cholinesterase level (PChE and red blood cells acetyl cholinesterase activity (AChE. Results: The results confirmed the presence of high concentrations of insecticides, including organonitrogenous and organochlorine in tap drinking surface and ground water. Conclusion: Drinking water contaminated with insecticides constitutes an important health concern in Dakahlyia governorate, Egypt.

  1. Monitoring surface-water quality in Arizona: the fixed-station network

    Science.gov (United States)

    Tadayon, Saeid

    2000-01-01

    Arizona is an arid State in which economic development is influenced largely by the quantity and quality of water and the location of adequate water supplies. In 1995, surface water supplied about 58 percent of total withdrawals in Arizona. Of the total amount of surface water used in 1995, about 89 percent was for agriculture, 10 percent for public supply, and 1 percent for industrial supply (including mining and thermoelectric; Solley and others, 1998). As a result of rapid population growth in Arizona, historic agricultural lands in the Phoenix (Maricopa County) and Tucson (Pima County) areas are now being developed for residential and commercial use; thus, the amount of water used for public supply is increasing. The Clean Water Act was established by U.S. Congress (1972) in response to public concern about water-pollution control. The act defines a process by which the United States Congress and the citizens are informed of the Nation’s progress in restoring and maintaining the quality of our waters. The Arizona Department of Environmental Quality (ADEQ) is the State-designated agency for this process and, as a result, has developed a monitoring program to assess water quality in Arizona. The ADEQ is required to submit a water-quality assessment report to the United States Environmental Protection Agency (USEPA) every 2 years. The USEPA summarizes the reports from each State and submits a report to the Congress characterizing water quality in the United States. These reports serve to inform Congress and the public of the Nation’s progress toward the restoration and maintenance of water quality in the United States (Arizona Department of Environmental Quality, 1998).

  2. Memorandum of Understanding on Surface Coal Mining Operations Resulting in Placement of Excess Spoil Fills in the Waters of the United States

    Science.gov (United States)

    MOU on Surface Coal Mining Operations establishes a process for improving coordination in the review of permit applications required for surface coal mining and reclamation in waters of the United States

  3. Adsorption of water, sulfates and chloride on arsenopyrite surface

    Science.gov (United States)

    Silva, Juliana C. M.; dos Santos, Egon C.; de Oliveira, Aline; Heine, Thomas; De Abreu, Heitor A.; Duarte, Hélio A.

    2018-03-01

    Arsenopyrite is one of the sulfide minerals responsible for acid rock drainage (ARD) and is one of the most hazardous in regions affected by mining activities. This phenomenon involves complex reaction mechanism. Although it is intensely investigated, there is a lack of consensus concerning the reaction mechanisms and more information is still necessary. In this work, the adsorption of water, hydrochloric acid, and sulfuric acid on arsenopyrite (001) surface was investigated by means of Density Functional calculations and the results compared to other sulfides aiming to understand the mineral/water interface. The interaction of the chemical species with the (001) FeAsS surface is the first step to understand the intricate oxidation mechanism of arsenopyrite. Molecular water adsorption on (001) FeAsS is more favored than the adsorption of sulfate favoring the dissolution of sulfates and enhancing its oxidation. The estimated adsorption energies of water, sulfates and chloride on other sulfide minerals are compared with the estimated values for arsenopyrite and the chemical reactivity differences discussed in detail.

  4. Groundwater and surface water pollution

    Energy Technology Data Exchange (ETDEWEB)

    Chae, Y.S.; Hamidi, A. [eds.

    2000-07-01

    This book contains almost all the technical know-how that is required to clean up the water supply. It provides a survey of up-to-date technologies for remediation, as well as a step-by-step guide to pollution assessment for both ground and surface waters. In addition to focusing on causes, effects, and remedies, the book stresses reuse, recycling, and recovery of resources. The authors suggest that through total recycling wastes can become resources.

  5. A Study on Water Surface Profiles of Rivers with Constriction

    Science.gov (United States)

    Qian, Chaochao; Yamada, Tadashi

    2013-04-01

    Water surface profile of rivers with constrictions is precious in both classic hydraulics and river management practice. This study was conducted to clarify the essences of the water surface profiles. 3 cases of experiments and 1D numerical calculations with different discharges were made in the study and analysis solutions of the non-linear basic equation of surface profile in varied flow without considering friction were derived. The manning's number was kept in the same in each case by using crosspiece roughness. We found a new type of water surface profile of varied flow from the results of 1D numerical calculation and that of experiments and named it as Mc curve because of its mild condition with constriction segment. This kind of curves appears as a nature phenomenon ubiquitously. The process of water surface forming is dynamic and bore occurs at the upper side of constriction during increasing discharge before the surface profile formed. As a theoretical work, 3 analysis solutions were derived included 2 physical-meaning solutions in the study by using Man-Machine system. One of the derived physical-meaning solutions was confirmed that it is validity by comparing to the results of 1D numerical calculation and that of experiments. The solution represents a flow profile from under critical condition at the upper side to super critical condition at the down side of constriction segment. The other derived physical-meaning solution represents a flow profile from super critical condition at the upper side to under critical condition at the down side of constriction segment. These two kinds of flow profiles exist in the nature but no theoretical solution can express the phenomenon. We find the depth distribution only concerned with unit width discharge distribution and critical depth under a constant discharge from the derived solutions. Therefor, the profile can be gained simply and precisely by using the theoretical solutions instead of numerical calculation even

  6. Microplastic distribution in global marine surface waters: results of an extensive citizen science study

    Science.gov (United States)

    Barrows, A.; Petersen, C.

    2017-12-01

    Plastic is a major pollutant throughout the world. The majority of the 322 million tons produced annually is used for single-use packaging. What makes plastic an attractive packaging material: cheap, light-weight and durable are also the features that help make it a common and persistent pollutant. There is a growing body of research on microplastic, particles less than 5 mm in size. Microfibers are the most common microplastic in the marine environment. Global estimates of marine microplastic surface concentrations are based on relatively small sample sizes when compared to the vast geographic scale of the ocean. Microplastic residence time and movement along the coast and sea surface outside of the gyres is still not well researched. This five-year project utilized global citizen scientists to collect 1,628 1-liter surface grab samples in every major ocean. The Artic and Southern oceans contained highest average of particles per liter of surface water. Open ocean samples (further than 12 nm from land, n = 686) contained a higher particle average (17 pieces L-1) than coastal samples (n = 723) 6 pieces L-1. Particles were predominantly 100 µm- 1.5 mm in length (77%), smaller than what has been captured in the majority of surface studies. Utilization of citizen scientists to collect data both in fairly accessible regions of the world as well as from areas hard to reach and therefore under sampled, provides us with a wider perspective of global microplastics occurrence. Our findings confirm global microplastic accumulation zone model predictions. The open ocean and poles have sequestered and trapped plastic for over half a century, and show that not only plastics, but anthropogenic fibers are polluting the environment. Continuing to fill knowledge gaps on microplastic shape, size and color in remote ocean areas will drive more accurate oceanographic models of plastic accumulation zones. Incorporation of smaller-sized particles in these models, which has previously

  7. Characterisation of the inorganic chemistry of surface waters in ...

    African Journals Online (AJOL)

    The main purpose of this study was to determine a simple inorganic chemistry index that can be used for all surface waters in South Africa, in order to characterise the inorganic chemistry of surface waters. Water quality data collected up until 1999 from all sample monitoring stations (2 068 monitoring stations, 364 659 ...

  8. Determining water sources in the boundary layer from tall tower profiles of water vapor and surface water isotope ratios after a snowstorm in Colorado

    Directory of Open Access Journals (Sweden)

    D. Noone

    2013-02-01

    Full Text Available The D/H isotope ratio is used to attribute boundary layer humidity changes to the set of contributing fluxes for a case following a snowstorm in which a snow pack of about 10 cm vanished. Profiles of H2O and CO2 mixing ratio, D/H isotope ratio, and several thermodynamic properties were measured from the surface to 300 m every 15 min during four winter days near Boulder, Colorado. Coeval analysis of the D/H ratios and CO2 concentrations find these two variables to be complementary with the former being sensitive to daytime surface fluxes and the latter particularly indicative of nocturnal surface sources. Together they capture evidence for strong vertical mixing during the day, weaker mixing by turbulent bursts and low level jets within the nocturnal stable boundary layer during the night, and frost formation in the morning. The profiles are generally not well described with a gradient mixing line analysis because D/H ratios of the end members (i.e., surface fluxes and the free troposphere evolve throughout the day which leads to large uncertainties in the estimate of the D/H ratio of surface water flux. A mass balance model is constructed for the snow pack, and constrained with observations to provide an optimal estimate of the partitioning of the surface water flux into contributions from sublimation, evaporation of melt water in the snow and evaporation from ponds. Results show that while vapor measurements are important in constraining surface fluxes, measurements of the source reservoirs (soil water, snow pack and standing liquid offer stronger constraint on the surface water balance. Measurements of surface water are therefore essential in developing observational programs that seek to use isotopic data for flux attribution.

  9. Groundwater infiltration, surface water inflow and sewerage exfiltration considering hydrodynamic conditions in sewer systems.

    Science.gov (United States)

    Karpf, Christian; Hoeft, Stefan; Scheffer, Claudia; Fuchs, Lothar; Krebs, Peter

    2011-01-01

    Sewer systems are closely interlinked with groundwater and surface water. Due to leaks and regular openings in the sewer system (e.g. combined sewer overflow structures with sometimes reverse pressure conditions), groundwater infiltration and surface water inflow as well as exfiltration of sewage take place and cannot be avoided. In the paper a new hydrodynamic sewer network modelling approach will be presented, which includes--besides precipitation--hydrographs of groundwater and surface water as essential boundary conditions. The concept of the modelling approach and the models to describe the infiltration, inflow and exfiltration fluxes are described. The model application to the sewerage system of the City of Dresden during a flood event with complex conditions shows that the processes of infiltration, exfiltration and surface water inflows can be described with a higher reliability and accuracy, showing that surface water inflow causes a pronounced system reaction. Further, according to the simulation results, a high sensitivity of exfiltration rates on the in-sewer water levels and a relatively low influence of the dynamic conditions on the infiltration rates were found.

  10. The groundwater contribution to surface water contamination in a region with intensive agricultural land use (Noord-Brabant, The Netherlands)

    International Nuclear Information System (INIS)

    Rozemeijer, J.C.; Broers, H.P.

    2007-01-01

    Traditionally, monitoring of soil, groundwater and surface water quality is coordinated by different authorities in the Netherlands. Nowadays, the European Water Framework Directive (EU, 2000) stimulates an integrated approach of the complete soil-groundwater-surface water system. Based on water quality data from several test catchments, we propose a conceptual model stating that stream water quality at different discharges is the result of different mixing ratios of groundwater from different depths. This concept is used for a regional study of the groundwater contribution to surface water contamination in the Dutch province of Noord-Brabant, using the large amount of available data from the regional monitoring networks. The results show that groundwater is a dominant source of surface water contamination. The poor chemical condition of upper and shallow groundwater leads to exceedance of the quality standards in receiving surface waters, especially during quick flow periods. - Water quality monitoring data show the importance of the groundwater contribution to surface water pollution

  11. Impact of potassium and water on the electronic properties of InN(0001) surfaces

    International Nuclear Information System (INIS)

    Reiss, S.; Eisenhardt, A.; Krischok, S.; Himmerlich, M.

    2014-01-01

    In this work we investigate the interaction of potassium and water with 2 x 2 reconstructed InN(0001) surfaces prepared by plasma-assisted molecular beam epitaxy. The influence of adsorbate-substrate-interaction on surface properties is characterized in-situ by photoelectron spectroscopy. Potassium exposure leads to a strong reduction in the work function Φ to 1.6 eV revealing a charge transfer from the adsorbate to the InN surface. In parallel, a reduction of the surface downward band bending by 0.2 eV and hence a reduced electron accumulation density is observed. While interaction of water with clean InN(0001)-2 x 2 surfaces induces only minor changes in the surface band bending, water adsorption at potassium covered InN(0001) leads to a reversal of the K-induced reduction in surface band bending and a slight increase of Φ to 2.4 eV. These results show that surrounding water modifies the interaction of potassium with InN(0001) surfaces. (copyright 2014 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  12. Spatial and temporal variability of surface water pollution in the Mekong Delta, Vietnam.

    Science.gov (United States)

    Wilbers, Gert-Jan; Becker, Mathias; Nga, La Thi; Sebesvari, Zita; Renaud, Fabrice G

    2014-07-01

    Surface water pollution in the Vietnamese Mekong Delta (MD) could threaten human, animal and ecosystem health given the fact that this water source is intensively used for drinking, irrigation and domestic services. We therefore determined the levels of pollution by organic pollutants, salts, metals and microbial indicators by (bi)monthly monitoring of canals between November 2011 and July 2012 at 32 sampling locations, representing fresh and saline/brackish environments. The results were compared with national water quality guidelines, between the studied regions and with water quality data from main waterways. Key factors explaining the observed levels of pollution in surface water were identified through principal component analysis (PCA). Temporal variations due to tidal regime and seasonality were also assessed. Based on regression models, the spatial variability of five water quality parameters was visualized using GIS based maps. Results indicate that pH (max. 8.6), turbidity (max. 461 FTU), maximum concentrations of ammonium (14.7 mg L(-1)), arsenic (44.1 μg L(-1)), barium (157.5 μg L(-1)), chromium (84.7 μg L(-1)), mercury (45.5 μg L(-1)), manganese (1659.7 μg L(-1)), aluminum (14.5 mg L(-1)), iron (17.0 mg L(-1)) and the number of Escherichia coli (87,000 CFU 100 mL(-1)) and total coliforms (2,500,000 CFU 100 mL(-1)) in canals exceed the thresholds set by Vietnamese quality guidelines for drinking and domestic purposes. The PCA showed that i) urbanization; ii) metal leaching from soils; iii) aquaculture; and iv) tidal regime explain 85% of the variance of surface water quality attributes. Significant differences in water quality were found due to daily tidal regime and as a result of seasonality. Surface water quality maps for dissolved oxygen, ammonium, ortho-phosphate, manganese and total coliforms were developed to highlight hot-spot areas of pollution. The results of this study can assist policy makers in developing water management strategies

  13. Mass transfer behavior of tritium from air to water through the water surface

    International Nuclear Information System (INIS)

    Takata, Hiroki; Nishikawa, Masabumi; Kamimae, Kozo

    2005-01-01

    It is anticipated that a certain amount of tritiated water exists in the atmosphere of tritium handling facilities, and it is recognized that the hazardous potential of tritiated water is rather high. Then, it is important to grasp the behavior of tritiated water for preserving of the radiation safety. The mass transfer behavior of tritium from air to water through the water surface was discussed in this study. The evaporation rate of water and the condensation rate of water were experimentally examined from measurement of change of the weight of distilled water. The tritium transfer rate from the tritiated water in air to the distilled water was also experimentally examined by using a liquid scintillation counter. Experimental results about change of tritium level in a small beaker placed in the atmosphere with tritiated water showed that diffusion of tritium in water and gas flow in the atmosphere gives considerable effect on tritium transfer. The estimation method of the tritium transfer made in this study was applied to explain the data at The Japan Atomic Power Company second power station at Tsuruga and good agreement was obtained. (author)

  14. 3D Imaging of Water-Drop Condensation on Hydrophobic and Hydrophilic Lubricant-Impregnated Surfaces

    Science.gov (United States)

    Kajiya, Tadashi; Schellenberger, Frank; Papadopoulos, Periklis; Vollmer, Doris; Butt, Hans-Jürgen

    2016-04-01

    Condensation of water from the atmosphere on a solid surface is an ubiquitous phenomenon in nature and has diverse technological applications, e.g. in heat and mass transfer. We investigated the condensation kinetics of water drops on a lubricant-impregnated surface, i.e., a micropillar array impregnated with a non-volatile ionic liquid. Growing and coalescing drops were imaged in 3D using a laser scanning confocal microscope equipped with a temperature and humidity control. Different stages of condensation can be discriminated. On a lubricant-impregnated hydrophobic micropillar array these are: (1) Nucleation on the lubricant surface. (2) Regular alignment of water drops between micropillars and formation of a three-phase contact line on a bottom of the substrate. (3) Deformation and bridging by coalescence which eventually leads to a detachment of the drops from the bottom substrate. The drop-substrate contact does not result in breakdown of the slippery behaviour. Contrary, on a lubricant-impregnated hydrophilic micropillar array, the condensed water drops replace the lubricant. Consequently, the surface loses its slippery property. Our results demonstrate that a Wenzel-like to Cassie transition, required to maintain the facile removal of condensed water drops, can be induced by well-chosen surface hydrophobicity.

  15. Atomic structure of diamond {111} surfaces etched in oxygen water vapor

    International Nuclear Information System (INIS)

    Theije, F.K. de; Reedijk, M.F.; Arsic, J.; Enckevort, W.J.P. van; Vlieg, E.

    2001-01-01

    The atomic structure of the {111} diamond face after oxygen-water-vapor etching is determined using x-ray scattering. We find that a single dangling bond diamond {111} surface model, terminated by a full monolayer of -OH fits our data best. To explain the measurements it is necessary to add an ordered water layer on top of the -OH terminated surface. The vertical contraction of the surface cell and the distance between the oxygen atoms are generally in agreement with model calculations and results on similar systems. The OH termination is likely to be present during etching as well. This model experimentally confirms the atomic-scale mechanism we proposed previously for this etching system

  16. Tritiated water vapor in the surface air at Tokyo

    International Nuclear Information System (INIS)

    Inoue, Hisayuki; Katsuragi, Yukio; Shigehara, Koji

    1984-01-01

    Tritium concentration in water vapor in the air near the surface and in the precipitation at Tokyo was measured during the period from 9 August to 20 November in 1974. From August to the middle of October, tritium mixing ratios in the surface air had relatively higher values except those in air masses which were associated with a typhoon. The mixing ratios of tritium in the air decreased abruptly at the middle of October, which indicates the decrease of tritium influx from aloft. These data exhibit the salient feature that variations in tritium concentration in TR are linear to the reciprocal of the content of water vapor during each period. Tritium concentrations in vapor and rain water collected simultaneously show nearly equal values. One of the reasons for the good correlation of tritium concentration between falling drops and ambient air is considered to be the result of the rapid isotopic exchange. (author)

  17. Water Transport and Removal in PEMFC Gas Flow Channel with Various Water Droplet Locations and Channel Surface Wettability

    Directory of Open Access Journals (Sweden)

    Yanzhou Qin

    2018-04-01

    Full Text Available Water transport and removal in the proton exchange membrane fuel cell (PEMFC is critically important to fuel cell performance, stability, and durability. Water emerging locations on the membrane-electrode assembly (MEA surface and the channel surface wettability significantly influence the water transport and removal in PEMFC. In most simulations of water transport and removal in the PEMFC flow channel, liquid water is usually introduced at the center of the MEA surface, which is fortuitous, since water droplet can emerge randomly on the MEA surface in PEMFC. In addition, the commonly used no-slip wall boundary condition greatly confines the water sliding features on hydrophobic MEA/channel surfaces, degrading the simulation accuracy. In this study, water droplet is introduced with various locations along the channel width direction on the MEA surface, and water transport and removal is investigated numerically using an improved model incorporating the sliding flow property by using the shear wall boundary condition. It is found that the water droplet can be driven to the channel sidewall by aerodynamics when the initial water location deviates from the MEA center to a certain amount, forming the water corner flow in the flow channel. The channel surface wettability on the water transport is also studied and is shown to have a significant impact on the water corner flow in the flow channel.

  18. Using a hybrid model to predict solute transfer from initially saturated soil into surface runoff with controlled drainage water.

    Science.gov (United States)

    Tong, Juxiu; Hu, Bill X; Yang, Jinzhong; Zhu, Yan

    2016-06-01

    The mixing layer theory is not suitable for predicting solute transfer from initially saturated soil to surface runoff water under controlled drainage conditions. By coupling the mixing layer theory model with the numerical model Hydrus-1D, a hybrid solute transfer model has been proposed to predict soil solute transfer from an initially saturated soil into surface water, under controlled drainage water conditions. The model can also consider the increasing ponding water conditions on soil surface before surface runoff. The data of solute concentration in surface runoff and drainage water from a sand experiment is used as the reference experiment. The parameters for the water flow and solute transfer model and mixing layer depth under controlled drainage water condition are identified. Based on these identified parameters, the model is applied to another initially saturated sand experiment with constant and time-increasing mixing layer depth after surface runoff, under the controlled drainage water condition with lower drainage height at the bottom. The simulation results agree well with the observed data. Study results suggest that the hybrid model can accurately simulate the solute transfer from initially saturated soil into surface runoff under controlled drainage water condition. And it has been found that the prediction with increasing mixing layer depth is better than that with the constant one in the experiment with lower drainage condition. Since lower drainage condition and deeper ponded water depth result in later runoff start time, more solute sources in the mixing layer are needed for the surface water, and larger change rate results in the increasing mixing layer depth.

  19. Water boiling on the corium melt surface under VVER severe accident conditions

    International Nuclear Information System (INIS)

    Bechta, S.V.; Vitol, S.A.; Krushinov, E.V.; Granovsky, V.S.; Sulatsky, A.A.; Khabensky, V.B.; Lopukh, D.B.; Petrov, Y.B.; Pechenkov, A.Y.

    2000-01-01

    Experimental results are presented on the interaction of corium melt with water supplied on its surface. The tests were conducted in the 'Rasplav-2' experimental facility. Corium melt was generated by induction melting in the cold crucible. The following data were obtained: heat transfer at boiling water-melt surface interaction, gas and aerosol release, post-interaction solidified corium structure. The corium melt charge had the following composition, mass%: 60% UO 2+x -16% ZrO 2 -15% Fe 2 O 3 -6% Cr 2 O 3 -3% Ni 2 O 3 . The melt surface temperature ranged within 1920-1970 K. (orig.)

  20. Water boiling on the corium melt surface under VVER severe accident conditions

    International Nuclear Information System (INIS)

    Bechta, S.V.; Vitol, S.A.; Krushinov, E.V.

    1999-01-01

    Experimental results are presented on the interaction between corium melt and water supplied onto its surface. The tests were conducted on the Rasplav-2' experimental facility. Induction melting in a cold crucible was used to produce the melt. The following data have been obtained: heat transfer at water boiling on the melt surface, aerosol release, structure of the post-interaction solidified corium. The corium melt had the following composition, mass %: 60%UO 2 - 16%ZrO 2 - 15%Fe 2 O 3 - 6%Cr 2 O 3 -3%Ni 2 O 3 . The melt surface temperature was 1650-1700degC. (author)

  1. Monitoring the dynamics of surface water fraction from MODIS time series in a Mediterranean environment

    Science.gov (United States)

    Li, Linlin; Vrieling, Anton; Skidmore, Andrew; Wang, Tiejun; Turak, Eren

    2018-04-01

    Detailed spatial information of changes in surface water extent is needed for water management and biodiversity conservation, particularly in drier parts of the globe where small, temporally-variant wetlands prevail. Although global surface water histories are now generated from 30 m Landsat data, for many locations they contain large temporal gaps particularly for longer periods (>10 years) due to revisit intervals and cloud cover. Daily Moderate Resolution Imaging Spectrometer (MODIS) imagery has potential to fill such gaps, but its relatively coarse spatial resolution may not detect small water bodies, which can be of great ecological importance. To address this problem, this study proposes and tests options for estimating the surface water fraction from MODIS 16-day 500 m Bidirectional Reflectance Distribution Function (BRDF) corrected surface reflectance image composites. The spatial extent of two Landsat tiles over Spain were selected as test areas. We obtained a 500 m reference dataset on surface water fraction by spatially aggregating 30 m binary water masks obtained from the Landsat-derived C-version of Function of Mask (CFmask), which themselves were evaluated against high-resolution Google Earth imagery. Twelve regression tree models were developed with two approaches, Random Forest and Cubist, using spectral metrics derived from MODIS data and topographic parameters generated from a 30 m spatial resolution digital elevation model. Results showed that accuracies were higher when we included annual summary statistics of the spectral metrics as predictor variables. Models trained on a single Landsat tile were ineffective in mapping surface water in the other tile, but global models trained with environmental conditions from both tiles can provide accurate results for both study areas. We achieved the highest accuracy with Cubist global model (R2 = 0.91, RMSE = 11.05%, MAE = 7.67%). Our method was not only effective for mapping permanent water fraction, but

  2. Agricultural insecticides threaten surface waters at the global scale.

    Science.gov (United States)

    Stehle, Sebastian; Schulz, Ralf

    2015-05-05

    Compared with nutrient levels and habitat degradation, the importance of agricultural pesticides in surface water may have been underestimated due to a lack of comprehensive quantitative analysis. Increasing pesticide contamination results in decreasing regional aquatic biodiversity, i.e., macroinvertebrate family richness is reduced by ∼30% at pesticide concentrations equaling the legally accepted regulatory threshold levels (RTLs). This study provides a comprehensive metaanalysis of 838 peer-reviewed studies (>2,500 sites in 73 countries) that evaluates, for the first time to our knowledge on a global scale, the exposure of surface waters to particularly toxic agricultural insecticides. We tested whether measured insecticide concentrations (MICs; i.e., quantified insecticide concentrations) exceed their RTLs and how risks depend on insecticide development over time and stringency of environmental regulation. Our analysis reveals that MICs occur rarely (i.e., an estimated 97.4% of analyses conducted found no MICs) and there is a complete lack of scientific monitoring data for ∼90% of global cropland. Most importantly, of the 11,300 MICs, 52.4% (5,915 cases; 68.5% of the sites) exceeded the RTL for either surface water (RTLSW) or sediments. Thus, the biological integrity of global water resources is at a substantial risk. RTLSW exceedances depend on the catchment size, sampling regime, and sampling date; are significantly higher for newer-generation insecticides (i.e., pyrethroids); and are high even in countries with stringent environmental regulations. These results suggest the need for worldwide improvements to current pesticide regulations and agricultural pesticide application practices and for intensified research efforts on the presence and effects of pesticides under real-world conditions.

  3. Basin scale management of surface and ground water

    International Nuclear Information System (INIS)

    Tracy, J.C.; Al-Sharif, M.

    1993-01-01

    An important element in the economic development of many regions of the Great Plains is the availability of a reliable water supply. Due to the highly variable nature of the climate through out much of the Great Plains region, non-controlled stream flow rates tend to be highly variable from year to year. Thus, the primary water supply has tended towards developing ground water aquifers. However, in regions where shallow ground water is extracted for use, there exists the potential for over drafting aquifers to the point of depleting hydraulically connected stream flows, which could adversely affect the water supply of downstream users. To prevent the potential conflict that can arise when a basin's water supply is being developed or to control the water extractions within a developed basin requires the ability to predict the effect that water extractions in one region will have on water extractions from either surface or ground water supplies else where in the basin. This requires the ability to simulate ground water levels and stream flows on a basin scale as affected by changes in water use, land use practices and climatic changes within the basin. The outline for such a basin scale surface water-ground water model has been presented in Tracy (1991) and Tracy and Koelliker (1992), and the outline for the mathematical programming statement to aid in determining the optimal allocation of water on a basin scale has been presented in Tracy and Al-Sharif (1992). This previous work has been combined into a computer based model with graphical output referred to as the LINOSA model and was developed as a decision support system for basin managers. This paper will present the application of the LINOSA surface-ground water management model to the Rattlesnake watershed basin that resides within Ground Water Management District Number 5 in south central Kansas

  4. Screening and human health risk assessment of pharmaceuticals and their transformation products in Dutch surface waters and drinking water.

    Science.gov (United States)

    de Jongh, Cindy M; Kooij, Pascal J F; de Voogt, Pim; ter Laak, Thomas L

    2012-06-15

    Numerous studies describe the presence of pharmaceuticals in the water cycle, while their transformation products are usually not included. In the current study 17 common pharmaceuticals and 9 transformation products were monitored in the Dutch waters, including surface waters, pre-treated surface waters, river bank filtrates, two groundwater samples affected by surface water and drinking waters. In these samples, 12 pharmaceuticals and 7 transformation products were present. Concentrations were generally highest in surface waters, intermediate in treated surface waters and river bank filtrates and lowest or not detected in produced drinking water. However, the concentrations of phenazone and its environmental transformation product AMPH were significantly higher in river bank filtrates, which is likely due to historical contamination. Fairly constant ratios were observed between concentrations of transformation products and parent pharmaceuticals. This might enable prediction of concentrations of transformation products from concentrations of parent pharmaceuticals. The toxicological relevance of the observed pharmaceuticals and transformation products was assessed by deriving (i) a substance specific provisional guideline value (pGLV) and (ii) a group pGLV for groups of related compounds were under the assumption of additivity of effects within each group. A substantial margin exists between the maximum summed concentrations of these compounds present in different water types and the derived (group) pGLVs. Based on the results of this limited screening campaign no adverse health effects of the studied compounds are expected in (sources of) drinking water in the Netherlands. The presence of transformation products with similar pharmacological activities and concentration levels as their parents illustrates the relevance of monitoring transformation products, and including these in risk assessment. More thorough monitoring yielding information on statistical

  5. Screening and human health risk assessment of pharmaceuticals and their transformation products in Dutch surface waters and drinking water

    International Nuclear Information System (INIS)

    Jongh, Cindy M. de; Kooij, Pascal J.F.; Voogt, Pim de; Laak, Thomas L. ter

    2012-01-01

    Numerous studies describe the presence of pharmaceuticals in the water cycle, while their transformation products are usually not included. In the current study 17 common pharmaceuticals and 9 transformation products were monitored in the Dutch waters, including surface waters, pre-treated surface waters, river bank filtrates, two groundwater samples affected by surface water and drinking waters. In these samples, 12 pharmaceuticals and 7 transformation products were present. Concentrations were generally highest in surface waters, intermediate in treated surface waters and river bank filtrates and lowest or not detected in produced drinking water. However, the concentrations of phenazone and its environmental transformation product AMPH were significantly higher in river bank filtrates, which is likely due to historical contamination. Fairly constant ratios were observed between concentrations of transformation products and parent pharmaceuticals. This might enable prediction of concentrations of transformation products from concentrations of parent pharmaceuticals. The toxicological relevance of the observed pharmaceuticals and transformation products was assessed by deriving (i) a substance specific provisional guideline value (pGLV) and (ii) a group pGLV for groups of related compounds were under the assumption of additivity of effects within each group. A substantial margin exists between the maximum summed concentrations of these compounds present in different water types and the derived (group) pGLVs. Based on the results of this limited screening campaign no adverse health effects of the studied compounds are expected in (sources of) drinking water in the Netherlands. The presence of transformation products with similar pharmacological activities and concentration levels as their parents illustrates the relevance of monitoring transformation products, and including these in risk assessment. More thorough monitoring yielding information on statistical

  6. Theoretical Study of Sodium-Water Surface Reaction Mechanism

    Science.gov (United States)

    Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR).

  7. Theoretical study of sodium-water surface reaction mechanism

    International Nuclear Information System (INIS)

    Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro

    2012-01-01

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR). (author)

  8. Evidence for phase separation of ethanol-water mixtures at the hydrogen terminated nanocrystalline diamond surface.

    Science.gov (United States)

    Janssens, Stoffel D; Drijkoningen, Sien; Saitner, Marc; Boyen, Hans-Gerd; Wagner, Patrick; Larsson, Karin; Haenen, Ken

    2012-07-28

    Interactions between ethanol-water mixtures and a hydrophobic hydrogen terminated nanocrystalline diamond surface, are investigated by sessile drop contact angle measurements. The surface free energy of the hydrophobic surface, obtained with pure liquids, differs strongly from values obtained by ethanol-water mixtures. Here, a model which explains this difference is presented. The model suggests that, due to a higher affinity of ethanol for the hydrophobic surface, when compared to water, a phase separation occurs when a mixture of both liquids is in contact with the H-terminated diamond surface. These results are supported by a computational study giving insight in the affinity and related interaction at the liquid-solid interface.

  9. Water use and quality of fresh surface-water resources in the Barataria-Terrebonne Basins, Louisiana

    Science.gov (United States)

    Johnson-Thibaut, Penny M.; Demcheck, Dennis K.; Swarzenski, Christopher M.; Ensminger, Paul A.

    1998-01-01

    Approximately 170 Mgal/d (million gallons per day) of ground- and surface-water was withdrawn from the Barataria-Terrebonne Basins in 1995. Of this amount, surface water accounted for 64 percent ( 110 MgaVd) of the total withdrawal rates in the basins. The largest surface-water withdrawal rates were from Bayou Lafourche ( 40 Mgal/d), Bayou Boeuf ( 14 MgaVd), and the Gulf Intracoastal Waterway (4.2 Mgal/d). The largest ground-water withdrawal rates were from the Mississippi River alluvial aquifer (29 Mgal/d), the Gonzales-New Orleans aquifer (9.5 Mgal/d), and the Norco aquifer (3.6 MgaVd). The amounts of water withdrawn in the basins in 1995 differed by category of use. Public water suppliers within the basins withdrew 41 Mgal/d of water. The five largest public water suppliers in the basins withdrew 30 Mgal/d of surface water: Terrebonne Waterworks District 1 withdrew the largest amount, almost 15 MgaVd. Industrial facilities withdrew 88 Mgal/d, fossil-fuel plants withdrew 4.7 MgaVd, and commercial facilities withdrew 0.67 MgaVd. Aggregate water-withdrawal rates, compiled by parish for aquaculture (37 Mgal/d), livestock (0.56 Mgal/d), rural domestic (0.44 MgaVd), and irrigation uses (0.54 MgaVd), totaled about 38 MgaVd in the basins. Ninety-five percent of aquaculture withdrawal rates, primarily for crawfish and alligator farming, were from surface-water sources. >br> Total water-withdrawal rates increased 221 percent from 1960–95. Surface-water withdrawal rates have increased by 310 percent, and ground-water withdrawal rates have increased by 133 percent. The projection for the total water-withdrawal rates in 2020 is 220 MgaVd, an increase of 30 percent from 1995. Surface-water withdrawal rates would account for 59 percent of the total, or 130 Mgal/d. Surface-water withdrawal rates are projected to increase by 20 percent from 1995 to 2020. Analysis of water-quality data from the Mississippi River indicates that the main threats to surface water resources are

  10. Liquid Water may Stick on Hydrophobic Surfaces

    Indian Academy of Sciences (India)

    IAS Admin

    Common Perception. A surface can be classified as. > Wetting. > Non-wetting. Depending on the spreading characteristics of a droplet of water that splashes on the surface. The behavior of fluid on a solid surface under static and dynamic ..... color of the number density profile. Ions at the interface tend to form pinning zones ...

  11. Contamination of ground water, surface water, and soil, and evaluation of selected ground-water pumping alternatives in the Canal Creek area of Aberdeen Proving Ground, Maryland

    Science.gov (United States)

    Lorah, Michelle M.; Clark, Jeffrey S.

    1996-01-01

    Chemical manufacturing, munitions filling, and other military-support activities have resulted in the contamination of ground water, surface water, and soil in the Canal Creek area of Aberdeen Proving Ground, Maryland. Chlorinated volatile organic compounds, including 1,1,2,2-tetrachloroethane and trichloroethylene, are widespread ground-water contaminants in two aquifers that are composed of unconsolidated sand and gravel. Distribution and fate of chlorinated organic compounds in the ground water has been affected by the movement and dissolution of solvents in their dense immiscible phase and by microbial degradation under anaerobic conditions. Detection of volatile organic contaminants in adjacent surface water indicates that shallow contaminated ground water discharges to surface water. Semivolatile organic compounds, especially polycyclic aromatic hydrocarbons, are the most prevalent organic contaminants in soils. Various trace elements, such as arsenic, cadmium, lead, and zinc, were found in elevated concentrations in ground water, surface water, and soil. Simulations with a ground-water-flow model and particle tracker postprocessor show that, without remedial pumpage, the contaminants will eventually migrate to Canal Creek and Gunpowder River. Simulations indicate that remedial pumpage of 2.0 million gallons per day from existing wells is needed to capture all particles originating in the contaminant plumes. Simulated pumpage from offsite wells screened in a lower confined aquifer does not affect the flow of contaminated ground water in the Canal Creek area.

  12. Sampling procedure for lake or stream surface water chemistry

    Science.gov (United States)

    Robert Musselman

    2012-01-01

    Surface waters collected in the field for chemical analyses are easily contaminated. This research note presents a step-by-step detailed description of how to avoid sample contamination when field collecting, processing, and transporting surface water samples for laboratory analysis.

  13. Modelling episodic acidification of surface waters: the state of science.

    Science.gov (United States)

    Eshleman, K N; Wigington, P J; Davies, T D; Tranter, M

    1992-01-01

    Field studies of chemical changes in surface waters associated with rainfall and snowmelt events have provided evidence of episodic acidification of lakes and streams in Europe and North America. Modelling these chemical changes is particularly challenging because of the variability associated with hydrological transport and chemical transformation processes in catchments. This paper provides a review of mathematical models that have been applied to the problem of episodic acidification. Several empirical approaches, including regression models, mixing models and time series models, support a strong hydrological interpretation of episodic acidification. Regional application of several models has suggested that acidic episodes (in which the acid neutralizing capacity becomes negative) are relatively common in surface waters in several regions of the US that receive acid deposition. Results from physically based models have suggested a lack of understanding of hydrological flowpaths, hydraulic residence times and biogeochemical reactions, particularly those involving aluminum. The ability to better predict episodic chemical responses of surface waters is thus dependent upon elucidation of these and other physical and chemical processes.

  14. Surface tension of normal and heavy water

    International Nuclear Information System (INIS)

    Straub, J.; Rosner, N.; Grigull, V.

    1980-01-01

    A Skeleton Table and simple interpolation equation for the surface tension of light water was developed by the Working Group III of the International Association for the Properties of Steam and is recommended as an International Standard. The Skeleton Table is based on all known measurements of the surface tension and individual data were weighted corresponding to the accuracy of the measurements. The form of the interpolation equation is based on a physical concept. It represents an extension of van der Waals-equation, where the exponent conforms to the 'Scaling Laws'. In addition for application purposes simple relations for the Laplace-coefficient and for the density difference between the liquid and gaseous phases of light water are given. The same form of interpolation equation for the surface tension can be used for heavy water, for which the coefficients are given. However, this equation is based only on a single set of data. (orig.) [de

  15. Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.

    Science.gov (United States)

    Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

    2018-04-19

    Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

  16. Occurrence of estrogenic activities in second-grade surface water and ground water in the Yangtze River Delta, China

    International Nuclear Information System (INIS)

    Shi, Wei; Hu, Guanjiu; Chen, Sulan; Wei, Si; Cai, Xi; Chen, Bo; Feng, Jianfang; Hu, Xinxin; Wang, Xinru; Yu, Hongxia

    2013-01-01

    Second-grade surface water and ground water are considered as the commonly used cleanest water in the Yangtze River Delta, which supplies centralized drinking water and contains rare species. However, some synthetic chemicals with estrogenic disrupting activities are detectable. Estrogenic activities in the second-grade surface water and ground water were surveyed by a green monkey kidney fibroblast (CV-1) cell line based ER reporter gene assay. Qualitative and quantitative analysis were further conducted to identify the responsible compounds. Estrogen receptor (ER) agonist activities were present in 7 out of 16 surface water and all the ground water samples. Huaihe River and Yangtze River posed the highest toxicity potential. The highest equivalent (2.2 ng E 2 /L) is higher than the predicted no-effect-concentration (PNEC). Bisphenol A (BPA) contributes to greater than 50% of the total derived equivalents in surface water, and the risk potential in this region deserves more attention and further research. -- Highlights: •Estrogenic activities were present in second-grade surface water and ground water. •Most of the detected equivalents were higher than the predicted no-effect-concentration of E 2 . •ER-EQ 20–80 ranges showed that samples in Huaihe River and Yangtze River posed the highest toxicity. •Bisphenol A contributes to most of the instrumentally derived equivalents in surface water. -- Estrogenic activities were observed in second-grade surface water and ground water in Yangtze River Delta, and BPA was the responsible contaminant

  17. Computational studies of atmospherically-relevant chemical reactions in water clusters and on liquid water and ice surfaces.

    Science.gov (United States)

    Gerber, R Benny; Varner, Mychel E; Hammerich, Audrey D; Riikonen, Sampsa; Murdachaew, Garold; Shemesh, Dorit; Finlayson-Pitts, Barbara J

    2015-02-17

    CONSPECTUS: Reactions on water and ice surfaces and in other aqueous media are ubiquitous in the atmosphere, but the microscopic mechanisms of most of these processes are as yet unknown. This Account examines recent progress in atomistic simulations of such reactions and the insights provided into mechanisms and interpretation of experiments. Illustrative examples are discussed. The main computational approaches employed are classical trajectory simulations using interaction potentials derived from quantum chemical methods. This comprises both ab initio molecular dynamics (AIMD) and semiempirical molecular dynamics (SEMD), the latter referring to semiempirical quantum chemical methods. Presented examples are as follows: (i) Reaction of the (NO(+))(NO3(-)) ion pair with a water cluster to produce the atmospherically important HONO and HNO3. The simulations show that a cluster with four water molecules describes the reaction. This provides a hydrogen-bonding network supporting the transition state. The reaction is triggered by thermal structural fluctuations, and ultrafast changes in atomic partial charges play a key role. This is an example where a reaction in a small cluster can provide a model for a corresponding bulk process. The results support the proposed mechanism for production of HONO by hydrolysis of NO2 (N2O4). (ii) The reactions of gaseous HCl with N2O4 and N2O5 on liquid water surfaces. Ionization of HCl at the water/air interface is followed by nucleophilic attack of Cl(-) on N2O4 or N2O5. Both reactions proceed by an SN2 mechanism. The products are ClNO and ClNO2, precursors of atmospheric atomic chlorine. Because this mechanism cannot result from a cluster too small for HCl ionization, an extended water film model was simulated. The results explain ClNO formation experiments. Predicted ClNO2 formation is less efficient. (iii) Ionization of acids at ice surfaces. No ionization is found on ideal crystalline surfaces, but the process is efficient on

  18. Probability of misclassifying biological elements in surface waters.

    Science.gov (United States)

    Loga, Małgorzata; Wierzchołowska-Dziedzic, Anna

    2017-11-24

    Measurement uncertainties are inherent to assessment of biological indices of water bodies. The effect of these uncertainties on the probability of misclassification of ecological status is the subject of this paper. Four Monte-Carlo (M-C) models were applied to simulate the occurrence of random errors in the measurements of metrics corresponding to four biological elements of surface waters: macrophytes, phytoplankton, phytobenthos, and benthic macroinvertebrates. Long series of error-prone measurement values of these metrics, generated by M-C models, were used to identify cases in which values of any of the four biological indices lay outside of the "true" water body class, i.e., outside the class assigned from the actual physical measurements. Fraction of such cases in the M-C generated series was used to estimate the probability of misclassification. The method is particularly useful for estimating the probability of misclassification of the ecological status of surface water bodies in the case of short sequences of measurements of biological indices. The results of the Monte-Carlo simulations show a relatively high sensitivity of this probability to measurement errors of the river macrophyte index (MIR) and high robustness to measurement errors of the benthic macroinvertebrate index (MMI). The proposed method of using Monte-Carlo models to estimate the probability of misclassification has significant potential for assessing the uncertainty of water body status reported to the EC by the EU member countries according to WFD. The method can be readily applied also in risk assessment of water management decisions before adopting the status dependent corrective actions.

  19. Virtual Mission First Results Supporting the WATER HM Satellite Concept

    Science.gov (United States)

    Alsdorf, D.; Andreadis, K.; Lettenmaier, D.; Moller, D.; Rodriguez, E.; Bates, P.; Mognard, N.; Participants, W.

    2007-12-01

    Surface fresh water is essential for life, yet we have surprisingly poor knowledge of its variability in space and time. Similarly, ocean circulation and ocean-atmosphere interactions fundamentally drive weather and climate variability, yet the global ocean current and eddy field (e.g., the Gulf Stream) that affects ocean circulation is poorly known. The Water And Terrestrial Elevation Recovery Hydrosphere Mapper satellite mission concept (WATER HM or SWOT per the NRC Decadal Survey) is a swath-based interferometric-altimeter designed to acquire elevations of ocean and terrestrial water surfaces at unprecedented spatial and temporal resolutions. WATER HM will have tremendous implications for estimation of the global water cycle, water management, ocean and coastal circulation, and assessment of many water-related impacts from climate change (e.g., sea level rise, carbon evasion, etc.). We describe a hydrological "virtual mission" (VM) for WATER HM which consists of: (a) A hydrodynamic-instrument simulation model that maps variations in water levels along river channels and across floodplains. These are then assimilated to estimate discharge and to determine trade-offs between resolutions and mission costs. (b) Measurements from satellites to determine feasibility of existing platforms for measuring storage changes and estimating discharge. First results demonstrate that: (1) Ensemble Kalman filtering of VM simulations recover water depth and discharge, reducing the discharge RMSE from 23.2% to 10.0% over an 84- day simulation period, relative to a simulation without assimilation. The filter also shows that an 8-day overpass frequency produces discharge relative errors of 10.0%, while 16-day and 32-day frequencies result in errors of 12.1% and 16.9%, respectively. (2) SRTM measurements of water surfaces along the Mississippi, Missouri, Ohio, and Amazon rivers, as well as smaller tributaries, show height standard deviations of 5 meters or greater (SRTM is the

  20. Nitrogen patterns in subsurface waters of the Yzeron stream: effect of combined sewer overflows and subsurface-surface water mixing.

    Science.gov (United States)

    Aucour, A M; Bariac, T; Breil, P; Namour, P; Schmitt, L; Gnouma, R; Zuddas, P

    2013-01-01

    Urbanization subjects streams to increased nitrogen loads. Therefore studying nitrogen forms at the interface between urban stream and groundwater is important for water resource management. In this study we report results on water δ(18)O and nitrogen forms in subsurface waters of a stream (Yzeron, France). The sites studied were located upstream and downstream of combined sewer overflows (CSO) in a rural area and a periurban area, respectively. Water δ(18)O allowed us to follow the mixing of subsurface water with surface water. Dissolved organic nitrogen and organic carbon of fine sediment increased by 20-30% between rural and periurban subsurface waters in the cold season, under high flow. The highest nitrate levels were observed in rural subsurface waters in the cold season. The lowest nitrate levels were found in periurban subsurface waters in the warm season, under low flow. They corresponded to slow exchange of subsurface waters with channel water. Thus reduced exchange between surface and subsurface waters and organic-matter-rich input seemed to favor nitrate reduction in the downstream, periurban, subsurface waters impacted by CSO.

  1. Direct measurements of the tile drain and groundwater flow route contributions to surface water contamination: From field-scale concentration patterns in groundwater to catchment-scale surface water quality

    International Nuclear Information System (INIS)

    Rozemeijer, J.C.; Velde, Y. van der; Geer, F.C. van; Bierkens, M.F.P.; Broers, H.P.

    2010-01-01

    Enhanced knowledge of water and solute pathways in catchments would improve the understanding of dynamics in water quality and would support the selection of appropriate water pollution mitigation options. For this study, we physically separated tile drain effluent and groundwater discharge from an agricultural field before it entered a 43.5-m ditch transect. Through continuous discharge measurements and weekly water quality sampling, we directly quantified the flow route contributions to surface water discharge and solute loading. Our multi-scale experimental approach allowed us to relate these measurements to field-scale NO 3 concentration patterns in shallow groundwater and to continuous NO 3 records at the catchment outlet. Our results show that the tile drains contributed 90-92% of the annual NO 3 and heavy metal loads. Considering their crucial role in water and solute transport, enhanced monitoring and modeling of tile drainage are important for adequate water quality management. - Direct measurements of flow route contributions to surface water contaminant loading reveal the crucial role of tile drainage for catchment-scale water and solute transport.

  2. Stormwater Priority Pollutants Versus Surface Water Quality Criteria

    DEFF Research Database (Denmark)

    Eriksson, Eva; Ledin, Anna; Baun, Anders

    2011-01-01

    Stormwater in urban areas comprises of a substantial part of the urban water cycle, dominating the flow in many small urban streams, and the pollution levels are sizeable. No stormwater quality criteria were found here and no European or national emission limit values exist. Stormwater pollutants...... however are present in levels exceeding most of the regulated surface water quality criteria and environmental quality standards. Therefore catchment characterisation is needed to chose suitable treatment prior to discharge into receiving surface waters, as the mixing may be insufficient in small streams....

  3. Water condensation on ultrahydrophobic flexible micro pillar surface

    Science.gov (United States)

    Narhe, Ramchandra

    2016-05-01

    We investigated the growth dynamics of water drops in controlled condensation on ultrahydrophobic geometrically patterned polydimethylsiloxane (PDMS) cylindrical micro pillars. At the beginning, the condensed drops size is comparable to the pattern dimensions. The interesting phenomenon we observe is that, as the condensation progresses, water drops between the pillars become unstable and enforced to grow in the upward direction along the pillars surface. The capillary force of these drops is of the order of μ\\text{N} and acts on neighboring pillars. That results into bending of the pillars. Pillars bending enhances the condensation and favors the most energetically stable Wenzel state.

  4. Effects of hot water pre-extraction on surface properties of bagasse soda pulp.

    Science.gov (United States)

    Cordeiro, Nereida; Ashori, Alireza; Hamzeh, Yahya; Faria, Marisa

    2013-03-01

    In this work, the effects of hot water pre-extraction of depithed bagasse on the soda pulping and surface properties were studied. The conditions of hot water pre-extraction were: maximum temperature 170 °C, heat-up time 90 min, time at maximum temperature 10 min, and solid to liquor ratio (S:L) 1:8. Consequently, the pre-extracted and un-extracted bagasse chips were subjected to soda pulping at 160 °C for 1h with 11, 14 and 17% active alkali charge and an S:L of 1:5. The results showed that the hot water pre-extraction increased bagasse surface texture porosity by hemicellulose degradation. Therefore, the delignification was faster for pulping of pre-extracted samples. At a certain charge of alkali, pre-extracted samples showed higher screened yield and lower Kappa number. For instance, at 17% alkali charge, pre-extracted bagasse gave 11.3% higher pulp yield compared with the un-extracted ones. Inverse gas chromatography (IGC) results showed that the hot water pre-extraction changed the active sites on the bagasse surface, decreasing the dispersive energy and the basicity character, and affected the particle morphology. The pulping process decreased the hydrophobicity and the basicity of the bagasse surface. The surfaces of un-extracted and pre-extracted bagasse pulps had similar properties but different morphology. The pulps present higher surface area and permeability with more reactive capacity. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Radiolysis of water in the vicinity of passive surfaces

    International Nuclear Information System (INIS)

    Moreau, S.; Fenart, M.; Renault, J.P.

    2014-01-01

    Highlights: • HO° production through water radiolysis is enhanced near metal surfaces. • Hastelloy and Stainless steel surfaces can also produce HO° radicals through hydrogen peroxide activation. • There is a deficit in solvated electron production compared to hydroxyl radicals near metal surfaces. - Abstract: Porous metals were used to describe the water radiolysis in the vicinity of metal surfaces. The hydroxyl radical production under gamma irradiation was measured by benzoate scavenging in water confined in a 200 nm porous Ni base alloy or in Stainless steel. The presence of the metallic surfaces changed drastically the HO° production level and lifetime. The solvated electron production was measured via glycylglycine scavenging for Stainless steel and was found to be significantly smaller than hydroxyl production. These observations imply that interfacial radiolysis may deeply impact the corrosion behavior of the SS and Ni based alloys

  6. Forming chemical composition of surface waters in the Arctic as "water - rock" interaction. Case study of lake Inari and river Paz

    Science.gov (United States)

    Mazukhina, Svetlana; Sandimirov, Sergey; Pozhilenko, Vladimir; Ivanov, Stanislav; Maksimova, Viktoriia

    2017-04-01

    Due to the depletion of fresh water supplies and the deterioration of their quality as a result of anthropogenic impact on the Arctic ecosystems, the research questions of forming surface and ground waters, their interactions with the rocks, development of the foundations for their rational use and protection are of great fundamental and practical importance. The aim of the work is to evaluate the influence of the chemical composition of rocks of the northern part of the Fennoscandian (Baltic) shield on forming surface waters chemical composition (Lake Inari, river Paz) using physical-chemical modeling (Chudnenko, 2010, Selector software package). River Paz (Paatsjoki) is the largest river in North Fennoscandia and flows through the territory of three countries - Finland, Russia and Norway. It originates from Lake Inari, which a large number of streams and rivers flow into, coming from the mountain range of the northern Finland (Maanselkä hill). Within the catchment of inflows feeding the lake Inari and river Paz in its upper flow there are mainly diverse early Precambrian metamorphic and intrusive rocks of the Lapland granulite belt and its framing, and to a lesser extent - various gneisses and migmatites with relicts of amphibolites, granitic gneisses, plagioclase and plagio- and plagiomicrocline granites, and quartz diorites of Inari terrane (Meriläinen, 1976, fig 1; Hörmann et al, 1980, fig 1; Geologicalmap, 2001). Basing on the techniques developed earlier (Mazukhina, 2012), and the data of monitoring of the chemical composition of surface waters and investigation of the chemical composition of the rocks, physical-chemical modeling (FCM) (Selector software package) was carried out. FCM includes 34 independent components (Al-B-Br-Ar-He-Ne-C-Ca-Cl-F-Fe-K-Mg-Mn-N-Na-P-S-Si-Sr-Cu-Zn-Ni-Pb-V-Ba-Co-Cr-Hg-As-Cd-H-O-e), 996 dependent components, of them 369 in aqueous solution, 76 in the gas phase, 111 liquid hydrocarbons, and 440 solid phases, organic and mineral

  7. A Probabilistic Analysis of Surface Water Flood Risk in London.

    Science.gov (United States)

    Jenkins, Katie; Hall, Jim; Glenis, Vassilis; Kilsby, Chris

    2017-10-30

    Flooding in urban areas during heavy rainfall, often characterized by short duration and high-intensity events, is known as "surface water flooding." Analyzing surface water flood risk is complex as it requires understanding of biophysical and human factors, such as the localized scale and nature of heavy precipitation events, characteristics of the urban area affected (including detailed topography and drainage networks), and the spatial distribution of economic and social vulnerability. Climate change is recognized as having the potential to enhance the intensity and frequency of heavy rainfall events. This study develops a methodology to link high spatial resolution probabilistic projections of hourly precipitation with detailed surface water flood depth maps and characterization of urban vulnerability to estimate surface water flood risk. It incorporates probabilistic information on the range of uncertainties in future precipitation in a changing climate. The method is applied to a case study of Greater London and highlights that both the frequency and spatial extent of surface water flood events are set to increase under future climate change. The expected annual damage from surface water flooding is estimated to be to be £171 million, £343 million, and £390 million/year under the baseline, 2030 high, and 2050 high climate change scenarios, respectively. © 2017 Society for Risk Analysis.

  8. Multi-functional surfaces with controllable wettability and water adhesion

    Science.gov (United States)

    Anastasiadis, Spiros H.; Frysali, Melani A.; Kenanakis, George; Kaklamani, Georgia; Papoutsakis, Lampros

    The design of multifunctional surfaces based on biomimetic structures has gained the interest of the scientific community. Novel multifunctional surfaces have been developed, able to alter their wetting properties in response to temperature and pH as well as light illumination, by combining proper chemistry and surface micro/nano-structuring using ultrafast (femtosecond) laser irradiation. The combination of the hierarchical surface with a ZnO and/or a responsive polymer coating results in efficient photo-active properties as well as reversible superhydrophobic / superhydrophilic surfaces in response to external stimuli. These surfaces can be optimized to exhibit high or zero water adhesion and/or controllable directionality as well. Moreover, they can be seeded with human fibroblasts to examine the cellular response on both surface roughness and surface chemistry. Acknowledgements: This research has been co-financed by the General Secretariat for Research and Technology (''ARISTEIA II'' Action, SMART-SURF) and the European Union (NFFA Europe -Grant agreement No. 654360).

  9. IMPROVING CYANOBACTERIA AND CYANOTOXIN MONITORING IN SURFACE WATERS FOR DRINKING WATER SUPPLY

    Directory of Open Access Journals (Sweden)

    Jing Li

    2017-06-01

    Full Text Available Cyanobacteria in fresh water can cause serious threats to drinking water supplies. Managing cyanobacterial blooms particularly at small drinking water treatment plants is challenging. Because large amount of cyanobacteria may cause clogging in the treatment process and various cyanotoxins are hard to remove, while they may cause severe health problems. There is lack of instructions of what cyanobacteria/toxin amount should trigger what kind of actions for drinking water management except for Microcystins. This demands a Cyanobacteria Management Tool (CMT to help regulators/operators to improve cyanobacteria/cyanotoxin monitoring in surface waters for drinking water supply. This project proposes a CMT tool, including selecting proper indicators for quick cyanobacteria monitoring and verifying quick analysis methods for cyanobacteria and cyanotoxin. This tool is suggested for raw water management regarding cyanobacteria monitoring in lakes, especially in boreal forest climate. In addition, it applies to regions that apply international WHO standards for water management. In Swedish context, drinking water producers which use raw water from lakes that experience cyanobacterial blooms, need to create a monitoring routine for cyanobacteria/cyanotoxin and to monitor beyond such as Anatoxins, Cylindrospermopsins and Saxitoxins. Using the proposed CMT tool will increase water safety at surface water treatment plants substantially by introducing three alerting points for actions. CMT design for each local condition should integrate adaptive monitoring program.

  10. Modeling groundwater/surface-water interactions in an Alpine valley (the Aosta Plain, NW Italy): the effect of groundwater abstraction on surface-water resources

    Science.gov (United States)

    Stefania, Gennaro A.; Rotiroti, Marco; Fumagalli, Letizia; Simonetto, Fulvio; Capodaglio, Pietro; Zanotti, Chiara; Bonomi, Tullia

    2018-02-01

    A groundwater flow model of the Alpine valley aquifer in the Aosta Plain (NW Italy) showed that well pumping can induce river streamflow depletions as a function of well location. Analysis of the water budget showed that ˜80% of the water pumped during 2 years by a selected well in the downstream area comes from the baseflow of the main river discharge. Alluvial aquifers hosted in Alpine valleys fall within a particular hydrogeological context where groundwater/surface-water relationships change from upstream to downstream as well as seasonally. A transient groundwater model using MODFLOW2005 and the Streamflow-Routing (SFR2) Package is here presented, aimed at investigating water exchanges between the main regional river (Dora Baltea River, a left-hand tributary of the Po River), its tributaries and the underlying shallow aquifer, which is affected by seasonal oscillations. The three-dimensional distribution of the hydraulic conductivity of the aquifer was obtained by means of a specific coding system within the database TANGRAM. Both head and flux targets were used to perform the model calibration using PEST. Results showed that the fluctuations of the water table play an important role in groundwater/surface-water interconnections. In upstream areas, groundwater is recharged by water leaking through the riverbed and the well abstraction component of the water budget changes as a function of the hydraulic conditions of the aquifer. In downstream areas, groundwater is drained by the river and most of the water pumped by wells comes from the base flow component of the river discharge.

  11. Water boiling on the corium melt surface under VVER severe accident conditions

    Energy Technology Data Exchange (ETDEWEB)

    Bechta, S.V.; Vitol, S.A.; Krushinov, E.V.; Granovsky, V.S.; Sulatsky, A.A.; Khabensky, V.B. [Sci. Res. Technol. Inst., Leningrad (Russian Federation); Lopukh, D.B.; Petrov, Y.B.; Pechenkov, A.Y. [St. Petersburg Electrotechnical University (SPbEU), Prof. Popov st 5/3, St. Petersburg (Russian Federation)

    2000-01-01

    Experimental results are presented on the interaction of corium melt with water supplied on its surface. The tests were conducted in the 'Rasplav-2' experimental facility. Corium melt was generated by induction melting in the cold crucible. The following data were obtained: heat transfer at boiling water-melt surface interaction, gas and aerosol release, post-interaction solidified corium structure. The corium melt charge had the following composition, mass%: 60% UO{sub 2+x}-16% ZrO{sub 2}-15% Fe{sub 2}O{sub 3}-6% Cr{sub 2}O{sub 3}-3% Ni{sub 2}O{sub 3}. The melt surface temperature ranged within 1920-1970 K. (orig.)

  12. Water boiling on the corium melt surface under VVER severe accident conditions

    Energy Technology Data Exchange (ETDEWEB)

    Bechta, S.V.; Vitol, S.A.; Krushinov, E.V. [Research Institute of Technology, Sosnovy Bor (NITI) (RU)] [and others

    1999-07-01

    Experimental results are presented on the interaction between corium melt and water supplied onto its surface. The tests were conducted on the Rasplav-2' experimental facility. Induction melting in a cold crucible was used to produce the melt. The following data have been obtained: heat transfer at water boiling on the melt surface, aerosol release, structure of the post-interaction solidified corium. The corium melt had the following composition, mass %: 60%UO{sub 2}- 16%ZrO{sub 2}- 15%Fe{sub 2}O{sub 3} - 6%Cr{sub 2}O{sub 3}-3%Ni{sub 2}O{sub 3}. The melt surface temperature was 1650-1700degC. (author)

  13. Part 2: Surface water quality

    International Nuclear Information System (INIS)

    1997-01-01

    In 1996 the surface water quality measurements were performed, according to the Agreement, at 8 profiles on the Hungarian territory and at 15 profiles on the Slovak territory. Basic physical and chemical parameters (as water temperature, pH values, conductivity, suspended solids, cations and anions (nitrates, ammonium ion, nitrites, total nitrogen, phosphates, total phosphorus, oxygen and organic carbon regime parameters), metals (iron, manganese and heavy metals), biological and microbiological parameters (coliform bacteria, chlorophyll-a, saprobity index and other biological parameters) and quality of sediment were measured

  14. Electrolysis of water on (oxidized) metal surfaces

    DEFF Research Database (Denmark)

    Rossmeisl, Jan; Logadottir, Ashildur; Nørskov, Jens Kehlet

    2005-01-01

    Density functional theory calculations are used as the basis for an analysis of the electrochemical process, where by water is split to form molecular oxygen and hydrogen. We develop a method for obtaining the thermochemistry of the electrochemical water splitting process as a function of the bias...... directly from the electronic structure calculations. We consider electrodes of Pt(111) and Au(111) in detail and then discuss trends for a series of different metals. We show that the difficult step in the water splitting process is the formation of superoxy-type (OOH) species on the surface...... by the splitting of a water molecule on top an adsorbed oxygen atom. One conclusion is that this is only possible on metal surfaces that are (partly) oxidized. We show that the binding energies of the different intermediates are linearly correlated for a number of metals. In a simple analysis, where the linear...

  15. Effect of surface roughness and softness on water capillary adhesion in apolar media.

    Science.gov (United States)

    Banerjee, Soumi; Mulder, Pieter; Kleijn, J Mieke; Cohen Stuart, Martien A

    2012-06-28

    The roughness and softness of interacting surfaces are both important parameters affecting the capillary condensation of water in apolar media, yet are poorly understood at present. We studied the water capillary adhesion between a cellulose surface and a silica colloidal probe in hexane by AFM force measurements. Nanomechanical measurements show that the Young's modulus of the cellulose layer in water is significantly less (~7 MPa) than in hexane (~7 GPa). In addition, the cellulose surface in both water and hexane is rather rough (6-10 nm) and the silica probe has a comparable roughness. The adhesion force between cellulose and silica in water-saturated hexane shows a time-dependent increase up to a waiting time of 200 s and is much (2 orders of magnitude) lower than that expected for a capillary bridge spanning the whole silica probe surface. This suggests the formation of one or more smaller bridges between asperities on both surfaces, which is confirmed by a theoretical analysis. The overall growth rate of the condensate cannot be explained from diffusion mediated capillary condensation alone; thin film flow due to the presence of a wetting layer of water at both the surfaces seems to be the dominant contribution. The logarithmic time dependence of the force can also be explained from the model of the formation of multiple capillary bridges with a distribution of activation times. Finally, the force-distance curves upon retraction show oscillations. Capillary condensation between an atomically smooth mica surface and the silica particle show less significant oscillations and the adhesion force is independent of waiting time. The oscillations in the force-distance curves between cellulose and silica may stem from multiple bridge formation between the asperities present on both surfaces. The softness of the cellulose surface can bring in additional complexities during retraction of the silica particle, also resulting in oscillations in the force-distance curves.

  16. Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

    NARCIS (Netherlands)

    van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

    2014-01-01

    Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in

  17. Modeled effects on permittivity measurements of water content in high surface area porous media

    International Nuclear Information System (INIS)

    Jones, S.B.; Or, Dani

    2003-01-01

    Time domain reflectometry (TDR) has become an important measurement technique for determination of porous media water content and electrical conductivity due to its accuracy, fast response and automation capability. Water content is inferred from the measured bulk dielectric constant based on travel time analysis along simple transmission lines. TDR measurements in low surface area porous media accurately describe water content using an empirical relationship. Measurement discrepancies arise from dominating influences such as bound water due to high surface area, extreme aspect ratio particles or atypical water phase configuration. Our objectives were to highlight primary factors affecting dielectric permittivity measurements for water content determination in porous mixtures, and demonstrate the influence of these factors on mixture permittivity as predicted by a three-phase dielectric mixture model. Modeled results considering water binding, higher porosity, constituent geometry or phase configuration suggest any of these effects individually are capable of causing permittivity reduction, though all likely contribute in high surface area porous media

  18. Modelling of long term nitrogen retention in surface waters

    Science.gov (United States)

    Halbfaß, S.; Gebel, M.; Bürger, S.

    2010-12-01

    In order to derive measures to reduce nutrient loadings into waters in Saxony, we calculated nitrogen inputs with the model STOFFBILANZ on the regional scale. Thereby we have to compare our modelling results to measured loadings at the river basin outlets, considering long term nutrient retention in surface waters. The most important mechanism of nitrogen retention is the denitrification in the contact zone of water and sediment, being controlled by hydraulic and micro-biological processes. Retention capacity is derived on the basis of the nutrient spiralling concept, using water residence time (hydraulic aspect) and time-specific N-uptake by microorganisms (biological aspect). Short time related processes of mobilization and immobilization are neglected, because they are of minor importance for the derivation of measures on the regional scale.

  19. Hydraulics and drones: observations of water level, bathymetry and water surface velocity from Unmanned Aerial Vehicles

    DEFF Research Database (Denmark)

    Bandini, Filippo

    -navigable rivers and overpass obstacles (e.g. river structures). Computer vision, autopilot system and beyond visual line-of-sight (BVLOS) flights will ensure the possibility to retrieve hyper-spatial observations of water depth, without requiring the operator to access the area. Surface water speed can......The planet faces several water-related threats, including water scarcity, floods, and pollution. Satellite and airborne sensing technology is rapidly evolving to improve the observation and prediction of surface water and thus prevent natural disasters. While technological developments require....... Although UAV-borne measurements of surface water speed have already been documented in the literature, a novel approach was developed to avoid GCPs. This research is the first demonstration that orthometric water level can be measured from UAVs with a radar system and a GNSS (Global Navigation Satellite...

  20. Effect of solid waste landfill on underground and surface water ...

    African Journals Online (AJOL)

    Effect of solid waste landfill on underground and surface water quality at ring road, Ibadan, Nigeria. ... parameters showed increased concentrations over those from control sites. ... Keywords: Landfill, groundwater, surface-water, pollution.

  1. Simulation of integrated surface-water/ground-water flow and salinity for a coastal wetland and adjacent estuary

    Science.gov (United States)

    Langevin, C.; Swain, E.; Wolfert, M.

    2005-01-01

    The SWIFT2D surface-water flow and transport code, which solves the St Venant equations in two dimensions, was coupled with the SEAWAT variable-density ground-water code to represent hydrologic processes in coastal wetlands and adjacent estuaries. A sequentially coupled time-lagged approach was implemented, based on a variable-density form of Darcy's Law, to couple the surface and subsurface systems. The integrated code also represents the advective transport of salt mass between the surface and subsurface. The integrated code was applied to the southern Everglades of Florida to quantify flow and salinity patterns and to evaluate effects of hydrologic processes. Model results confirm several important observations about the coastal wetland: (1) the coastal embankment separating the wetland from the estuary is overtopped only during tropical storms, (2) leakage between the surface and subsurface is locally important in the wetland, but submarine ground-water discharge does not contribute large quantities of freshwater to the estuary, and (3) coastal wetland salinities increase to near seawater values during the dry season, and the wetland flushes each year with the onset of the wet season. ?? 2005 Elsevier B.V. All rights reserved.

  2. Optimizing water resources management in large river basins with integrated surface water-groundwater modeling: A surrogate-based approach

    Science.gov (United States)

    Wu, Bin; Zheng, Yi; Wu, Xin; Tian, Yong; Han, Feng; Liu, Jie; Zheng, Chunmiao

    2015-04-01

    Integrated surface water-groundwater modeling can provide a comprehensive and coherent understanding on basin-scale water cycle, but its high computational cost has impeded its application in real-world management. This study developed a new surrogate-based approach, SOIM (Surrogate-based Optimization for Integrated surface water-groundwater Modeling), to incorporate the integrated modeling into water management optimization. Its applicability and advantages were evaluated and validated through an optimization research on the conjunctive use of surface water (SW) and groundwater (GW) for irrigation in a semiarid region in northwest China. GSFLOW, an integrated SW-GW model developed by USGS, was employed. The study results show that, due to the strong and complicated SW-GW interactions, basin-scale water saving could be achieved by spatially optimizing the ratios of groundwater use in different irrigation districts. The water-saving potential essentially stems from the reduction of nonbeneficial evapotranspiration from the aqueduct system and shallow groundwater, and its magnitude largely depends on both water management schemes and hydrological conditions. Important implications for water resources management in general include: first, environmental flow regulation needs to take into account interannual variation of hydrological conditions, as well as spatial complexity of SW-GW interactions; and second, to resolve water use conflicts between upper stream and lower stream, a system approach is highly desired to reflect ecological, economic, and social concerns in water management decisions. Overall, this study highlights that surrogate-based approaches like SOIM represent a promising solution to filling the gap between complex environmental modeling and real-world management decision-making.

  3. Water slip and friction at a solid surface

    Energy Technology Data Exchange (ETDEWEB)

    Brigo, L; Pierno, M; Mammano, F; Sada, C; Fois, G; Pozzato, A; Zilio, S dal; Mistura, G [Dipartimento di Fisica G Galilei, Universita degli Studi di Padova, via Marzolo 8, 35131 Padova (Italy); Natali, M [Istituto di Chimica Inorganica e delle Superfici (ICIS), CNR, Corso Stati Uniti 4, 35127 Padova (Italy); Tormen, M [TASC-INFM, CNR, S S 14 km 163.5 Area Science Park, 34012 Basovizza, Trieste (Italy)], E-mail: mistura@padova.infm.it

    2008-09-03

    A versatile micro-particle imaging velocimetry ({mu}-PIV) recording system is described, which allows us to make fluid velocity measurements in a wide range of flow conditions both inside microchannels and at liquid-solid interfaces by using epifluorescence and total internal reflection fluorescence excitation. This set-up has been applied to study the slippage of water over flat surfaces characterized by different degrees of hydrophobicity and the effects that a grooved surface has on the fluid flow inside a microchannel. Preliminary measurements of the slip length of water past various flat surfaces show no significant dependence on the contact angle.

  4. Context of surveillance of underground and surface waters

    International Nuclear Information System (INIS)

    2010-01-01

    This document briefly describes the evolutions of regulations on site liquid effluents and of guideline values concerning radioactive wastes, briefly presents the surveillance of underground and surface waters of CEA sites, comments the guideline values of the radiological quality of waters aimed at human consumption, and gives an overview of information which are brought to public's attention. Then, for different CEA sites (Cadarache, Marcoule, Saclay, Grenoble, Fontenay-aux-Roses, Valduc, DIF), this document proposes a presentation of the hydrological context, regulatory context, the surface and underground water surveillance process and values, the storing zones of old wastes

  5. Surface emissions of heat, water and GHGs from a NYC greenroof

    Science.gov (United States)

    McGillis, W. R.; Jacobson, G.; Culligan, P.; Gaffin, S.; Carson, T.; Marasco, D.; Hsueh, D.; Rella, C.

    2012-04-01

    The budgets of heat, water, and GHGs from greenroofs in New York City, needed for adaptation and sustainable policy and infrastructure strategies, requires an accurate measure of their surface emissions. A high speed, Cavity Ring-Down Spectroscopy (CRDS) based analyzer for measuring carbon dioxide (CO2), methane (CH4) and water (H2O) and an ultrasonic wind and temperature anemometer for measuring heat and momentum is used to assess greenroof performance during seasonal, diurnal, and episodic weather conditions. The flux instrument has proven capable of raw 10 Hz precision (one standard deviation) better than 110 parts-per-billion (ppbv) for carbon dioxide, better than 3 ppbv for methane and better than 6 ppmv +0.3% of reading for water vapor. In the water and heat budget, comparison and reconciliation of greenroof evapotranspiration (ET) using micrometeorological techniques, water balance, and heat balance was conducted. The water balance (month timescales), the heat balance (week timescale) show agreement to the micrometeorological surface ET (hour timescale). By using boundary layer flux measurements of ET, the fundamental performance of greenroofs on climate and weather conditions can be explored. These boundary layer measured surface fluxes provide critical information on the physiology of the built environment in New York City. Faced with sewage failures due to water management and exacerbated heating, the accurate assessment of greenroof performance on high spatial and temporal scales in required for the urban environment. Results will be presented and discussed.

  6. The Proposed Surface Water and Ocean Topography (SWOT) Mission

    Science.gov (United States)

    Fu, Lee-Lueng; Alsdorf, Douglas; Rodriguez, Ernesto; Morrow, Rosemary; Mognard, Nelly; Vaze, Parag; Lafon, Thierry

    2012-01-01

    A new space mission concept called Surface Water and Ocean Topography (SWOT) is being developed jointly by a collaborative effort of the international oceanographic and hydrological communities for making high-resolution measurement of the water elevation of both the ocean and land surface water to answer the questions about the oceanic submesoscale processes and the storage and discharge of land surface water. The key instrument payload would be a Ka-band radar interferometer capable of making high-resolution wide-swath altimetry measurement. This paper describes the proposed science objectives and requirements as well as the measurement approach of SWOT, which is baselined to be launched in 2019. SWOT would demonstrate this new approach to advancing both oceanography and land hydrology and set a standard for future altimetry missions.

  7. The interaction of water and hydrogen with nickel surfaces

    NARCIS (Netherlands)

    Shan, Junjun

    2009-01-01

    As nickel and platinum are in the same group of the periodic table, the Ni(111) and Pt(111) surfaces may be expected to show similar interaction with water and hydrogen. However in this thesis, we show these interactions for Ni(111) are quite different from those of Pt(111). Moreover, our results

  8. Documentation of the Santa Clara Valley regional ground-water/surface-water flow model, Santa Clara Valley, California

    Science.gov (United States)

    Hanson, R.T.; Li, Zhen; Faunt, C.C.

    2004-01-01

    The Santa Clara Valley is a long, narrow trough extending about 35 miles southeast from the southern end of San Francisco Bay where the regional alluvial-aquifer system has been a major source of water. Intensive agricultural and urban development throughout the 20th century and related ground-water development resulted in ground-water-level declines of more than 200 feet and land subsidence of as much as 12.7 feet between the early 1900s and the mid-1960s. Since the 1960s, Santa Clara Valley Water District has imported surface water to meet growing demands and reduce dependence on ground-water supplies. This importation of water has resulted in a sustained recovery of the ground-water flow system. To help support effective management of the ground-water resources, a regional ground-water/surface-water flow model was developed. This model simulates the flow of ground water and surface water, changes in ground-water storage, and related effects such as land subsidence. A numerical ground-water/surface-water flow model of the Santa Clara Valley subbasin of the Santa Clara Valley was developed as part of a cooperative investigation with the Santa Clara Valley Water District. The model better defines the geohydrologic framework of the regional flow system and better delineates the supply and demand components that affect the inflows to and outflows from the regional ground-water flow system. Development of the model includes revisions to the previous ground-water flow model that upgraded the temporal and spatial discretization, added source-specific inflows and outflows, simulated additional flow features such as land subsidence and multi-aquifer wellbore flow, and extended the period of simulation through September 1999. The transient-state model was calibrated to historical surface-water and ground-water data for the period 197099 and to historical subsidence for the period 198399. The regional ground-water flow system consists of multiple aquifers that are grouped

  9. DNA damage and oxidative stress in human liver cell L-02 caused by surface water extracts during drinking water treatment in a waterworks in China.

    Science.gov (United States)

    Xie, Shao-Hua; Liu, Ai-Lin; Chen, Yan-Yan; Zhang, Li; Zhang, Hui-Juan; Jin, Bang-Xiong; Lu, Wen-Hong; Li, Xiao-Yan; Lu, Wen-Qing

    2010-04-01

    Because of the daily and life-long exposure to disinfection by-products formed during drinking water treatment, potential adverse human health risk of drinking water disinfection is of great concern. Toxicological studies have shown that drinking water treatment increases the genotoxicity of surface water. Drinking water treatment is comprised of different potabilization steps, which greatly influence the levels of genotoxic products in the surface water and thus may alter the toxicity and genotoxicity of surface water. The aim of the present study was to understand the influence of specific steps on toxicity and genotoxicity during the treatment of surface water in a water treatment plant using liquid chlorine as the disinfectant in China. An integrated approach of the comet and oxidative stress assays was used in the study, and the results showed that both the prechlorination and postchlorination steps increased DNA damage and oxidative stress caused by water extracts in human derived L-02 cells while the tube settling and filtration steps had the opposite effect. This research also highlighted the usefulness of an integrated approach of the comet and oxidative stress assays in evaluating the genotoxicity of surface water during drinking water treatment. Copyright 2009 Wiley-Liss, Inc.

  10. Surface Waters Information Management System (SWIMS)

    Data.gov (United States)

    Kansas Data Access and Support Center — The Surface Waters Information Management System (SWIMS) has been designed to meet multi-agency hydrologic database needs for Kansas. The SWIMS project was supported...

  11. Fabrication of Superhydrophobic Surfaces with Controllable Electrical Conductivity and Water Adhesion.

    Science.gov (United States)

    Ye, Lijun; Guan, Jipeng; Li, Zhixiang; Zhao, Jingxin; Ye, Cuicui; You, Jichun; Li, Yongjin

    2017-02-14

    A facile and versatile strategy for fabricating superhydrophobic surfaces with controllable electrical conductivity and water adhesion is reported. "Vine-on-fence"-structured and cerebral cortex-like superhydrophobic surfaces are constructed by filtering a suspension of multiwalled carbon nanotubes (MWCNTs), using polyoxymethylene nonwovens as the filter paper. The nonwovens with micro- and nanoporous two-tier structures act as the skeleton, introducing a microscale structure. The MWCNTs act as nanoscale structures, creating hierarchical surface roughness. The surface topography and the electrical conductivity of the superhydrophobic surfaces are controlled by varying the MWCNT loading. The vine-on-fence-structured surfaces exhibit "sticky" superhydrophobicity with high water adhesion. The cerebral cortex-like surfaces exhibit self-cleaning properties with low water adhesion. The as-prepared superhydrophobic surfaces are chemically resistant to acidic and alkaline environments of pH 2-12. They therefore have potential in applications such as droplet-based microreactors and thin-film microextraction. These findings aid our understanding of the role that surface topography plays in the design and fabrication of superhydrophobic surfaces with different water-adhesion properties.

  12. Quality-control design for surface-water sampling in the National Water-Quality Network

    Science.gov (United States)

    Riskin, Melissa L.; Reutter, David C.; Martin, Jeffrey D.; Mueller, David K.

    2018-04-10

    The data-quality objectives for samples collected at surface-water sites in the National Water-Quality Network include estimating the extent to which contamination, matrix effects, and measurement variability affect interpretation of environmental conditions. Quality-control samples provide insight into how well the samples collected at surface-water sites represent the true environmental conditions. Quality-control samples used in this program include field blanks, replicates, and field matrix spikes. This report describes the design for collection of these quality-control samples and the data management needed to properly identify these samples in the U.S. Geological Survey’s national database.

  13. Deuterium Excess of Waters in Slovenia. Preliminary Results

    Energy Technology Data Exchange (ETDEWEB)

    Brencic, M.; Torkar, A. [Faculty of Natural Sciences and Engineering, University of Ljubljana, Ljubljana (Slovenia); Vreca, P. [Jozef Stefan Institut, Department of Environmental Sciences, Ljubljana (Slovenia)

    2013-07-15

    In climatic and hydrological studies, deuterium excess has proven to be a useful parameter; therefore this parameter has been investigated in the waters of slovenia - positioned in central europe. All the data were acquired from publicly available data sources (e.g. journals, databases). Data were collected for four different parts of the water cycle: precipitation, surface water, groundwater and water in the unsaturated zone. For precipitation the value for deuterium excess ranges between -19.9 per mille and 28.8 per mille with the median at 10.1 per mille. Surface water has the minimum at 2.9 per mille, the maximum at 22.4 per mille and the median at 13.2 per mille. Values for groundwater vary between -17.7 per mille and 34.9 per mille with the median at 11.8 per mille. Median for deuterium excess for the unsaturated zone is 15.1 per mille and the values are between -2.8 per mille and 17.6 per mille. (author)

  14. Quantum mechanical/molecular mechanical modeling finds Diels-Alder reactions are accelerated less on the surface of water than in water.

    Science.gov (United States)

    Thomas, Laura L; Tirado-Rives, Julian; Jorgensen, William L

    2010-03-10

    Quantum and molecular mechanics calculations for the Diels-Alder reactions of cyclopentadiene with 1,4-naphthoquinone, methyl vinyl ketone, and acrylonitrile have been carried out at the vacuum-water interface and in the gas phase. In conjunction with previous studies of these cycloadditions in dilute solution, a more complete picture of aqueous environmental effects emerges with implications for the origin of observed rate accelerations using heterogeneous aqueous suspensions, "on water" conditions. The pure TIP4P water slab maintains the bulk density and hydrogen-bonding properties in central water layers. The bulk region merges to vacuum over a ca. 5 A band with progressive diminution of the density and hydrogen bonding. The relative free energies of activation and transition structures for the reactions at the interface are found to be intermediate between those calculated in the gas phase and in bulk water; i.e., for the reaction with 1,4-naphthoquinone, the DeltaDeltaG(++) values relative to the gas phase are -3.6 and -7.3 kcal/mol at the interface and in bulk water, respectively. Thus, the results do not support the notion that a water surface is more effective than bulk water for catalysis of such pericyclic reactions. The trend is in qualitative agreement with expectations based on density considerations and estimates of experimental rate constants for the gas phase, a heterogeneous aqueous suspension, and a dilute aqueous solution for the reaction of cyclopentadiene with methyl vinyl ketone. Computed energy pair distributions reveal a uniform loss of 0.5-1.0 hydrogen bond for the reactants and transition states in progressing from bulk water to the vacuum-water interface. Orientational effects are apparent at the surface; e.g., the carbonyl group in the methyl vinyl ketone transition structure is preferentially oriented into the surface. Also, the transition structure for the 1,4-naphthoquinone case is buried more in the surface, and the free energy of

  15. Strategic Evaluation Tool for Surface Water Quality Management Remedies in Drinking Water Catchments

    Directory of Open Access Journals (Sweden)

    Huda Almaaofi

    2017-09-01

    Full Text Available Drinking water catchments (DWC are under pressure from point and nonpoint source pollution due to the growing human activities. This worldwide challenge is causing number of adverse effects, such as degradation in water quality, ecosystem health, and other economic and social pressures. Different evaluation tools have been developed to achieve sustainable and healthy drinking water catchments. However, a holistic and strategic framework is still required to adequately consider the uncertainty associated with feasible management remedies of surface water quality in drinking water catchments. A strategic framework was developed to adequately consider the uncertainty associated with management remedies for surface water quality in drinking water catchments. A Fuzzy Multiple Criteria Decision Analysis (FMCDA approach was embedded into a strategic decision support framework to evaluate and rank water quality remediation options within a typical fixed budget constraint faced by bulk water providers. The evaluation framework consists of four core aspects; namely, water quality, environmental, economic and social, and number of associated quantitative and qualitative criteria and sub-criteria. Final remediation strategy ranking was achieved through the application of the Euclidean Distance by the In-center of Centroids (EDIC.

  16. Manufacturing and characterisation of water repellent surfaces

    DEFF Research Database (Denmark)

    De Grave, Arnaud; Botija, Pablo; Hansen, Hans Nørgaard

    2006-01-01

    design criteria for such surfaces. The problem of adapting this behaviour to artificially roughened surfaces is addressed by providing design criteria for superhydrophobic, water-repellent and self-cleaning surfaces according to the concrete performance desired for them. Different kind of manufacturing...... techniques are investigated and the production of patterned micro structured surfaces following two different manufacturing techniques is reported. The first is a combination of laser manufacturing and hot embossing on polystyrene. To compare geometry and functionality a non-silicon based lithography...

  17. Innovative coatings and surface modification of titanium for sea water condenser applications

    International Nuclear Information System (INIS)

    George, R.P.; Anandkumar, B.; Vanithakumari, S.C.; Kamachi Mudali, U.

    2016-01-01

    Effectiveness of cooling water systems in various power plants to maintain highest electrical energy output per tonne of fuel is important as part of good energy management. Cooling water systems of nuclear power plants using seawater for cooling comes under constant attack from the marine and sea water environment. Many metallic components and civil structures in the cooling water systems like bridges, intake wells, intake pipes, pump house wells, water boxes, condenser pipes are subjected to severe fouling and corrosion which limits the service life and availability of power plants. The experience with a coastal water cooled power plant at Kalpakkam (MAPS), India, showed that chlorination and screening control macrofouling to a great extend by controlling protozoans, invertebrates, algae and fungi. However 90% of marine bacteria are resistant to such control measures, and they cause microfouling of condenser pipes leading to poor heat transfer and microbially influenced corrosion (MIC) failures. Titanium is used as condenser for Indian nuclear power plants employing sea water cooling, including the PFBR at Kalpakkam. Though titanium is excellent with respect to corrosion behavior under sea water conditions, its biocompatible nature results in biofouling and MIC during service. Therefore innovative antifouling coatings and surface modification techniques for titanium condenser applications in seawater and marine environments are the need of the hour. Extensive investigations were carried out by different methods including nanostructuring of surfaces for making them antibacterial. The microroughness of titanium was produced by repeated pickling and polishing which by itself reduced microbial adhesion. To utilize photocatalytic activity for antibacterial property, anodization of titanium surfaces followed by heat treatment was adopted and this also has controlled microbial fouling. Electroless plating of nanofilm of copper-nickel alloy decreased biofouling of

  18. Integrated modelling for assessing the risk of groundwater contaminants to human health and surface water ecosystems

    DEFF Research Database (Denmark)

    McKnight, Ursula S.; Rasmussen, Jes; Funder, Simon G.

    2010-01-01

    for evaluating the impact of a TCE groundwater plume, located in an area with protected drinking water interests, to human health and surface water ecosystems. This is accomplished by coupling the system dynamicsbased decision support system CARO-Plus to the aquatic ecosystem model AQUATOX via an analytical......The practical implementation of the European Water Framework Directive has resulted in an increased focus on the groundwater-surface water interaction zone. A gap exists with respect to preliminary assessment methodologies that are capable of evaluating and prioritising point sources...... volatilisation model for the stream. The model is tested on a Danish case study involving a 750 m long TCE groundwater plume discharging into a stream. The initial modelling results indicate that TCE contaminant plumes with μgL-1 concentrations entering surface water systems do not pose a significant risk...

  19. Lake Chad Total Surface Water Area as Derived from Land Surface Temperature and Radar Remote Sensing Data

    Directory of Open Access Journals (Sweden)

    Frederick Policelli

    2018-02-01

    Full Text Available Lake Chad, located in the middle of the African Sahel belt, underwent dramatic decreases in the 1970s and 1980s leaving less than ten percent of its 1960s surface water extent as open water. In this paper, we present an extended record (dry seasons 1988–2016 of the total surface water area of the lake (including both open water and flooded vegetation derived using Land Surface Temperature (LST data (dry seasons 2000–2016 from the NASA Terra MODIS sensor and EUMETSAT Meteosat-based LST measurements (dry seasons 1988–2001 from an earlier study. We also examine the total surface water area for Lake Chad using radar data (dry seasons 2015–2016 from the ESA Sentinel-1a mission. For the limited number of radar data sets available to us (18 data sets, we find on average a close match between the estimates from these data and the corresponding estimates from LST, though we find spatial differences in the estimates using the two types of data. We use these spatial differences to adjust the record (dry seasons 2000–2016 from MODIS LST. Then we use the adjusted record to remove the bias of the existing LST record (dry seasons 1988–2001 derived from Meteosat measurements and combine the two records. From this composite, extended record, we plot the total surface water area of the lake for the dry seasons of 1988–1989 through 2016–2017. We find for the dry seasons of 1988–1989 to 2016–2017 that the maximum total surface water area of the lake was approximately 16,800 sq. km (February and May, 2000, the minimum total surface water area of the lake was approximately 6400 sq. km (November, 1990, and the average was approximately 12,700 sq. km. Further, we find the total surface water area of the lake to be highly variable during this period, with an average rate of increase of approximately 143 km2 per year.

  20. Preparation and characterization of soy protein films with a durable water resistance-adjustable and antimicrobial surface.

    Science.gov (United States)

    Li, Shuzhao; Donner, Elizabeth; Xiao, Huining; Thompson, Michael; Zhang, Yachuan; Rempel, Curtis; Liu, Qiang

    2016-12-01

    A water resistant surface was first obtained by immobilizing hydrophobic copolymers, poly (styrene-co-glycidyl methacrylate) (PSG), with functional groups on soy protein isolate (SPI) films. XPS and AFM results showed that PSG copolymers were immobilized on the film by chemical bonding, and formed a rough surface with some bumps because of the segregation of two different phases on PSG copolymers. Water resistance of the modified films could be adjusted dramatically by further immobilizing different amounts of guanidine-based antimicrobial polymers, poly (hexamethylene guanidine hydrochloride) (PHMG) on the resulting hydrophobic surface. The introduction of hydrophilic PHMG on the resulting surface generated many micropores, which potentially increased the water uptake of the modified films. Furthermore, the modified SPI films showed higher thermostability compared to native SPI film and broad-spectrum antimicrobial activity by contact killing, attributed to the presence of PHMG on the surface. The modified SPI film with a multi-functional surface showed potential for applications in the packaging and medical fields. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  1. The Association of Cryptosporidium parvum With Suspended Sediments: Implications for Transport in Surface Waters

    Science.gov (United States)

    Searcy, K. E.; Packman, A. I.; Atwill, E. R.; Harter, T.

    2003-12-01

    Understanding the transport and fate of microorganisms in surface waters is of vital concern in protecting the integrity and safety of municipal water supply systems. The human pathogen Cryptosporidium parvum is a particular public health interest, as it is ubiquitous in the surface waters of the United States, it can persist for long periods in the environment, and it is difficult to disinfect in water treatment plants. Due to its small size (5 um), low specific gravity (1.05 g/cm3), and negative surface charge, C. parvum oocysts are generally considered to move through watersheds from their source to drinking water reservoirs with little attenuation. However, the transport of the oocysts in surface waters may be mediated by interactions with suspended sediments. Batch experiments were conducted to determine the extent of C. parvum oocyst attachment to several inorganic and organic sediments under varying water chemical conditions, and settling column experiments were performed to demonstrate how these associations influence the effective settling velocity of C. parvum oocysts. Results from these experiments showed that C. parvum oocysts do associate with inorganic and organic sediments and often settle at the rate of the suspended sediment. The size and surface charge of the host suspended sediment influenced the extent of oocyst attachment as oocysts preferentially associated with particles greater than 3 um, and fewer oocysts associated with particles having a highly negative surface charge. Background water chemical conditions including ionic strength, ion composition, and pH did not have a significant effect on oocyst attachment to suspended sediments.

  2. Shallow Water Measurements Using a Single Green Laser Corrected by Building a Near Water Surface Penetration Model

    Directory of Open Access Journals (Sweden)

    Jianhu Zhao

    2017-04-01

    Full Text Available To reduce the size and cost of an integrated infrared (IR and green airborne LiDAR bathymetry (ALB system, and improve the accuracy of the green ALB system, this study proposes a method to accurately determine water surface and water bottom heights using a single green laser corrected by the near water surface penetration (NWSP model. The factors that influence the NWSP of green laser are likewise analyzed. In addition, an NWSP modeling method is proposed to determine the relationship between NWSP and the suspended sediment concentration (SSC of the surface layer, scanning angle of a laser beam and sensor height. The water surface and water bottom height models are deduced by considering NWSP and using only green laser based on the measurement principle of the IR laser and green laser, as well as employing the relationship between NWSP and the time delay of the surface return of the green laser. Lastly, these methods and models are applied to a practical ALB measurement. Standard deviations of 3.0, 5.3, and 1.3 cm are obtained by the NWSP, water-surface height, and water-bottom height models, respectively. Several beneficial conclusions and recommendations are drawn through the experiments and discussions.

  3. Use of upscaled elevation and surface roughness data in two-dimensional surface water models

    Science.gov (United States)

    Hughes, J.D.; Decker, J.D.; Langevin, C.D.

    2011-01-01

    In this paper, we present an approach that uses a combination of cell-block- and cell-face-averaging of high-resolution cell elevation and roughness data to upscale hydraulic parameters and accurately simulate surface water flow in relatively low-resolution numerical models. The method developed allows channelized features that preferentially connect large-scale grid cells at cell interfaces to be represented in models where these features are significantly smaller than the selected grid size. The developed upscaling approach has been implemented in a two-dimensional finite difference model that solves a diffusive wave approximation of the depth-integrated shallow surface water equations using preconditioned Newton–Krylov methods. Computational results are presented to show the effectiveness of the mixed cell-block and cell-face averaging upscaling approach in maintaining model accuracy, reducing model run-times, and how decreased grid resolution affects errors. Application examples demonstrate that sub-grid roughness coefficient variations have a larger effect on simulated error than sub-grid elevation variations.

  4. Transport of lincomycin to surface and ground water from manure-amended cropland.

    Science.gov (United States)

    Kuchta, Sandra L; Cessna, Allan J; Elliott, Jane A; Peru, Kerry M; Headley, John V

    2009-01-01

    Livestock manure containing antimicrobials becomes a possible source of these compounds to surface and ground waters when applied to cropland as a nutrient source. The potential for transport of the veterinary antimicrobial lincomycin to surface waters via surface runoff and to leach to ground water was assessed by monitoring manure-amended soil, simulated rainfall runoff, snowmelt runoff, and ground water over a 2-yr period in Saskatchewan, Canada, after fall application of liquid swine manure to cropland. Liquid chromatography tandem mass spectrometry was used to quantify lincomycin in all matrix extracts. Initial concentrations in soil (46.3-117 mug kg(-1)) were not significantly different (p > 0.05) for manure application rates ranging from 60,000 to 95,000 L ha(-1) and had decreased to nondetectable levels by mid-summer the following year. After fall manure application, lincomycin was present in all simulated rainfall runoff (0.07-2.7 mug L(-1)) and all snowmelt runoff (0.038-3.2 mug L(-1)) samples. Concentrations in snowmelt runoff were not significantly different from those in simulated rainfall runoff the previous fall. On average, lincomycin concentrations in ephemeral wetlands dissipated by 50% after 31 d. Concentrations of lincomycin in ground water were generally <0.005 mug L(-1). This study demonstrates that the management practice of using livestock manure from confined animal feeding operations as a plant nutrient source on cropland may result in antimicrobial transport to surface and ground waters.

  5. Integrated Modeling of Groundwater and Surface Water Interactions in a Manmade Wetland

    Directory of Open Access Journals (Sweden)

    Guobiao Huang Gour-Tsyh Yeh

    2012-01-01

    Full Text Available A manmade pilot wetland in south Florida, the Everglades Nutrient Removal (ENR project, was modeled with a physics-based integrated approach using WASH123D (Yeh et al. 2006. Storm water is routed into the treatment wetland for phosphorus removal by plant and sediment uptake. It overlies a highly permeable surficial groundwater aquifer. Strong surface water and groundwater interactions are a key component of the hydrologic processes. The site has extensive field measurement and monitoring tools that provide point scale and distributed data on surface water levels, groundwater levels, and the physical range of hydraulic parameters and hydrologic fluxes. Previous hydrologic and hydrodynamic modeling studies have treated seepage losses empirically by some simple regression equations and, only surface water flows are modeled in detail. Several years of operational data are available and were used in model historical matching and validation. The validity of a diffusion wave approximation for two-dimensional overland flow (in the region with very flat topography was also tested. The uniqueness of this modeling study is notable for (1 the point scale and distributed comparison of model results with observed data; (2 model parameters based on available field test data; and (3 water flows in the study area include two-dimensional overland flow, hydraulic structures/levees, three-dimensional subsurface flow and one-dimensional canal flow and their interactions. This study demonstrates the need and the utility of a physics-based modeling approach for strong surface water and groundwater interactions.

  6. Modification of surface properties of LLDPE by water plasma discharge

    International Nuclear Information System (INIS)

    Chantara Thevy Ratnam; Hill, D.J.T.; Firas Rasoul; Whittaker, A.K.; Imelda Keen

    2007-01-01

    Linear low density polyethylene (LLDPE) surface was modified by water plasma treatment. The LLDPE surface was treated at 10 and 20 W discharge power at various exposure times. A laboratory scale Megatherm radio frequency (RF) plasma apparatus that operates at 27 MHz was used to generate the water plasmas. The changes in chemical structure of the LLDPE polymeric chain upon plasma treatment were characterized by FTIR and XPS techniques. The selectivity of trifluoroacetic anhydride (TFAA) toward hydroxyl groups is used to quantify the hydroxyl groups formed on the polymer surface upon plasma treatment. After exposition to the plasma discharge a decline in water contact angle were observed. FTIR and XPS measurements indicate an oxidation of degraded polymeric chains and creation of hydroxyl, carbonyl, ether, ester and carboxyl groups. Chemical derivatization with TFAA of water plasma treated polymer surfaces has shown that under the conditions employed, a very small (less than 5%) of the oxygen introduced by the water plasma treatment was present as hydroxyl group. (Author)

  7. High-resolution Continental Scale Land Surface Model incorporating Land-water Management in United States

    Science.gov (United States)

    Shin, S.; Pokhrel, Y. N.

    2016-12-01

    Land surface models have been used to assess water resources sustainability under changing Earth environment and increasing human water needs. Overwhelming observational records indicate that human activities have ubiquitous and pertinent effects on the hydrologic cycle; however, they have been crudely represented in large scale land surface models. In this study, we enhance an integrated continental-scale land hydrology model named Leaf-Hydro-Flood to better represent land-water management. The model is implemented at high resolution (5km grids) over the continental US. Surface water and groundwater are withdrawn based on actual practices. Newly added irrigation, water diversion, and dam operation schemes allow better simulations of stream flows, evapotranspiration, and infiltration. Results of various hydrologic fluxes and stores from two sets of simulation (one with and the other without human activities) are compared over a range of river basin and aquifer scales. The improved simulations of land hydrology have potential to build consistent modeling framework for human-water-climate interactions.

  8. Drinking Water Sources with Surface Intakes from LDHH source data, Geographic NAD83, LOSCO (1999) [drinking_water_surface_intakes_LDHH_1999

    Data.gov (United States)

    Louisiana Geographic Information Center — This is a point dataset for 87 public drinking water sources with surface intakes. It was derived from a larger statewide general drinking water source dataset...

  9. The degradation behaviour of nine diverse contaminants in urban surface water and wastewater prior to water treatment.

    Science.gov (United States)

    Cormier, Guillaume; Barbeau, Benoit; Arp, Hans Peter H; Sauvé, Sébastien

    2015-12-01

    An increasing diversity of emerging contaminants are entering urban surface water and wastewater, posing unknown risks for the environment. One of the main contemporary challenges in ensuring water quality is to design efficient strategies for minimizing such risks. As a first step in such strategies, it is important to establish the fate and degradation behavior of contaminants prior to any engineered secondary water treatment. Such information is relevant for assessing treatment solutions by simple storage, or to assess the impacts of contaminant spreading in the absence of water treatment, such as during times of flooding or in areas of poor infrastructure. Therefore in this study we examined the degradation behavior of a broad array of water contaminants in actual urban surface water and wastewater, in the presence and absence of naturally occurring bacteria and at two temperatures. The chemicals included caffeine, sulfamethoxazole, carbamazepine, atrazine, 17β-estradiol, ethinylestradiol, diclofenac, desethylatrazine and norethindrone. Little information on the degradation behavior of these pollutants in actual influent wastewater exist, nor in general in water for desethylatrazine (a transformation product of atrazine) and the synthetic hormone norethindrone. Investigations were done in aerobic conditions, in the absence of sunlight. The results suggest that all chemicals except estradiol are stable in urban surface water, and in waste water neither abiotic nor biological degradation in the absence of sunlight contribute significantly to the disappearance of desethylatrazine, atrazine, carbamazepine and diclofenac. Biological degradation in wastewater was effective at transforming norethindrone, 17β-estradiol, ethinylestradiol, caffeine and sulfamethoxazole, with measured degradation rate constants k and half-lives ranging respectively from 0.0082-0.52 d(-1) and 1.3-85 days. The obtained degradation data generally followed a pseudo-first-order-kinetic model

  10. Quantification of surface water volume changes in the Mackenzie Delta using satellite multi-mission data

    Science.gov (United States)

    Normandin, Cassandra; Frappart, Frédéric; Lubac, Bertrand; Bélanger, Simon; Marieu, Vincent; Blarel, Fabien; Robinet, Arthur; Guiastrennec-Faugas, Léa

    2018-02-01

    Quantification of surface water storage in extensive floodplains and their dynamics are crucial for a better understanding of global hydrological and biogeochemical cycles. In this study, we present estimates of both surface water extent and storage combining multi-mission remotely sensed observations and their temporal evolution over more than 15 years in the Mackenzie Delta. The Mackenzie Delta is located in the northwest of Canada and is the second largest delta in the Arctic Ocean. The delta is frozen from October to May and the recurrent ice break-up provokes an increase in the river's flows. Thus, this phenomenon causes intensive floods along the delta every year, with dramatic environmental impacts. In this study, the dynamics of surface water extent and volume are analysed from 2000 to 2015 by combining multi-satellite information from MODIS multispectral images at 500 m spatial resolution and river stages derived from ERS-2 (1995-2003), ENVISAT (2002-2010) and SARAL (since 2013) altimetry data. The surface water extent (permanent water and flooded area) peaked in June with an area of 9600 km2 (±200 km2) on average, representing approximately 70 % of the delta's total surface. Altimetry-based water levels exhibit annual amplitudes ranging from 4 m in the downstream part to more than 10 m in the upstream part of the Mackenzie Delta. A high overall correlation between the satellite-derived and in situ water heights (R > 0.84) is found for the three altimetry missions. Finally, using altimetry-based water levels and MODIS-derived surface water extents, maps of interpolated water heights over the surface water extents are produced. Results indicate a high variability of the water height magnitude that can reach 10 m compared to the lowest water height in the upstream part of the delta during the flood peak in June. Furthermore, the total surface water volume is estimated and shows an annual variation of approximately 8.5 km3 during the whole study period, with

  11. The interaction between surface water and groundwater and its ...

    Indian Academy of Sciences (India)

    Surface water; groundwater; stable isotopes; water quality; Second Songhua River basin. .... The total dissolved solid (TDS) was calculated by the con- centrations of major ions in ...... evaluating water quality management effectiveness; J.

  12. Surface Water Data at Los Alamos National Laboratory 2006 Water Year

    Energy Technology Data Exchange (ETDEWEB)

    R.P. Romero, D. Ortiz, G. Kuyumjian

    2007-08-01

    The principal investigators collected and computed surface water discharge data from 44 stream-gaging stations that cover most of Los Alamos National Laboratory and one at Bandelier National Monument. Also included are discharge data from three springs--two that flow into Canon de Valle and one that flows into Water Canyon--and peak flow data for 44 stations.

  13. Diminished Mercury Emission From Water Surfaces by Duckweed (Lemna minor)

    Science.gov (United States)

    Wollenberg, J. L.; Peters, S. C.

    2007-12-01

    Aquatic plants of the family Lemnaceae (generally referred to as duckweeds) are a widely distributed type of floating vegetation in freshwater systems. Under suitable conditions, duckweeds form a dense vegetative mat on the water surface, which reduces light penetration into the water column and decreases the amount of exposed water surface. These two factors would be expected to reduce mercury emission by limiting a) direct photoreduction of Hg(II), b) indirect reduction via coupled DOC photooxidation-Hg(II) reduction, and c) gas diffusion across the water-air interface. Conversely, previous studies have demonstrated transpiration of Hg(0) by plants, so it is therefore possible that the floating vegetative mat would enhance emission via transpiration of mercury vapor. The purpose of this experiment was to determine whether duckweed limits mercury flux to the atmosphere by shading and the formation of a physical barrier to diffusion, or whether it enhances emission from aquatic systems via transpiration of Hg(0). Deionized water was amended with mercury to achieve a final concentration of approximately 35 ng/L and allowed to equilibrate prior to the experiment. Experiments were conducted in rectangular polystyrene flux chambers with measured UV-B transmittance greater than 60% (spectral cutoff approximately 290 nm). Light was able to penetrate the flux chamber from the sides as well as the top throughout the experiment, limiting the effect of shading by duckweed on the water surface. Flux chambers contained 8L of water with varying percent duckweed cover, and perforated plastic sheeting was used as an abiotic control. Exposures were conducted outside on days with little to no cloud cover. Real time mercury flux was measured using atomic absorption (Mercury Instruments UT-3000). Total solar and ultraviolet radiation, as well as a suite of meteorological parameters, were also measured. Results indicate that duckweed diminishes mercury emission from the water surface

  14. Surface-water, water-quality, and ground-water assessment of the Municipio of Comerio, Puerto Rico, 1997-99

    Science.gov (United States)

    Rodríguez-Martínez, Jesús; Gómez-Gómez, Fernando; Santiago-Rivera, Luis; Oliveras-Feliciano, M. L.

    2001-01-01

    To meet the increasing need for a safe and adequate supply of water in the municipio of Comerio, an integrated surface-water, water-quality, and ground-water assessment of the area was conducted. The major results of this study and other important hydrologic and water-quality features were compiled in a Geographic Information System, and are presented in two 1:30,000-scale map plates to facilitate interpretation and use of the diverse water-resource data. Because the supply of safe drinking water was a critical issue during recent dry periods, the surface-water assessment portion of this study focused on analysis of low-flow characteristics in local streams and rivers. Low-flow characteristics were evaluated at one continuous-record gaging station based on graphical curve-fitting techniques and log-Pearson Type III frequency curves. Estimates of low-flow characteristics for 13 partial-record stations were generated using graphical-correlation techniques. Flow-duration characteristics for the continuous- and partial-record stations were estimated using the relation curves developed for the low-flow study. Stream low-flow statistics document the general hydrology under current land- and water-use conditions. A sanitary quality survey of streams utilized 24 sampling stations to evaluate about 84 miles of stream channels with drainage to or within the municipio of Comerio. River and stream samples for fecal coliform and fecal streptococcus analyses were collected on two occasions at base-flow conditions to evaluate the sanitary quality of streams. Bacteriological analyses indicate that about 27 miles of stream reaches within the municipio of Comerio may have fecal coliform bacteria concentrations above the water-quality goal established by the Puerto Rico Environmental Quality Board (Junta de Calidad Ambiental de Puerto Rico) for inland surface waters. Sources of fecal contamination may include illegal discharge of sewage to storm-water drains, malfunction of sanitary

  15. Influence of surface condition on the corrosion resistance of copper alloy condenser tubes in sea water

    Energy Technology Data Exchange (ETDEWEB)

    Sato, S; Nagata, K; Yamauchi, S

    1979-07-01

    Investigation was made on the influence of various surface conditions of aluminum brass tube. The corrosion behavior of aluminum brass tube, with nine kinds of surface conditions, was studied in stagnant 0.1N NaHCo/sub 3/ solution and flowing sea water (natural, Fe/sup + +/ containing and S/sup - -/ containing water). Surface treatments investigated contained bright annealing, special annealing to form carbon film, hot oxidizing and pickling. Anodic polarization measurements in 0.1N NaHCO/sub 3/ solution showed that the oxidized surface was superior and that the pickled surface was inferior. However, relation between these characteristics and corrosion resistance in sea water has not been established. Electrochemical characteristics in flowing sea water were dependent on the surface conditions in the very beginning of immersion time; nobler corrosion potential for the surface with carbon film, higher polarization resistance for the bright annealed and the oxidized surface, and faster decrease of polarization resistance in S/sup - -/ containing sea water for the pickled surface. However, these differences disappeared in the immersion time of only 2 to 7 days. It was revealed, by the statistical analysis on the corrosion depth in corrosion test in flowing sea water and in jet impingement test, that the corrosion behavior was not influenced by surface conditions, but was significantly influenced by quality of sea water and sponge ball cleaning. Sulfide ion of 0.05 ppm caused severe pitting corrosion, and sponge ball cleaning of 5 chances a week caused erosion corrosion. From above results, it was concluded that surface conditions of aluminum brass were not important to sea water corrosion, and that quality of sea water and operating condition such as sponge ball cleaning were more significant.

  16. Surface WAter Scenario Help (SWASH) version 5.3 : technical description

    NARCIS (Netherlands)

    Roller, te J.A.; Berg, van den F.; Adriaanse, P.I.; Jong, de A.; Beltman, W.H.J.

    2015-01-01

    The user-friendly shell SWASH, acronym for Surface WAter Scenarios Help, assists the user in calculating pesticide exposure concentrations in the EU FOCUS surface water scenarios. SWASH encompasses five separate tools and models: (i) FOCUS Drift Calculator, calculating pesticide entries through

  17. Core-shell magnetite-silica dithiocarbamate-derivatised particles achieve the Water Framework Directive quality criteria for mercury in surface waters.

    Science.gov (United States)

    Lopes, C B; Figueira, P; Tavares, D S; Lin, Z; Daniel-da-Silva, A L; Duarte, A C; Rocha, J; Trindade, T; Pereira, E

    2013-09-01

    The sorption capacity of nanoporous titanosilicate Engelhard titanosilicate number 4 (ETS-4) and silica-coated magnetite particles derivatised with dithiocarbamate groups towards Hg(II) was evaluated and compared in spiked ultra-pure and spiked surface-river water, for different batch factors. In the former, and using a batch factor of 100 m(3)/kg and an initial Hg(II) concentrations matching the maximum allowed concentration in an effluent discharge, both materials achieve Hg(II) uptake efficiencies in excess of 99 % and a residual metal concentration lower than the guideline value for drinking water quality. For the surface-river water and the same initial concentration, the Hg(II) uptake efficiency of magnetite particles is outstanding, achieving the quality criteria established by the Water Framework Directive (concerning Hg concentration in surface waters) using a batch factor of 50 m(3)/kg, while the efficiency of ETS-4 is significantly inferior. The dissimilar sorbents' Hg(II) removal efficiency is attributed to different uptake mechanisms. This study also highlights the importance of assessing the effective capacity of the sorbents under realistic conditions in order to achieve trustable results.

  18. The synergistic effect of manure supply and extreme precipitation on surface water quality

    Science.gov (United States)

    Motew, Melissa; Booth, Eric G.; Carpenter, Stephen R.; Chen, Xi; Kucharik, Christopher J.

    2018-04-01

    Over-enrichment of phosphorus (P) in agroecosystems contributes to eutrophication of surface waters. In the Midwest US and elsewhere, climate change is increasing the frequency of high-intensity precipitation events, which can serve as a primary conduit of P transport within watersheds. Despite uncertainty in their estimates, process-based watershed models are important tools that help characterize watershed hydrology and biogeochemistry and scale up important mechanisms affecting water quality. Using one such model developed for an agricultural watershed in Wisconsin, we conducted a 2 × 2 factorial experiment to test the effects of (high/low) terrestrial P supply (PSUP) and (high/low) precipitation intensity (PREC) on surface water quality. Sixty-year simulations were conducted for each of the four runs, with annual results obtained for watershed average P yield and concentration at the field scale (220 × 220 m grid cells), P load and concentration at the stream scale, and summertime total P concentration (TP) in Lake Mendota. ANOVA results were generated for the 2 × 2 factorial design, with PSUP and PREC treated as categorical variables. The results showed a significant, positive interaction (p loss may have important ecological consequences because dissolved P is highly bioavailable. Overall, the results suggest that high levels of terrestrial P supplied as manure can exacerbate water quality problems in the future as the frequency of high-intensity rainfall events increases with a changing climate. Conversely, lowering terrestrial manure P supply may help improve the resilience of surface water quality to extreme events.

  19. Interaction of the Helium, Hydrogen, Air, Argon, and Nitrogen Bubbles with Graphite Surface in Water.

    Science.gov (United States)

    Bartali, Ruben; Otyepka, Michal; Pykal, Martin; Lazar, Petr; Micheli, Victor; Gottardi, Gloria; Laidani, Nadhira

    2017-05-24

    The interaction of the confined gas with solid surface immersed in water is a common theme of many important fields such as self-cleaning surface, gas storage, and sensing. For that reason, we investigated the gas-graphite interaction in the water medium. The graphite surface was prepared by mechanical exfoliation of highly oriented pyrolytic graphite (HOPG). The surface chemistry and morphology were studied by X-ray photoelectron spectroscopy, profilometry, and atomic force microscopy. The surface energy of HOPG was estimated by contact angle measurements using the Owens-Wendt method. The interaction of gases (Ar, He, H 2 , N 2 , and air) with graphite was studied by a captive bubble method, in which the gas bubble was in contact with the exfoliated graphite surface in water media. The experimental data were corroborated by molecular dynamics simulations and density functional theory calculations. The surface energy of HOPG equaled to 52.8 mJ/m 2 and more of 95% of the surface energy was attributed to dispersion interactions. The results on gas-surface interaction indicated that HOPG surface had gasphilic behavior for helium and hydrogen, while gasphobic behavior for argon and nitrogen. The results showed that the variation of the gas contact angle was related to the balance between the gas-surface and gas-gas interaction potentials. For helium and hydrogen the gas-surface interaction was particularly high compared to gas-gas interaction and this promoted the favorable interaction with graphite surface.

  20. Anthropogenic influence on surface water quality of the Nhue and Day sub-river systems in Vietnam.

    Science.gov (United States)

    Hanh, Pham Thi Minh; Sthiannopkao, Suthipong; Kim, Kyoung-Woong; Ba, Dang The; Hung, Nguyen Quang

    2010-06-01

    In order to investigate the temporal and spatial variations of 14 physical and chemical surface water parameters in the Nhue and Day sub-river systems of Vietnam, surface water samples were taken from 43 sampling sites during the dry and rainy seasons in 2007. The results were statistically examined by Mann-Whitney U-test and hierarchical cluster analysis. The results show that water quality of the Day River was significantly improved during the rainy season while this was not the case of the Nhue River. However, the river water did not meet the Vietnamese surface water quality standards for dissolved oxygen (DO), biological oxygen demand (BOD(5)), chemical oxygen demand (COD), nutrients, total coliform, and fecal coliform. This implies that the health of local communities using untreated river water for drinking purposes as well as irrigation of vegetables may be at risk. Forty-three sampling sites were grouped into four main clusters on the basis of water quality characteristics with particular reference to geographic location and land use and revealed the contamination levels from anthropogenic sources.

  1. Hydrologic Science and Satellite Measurements of Surface Water (Invited)

    Science.gov (United States)

    Alsdorf, D. E.; Mognard, N. M.; Lettenmaier, D. P.

    2010-12-01

    While significant advances continue to be made for satellite measurements of surface waters, important science and application opportunities remain. Examples include the following: (1) Our current methods of measuring floodwater dynamics are either sparsely distributed or temporally inadequate. As an example, flood depths are measured by using high water marks, which capture only the peak of the flood wave, not its temporal variability. (2) Discharge is well measured at individual points along stream networks using in-situ gauges, but these do not capture within-reach hydraulic variability such as the water surface slope changes on the rising and falling limbs of flood waves. (3) Just a 1.0 mm/day error in ET over the Congo Basin translates to a 35,000 m3/s discharge error. Knowing the discharge of the Congo River and its many tributaries should significantly improve our understanding of the water balance throughout the basin. The Congo is exemplary of many other basins around the globe. (4) Arctic hydrology is punctuated by millions of unmeasured lakes. Globally, there might be as many as 30 million lakes larger than a hectare. Storage changes in these lakes are nearly unknown, but in the Arctic such changes are likely an indication of global warming. (5) Well over 100 rivers cross international boundaries, yet the sharing of water data is poor. Overcoming this helps to better manage the entire river basin while also providing a better assessment of potential water related disasters. The Surface Water and Ocean Topography (SWOT, http://swot.jpl.nasa.gov/) mission is designed to meet these needs by providing global measurements of surface water hydrodynamics. SWOT will allow estimates of discharge in rivers wider than 100m (50m goal) and storage changes in water bodies larger than 250m by 250m (and likely as small as one hectare).

  2. Surface water management at a mixed waste remediation site

    International Nuclear Information System (INIS)

    Schlotzhauer, D.S.; Warbritton, K.R.

    1991-01-01

    The Weldon Spring Remedial Action Project (WSSRAP) deals with chemical and radiological contaminants. MK-Ferguson Company is managing the project under contract with the US Department of Energy. Remedial activities include demolishing buildings, constructing material storage and staging areas, excavating and consolidating waste materials, and treating and disposing of the materials in a land disposal facility. Due to the excavation and construction required during remediation, a well-planned surface water management system is essential. Planning involves characterization of source areas and surface water transport mechanisms and identification of applicable regulations. System components include: erosion control sediment control, flow attenuation, and management of contaminated water. Combinations of these components may be utilized during actual construction and remediation to obtain optimum control. Monitoring is performed during implementation in order to assess the effectiveness of control measures. This management scheme provides for comprehensive management of surface water at this site by providing control and/or treatment to appropriate standards. Although some treatment methodologies for contaminated water are specific to site contaminants, this comprehensive program provides a management approach which is applicable to many remedial projects in order to minimize contaminant release and meet Clean Water Act requirements

  3. Observation of dynamic water microadsorption on Au surface

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xiaokang, E-mail: xiaokang.huang@tqs.com; Gupta, Gaurav; Gao, Weixiang; Tran, Van; Nguyen, Bang; McCormick, Eric; Cui, Yongjie; Yang, Yinbao; Hall, Craig; Isom, Harold [TriQuint Semiconductor, Inc., 500 W Renner Road, Richardson, Texas 75080 (United States)

    2014-05-15

    Experimental and theoretical research on water wettability, adsorption, and condensation on solid surfaces has been ongoing for many decades because of the availability of new materials, new detection and measurement techniques, novel applications, and different scales of dimensions. Au is a metal of special interest because it is chemically inert, has a high surface energy, is highly conductive, and has a relatively high melting point. It has wide applications in semiconductor integrated circuitry, microelectromechanical systems, microfluidics, biochips, jewelry, coinage, and even dental restoration. Therefore, its surface condition, wettability, wear resistance, lubrication, and friction attract a lot of attention from both scientists and engineers. In this paper, the authors experimentally investigated Au{sub 2}O{sub 3} growth, wettability, roughness, and adsorption utilizing atomic force microscopy, scanning electron microscopy, reflectance spectrometry, and contact angle measurement. Samples were made using a GaAs substrate. Utilizing a super-hydrophilic Au surface and the proper surface conditions of the surrounding GaAs, dynamic microadsorption of water on the Au surface was observed in a clean room environment. The Au surface area can be as small as 12 μm{sup 2}. The adsorbed water was collected by the GaAs groove structure and then redistributed around the structure. A model was developed to qualitatively describe the dynamic microadsorption process. The effective adsorption rate was estimated by modeling and experimental data. Devices for moisture collection and a liquid channel can be made by properly arranging the wettabilities or contact angles of different materials. These novel devices will be very useful in microfluid applications or biochips.

  4. Economic Impacts of Surface Mining on Household Drinking Water Supplies

    Science.gov (United States)

    This report provides information on the economic and social impacts of contaminated surface and ground water supplies on residents and households near surface mining operations. The focus is on coal slurry contamination of water supplies in Mingo County, West Virginia, and descr...

  5. Water response to ganglioside GM1 surface remodelling.

    Science.gov (United States)

    Brocca, P; Rondelli, V; Mallamace, F; Di Bari, M T; Deriu, A; Lohstroh, W; Del Favero, E; Corti, M; Cantu', L

    2017-01-01

    Gangliosides are biological glycolipids participating in rafts, structural and functional domains of cell membranes. Their headgroups are able to assume different conformations when packed on the surface of an aggregate, more lying or standing. Switching between different conformations is possible, and is a collective event. Switching can be induced, in model systems, by concentration or temperature increase, then possibly involving ganglioside-water interaction. In the present paper, the effect of GM1 ganglioside headgroup conformation on the water structuring and interactions is addressed. Depolarized Rayleigh Scattering, Raman Scattering, Quasielastic Neutron Scattering and NMR measurements were performed on GM1 ganglioside solutions, focusing on solvent properties. All used techniques agree in evidencing differences in the structure and dynamics of solvent water on different time-and-length scales in the presence of either GM1 headgroup conformations. In general, all results indicate that both the structural properties of solvent water and its interactions with the sugar headgroups of GM1 respond to surface remodelling. The extent of this modification is much higher than expected and, interestingly, ganglioside headgroups seem to turn from cosmotropes to chaotropes upon collective rearrangement from the standing- to the lying-conformation. In a biological perspective, water structure modulation could be one of the physico-chemical elements contributing to the raft strategy, both for rafts formation and persistence and for their functional aspects. In particular, the interaction with approaching bodies could be favoured or inhibited or triggered by complex-sugar-sequence conformational switch. This article is part of a Special Issue entitled "Science for Life" Guest Editor: Dr. Austen Angell, Dr. Salvatore Magazù and Dr. Federica Migliardo. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Perfluoroalkyl substances in the Maltese Environment - (I) Surface water and rain water

    NARCIS (Netherlands)

    Sammut, G.; Sinagra, E.; Helmus, R.; de Voogt, P.

    2017-01-01

    The presence of perfluoroalkyl substances (PFASs) in rain water on the Maltese Islands is reported here for the first time and an extensive survey of these substances in surface water also reported. The Maltese archipelago lies at the centre of the Mediterranean Sea and consists of three main

  7. Iron oxidation kinetics and phosphate immobilization along the flow-path from groundwater into surface water

    Science.gov (United States)

    van der Grift, B.; Rozemeijer, J. C.; Griffioen, J.; van der Velde, Y.

    2014-11-01

    The retention of phosphorus in surface waters through co-precipitation of phosphate with Fe-oxyhydroxides during exfiltration of anaerobic Fe(II) rich groundwater is not well understood. We developed an experimental field set-up to study Fe(II) oxidation and P immobilization along the flow-path from groundwater into surface water in an agricultural experimental catchment of a small lowland river. We physically separated tube drain effluent from groundwater discharge before it entered a ditch in an agricultural field. Through continuous discharge measurements and weekly water quality sampling of groundwater, tube drain water, exfiltrated groundwater, and surface water, we investigated Fe(II) oxidation kinetics and P immobilization processes. The oxidation rate inferred from our field measurements closely agreed with the general rate law for abiotic oxidation of Fe(II) by O2. Seasonal changes in climatic conditions affected the Fe(II) oxidation process. Lower pH and lower temperatures in winter (compared to summer) resulted in low Fe oxidation rates. After exfiltration to the surface water, it took a couple of days to more than a week before complete oxidation of Fe(II) is reached. In summer time, Fe oxidation rates were much higher. The Fe concentrations in the exfiltrated groundwater were low, indicating that dissolved Fe(II) is completely oxidized prior to inflow into a ditch. While the Fe oxidation rates reduce drastically from summer to winter, P concentrations remained high in the groundwater and an order of magnitude lower in the surface water throughout the year. This study shows very fast immobilization of dissolved P during the initial stage of the Fe(II) oxidation process which results in P-depleted water before Fe(II) is completely depleted. This cannot be explained by surface complexation of phosphate to freshly formed Fe-oxyhydroxides but indicates the formation of Fe(III)-phosphate precipitates. The formation of Fe(III)-phosphates at redox gradients

  8. Water on Mars: Evidence from MER Mission Results

    Science.gov (United States)

    Landis, Geoffrey A.

    2004-01-01

    The Viking and the Mars Exploration Rover missions observed that the surface of Mars is encrusted by a thinly cemented layer, or "duricrust". Elemental analyzes at five sites on Mars show that these soils have sulfur content and chlorine content consistent with the presence of sulfates and halides as mineral cements. The soil is highly enriched in the salt-forming elements compared with rock. Analysis of the soil cementation indicates some features which may be evidence of liquid water. At both MER sites, duricrust textures revealed by the Microscopic Imager show features including the presence of fine sand-sized grains, some of which may be aggregates of fine silt and clay, surrounded by a pervasive light colored material that is associated with microtubular structures and networks of microfractures. Stereo views of undisturbed duricrust surfaces reveal rugged microrelief between 2-3 mm and minimal loose material. Comparisons of microscopic images of duricrust soils obtain before and after placement of the Mossbauer spectrometer indicate differing degrees of compaction and cementation. Two models of a transient water hypothesis are offered, a "top down" hypothesis that emphasizes the surface deposition of frost, melting and downward migration of liquid water and a "bottom up" alternative that proposes the presence of interstitial ice/brine, with the upward capillary migration of liquid water. The viability of both of these models ultimately hinges on the availability of seasonally transient liquid water for brief periods.

  9. Interactions on External MOF Surfaces: Desorption of Water and Ethanol from CuBDC Nanosheets.

    Science.gov (United States)

    Elder, Alexander C; Aleksandrov, Alexandr B; Nair, Sankar; Orlando, Thomas M

    2017-10-03

    The external surfaces of metal-organic framework (MOF) materials are difficult to experimentally isolate due to the high porosities of these materials. MOF surface surrogates in the form of copper benzenedicarboxylate (CuBDC) nanosheets were synthesized using a bottom-up approach, and the surface interactions of water and ethanol were investigated by temperature-programmed desorption (TPD). A method of analysis of diffusion-influenced TPD was developed to measure the desorption properties of these porous materials. This approach also allows the extraction of diffusion coefficients from TPD data. The transmission Fourier transform infrared spectra, powder X-ray diffraction patterns, and TPD data indicate that water desorbs from CuBDC nanosheets with activation energies of 44 ± 2 kJ/mol at edge sites and 58 ± 1 kJ/mol at external surface and internal and pore sites. Ethanol desorbs with activation energies of 58 ± 1 kJ/mol at internal pore sites and 66 ± 0.4 kJ/mol at external surface sites. Co-adsorption of water and ethanol was also investigated. The presence of ethanol was found to inhibit the desorption of water, resulting in a water desorption process with an activation energy of 68 ± 0.7 kJ/mol.

  10. MUTAGENICITY AND DISINFECTION BY-PRODUCTS IN SURFACE DRINKING WATER DISINFECTED WITH PERACETIC ACID

    Science.gov (United States)

    The aims of this research were to study the influence of peracetic acid (PAA) on the formation of mutagens in surface waters used for human consumption and to assess its potential application for the disinfection of drinking water. The results obtained using PAA were compared to ...

  11. REMOVAL OF ORGANIC MATTER FROM SURFACE WATER USING COAGULANTS WITH VARIOUS BASICITY

    Directory of Open Access Journals (Sweden)

    Lidia Dąbrowska

    2016-07-01

    Full Text Available Humic substances are a natural admixture of surface water and determine the level of organic pollution of water and colour intensity. Application of coagulation process in surface water treatment allows for decrease turbidity and colour of water, as well as organic matter content. In Poland most drinking water treatment plants use aluminium sulphate as a coagulant. Research works on pre-hydrolysed coagulants, e.g. polyaluminium chlorides (general formula Aln(OHmCl3n-m are also carried out. The aim of this study was to evaluate the effectiveness of the coagulation process using polyaluminium chlorides with different basicity, in reducing the level of pollution of surface water with organic substances. Apart from the typical indicators used to evaluate the content of organic compounds, the potential for trihalomethanes formation THM-FP was also determined. The influence of the type of coagulant (low, medium, highly alkaline on the efficiency of organic compound removal, determined as total organic carbon TOC, oxidisability OXI, absorbance UV254, was stated. Under the conditions of the coagulation (pH 7.2-7.4, temperature of 19-21°C, the best results were obtained using highly alkaline polyaluminium chlorides PAX-XL19F, PAX-XL1905 and PAX-XL1910S, decrease in TOC and OXI by 43-46%, slightly worse - 40-41% using low alkaline PAX18. Using the medium alkaline coagulants PAX-XL61 and PAXX-XL69, 30-35% removal of organic matter was obtained. Despite various effects of dissolved organic carbon removal, depending on the used coagulant, THM-FP in purified water did not differ significantly and ranged from 10.0 to 10.9 mgCHCl3 m-3. It was by 37-42% lower than in surface water.

  12. Impacts of petroleum production on ground and surface waters: Results from the Osage-Skiatook Petroleum Environmental Research A site, Osage County Oklahoma

    Science.gov (United States)

    Kharaka, Y.K.; Thordsen, J.J.; Kakouros, E.; Herkelrath, W.N.

    2005-01-01

    As part of a multidisciplinary group of about 20 scientists, we are investigating the transport, fate, natural attenuation, and ecosystem impacts of inorganic salts and organic compounds present in releases of produced water and associated hydrocarbons at the Osage-Skiatook Petroleum Environmental Research (OSPER) sites, located in Osage County, Oklahoma. Geochemical data collected from nearby oil wells show that the produced water source is a Na-Ca-Cl brine (???150,000 mg/L total dissolved solids [TDS]), with relatively high concentrations of Mg, Sr, and NH4, but low SO4 and H2S. Results from the depleted OSPER A site show that the salts continue to be removed from the soil and surficial rocks, but degraded oil persists on the contaminated surface. Eventually, the bulk of inorganic salts and dissolved organics in the brine will reach the adjacent Skiatook Lake, a 4250-ha (10,501-ac) potable water reservoir. Repeated sampling of 44 wells show a plume of high-salinity water (2000-30,000 mg/L TDS) at intermediate depths that intersects Skiatook Lake and extends beyond the visibly impacted areas. No liquid petroleum was observed in this plume, but organic acid anions, benzene, toluene, ethylbenzene, and xylene (BTEX), and other volatile organic carbon (VOC) are present. The chemical composition of released brine is modified by sorption, mineral precipitation and dissolution, evapotranspiration, volatilization, and bacterially mediated oxidation-reduction reactions, in addition to mixing with percolating precipitation water, lake water, and pristine groundwater. Results show that only minor amounts of salt are removed by runoff, supporting the conclusion that significant amounts of salts from produced water and petroleum releases still remain in the soils and rocks of the impacted area after more than 65 yr of natural attenuation. Copyright ?? 2005. The American Association of Petroleum Geologists/Division of Environmental Geosciences. All rights reserved.

  13. Neutron probe measurement of soil water content close to soil surface

    International Nuclear Information System (INIS)

    Faleiros, M.C.; Ravelo S, A.; Souza, M.D. de

    1993-01-01

    The problem of neutron probe soil water content measurements close to soil surface is analysed from the spatial variability and also from the slow neutron loss to the atmosphere points of view. Results obtained on a dark red latosol of the county of Piracicaba, SP, indicate the possibility of precisely measuring the neutron sphere of influence when different media are used on soil surface. (author). 7 refs, 5 figs, 1 tab

  14. Polyfluorinated chemicals in European surface waters, ground- and drinking waters

    NARCIS (Netherlands)

    Eschauzier, C.; de Voogt, P.; Brauch, H.-J.; Lange, F.T.; Knepper, T.P.; Lange, F.T.

    2012-01-01

    Polyfluorinated chemicals (PFCs), especially short chain fluorinated alkyl sulfonates and carboxylates, are ubiquitously found in the environment. This chapter aims at giving an overview of PFC concentrations found in European surface, ground- and drinking waters and their behavior during

  15. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  16. Effect of high-extraction coal mining on surface and ground waters

    International Nuclear Information System (INIS)

    Kendorski, F.S.

    1993-01-01

    Since first quantified around 1979, much new data have become available. In examining the sources of data and the methods and intents of the researchers of over 65 case histories, it became apparent that the strata behaviors were being confused with overlapping vertical extents reported for the fractured zones and aquiclude zones depending on whether the researcher was interested in water intrusion into the mine or in water loss from surface or ground waters. These more recent data, and critical examination of existing data, have led to the realization that the former Aquiclude Zone defined for its ability to prevent or minimize the intrusion of ground or surface waters into mines has another important character in increasing storage of surface and shallow ground waters in response to mining with no permanent loss of waters. This zone is here named the Dilated Zone. Surface and ground waters can drain into this zone, but seldom into the mine, and can eventually be recovered through closing of dilations by mine subsidence progression away from the area, or filling of the additional void space created, or both. A revised model has been developed which accommodates the available data, by modifying the zones as follows: collapse and disaggregation extending 6 to 10 times the mined thickness above the panel; continuous fracturing extending approximately 24 times the mined thickness above the panel, allowing temporary drainage of intersected surface and ground waters; development of a zone of dilated, increased storativity, and leaky strata with little enhanced vertical permeability from 24 to 60 times the mined thickness above the panel above the continuous fracturing zone, and below the constrained or surface effects zones; maintenance of a constrained but leaky zone above the dilated zone and below the surface effects zone; and limited surface fracturing in areas of extension extending up to 50 ft or so beneath the ground surface. 119 ref., 5 figs., 2 tabs

  17. Tracking fine-scale seasonal evolution of surface water extent in Central Alaska and the Canadian Shield

    Science.gov (United States)

    Cooley, S. W.; Smith, L. C.; Pitcher, L. H.; Pavelsky, T.; Topp, S.

    2017-12-01

    Quantifying spatial and temporal variability in surface water storage at high latitudes is critical for assessing environmental sensitivity to climate change. Traditionally the tradeoff between high spatial and high temporal resolution space-borne optical imagery has limited the ability to track fine-scale changes in surface water extent. However, the recent launch of hundreds of earth-imaging CubeSats by commercial satellite companies such as Planet opens up new possibilities for monitoring surface water from space. In this study we present a comparison of seasonal evolution of surface water extent in two study areas with differing geologic, hydrologic and permafrost regimes, namely, the Yukon Flats in Central Alaska and the Canadian Shield north of Yellowknife, N.W.T. Using near-daily 3m Planet CubeSat imagery, we track individual lake surface area from break-up to freeze-up during summer 2017 and quantify the spatial and temporal variability in inundation extent. We validate our water delineation method and inundation extent time series using WorldView imagery, coincident in situ lake shoreline mapping and pressure transducer data for 19 lakes in the Northwest Territories and Alaska collected during the NASA Arctic Boreal Vulnerability Experiment (ABoVE) 2017 field campaign. The results of this analysis demonstrate the value of CubeSat imagery for dynamic surface water research particularly at high latitudes and illuminate fine-scale drivers of cold regions surface water extent.

  18. Sectoral contributions to surface water stress in the coterminous United States

    International Nuclear Information System (INIS)

    Averyt, K; Meldrum, J; Caldwell, P; Sun, G; McNulty, S; Huber-Lee, A; Madden, N

    2013-01-01

    Here, we assess current stress in the freshwater system based on the best available data in order to understand possible risks and vulnerabilities to regional water resources and the sectors dependent on freshwater. We present watershed-scale measures of surface water supply stress for the coterminous United States (US) using the water supply stress index (WaSSI) model which considers regional trends in both water supply and demand. A snapshot of contemporary annual water demand is compared against different water supply regimes, including current average supplies, current extreme-year supplies, and projected future average surface water flows under a changing climate. In addition, we investigate the contributions of different water demand sectors to current water stress. On average, water supplies are stressed, meaning that demands for water outstrip natural supplies in over 9% of the 2103 watersheds examined. These watersheds rely on reservoir storage, conveyance systems, and groundwater to meet current water demands. Overall, agriculture is the major demand-side driver of water stress in the US, whereas municipal stress is isolated to southern California. Water stress introduced by cooling water demands for power plants is punctuated across the US, indicating that a single power plant has the potential to stress water supplies at the watershed scale. On the supply side, watersheds in the western US are particularly sensitive to low flow events and projected long-term shifts in flow driven by climate change. The WaSSI results imply that not only are water resources in the southwest in particular at risk, but that there are also potential vulnerabilities to specific sectors, even in the ‘water-rich’ southeast. (letter)

  19. Hydrochemical assessments of surface Nile water and ground water in an industry area – South West Cairo

    Directory of Open Access Journals (Sweden)

    Mona El-Sayed

    2015-09-01

    The data obtained were used for mathematical calculations of some parameters such as sodium adsorption ratio (SAR, sodium percentage (Na%, and the suitability of water samples for drinking, domestic, and irrigation purposes was evaluated. The results indicate that most studied surface Nile water samples show excellent to good categories and are suitable for drinking and irrigation. Most studied ground water samples are not suitable for drinking and need treatment for irrigation; few samples are not suitable for any purpose because of pollution from different sources in this area.

  20. Polarization Patterns of Transmitted Celestial Light under Wavy Water Surfaces

    Directory of Open Access Journals (Sweden)

    Guanhua Zhou

    2017-03-01

    Full Text Available This paper presents a model to describe the polarization patterns of celestial light, which includes sunlight and skylight, when refracted by wavy water surfaces. The polarization patterns and intensity distribution of refracted light through the wave water surface were calculated. The model was validated by underwater experimental measurements. The experimental and theoretical values agree well qualitatively. This work provides a quantitative description of the repolarization and transmittance of celestial light transmitted through wave water surfaces. The effects of wind speed and incident sources on the underwater refraction polarization patterns are discussed. Scattering skylight dominates the polarization patterns while direct solar light is the dominant source of the intensity of the underwater light field. Wind speed has an influence on disturbing the patterns under water.

  1. Pesticide monitoring in surface water and groundwater using passive samplers

    Science.gov (United States)

    Kodes, V.; Grabic, R.

    2009-04-01

    Passive samplers as screening devices have been used within a czech national water quality monitoring network since 2002 (SPMD and DGT samplers for non polar substances and metals). The passive sampler monitoring of surface water was extended to polar substances, in 2005. Pesticide and pharmaceutical POCIS samplers have been exposed in surface water at 21 locations and analysed for polar pesticides, perfluorinated compounds, personal care products and pharmaceuticals. Pesticide POCIS samplers in groundwater were exposed at 5 locations and analysed for polar pesticides. The following active substances of plant protection products were analyzed in surface water and groundwater using LC/MS/MS: 2,4,5-T, 2,4-D, Acetochlor, Alachlor, Atrazine, Atrazine_desethyl, Azoxystrobin, Bentazone, Bromacil, Bromoxynil, Carbofuran, Clopyralid, Cyanazin, Desmetryn, Diazinon, Dicamba, Dichlobenil, Dichlorprop, Dimethoat, Diuron, Ethofumesate, Fenarimol, Fenhexamid, Fipronil, Fluazifop-p-butyl, Hexazinone, Chlorbromuron, Chlorotoluron, Imazethapyr, Isoproturon, Kresoxim-methyl, Linuron, MCPA, MCPP, Metalaxyl, Metamitron, Methabenzthiazuron, Methamidophos, Methidathion, Metobromuron, Metolachlor, Metoxuron, Metribuzin, Monolinuron, Nicosulfuron, Phorate, Phosalone, Phosphamidon, Prometryn, Propiconazole, Propyzamide, Pyridate, Rimsulfuron, Simazine, Tebuconazole, Terbuthylazine, Terbutryn, Thifensulfuron-methyl, Thiophanate-methyl and Tri-allate. The POCIS samplers performed very well being able to provide better picture than grab samples. The results show that polar pesticides and also perfluorinated compounds, personal care products and pharmaceuticals as well occur in hydrosphere of the Czech republic. Acknowledgment: Authors acknowledge the financial support of grant No. 2B06095 by the Ministry of Education, Youth and Sports.

  2. Calcium carbonate nucleation in an alkaline lake surface water, Pyramid Lake, Nevada, USA

    Science.gov (United States)

    Reddy, Michael M.; Hoch, Anthony

    2012-01-01

    Calcium concentration and calcite supersaturation (Ω) needed for calcium carbonate nucleation and crystal growth in Pyramid Lake (PL) surface water were determined during August of 1997, 2000, and 2001. PL surface water has Ω values of 10-16. Notwithstanding high Ω, calcium carbonate growth did not occur on aragonite single crystals suspended PL surface water for several months. However, calcium solution addition to PL surface-water samples caused reproducible calcium carbonate mineral nucleation and crystal growth. Mean PL surface-water calcium concentration at nucleation was 2.33 mM (n = 10), a value about nine times higher than the ambient PL surface-water calcium concentration (0.26 mM); mean Ω at nucleation (109 with a standard deviation of 8) is about eight times the PL surface-water Ω. Calcium concentration and Ω regulated the calcium carbonate formation in PL nucleation experiments and surface water. Unfiltered samples nucleated at lower Ω than filtered samples. Calcium concentration and Ω at nucleation for experiments in the presence of added particles were within one standard deviation of the mean for all samples. Calcium carbonate formation rates followed a simple rate expression of the form, rate (mM/min) = A (Ω) + B. The best fit rate equation "Rate (Δ mM/Δ min) = -0.0026 Ω + 0.0175 (r = 0.904, n = 10)" was statistically significant at greater than the 0.01 confidence level and gives, after rearrangement, Ω at zero rate of 6.7. Nucleation in PL surface water and morphology of calcium carbonate particles formed in PL nucleation experiments and in PL surface-water samples suggest crystal growth inhibition by multiple substances present in PL surface water mediates PL calcium carbonate formation, but there is insufficient information to determine the chemical nature of all inhibitors.

  3. Assesment of pesticide fluxes to surface water using Uranine in Colombia

    Science.gov (United States)

    Garcia-Santos, G.; Scheiben, D.; Diaz, J.; Leuenberger, F.; Binder, C. R.

    2009-04-01

    In the highlands of Colombia, potato farmers maximize their yields by the application of pesticides. Properly applied pesticides can significantly reduce yield loss and improve product quality; however their misuse leads to human health and environmental problems, i.e. water bodies contaminated with pesticides. Due to the lack of control regarding local pesticide use, unmeasured hydrological parameters and use of local water runoff as a drinking water supply, an assessment of the impact of agricultural practice on water quality is mandatory as first stage. In order to accomplish this, our study assesses pesticide fluxes to surface water using the tracer Uranine. The experimental area La Hoya main basin (3 km2) contains the Pantano Verde river which flows into the Teatinos river in the Boyaca region (Colombia). Some facts such as the deep soils in the area and the importance of the unsaturated zone for the sorption and degradation of pesticides suggest a lack of contaminants in groundwater. However, due to the humid conditions, steep slopes and an intensive agricultural with high pesticide use, we expect surface water to be highly contaminated. In order to assess pesticide pathways, a tracer (Uranine), detectable at very low amount was used. Four local farmers applied the tracer instead of the pesticide mixture covering a total surface of 1.2 10-2 km2. Meteorological data were measured every 15 min with one compact meteorological station installed within the basin and water flow and water sampling were obtained using an ISCO-6700 water sampler, during one week every 10 min in the outlet of Pantano Verde River. In addition, three pairs of membranes were installed down the river and collected 1 week, one month and 4 months after the experiment to measure tracer accumulation. The tracer in water was analysed using a fluorescent spectrometer. Results of this study show first variations of tracer concentration in water in La Hoya basin and constitute an initial steep in

  4. Validation of a new device to quantify groundwater-surface water exchange

    Science.gov (United States)

    Cremeans, Mackenzie M.; Devlin, J. F.

    2017-11-01

    Distributions of flow across the groundwater-surface water interface should be expected to be as complex as the geologic deposits associated with stream or lake beds and their underlying aquifers. In these environments, the conventional Darcy-based method of characterizing flow systems (near streams) has significant limitations, including reliance on parameters with high uncertainties (e.g., hydraulic conductivity), the common use of drilled wells in the case of streambank investigations, and potentially lengthy measurement times for aquifer characterization and water level measurements. Less logistically demanding tools for quantifying exchanges across streambeds have been developed and include drive-point mini-piezometers, seepage meters, and temperature profiling tools. This project adds to that toolbox by introducing the Streambed Point Velocity Probe (SBPVP), a reusable tool designed to quantify groundwater-surface water interactions (GWSWI) at the interface with high density sampling, which can effectively, rapidly, and accurately complement conventional methods. The SBPVP is a direct push device that measures in situ water velocities at the GWSWI with a small-scale tracer test on the probe surface. Tracer tests do not rely on hydraulic conductivity or gradient information, nor do they require long equilibration times. Laboratory testing indicated that the SBPVP has an average accuracy of ± 3% and an average precision of ± 2%. Preliminary field testing, conducted in the Grindsted Å in Jutland, Denmark, yielded promising agreement between groundwater fluxes determined by conventional methods and those estimated from the SBPVP tests executed at similar scales. These results suggest the SBPVP is a viable tool to quantify groundwater-surface water interactions in high definition in sandy streambeds.

  5. The impact of uncontrolled waste disposal on surface water quality ...

    African Journals Online (AJOL)

    The main threat to the surface water quality in Addis Ababa is environmental pollution derived from domestic and industrial activities. Due to the inadequacy of controlled waste management strategies and waste treatment plants, people are forced to discharge wastes both on open surface and within water bodies.

  6. Surface-water radon-222 distribution along the west-central Florida shelf

    Science.gov (United States)

    Smith, C.G.; Robbins, L.L.

    2012-01-01

    In February 2009 and August 2009, the spatial distribution of radon-222 in surface water was mapped along the west-central Florida shelf as collaboration between the Response of Florida Shelf Ecosystems to Climate Change project and a U.S. Geological Survey Mendenhall Research Fellowship project. This report summarizes the surface distribution of radon-222 from two cruises and evaluates potential physical controls on radon-222 fluxes. Radon-222 is an inert gas produced overwhelmingly in sediment and has a short half-life of 3.8 days; activities in surface water ranged between 30 and 170 becquerels per cubic meter. Overall, radon-222 activities were enriched in nearshore surface waters relative to offshore waters. Dilution in offshore waters is expected to be the cause of the low offshore activities. While thermal stratification of the water column during the August survey may explain higher radon-222 activities relative to the February survey, radon-222 activity and integrated surface-water inventories decreased exponentially from the shoreline during both cruises. By estimating radon-222 evasion by wind from nearby buoy data and accounting for internal production from dissolved radium-226, its radiogenic long-lived parent, a simple one-dimensional model was implemented to determine the role that offshore mixing, benthic influx, and decay have on the distribution of excess radon-222 inventories along the west Florida shelf. For multiple statistically based boundary condition scenarios (first quartile, median, third quartile, and maximum radon-222 inshore of 5 kilometers), the cross-shelf mixing rates and average nearshore submarine groundwater discharge (SGD) rates varied from 100.38 to 10-3.4 square kilometers per day and 0.00 to 1.70 centimeters per day, respectively. This dataset and modeling provide the first attempt to assess cross-shelf mixing and SGD on such a large spatial scale. Such estimates help scale up SGD rates that are often made at 1- to 10-meter

  7. Water surface deformation in strong electrical fields and its influence on electrical breakdown in a metal pin-water electrode system

    International Nuclear Information System (INIS)

    Bruggeman, Peter; Graham, Leigh; Groote, Joris de; Vierendeels, Jan; Leys, Christophe

    2007-01-01

    Electrical breakdown and water surface deformation in a metal pin-water electrode system with dc applied voltages is studied for small inter-electrode distances (2-12 mm). The radius of curvature of the metal pin is 0.5 cm to exclude corona before breakdown at these small inter-electrode spacings. Calculations of the water surface deformation as a function of the applied voltage and initial inter-electrode spacing are compared with measurements of the water elevation. For distances smaller than 7 mm the calculated stability limit of the water surface corresponds with the experimentally obtained breakdown voltage. It is proved with fast CCD images and calculations of the electrical field distribution that the water surface instability triggers the electrical breakdown in this case. The images show that at breakdown the water surface has a Taylor cone-like shape. At inter-electrode distance of 7 mm and larger the breakdown voltage is well below the water stability limit and the conductive channel at breakdown is formed between the pin electrode and the static water surface. Both cases are discussed and compared

  8. Fission Surface Power Technology Demonstration Unit Test Results

    Science.gov (United States)

    Briggs, Maxwell H.; Gibson, Marc A.; Geng, Steven M.; Sanzi, James L.

    2016-01-01

    The Fission Surface Power (FSP) Technology Demonstration Unit (TDU) is a system-level demonstration of fission power technology intended for use on manned missions to Mars. The Baseline FSP systems consists of a 190 kWt UO2 fast-spectrum reactor cooled by a primary pumped liquid metal loop. This liquid metal loop transfers heat to two intermediate liquid metal loops designed to isolate fission products in the primary loop from the balance of plant. The intermediate liquid metal loops transfer heat to four Stirling Power Conversion Units (PCU), each of which produce 12 kWe (48 kW total) and reject waste heat to two pumped water loops, which transfer the waste heat to titanium-water heat pipe radiators. The FSP TDU simulates a single leg of the baseline FSP system using an electrically heater core simulator, a single liquid metal loop, a single PCU, and a pumped water loop which rejects the waste heat to a Facility Cooling System (FCS). When operated at the nominal operating conditions (modified for low liquid metal flow) during TDU testing the PCU produced 8.9 kW of power at an efficiency of 21.7 percent resulting in a net system power of 8.1 kW and a system level efficiency of 17.2 percent. The reduction in PCU power from levels seen during electrically heated testing is the result of insufficient heat transfer from the NaK heater head to the Stirling acceptor, which could not be tested at Sunpower prior to delivery to the NASA Glenn Research Center (GRC). The maximum PCU power of 10.4 kW was achieved at the maximum liquid metal temperature of 875 K, minimum water temperature of 350 K, 1.1 kg/s liquid metal flow, 0.39 kg/s water flow, and 15.0 mm amplitude at an efficiency of 23.3 percent. This resulted in a system net power of 9.7 kW and a system efficiency of 18.7 percent.

  9. A global, 30-m resolution land-surface water body dataset for 2000

    Science.gov (United States)

    Feng, M.; Sexton, J. O.; Huang, C.; Song, D. X.; Song, X. P.; Channan, S.; Townshend, J. R.

    2014-12-01

    Inland surface water is essential to terrestrial ecosystems and human civilization. The distribution of surface water in space and its change over time are related to many agricultural, environmental and ecological issues, and are important factors that must be considered in human socioeconomic development. Accurate mapping of surface water is essential for both scientific research and policy-driven applications. Satellite-based remote sensing provides snapshots of Earth's surface and can be used as the main input for water mapping, especially in large areas. Global water areas have been mapped with coarse resolution remotely sensed data (e.g., the Moderate Resolution Imaging Spectroradiometer (MODIS)). However, most inland rivers and water bodies, as well as their changes, are too small to map at such coarse resolutions. Landsat TM (Thematic Mapper) and ETM+ (Enhanced Thematic Mapper Plus) imagery has a 30m spatial resolution and provides decades of records (~40 years). Since 2008, the opening of the Landsat archive, coupled with relatively lower costs associated with computing and data storage, has made comprehensive study of the dynamic changes of surface water over large even global areas more feasible. Although Landsat images have been used for regional and even global water mapping, the method can hardly be automated due to the difficulties on distinguishing inland surface water with variant degrees of impurities and mixing of soil background with only Landsat data. The spectral similarities to other land cover types, e.g., shadow and glacier remnants, also cause misidentification. We have developed a probabilistic based automatic approach for mapping inland surface water bodies. Landsat surface reflectance in multiple bands, derived water indices, and data from other sources are integrated to maximize the ability of identifying water without human interference. The approach has been implemented with open-source libraries to facilitate processing large

  10. Water redistribution at the soil surface : ponding and surface runoff in flat areas

    NARCIS (Netherlands)

    Appels, W.M.

    2013-01-01

    In The Netherlands, one of the most important targets for the improvement of surface water quality as aimed for in the European Water Framework Directive, is the reduction of nutrient concentrations (both nitrogen and phosphorus). To identify the most suitable and effective measures for reducing the

  11. Forecasting in an integrated surface water-ground water system: The Big Cypress Basin, South Florida

    Science.gov (United States)

    Butts, M. B.; Feng, K.; Klinting, A.; Stewart, K.; Nath, A.; Manning, P.; Hazlett, T.; Jacobsen, T.

    2009-04-01

    The South Florida Water Management District (SFWMD) manages and protects the state's water resources on behalf of 7.5 million South Floridians and is the lead agency in restoring America's Everglades - the largest environmental restoration project in US history. Many of the projects to restore and protect the Everglades ecosystem are part of the Comprehensive Everglades Restoration Plan (CERP). The region has a unique hydrological regime, with close connection between surface water and groundwater, and a complex managed drainage network with many structures. Added to the physical complexity are the conflicting needs of the ecosystem for protection and restoration, versus the substantial urban development with the accompanying water supply, water quality and flood control issues. In this paper a novel forecasting and real-time modelling system is presented for the Big Cypress Basin. The Big Cypress Basin includes 272 km of primary canals and 46 water control structures throughout the area that provide limited levels of flood protection, as well as water supply and environmental quality management. This system is linked to the South Florida Water Management District's extensive real-time (SCADA) data monitoring and collection system. Novel aspects of this system include the use of a fully distributed and integrated modeling approach and a new filter-based updating approach for accurately forecasting river levels. Because of the interaction between surface- and groundwater a fully integrated forecast modeling approach is required. Indeed, results for the Tropical Storm Fay in 2008, the groundwater levels show an extremely rapid response to heavy rainfall. Analysis of this storm also shows that updating levels in the river system can have a direct impact on groundwater levels.

  12. [Correlative analysis of the diversity patterns of regional surface water, NDVI and thermal environment].

    Science.gov (United States)

    Duan, Jin-Long; Zhang, Xue-Lei

    2012-10-01

    Taking Zhengzhou City, the capital of Henan Province in Central China, as the study area, and by using the theories and methodologies of diversity, a discreteness evaluation on the regional surface water, normalized difference vegetation index (NDVI), and land surface temperature (LST) distribution was conducted in a 2 km x 2 km grid scale. Both the NDVI and the LST were divided into 4 levels, their spatial distribution diversity indices were calculated, and their connections were explored. The results showed that it was of operability and practical significance to use the theories and methodologies of diversity in the discreteness evaluation of the spatial distribution of regional thermal environment. There was a higher overlap of location between the distributions of surface water and the lowest temperature region, and the high vegetation coverage was often accompanied by low land surface temperature. In 1988-2009, the discreteness of the surface water distribution in the City had an obvious decreasing trend. The discreteness of the surface water distribution had a close correlation with the discreteness of the temperature region distribution, while the discreteness of the NDVI classification distribution had a more complicated correlation with the discreteness of the temperature region distribution. Therefore, more environmental factors were needed to be included for a better evaluation.

  13. UV sensitivity of planktonic net community production in ocean surface waters

    OpenAIRE

    Regaudie de Gioux, Aurore; Agustí, Susana; Duarte, Carlos M.

    2014-01-01

    The net plankton community metabolism of oceanic surface waters is particularly important as it more directly affects the partial pressure of CO2 in surface waters and thus the air-sea fluxes of CO2. Plankton communities in surface waters are exposed to high irradiance that includes significant ultraviolet blue (UVB, 280-315 nm) radiation. UVB radiation affects both photosynthetic and respiration rates, increase plankton mortality rates, and other metabolic and chemical processes. Here we tes...

  14. Simulation of gas compressible flow by free surface water flow

    International Nuclear Information System (INIS)

    Altafini, C.R.; Silva Ferreira, R.T. da

    1981-01-01

    The analogy between the water flow with a free surface and the compressible fluid flow, commonly called hydraulic analogy, is analyzed and its limitations are identified. The water table is the equipment used for this simulation, which allows the quatitative analysis of subsonic and supersonic flow with a low cost apparatus. The hydraulic analogy is applied to subsonic flow around circular cylinders and supersonic flow around cones. The results are compared with available theoretical and experimental data and a good agreement is achieved. (Author) [pt

  15. Source Water Assessment for the Las Vegas Valley Surface Waters

    Science.gov (United States)

    Albuquerque, S. P.; Piechota, T. C.

    2003-12-01

    The 1996 amendment to the Safe Drinking Water Act of 1974 created the Source Water Assessment Program (SWAP) with an objective to evaluate potential sources of contamination to drinking water intakes. The development of a Source Water Assessment Plan for Las Vegas Valley surface water runoff into Lake Mead is important since it will guide future work on source water protection of the main source of water. The first step was the identification of the watershed boundary and source water protection area. Two protection zones were delineated. Zone A extends 500 ft around water bodies, and Zone B extends 3000 ft from the boundaries of Zone A. These Zones extend upstream to the limits of dry weather flows in the storm channels within the Las Vegas Valley. After the protection areas were identified, the potential sources of contamination in the protection area were inventoried. Field work was conducted to identify possible sources of contamination. A GIS coverage obtained from local data sources was used to identify the septic tank locations. Finally, the National Pollutant Discharge Elimination System (NPDES) Permits were obtained from the State of Nevada, and included in the inventory. After the inventory was completed, a level of risk was assigned to each potential contaminating activity (PCA). The contaminants of concern were grouped into five categories: volatile organic compounds (VOCs), synthetic organic compounds (SOCs), inorganic compounds (IOCs), microbiological, and radionuclides. The vulnerability of the water intake to each of the PCAs was assigned based on these five categories, and also on three other factors: the physical barrier effectiveness, the risk potential, and the time of travel. The vulnerability analysis shows that the PCAs with the highest vulnerability rating include septic systems, golf courses/parks, storm channels, gas stations, auto repair shops, construction, and the wastewater treatment plant discharges. Based on the current water quality

  16. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  17. Issues of the presence of parasitic protozoa in surface waters

    Directory of Open Access Journals (Sweden)

    Hawrylik Eliza

    2018-01-01

    This paper focuses on the problem of the presence of parasitic protozoa in surface waters. Characteristics of the most frequently recognized pathogens responsible for water-borne outbreaks were described, as well as sources of contamination and surface waters contamination due to protozoa of the genus Cryptosporidium and Giardia were presented. The methods of destroying the cysts and oocysts of parasitic protozoa used nowadays in the world were also presented in a review.

  18. Evaporation phase change processes of water/methanol mixtures on superhydrophobic nanostructured surfaces

    Science.gov (United States)

    Chiang, Cheng-Kun; Lu, Yen-Wen

    2011-07-01

    Evaporation phenomena are a critical and frequently seen phase change process in many heat transfer applications. In this paper, we study the evaporation process of a sessile droplet on two topologically different surfaces, including smooth and nanostructured surfaces. The nanostructured surface has an array of high-aspect-ratio nanowires (height/diameter ~ 125) and is implemented by using a simple template-based nanofabrication method. It possesses superhydrophobicity (>140°) and low contact angle hysteresis (1.2-2.1°), allowing the liquid droplets to remain in the 'fakir' state throughout the evaporation processes. Sessile droplets of deionized (DI) water and water/methanol binary mixture test liquids with their contact angles and base diameters are monitored. The results show that the nanostructures play a critical role in the droplet dynamics during evaporation.

  19. Evaporation phase change processes of water/methanol mixtures on superhydrophobic nanostructured surfaces

    International Nuclear Information System (INIS)

    Chiang, Cheng-Kun; Lu, Yen-Wen

    2011-01-01

    Evaporation phenomena are a critical and frequently seen phase change process in many heat transfer applications. In this paper, we study the evaporation process of a sessile droplet on two topologically different surfaces, including smooth and nanostructured surfaces. The nanostructured surface has an array of high-aspect-ratio nanowires (height/diameter ∼ 125) and is implemented by using a simple template-based nanofabrication method. It possesses superhydrophobicity (>140°) and low contact angle hysteresis (1.2–2.1°), allowing the liquid droplets to remain in the 'fakir' state throughout the evaporation processes. Sessile droplets of deionized (DI) water and water/methanol binary mixture test liquids with their contact angles and base diameters are monitored. The results show that the nanostructures play a critical role in the droplet dynamics during evaporation

  20. Thermal desorption of formamide and methylamine from graphite and amorphous water ice surfaces

    Science.gov (United States)

    Chaabouni, H.; Diana, S.; Nguyen, T.; Dulieu, F.

    2018-04-01

    Context. Formamide (NH2CHO) and methylamine (CH3NH2) are known to be the most abundant amine-containing molecules in many astrophysical environments. The presence of these molecules in the gas phase may result from thermal desorption of interstellar ices. Aims: The aim of this work is to determine the values of the desorption energies of formamide and methylamine from analogues of interstellar dust grain surfaces and to understand their interaction with water ice. Methods: Temperature programmed desorption (TPD) experiments of formamide and methylamine ices were performed in the sub-monolayer and monolayer regimes on graphite (HOPG) and non-porous amorphous solid water (np-ASW) ice surfaces at temperatures 40-240 K. The desorption energy distributions of these two molecules were calculated from TPD measurements using a set of independent Polanyi-Wigner equations. Results: The maximum of the desorption of formamide from both graphite and ASW ice surfaces occurs at 176 K after the desorption of H2O molecules, whereas the desorption profile of methylamine depends strongly on the substrate. Solid methylamine starts to desorb below 100 K from the graphite surface. Its desorption from the water ice surface occurs after 120 K and stops during the water ice sublimation around 150 K. It continues to desorb from the graphite surface at temperatures higher than160 K. Conclusions: More than 95% of solid NH2CHO diffuses through the np-ASW ice surface towards the graphitic substrate and is released into the gas phase with a desorption energy distribution Edes = 7460-9380 K, which is measured with the best-fit pre-exponential factor A = 1018 s-1. However, the desorption energy distribution of methylamine from the np-ASW ice surface (Edes = 3850-8420 K) is measured with the best-fit pre-exponential factor A = 1012 s-1. A fraction of solid methylamine monolayer of roughly 0.15 diffuses through the water ice surface towards the HOPG substrate. This small amount of methylamine

  1. Application of new point measurement device to quantify groundwater-surface water interactions

    DEFF Research Database (Denmark)

    Cremeans, Mackenzie; Devlin, J.F.; McKnight, Ursula S.

    2018-01-01

    The Streambed Point Velocity Probe (SBPVP) measures in situ groundwater velocities at the groundwater-surface water interface without reliance on hydraulic conductivity, porosity, or hydraulic gradient information. The tool operates on the basis of a mini-tracer test that occurs on the probe...... hydraulic head and temperature gradient data collected at similar scales. Spatial relationships of water flow through the streambed were found to be similar by all three methods, and indicated a heterogeneous pattern of groundwater-surface water exchange. The magnitudes of estimated flow varied to a greater...... degree. It was found that pollutants enter the stream in localized regions of high flow which do not always correspond to the locations of highest pollutant concentration. The results show the combined influence of flow and concentration on contaminant discharge and illustrate the advantages of adopting...

  2. Models of Fate and Transport of Pollutants in Surface Waters

    Science.gov (United States)

    Okome, Gloria Eloho

    2013-01-01

    There is the need to answer very crucial questions of "what happens to pollutants in surface waters?" This question must be answered to determine the factors controlling fate and transport of chemicals and their evolutionary state in surface waters. Monitoring and experimental methods are used in establishing the environmental states.…

  3. Radiological monitoring plan for the Oak Ridge Y-12 Plant: Surface Water

    International Nuclear Information System (INIS)

    1997-10-01

    The Y-12 Plant conducts a surface water monitoring program in response to DOE Orders and state of Tennessee requirements under the National Pollutant Discharge Elimination System (NPDES). The anticipated codification of DOE Order 5400.5 for radiation protection of the public and the environment (10 CFR Part 834) will require an environmental radiation protection plan (ERPP). The NPDES permit issued by the state of Tennessee requires a radiological monitoring plan (RMP) for Y-12 Plant surface waters. In a May 4, 1995 memo, the state of Tennessee, Division of Water Pollution Control, stated their desired needs and goals regarding the content of RMPs, associated documentation, and data resulting from the RMPs required under the NPDES permitting system (L. Bunting, General Discussion, Radiological Monitoring Plans, Tennessee Division of Water Pollution Control, May 4,1995). Appendix A provides an overview of how the Y-12 Plant will begin to address these needs and goals. It provides a more complete, documented basis for the current Y-12 Plant surface water monitoring program and is intended to supplement documentation provided in the Annual Site Environmental Reports (ASERs), NPDES reports, Groundwater Quality Assessment Reports, and studies conducted under the Y-12 Plant Environmental Restoration (ER) Program. The purpose of this update to the Y-12 Plant RMP is to satisfy the requirements of the current NPDES permit, DOE Order 5400.5, and 10 CFR Part 834, as current proposed, by defining the radiological monitoring plan for surface water for the Y-12 Plant. This plan includes initial storm water monitoring and data analysis. Related activities such as sanitary sewer and sediment monitoring are also summarized. The plan discusses monitoring goals necessary to determine background concentrations of radionuclides, to quantify releases, determine trends, satisfy regulatory requirements, support consequence assessments, and meet requirements that releases be ''as low as

  4. Quality of surface water and ground water in the proposed artificial-recharge project area, Rillito Creek basin, Tucson, Arizona, 1994

    Science.gov (United States)

    Tadayon, Saeid

    1995-01-01

    Controlled artificial recharge of surface runoff is being considered as a water-management technique to address the problem of ground-water overdraft. The planned use of recharge facilities in urban areas has caused concern about the quality of urban runoff to be recharged and the potential for ground-water contamination. The proposed recharge facility in Rillito Creek will utilize runoff entering a 1-mile reach of the Rillito Creek between Craycroft Road and Swan Road for infiltration and recharge purposes within the channel and excavated overbank areas. Physical and chemical data were collected from two surface-water and two ground-water sites in the study area in 1994. Analyses of surface-water samples were done to determine the occurrence and concentration of potential contaminants and to determine changes in quality since samples were collected during 1987-93. Analyses of ground-water samples were done to determine the variability of ground-water quality at the monitoring wells throughout the year and to determine changes in quality since samples were collected in 1989 and 1993. Surface-water samples were collected from Tanque Verde Creek at Sabino Canyon Road (streamflow-gaging station Tanque Verde Creek at Tucson, 09484500) and from Alamo Wash at Fort Lowell Road in September and May 1994, respectively. Ground-water samples were collected from monitoring wells (D- 13-14)26cbb2 and (D-13-14)26dcb2 in January, May, July, and October 1994. In surface water, calcium was the dominant cation, and bicarbonate was the dominant anion. In ground water, calcium and sodium were the dominant cations and bicarbonate was the dominant anion. Surface water in the area is soft, and ground water is moderately hard to hard. In surface water and ground water, nitrogen was found predominantly as nitrate. Concentrations of manganese in ground-water samples ranged from 60 to 230 micrograms per liter and exceeded the U.S. Environmental Protection Agency secondary maximum contaminant

  5. Groundwater and surface-water interactions near White Bear Lake, Minnesota, through 2011

    Science.gov (United States)

    Jones, Perry M.; Trost, Jared J.; Rosenberry, Donald O.; Jackson, P. Ryan; Bode, Jenifer A.; O'Grady, Ryan M.

    2013-01-01

    indicated the net effect of the non-precipitation terms on the water balance has changed relative to precipitation. The average amount of precipitation required each year to maintain the lake level has increased from 33 inches per year during 1978-2002 to 37 inches per year during 2003-11. The combination of lower precipitation and an increase in groundwater withdrawals can explain the change in the lake-level response to precipitation. Annual and summer groundwater withdrawals from the Prairie du Chien-Jordan aquifer have more than doubled from 1980 through 2010. Results from a regression model constructed with annual lake-level change, annual precipitation minus evaporation, and annual volume of groundwater withdrawn from the Prairie du Chien-Jordan aquifer indicated groundwater withdrawals had a greater effect than precipitation minus evaporation on water levels in the White Bear Lake area for all years since 2003. The recent (2003-11) decline in White Bear Lake reflects the declining water levels in the Prairie du Chien-Jordan aquifer; increases in groundwater withdrawals from this aquifer are a likely cause for declines in groundwater levels and lake levels. Synoptic, static groundwater-level and lake-level measurements in March/April and August 2011 indicated groundwater was potentially flowing into White Bear Lake from glacial aquifers to the northeast and south, and lake water was potentially discharging from White Bear Lake to the underlying glacial and Prairie du Chien-Jordan aquifers and glacial aquifers to the northwest. Groundwater levels in the Prairie du Chien-Jordan aquifer below White Bear Lake are approximately 0 to 19 feet lower than surface-water levels in the lake, indicating groundwater from the aquifer likely does not flow into White Bear Lake, but lake water may discharge into the aquifer. Groundwater levels from March/April to August 2011 declined more than 10 feet in the Prairie du Chien-Jordan aquifer south of White Bear Lake and to the north in

  6. Application of FTLOADDS to Simulate Flow, Salinity, and Surface-Water Stage in the Southern Everglades, Florida

    Science.gov (United States)

    Wang, John D.; Swain, Eric D.; Wolfert, Melinda A.; Langevin, Christian D.; James, Dawn E.; Telis, Pamela A.

    2007-01-01

    The Comprehensive Everglades Restoration Plan requires numerical modeling to achieve a sufficient understanding of coastal freshwater flows, nutrient sources, and the evaluation of management alternatives to restore the ecosystem of southern Florida. Numerical models include a regional water-management model to represent restoration changes to the hydrology of southern Florida and a hydrodynamic model to represent the southern and western offshore waters. The coastal interface between these two systems, however, has complex surface-water/ground-water and freshwater/saltwater interactions and requires a specialized modeling effort. The Flow and Transport in a Linked Overland/Aquifer Density Dependent System (FTLOADDS) code was developed to represent connected surface- and ground-water systems with variable-density flow. The first use of FTLOADDS is the Southern Inland and Coastal Systems (SICS) application to the southeastern part of the Everglades/Florida Bay coastal region. The need to (1) expand the domain of the numerical modeling into most of Everglades National Park and the western coastal area, and (2) better represent the effect of water-delivery control structures, led to the application of the FTLOADDS code to the Tides and Inflows in the Mangroves of the Everglades (TIME) domain. This application allows the model to address a broader range of hydrologic issues and incorporate new code modifications. The surface-water hydrology is of primary interest to water managers, and is the main focus of this study. The coupling to ground water, however, was necessary to accurately represent leakage exchange between the surface water and ground water, which transfers substantial volumes of water and salt. Initial calibration and analysis of the TIME application produced simulated results that compare well statistically with field-measured values. A comparison of TIME simulation results to previous SICS results shows improved capabilities, particularly in the

  7. Prediction of water droplet evaporation on zircaloy surface

    International Nuclear Information System (INIS)

    Lee, Chi Young; In, Wang Kee

    2014-01-01

    In the present experimental study, the prediction of water droplet evaporation on a zircaloy surface was investigated using various initial droplet sizes. To the best of our knowledge, this may be the first valuable effort for understanding the details of water droplet evaporation on a zircaloy surface. The initial contact diameters of the water droplets tested ranged from 1.76 to 3.41 mm. The behavior (i.e., time-dependent droplet volume, contact angle, droplet height, and contact diameter) and mode-transition time of the water droplet evaporation were strongly influenced by the initial droplet size. Using the normalized contact angle (θ*) and contact diameter (d*), the transitions between evaporation modes were successfully expressed by a single curve, and their criteria were proposed. To predict the temporal droplet volume change and evaporation rate, the range of θ* > 0.25 and d* > 0.9, which mostly covered the whole evaporation period and the initial contact diameter remained almost constant during evaporation, was targeted. In this range, the previous contact angle functions for the evaporation model underpredicted the experimental data. A new contact angle function of a zircaloy surface was empirically proposed, which represented the present experimental data within a reasonable degree of accuracy. (author)

  8. Residual stress improved by water jet peening using cavitation for small-diameter pipe inner surfaces

    International Nuclear Information System (INIS)

    Yasuo, Nakamura; Toshizo, Ohya; Koji, Okimura

    2001-01-01

    As one of degradation conditions on components used in water, the overlapping effect of environment, material and stress might cause stress corrosion cracking (SCC). Especially, for the tensile residual stress produced by welding, it is particularly effective to reduce the tensile residual stress on the material surface to prevent SCC. In this paper, the residual stress improvement method using cavitation impact generated by a water jet, called Water Jet Peening (WJP), has been developed as the maintenance technology for the inner surfaces of small-diameter Ni-Cr-Fe alloy (Alloy 600) pipes. As the results, by WJP for the inner surface of Alloy 600 pipe (inner diameter; approximately 10-15 mm), we confirmed that the compressive stress generated within the range from the surface to the inner part about 0.5 mm deep and took a maximum value about 350 MPa on the surface. (author)

  9. Adsorption of methanol, ethanol and water on well-characterized PtSn surface alloys

    Science.gov (United States)

    Panja, Chameli; Saliba, Najat; Koel, Bruce E.

    1998-01-01

    Adsorption and desorption of methanol (CH 3OH), ethanol (C 2H 5OH) and water on Pt(111) and two, ordered, PtSn alloys has been studied primarily using temperature-programmed desorption (TPD) mass spectroscopy. The two alloys studied were the {p(2 × 2) Sn}/{Pt(111) } and (√3 × √3) R30° {Sn}/{Pt(111) } surface alloys prepared by vapor deposition of Sn on Pt(111), with θSn = 0.25 and 0.33, respectively. All three molecules are weakly bonded and reversibly adsorbed under UHV conditions on all three surfaces, molecularly desorbing during TPD without any decomposition. The two PtSn surface alloys were found to chemisorb both methanol and ethanol slightly more weakly than on the Pt(111) surface. The desorption activation energies measured by TPD, and hence the adsorption energies, of both methanol and ethanol progressively decrease as the surface concentration of Sn increases, compared with Pt(111). The decreased binding energy leads one to expect a lower reactivity for these alcohols on the two alloys. The sticking coefficients and the monolayer coverages of these alcohols on the two alloys were identical to that on Pt(111) at 100 K, independent of the amount of Sn present in the surface layer. Alloying Sn in Pt(111) also slightly weakens the adsorption energy of water. Water clusters are formed even at low coverages on all three surfaces, eventually forming a water bilayer prior to the formation of a condensed ice phase. These results are relevant to a molecular-level explanation for the reactivity of Sn-promoted Pt surfaces that have been used in the electro-oxidation of simple organic molecules.

  10. Radiological assessment of surface water quality around proposed uranium mining site in India.

    Science.gov (United States)

    Jha, S K; Lenka, P; Gothankar, S; Tripathi, R M; Puranik, V D; Khating, D T

    2009-06-01

    The gross alpha and gross beta activities were estimated for radiological assessment of surface water quality around the proposed uranium mining site Kylleng Pyndengsohiong Mawthabah (Domiasiat), West Khasi Hills District, Meghalaya situated in a high rainfall area (12,000mm) in India. 189 Surface water samples were collected over different seasons of the year from nine different locations covering around 100km(2). Gross beta activities were found to vary from 144 to 361mBq/L which is much below the prescribed WHO limit of 1000mBq/L for drinking water. Gross alpha activities varied from 61 to 127mBq/L. These values are much below the reported gross alpha values by other countries. In about 7% of the samples the alpha activities remain exceeded the WHO guideline limit of 100mBq/L. Surface water samples collected during the summer season of the year show higher activity whereas low activity was found from samples collected during monsoon season. Results show that all water sources are acceptable as drinking water for human consumption from the radiological point of view, the higher gross alpha concentrations in a few locations remains so only for short duration during the summer season.

  11. Radiological assessment of surface water quality around proposed uranium mining site in India

    International Nuclear Information System (INIS)

    Jha, S.K.; Lenka, P.; Gothankar, S.; Tripathi, R.M.; Puranik, V.D.; Khating, D.T.

    2009-01-01

    The gross alpha and gross beta activities were estimated for radiological assessment of surface water quality around the proposed uranium mining site Kylleng Pyndengsohiong Mawthabah (Domiasiat), West Khasi Hills District, Meghalaya situated in a high rainfall area (12,000 mm) in India. 189 Surface water samples were collected over different seasons of the year from nine different locations covering around 100 km 2 . Gross beta activities were found to vary from 144 to 361 mBq/L which is much below the prescribed WHO limit of 1000 mBq/L for drinking water. Gross alpha activities varied from 61 to 127 mBq/L. These values are much below the reported gross alpha values by other countries. In about 7% of the samples the alpha activities remain exceeded the WHO guideline limit of 100 mBq/L. Surface water samples collected during the summer season of the year show higher activity whereas low activity was found from samples collected during monsoon season. Results show that all water sources are acceptable as drinking water for human consumption from the radiological point of view, the higher gross alpha concentrations in a few locations remains so only for short duration during the summer season.

  12. Effect of traditional gold mining to surface water quality in Murung Raya District, Central Kalimantan Province

    Directory of Open Access Journals (Sweden)

    W.Wilopo

    2013-10-01

    Full Text Available There are many locations for traditional gold mining in Indonesia. One of these is in Murung Raya District, Central Kalimantan Province. Mining activities involving the application of traditional gold processing technology have a high potential to pollute the environment, especially surface water. Therefore, this study aims to determine the impact of gold mining and processing on surface water quality around the mine site. Based on the results of field surveys and laboratory analysis, our data shows that the concentration of mercury (Hg and Cyanide (CN has reached 0.3 mg/L and 1.9 mg/L, respectively, in surface water. These values exceed the drinking water quality standards of Indonesia and WHO. Many people who live in the mining area use surface water for daily purposes including drinking, cooking, bathing and washing. This scenario is very dangerous because the effect of surface water contamination on human health cannot be immediately recognized or diagnosed. In our opinion the dissemination of knowledge regarding the treatment of gold mining wastewater is urgently required so that the quality of wastewater can be improved before it is discharged into the environment

  13. Water and Regolith Shielding for Surface Reactor Missions

    Science.gov (United States)

    Poston, David I.; Ade, Brian J.; Sadasivan, Pratap; Leichliter, Katrina J.; Dixon, David D.

    2006-01-01

    This paper investigates potential shielding options for surface power fission reactors. The majority of work is focused on a lunar shield that uses a combination of water in stainless-steel cans and lunar regolith. The major advantage of a water-based shield is that development, testing, and deployment should be relatively inexpensive. This shielding approach is used for three surface reactor concepts: (1) a moderated spectrum, NaK cooled, Hastalloy/UZrH reactor, (2) a fast-spectrum, NaK-cooled, SS/UO2 reactor, and (3) a fast-spectrum, K-heat-pipe-cooled, SS/UO2 reactor. For this study, each of these reactors is coupled to a 25-kWt Stirling power system, designed for 5 year life. The shields are designed to limit the dose both to the Stirling alternators and potential astronauts on the surface. The general configuration used is to bury the reactor, but several other options exist as well. Dose calculations are presented as a function of distance from reactor, depth of buried hole, water boron concentration (if any), and regolith repacked density.

  14. Water and Regolith Shielding for Surface Reactor Missions

    International Nuclear Information System (INIS)

    Poston, David I.; Sadasivan, Pratap; Dixon, David D.; Ade, Brian J.; Leichliter, Katrina J.

    2006-01-01

    This paper investigates potential shielding options for surface power fission reactors. The majority of work is focused on a lunar shield that uses a combination of water in stainless-steel cans and lunar regolith. The major advantage of a water-based shield is that development, testing, and deployment should be relatively inexpensive. This shielding approach is used for three surface reactor concepts: (1) a moderated spectrum, NaK cooled, Hastalloy/UZrH reactor, (2) a fast-spectrum, NaK-cooled, SS/UO2 reactor, and (3) a fast-spectrum, K-heat-pipe-cooled, SS/UO2 reactor. For this study, each of these reactors is coupled to a 25-kWt Stirling power system, designed for 5 year life. The shields are designed to limit the dose both to the Stirling alternators and potential astronauts on the surface. The general configuration used is to bury the reactor, but several other options exist as well. Dose calculations are presented as a function of distance from reactor, depth of buried hole, water boron concentration (if any), and regolith repacked density

  15. Integrated modeling of groundwater–surface water interactions in a tile-drained agricultural field

    NARCIS (Netherlands)

    Rosemeijer, J.C.; Velde, van der Y.; McLaren, R.G.; Geer, van F.C.; Broers, H.P.; Bierkens, M.F.P.

    2010-01-01

    Understanding the dynamics of groundwater–surface water interaction is needed to evaluate and simulate water and solute transport in catchments. However, direct measurements of the contributions of different flow routes from specific surfaces within a catchment toward the surface water are rarely

  16. Short Communication: Conductivity as an indicator of surface water ...

    African Journals Online (AJOL)

    Various water- soluble species are present in FeCr waste materials and in process water. Considering the size of the South African FeCr industry and its global importance, it is essential to assess the extent of potential surface water pollution in the proximity of FeCr smelters by such watersoluble species. In this study water ...

  17. Modeling global distribution of agricultural insecticides in surface waters

    International Nuclear Information System (INIS)

    Ippolito, Alessio; Kattwinkel, Mira; Rasmussen, Jes J.; Schäfer, Ralf B.; Fornaroli, Riccardo; Liess, Matthias

    2015-01-01

    Agricultural insecticides constitute a major driver of animal biodiversity loss in freshwater ecosystems. However, the global extent of their effects and the spatial extent of exposure remain largely unknown. We applied a spatially explicit model to estimate the potential for agricultural insecticide runoff into streams. Water bodies within 40% of the global land surface were at risk of insecticide runoff. We separated the influence of natural factors and variables under human control determining insecticide runoff. In the northern hemisphere, insecticide runoff presented a latitudinal gradient mainly driven by insecticide application rate; in the southern hemisphere, a combination of daily rainfall intensity, terrain slope, agricultural intensity and insecticide application rate determined the process. The model predicted the upper limit of observed insecticide exposure measured in water bodies (n = 82) in five different countries reasonably well. The study provides a global map of hotspots for insecticide contamination guiding future freshwater management and conservation efforts. - Highlights: • First global map on insecticide runoff through modelling. • Model predicts upper limit of insecticide exposure when compared to field data. • Water bodies in 40% of global land surface may be at risk of adverse effects. • Insecticide application rate, terrain slope and rainfall main drivers of exposure. - We provide the first global map on insecticide runoff to surface water predicting that water bodies in 40% of global land surface may be at risk of adverse effects

  18. The impact of land use on microbial surface water pollution.

    Science.gov (United States)

    Schreiber, Christiane; Rechenburg, Andrea; Rind, Esther; Kistemann, Thomas

    2015-03-01

    Our knowledge relating to water contamination from point and diffuse sources has increased in recent years and there have been many studies undertaken focusing on effluent from sewage plants or combined sewer overflows. However, there is still only a limited amount of microbial data on non-point sources leading to diffuse pollution of surface waters. In this study, the concentrations of several indicator micro-organisms and pathogens in the upper reaches of a river system were examined over a period of 16 months. In addition to bacteria, diffuse pollution caused by Giardia lamblia and Cryptosporidium spp. was analysed. A single land use type predestined to cause high concentrations of all microbial parameters could not be identified. The influence of different land use types varies between microbial species. The microbial concentration in river water cannot be explained by stable non-point effluent concentrations from different land use types. There is variation in the ranking of the potential of different land use types resulting in surface water contamination with regard to minimum, median and maximum effects. These differences between median and maximum impact indicate that small-scale events like spreading manure substantially influence the general contamination potential of a land use type and may cause increasing micro-organism concentrations in the river water by mobilisation during the next rainfall event. Copyright © 2014 Elsevier GmbH. All rights reserved.

  19. Water Surface Overgrowing of the Tatra’s Lakes

    Directory of Open Access Journals (Sweden)

    Kapusta Juraj

    2018-03-01

    Full Text Available Tatra’s lakes are vulnerable ecosystems and an important element of the alpine landscape. Mainly some shallow lake basins succumb to intense detritus sedimentation, fine fractions of material from the catchment area or to the overgrowing of water level by vegetation. In this paper, changes and dynamics of the 12 Tatra’s lake shorelines that were selected based on the detailed mapping of their extent are pointed out. Changes were assessed by accurate comparisons of historical and current orthophoto maps from the years 1949, 1955 and 2015 – and therefore, based on the oldest and the latest relevant materials. Due to the overgrowing of lakes caused by vegetation, their water surface decreased from −0.9% up to −47.9%, during the examined period. Losses were caused by the overgrowing of open water surface by the communities of sedges and peat bogs. The most significant dynamics of the shorelines during the last decades were reached by those lakes, into which fine sediments were simultaneously deposited by means of mountain water coarse. These sediments made the marginal parts of the lake basins shallower and accelerated rapid expansion of vegetation to the detriment of the open water surface. The overgrowing of shallow moraine lakes lying in the vegetation zone is a significant phenomenon of the High Tatras alpine landscape. It leads to their gradual extinction, turn into peat bogs and wet alpine meadows.

  20. Water and oil wettability of anodized 6016 aluminum alloy surface

    Science.gov (United States)

    Rodrigues, S. P.; Alves, C. F. Almeida; Cavaleiro, A.; Carvalho, S.

    2017-11-01

    This paper reports on the control of wettability behaviour of a 6000 series aluminum (Al) alloy surface (Al6016-T4), which is widely used in the automotive and aerospace industries. In order to induce the surface micro-nanostructuring of the surface, a combination of prior mechanical polishing steps followed by anodization process with different conditions was used. The surface polishing with sandpaper grit size 1000 promoted aligned grooves on the surface leading to static water contact angle (WCA) of 91° and oil (α-bromonaphthalene) contact angle (OCA) of 32°, indicating a slightly hydrophobic and oleophilic character. H2SO4 and H3PO4 acid electrolytes were used to grow aluminum oxide layers (Al2O3) by anodization, working at 15 V/18° C and 100 V/0 °C, respectively, in one or two-steps configuration. Overall, the anodization results showed that the structured Al surfaces were hydrophilic and oleophilic-like with both WCA and OCA below 90°. The one-step configuration led to a dimple-shaped Al alloy surface with small diameter of around 31 nm, in case of H2SO4, and with larger diameters of around 223 nm in case of H3PO4. The larger dimples achieved with H3PO4 electrolyte allowed to reach a slight hydrophobic surface. The thicker porous Al oxide layers, produced by anodization in two-step configuration, revealed that the liquids can penetrate easily inside the non-ordered porous structures and, thus, the surface wettability tended to superhydrophilic and superoleophilic character (CA OCA. This inversion in favour of the hydrophilic-oleophobic surface behaviour is of great interest either for lubrication of mechanical components or in water-oil separation process.

  1. 77 FR 12227 - Long Term 2 Enhanced Surface Water Treatment Rule: Uncovered Finished Water Reservoirs; Public...

    Science.gov (United States)

    2012-02-29

    ... Water Treatment Rule: Uncovered Finished Water Reservoirs; Public Meeting AGENCY: Environmental... review of the uncovered finished water reservoir requirement in the Long Term 2 Enhanced Surface Water... uncovered finished water reservoir requirement and the agency's Six Year Review process. EPA also plans to...

  2. Water surface elevation from the upcoming SWOT mission under different flows conditions

    Science.gov (United States)

    Domeneghetti, Alessio; Schumann, Guy J. P.; Wei, Rui; Frasson, Renato P. M.; Durand, Michael; Pavelsky, Tamlin; Castellarin, Attilio; Brath, Armando

    2017-04-01

    The upcoming SWOT (Surface Water and Ocean Topography) satellite mission will provide unprecedented bi-dimensional observations of terrestrial water surface heights along rivers wider than 100m. Despite the literature reports several activities showing possible uses of SWOT products, potential and limitations of satellite observations still remain poorly understood and investigated. We present one of the first analyses regarding the spatial observation of water surface elevation expected from SWOT for a 140 km reach of the middle-lower portion of the Po River, in Northern Italy. The river stretch is characterized by a main channel varying from 100-500 m in width and a floodplain delimited by a system of major embankments that can be as wide as 5 km. The reconstruction of the hydraulic behavior of the Po River is performed by means of a quasi-2D model built with detailed topographic and bathymetric information (LiDAR, 2m resolution), while the simulation of remotely sensed hydrometric data is performed with a SWOT simulator that mimics the satellite sensor characteristics. Referring to water surface elevations associated with different flow conditions (maximum, minimum and average flow) this work characterizes the spatial observations provided by SWOT and highlights the strengths and limitations of the expected products. The analysis provides a robust reference for spatial water observations that will be available from SWOT and assesses possible effects of river embankments, river width and river topography under different hydraulic conditions. Results of the study characterize the expected accuracy of the upcoming SWOT mission and provide additional insights towards the appropriate exploitation of future hydrological observations.

  3. Mathematical modelization of surface waters for drinking water; Modelizacion matematica de la potabilizacion de aguas superficiales

    Energy Technology Data Exchange (ETDEWEB)

    Marin Llanes, L.A.; Alvarez Rosell, S.

    1995-06-01

    The application of the general strategy of deterministic modelling to the water treatment for human consumption process for surface waters is treated in this paper. Deterministic models that describe the behaviour of clarification processes: coagulation-flocculation an filtration with respect to the principal parameters that define the water principal parameters that define the water quality: turbidity, color, pH, organic matter an presence of iron, manganese and aluminium cations were obtained. The models have been checked in actual operation conditions of water treatment plant for human consumption located in Campo Florido, Havana, cuba, named Planta Norte Habana. This plant receives water from three dams. The obtained results were good. The models are valid to describe the process, to corroborate the main theories related to water clarification and to know more about this process. The complexity of the models permits their rapid and efficient solution even without the aid of a digital computer. (Author) 5 refs.

  4. Imbalance in Groundwater-Surface Water Interactions and its Relationship to the Coastal Zone Hazards

    Science.gov (United States)

    Kontar, Y. A.; Ozorovich, Y. R.; Salokhiddinov, A. T.

    2011-12-01

    We report here some efforts and results in studying the imbalance in groundwater-surface water interactions and processes of groundwater-surface water interactions and groundwater flooding creating hazards in the coastal zones. Hazards, hydrological and geophysical risk analysis related to imbalance in groundwater-surface water interactions and groundwater flooding have been to a large extent under-emphasized for coastal zone applications either due to economical limitations or underestimation of significance of imbalance in groundwater-surface water interactions. This is particularly true for tsunamis creating salt water intrusion to coastal aquifers, even though most tsunami hazard assessments have in the past relied on scenario or deterministic type models, and to increasing mineralization of potable water because of intensive water diversions and also the abundance of highly toxic pollutants (mainly pesticides) in water, air and food, which contribute to the deterioration of the coastal population's health. In the wake of pressing environmental and economic issues, it is of prime importance for the scientific community to shed light onto the great efforts by hydrologists and geophysicists to quantify conceptual uncertainties and to provide quality assurances of potential coastal zone hazard evaluation and prediction under conditions of imbalance in groundwater-surface water interactions. This paper proposes consideration of two case studies which are important and significant for future understanding of a concept of imbalance in groundwater-surface water interactions and development and essential for feasibility studies of hazards in the coastal zone. The territory of the Aral Sea Region in Central Asia is known as an ecological disaster coastal zone. It is now obvious that, in order to provide reasonable living conditions to the coastal zone population, it is first of all necessary to drastically improve the quality of the water dedicated to human needs. Due

  5. Significantly improving trace thallium removal from surface waters during coagulation enhanced by nanosized manganese dioxide.

    Science.gov (United States)

    Huangfu, Xiaoliu; Ma, Chengxue; Ma, Jun; He, Qiang; Yang, Chun; Jiang, Jin; Wang, Yaan; Wu, Zhengsong

    2017-02-01

    Thallium (Tl) is an element of high toxicity and significant accumulation in human body. There is an urgent need for the development of appropriate strategies for trace Tl removal in drinking water treatment plants. In this study, the efficiency and mechanism of trace Tl (0.5 μg/L) removal by conventional coagulation enhanced by nanosized manganese dioxide (nMnO 2 ) were explored in simulated water and two representative surface waters (a river water and a reservoir water obtained from Northeast China). Experimental results showed that nMnO 2 significantly improve Tl(I) removal from selected waters. The removal efficiency was dramatically higher in the simulated water, demonstrating by less than 0.1 μg/L Tl residual. The enhancement of trace Tl removal in the surface waters decreased to a certain extent. Both adjusting water pH to alkaline condition and preoxidation of Tl(I) to Tl(III) benefit trace Tl removal from surface waters. Data also indicated that competitive cation of Ca 2+ decreased the efficiency of trace Tl removal, resulting from the reduction of Tl adsorption on nMnO 2 . Humic acid could largely low Tl removal efficiency during nMnO 2 enhanced coagulation processes. Trace elemental Tl firstly adsorbed on nMnO 2 and then removed accompanying with nMnO 2 settling. The information obtained in the present study may provide a potential strategy for drinking water treatment plants threatened by trace Tl. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Water evaporation on highly viscoelastic polymer surfaces.

    Science.gov (United States)

    Pu, Gang; Severtson, Steven J

    2012-07-03

    Results are reported for a study on the evaporation of water droplets from a highly viscoelastic acrylic polymer surface. These are contrasted with those collected for the same measurements carried out on polydimethylsiloxane (PDMS). For PDMS, the evaporation process involves the expected multistep process including constant drop area, constant contact angle, and finally a combination of these steps until the liquid is gone. In contrast, water evaporation from the acrylic polymer shows a constant drop area mode throughout. Furthermore, during the evaporation process, the drop area actually expands on the acrylic polymer. The single mode evaporation process is consistent with formation of wetting structures, which cannot be propagated by the capillary forces. Expansion of the drop area is attributed to the influence of the drop capillary pressure. Furthermore, the rate of drop area expansion is shown to be dependent on the thickness of the polymer film.

  7. Adaptable bioinspired special wetting surface for multifunctional oil/water separation

    Science.gov (United States)

    Kavalenka, Maryna N.; Vüllers, Felix; Kumberg, Jana; Zeiger, Claudia; Trouillet, Vanessa; Stein, Sebastian; Ava, Tanzila T.; Li, Chunyan; Worgull, Matthias; Hölscher, Hendrik

    2017-01-01

    Inspired by the multifunctionality of biological surfaces necessary for the survival of an organism in its specific environment, we developed an artificial special wetting nanofur surface which can be adapted to perform different functionalities necessary to efficiently separate oil and water for cleaning accidental oil spills or separating industrial oily wastewater. Initial superhydrophobic nanofur surface is fabricated using a hot pulling method, in which nano- and microhairs are drawn out of the polymer surface during separation from a heated sandblasted steel plate. By using a set of simple modification techniques, which include microperforation, plasma treatment and subsequent control of storage environment, we achieved selective separation of either water or oil, variable oil absorption and continuous gravity driven separation of oil/water mixtures by filtration. Furthermore, these functions can be performed using special wetting nanofur made from various thermoplastics, including biodegradable and recyclable polymers. Additionally, nanofur can be reused after washing it with organic solvents, thus, further helping to reduce the environmental impacts of oil/water separation processes. PMID:28051163

  8. Climate and surface water hydrology baseline data for Aurora Mine EIA

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-12-31

    A climate and hydrology database was assembled to describe the existing climatic and surface water hydrological characteristics of the proposed Aurora Mine area in Leases 10, 12, 13, 31, and 34 east of the Athabasca River near Fort McKay. The study was based upon data available from the regional hydrometeorological monitoring network operated by the Governments of Canada and Alberta. The study also included the installation and monitoring of one climate station and five streamflow gauging stations on small watersheds in the area. The representative climatic and hydrologic characteristics of the area, including precipitation, evaporation, evapotranspiration, temperature and wind, were determined. Streamflow characteristics such as flood frequencies, low flow frequencies, water yield and flow durations representative of large gauged watersheds within the study area were also determined. The results offer a good basis for preliminary design of surface water management systems. It was recommended that the monitoring program should be continued to monitor potential environmental impacts of proposed development activities. 9 refs., 29 tabs., 32 figs.

  9. Determination of trifluoroacetic acid in 1996--1997 precipitation and surface waters in California and Nevada

    Energy Technology Data Exchange (ETDEWEB)

    Wujcik, C.E.; Cahill, T.M.; Seiber, J.N. [Univ. of Nevada, Reno, NV (United States)

    1999-05-15

    The atmospheric degradation of three chlorofluorocarbon (CFC) replacement compounds, namely HFC-134a, HCFC-123, and HCFC-124, results in the formation of trifluoroacetic acid (TFA). Concentrations of TFA were determined in precipitation and surface water samples collected in California and Nevada during 1996--1997. Terminal lake systems were found to have concentrations 4--13 times higher than their calculated yearly inputs, providing evidence for accumulation. The results support dry deposition as the primary contributor of TFA to surface waters in arid and semiarid environments. Precipitation samples obtained from three different locations contained 20.7--1530 ng/L with significantly higher concentrations in fogwater over rainwater. Elevated levels of TFA were observed for rainwater collected in Nevada over those collected in California, indicating continual uptake and concentration as clouds move from a semiarid to arid climate. Thus several mechanisms exist, including evaporative concentration, vapor-liquid phase partitioning, lowered washout volumes of atmospheric deposition water, and dry deposition, which may lead to elevated concentrations of TFA in atmospheric and surface waters above levels expected from usual rainfall washout.

  10. A new theory and its application to remove the effect of surface-reflected light in above-surface radiance data from clear and turbid waters

    International Nuclear Information System (INIS)

    Dev, Pravin Jeba; Shanmugam, Palanisamy

    2014-01-01

    Water-leaving radiances (L w ) measured from the deck of a ship or boat in oceanic and lake waters are widely and operationally used for satellite sensor vicarious calibration and validation and development of remote-sensing algorithms to understand interdisciplinary coastal ocean properties and processes. However, accurate determination of L w remains to be a challenging issue because of the limitations of the existing methods to accurately remove the undesired signal (surface-reflected light of the sky and sun) from above-surface measurements of the total upwelling radiance leaving the water surface. In this study, a new theory is developed and applied to the above-surface radiometric data measured from clear, turbid and eutrophic waters. The new method effectively removes surface-reflected contributions from the total upwelling radiance signal under different sky (clear sky to overcast sky) and sun glint conditions. The L w spectra obtained from the above-surface radiance data using the new method are found to match well with those extrapolated from the upwelling radiances (L u ) measured with another set of underwater radiometers (used just below the sea surface). The new method proves to be a viable alternative, especially in circumstances when the above-surface measurements of radiances are severally contaminated by the surface-reflected light fields. Since spectral radiance measurements are also sensitive to the observation angles, and to the magnitude of the radiometer's solid angle field of view, above-surface radiances are also measured for different viewing angles in highly eutrophic waters. Such measurements show large deviations in L w spectra except at lower viewing angles (30°). When applied to these data, the new method eliminates the undesired signal encountered at higher viewing angles and delivers accurate water-leaving radiance data. These results suggest that the new method is capable of removing the surface-reflected light fields from both

  11. Macroelements in the surface microlayer of water of urban ponds

    Directory of Open Access Journals (Sweden)

    Antonowicz Józef Piotr

    2016-03-01

    Full Text Available Analyses were conducted concerning the accumulation of four metals representing the group of macroelements, i.e. sodium, potassium, calcium and magnesium in two ponds located in the city of Słupsk. Water samples for chemical analyses were collected from the surface microlayer using a Garrett net. At the same time subsurface water samples were collected. Concentrations of metals were determined using a mass spectrometer. Generally, amounts of sodium, potassium, calcium and magnesium were similar in surface microlayer and subsurface water. Only in the case of potassium and calcium was low enrichment observed in the surface microlayer in one pond, while the greatest extent for magnesium enrichment was observed in the spring period.

  12. Sulphur dioxide removal by turbulent transfer over grass, snow, and water surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Whelpdale, D M; Shaw, R W

    1974-01-01

    Vertical gradients of sulphur dioxide concentration have been measured over grass, snow, and water surfaces in order to assess the importance of these surfaces as SO/sub 2/ sinks. Concentrations were usually found to be lower near the surface indicating that removal occurs there. Vertical concentration gradients, normalized with repect to the concentration at 8 m, were generally greatest over water and least over snow, independent of meteorological conditions, suggesting that a water surface is the strongest SO/sub 2/ sink, with grass next, and snow weakest. The turbulent transfer of SO/sub 2/ to the interface is discussed in relation to stability of the lower atmosphere and physical and chemical properties of the surfaces. Using a bulk aerodynamic transfer approach similar to that for water vapour, values of SO/sub 2/ flux averaged over periods of from one to several hours were found to be of the order of 1 microgram/M/sup 2//S to the water and grass surfaces, and an order of magnitude smaller to the snow surface. Deposition velocities were found to be of the order of 1 cm/s.

  13. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    (relief, soil properties, weather conditions and crop coverage) are represented. Water balance parameters are modeled in daily steps, taking into account relief determined discharge pathways, runoff velocity and number of field boundaries passed until receiving streams are reached. Model development is based on a comprehensive monitoring campaign at 3 smaller catchments in North Rhine-Westphalia (Germany), equipped with two gauges each, upstream and downstream, an optical Trios probe and four Isco-Samplers. The temporal high resolution monitoring of discharge, ppp, orthophosphate and nitrate-nitrogen enables an evaluation of runoff simulations in relation with rain events. First model results suggest that the simulation of surface runoff pathways enables a spatial-explicit identification of fields contributing to pollutant inputs. We assume that targeted actions on few fields will help solving the problem of diffuse inputs of ppp in our surface water to a considerable extent.

  14. A new capture fraction method to map how pumpage affects surface water flow

    Science.gov (United States)

    Leake, S.A.; Reeves, H.W.; Dickinson, J.E.

    2010-01-01

    All groundwater pumped is balanced by removal of water somewhere, initially from storage in the aquifer and later from capture in the form of increase in recharge and decrease in discharge. Capture that results in a loss of water in streams, rivers, and wetlands now is a concern in many parts of the United States. Hydrologists commonly use analytical and numerical approaches to study temporal variations in sources of water to wells for select points of interest. Much can be learned about coupled surface/groundwater systems, however, by looking at the spatial distribution of theoretical capture for select times of interest. Development of maps of capture requires (1) a reasonably well-constructed transient or steady state model of an aquifer with head-dependent flow boundaries representing surface water features or evapotranspiration and (2) an automated procedure to run the model repeatedly and extract results, each time with a well in a different location. This paper presents new methods for simulating and mapping capture using three-dimensional groundwater flow models and presents examples from Arizona, Oregon, and Michigan. Journal compilation ?? 2010 National Ground Water Association. No claim to original US government works.

  15. Assessment of radioecological state of surface waters in the Gomel and Mogilev regions

    International Nuclear Information System (INIS)

    Khvaley, O.D.; Datskevich, P.I.; Komissarov, F.D.; Levosechko, S.I.

    2000-01-01

    Article states that aplication of the republican Admissible Levels (RAL-96) in practice and their juxtaposition with the obtained results of analyses are not always justified because water of the studied systems is excluded from economic water supply to population in resettlement zone. The radioecological criteria of quality of surface waters were developed in 1993 by Ukrainian hydrobiologists O.P.Oksiyuk, V.N.Zhukinsky and others contain six levels (classes) of radioecological pollution of water: 1 - non-polluted, 2 - lowly polluted, 3 - moderately polluted, 4 - highly polluted, 5 - very high pollution, 6 - utmost pollution; three classes of water quality and six categories of water quality. It is believed that according to this complex clasification of quality of surface terrestrial waters, water of the studied systems of Gomel and Mogilev regions very often has exceeded the RAL-96 for 90Sr. According to the proposed complex classification of quality of surface terrestrial waters, water of the studied systems belongs mainly - for 137Cs and 90Sr - to the quality categories: 3b ''lowly polluted'' and 4a ''moderately polluted'' independent on sampling period. On some sites of 30...10 km zone, water quality corresponds to categories 5a ''very high pollution'' and 5b ''utmost pollution'' for 90Sr (rivers Slovechna, Nesvich and Pogonyansky channel). Thus, in the studied water systems, in radioecological relation, there is not a single one with water quality corresponding to indices 3a, i.e.sufficiently clean. 90Sr has high migration ability and is able to participate in different migration cycles including biological (food chains). The cases of exceeding the RAL indices for 90Sr in water indicate the necessity to study also other components of water systems of Belarus relating to this isotope

  16. Band gaps and localization of surface water waves over large-scale sand waves with random fluctuations

    Science.gov (United States)

    Zhang, Yu; Li, Yan; Shao, Hao; Zhong, Yaozhao; Zhang, Sai; Zhao, Zongxi

    2012-06-01

    Band structure and wave localization are investigated for sea surface water waves over large-scale sand wave topography. Sand wave height, sand wave width, water depth, and water width between adjacent sand waves have significant impact on band gaps. Random fluctuations of sand wave height, sand wave width, and water depth induce water wave localization. However, random water width produces a perfect transmission tunnel of water waves at a certain frequency so that localization does not occur no matter how large a disorder level is applied. Together with theoretical results, the field experimental observations in the Taiwan Bank suggest band gap and wave localization as the physical mechanism of sea surface water wave propagating over natural large-scale sand waves.

  17. Innovative Technique for High-Accuracy Remote Monitoring of Surface Water

    Science.gov (United States)

    Gisler, A.; Barton-Grimley, R. A.; Thayer, J. P.; Crowley, G.

    2016-12-01

    Lidar (light detection and ranging) provides absolute depth and topographic mapping capability compared to other remote sensing methods, which is useful for mapping rapidly changing environments such as riverine systems and agricultural waterways. Effectiveness of current lidar bathymetric systems is limited by the difficulty in unambiguously identifying backscattered lidar signals from the water surface versus the bottom, limiting their depth resolution to 0.3-0.5 m. Additionally these are large, bulky systems that are constrained to expensive aircraft-mounted platforms and use waveform-processing techniques requiring substantial computation time. These restrictions are prohibitive for many potential users. A novel lidar device has been developed that allows for non-contact measurements of water depth down to 1 cm with an accuracy and precision of shallow to deep water allowing for shoreline charting, measuring water volume, mapping bottom topology, and identifying submerged objects. The scalability of the technique opens up the ability for handheld or UAS-mounted lidar bathymetric systems, which provides for potential applications currently unavailable to the community. The high laser pulse repetition rate allows for very fine horizontal resolution while the photon-counting technique permits real-time depth measurement and object detection. The enhanced measurement capability, portability, scalability, and relatively low-cost creates the opportunity to perform frequent high-accuracy monitoring and measuring of aquatic environments which is crucial for monitoring water resources on fast timescales. Results from recent campaigns measuring water depth in flowing creeks and murky ponds will be presented which demonstrate that the method is not limited by rough water surfaces and can map underwater topology through moderately turbid water.

  18. Transfer of glyphosate and its degradate AMPA to surface waters through urban sewerage systems.

    Science.gov (United States)

    Botta, Fabrizio; Lavison, Gwenaëlle; Couturier, Guillaume; Alliot, Fabrice; Moreau-Guigon, Elodie; Fauchon, Nils; Guery, Bénédicte; Chevreuil, Marc; Blanchoud, Hélène

    2009-09-01

    A study of glyphosate and aminomethyl phosphonic acid (AMPA) transfer in the Orge watershed (France) was carried out during 2007 and 2008. Water samples were collected in surface water, wastewater sewer, storm sewer and wastewater treatment plant (WWTP). These two molecules appeared to be the most frequently detected ones in the rivers and usually exceeded the European quality standard concentrations of 0.1microg L(-1) for drinking water. The annual glyphosate estimated load was 1.9 kg year(-1) upstream (agricultural zone) and 179.5 kg year(-1) at the catchment outlet (urban zone). This result suggests that the contamination of this basin by glyphosate is essentially from urban origin (road and railway applications). Glyphosate reached surface water prevalently through storm sewer during rainfall event. Maximum concentrations were detected in storm sewer just after a rainfall event (75-90 microg L(-1)). High concentrations of glyphosate in surface water during rainfall events reflected urban runoff impact. AMPA was always detected in the sewerage system. This molecule reached surface water mainly via WWTP effluent and also through storm sewer. Variations in concentrations of AMPA during hydrological episodes were minor compared to glyphosate variations. Our study highlights that AMPA and glyphosate origins in urban area are different. During dry period, detergent degradation seemed to be the major AMPA source in wastewater.

  19. Methane oxidation and methane fluxes in the ocean surface layer and deep anoxic waters

    Science.gov (United States)

    Ward, B. B.; Kilpatrick, K. A.; Novelli, P. C.; Scranton, M. I.

    1987-01-01

    Measured biological oxidation rates of methane in near-surface waters of the Cariaco Basin are compared with the diffusional fluxes computed from concentration gradients of methane in the surface layer. Methane fluxes and oxidation rates were investigated in surface waters, at the oxic/anoxic interface, and in deep anoxic waters. It is shown that the surface-waters oxidation of methane is a mechanism which modulates the flux of methane from marine waters to the atmosphere.

  20. Comparison of low-cost and engineered materials for phosphorus removal from organic-rich surface water.

    Science.gov (United States)

    Boyer, Treavor H; Persaud, Amar; Banerjee, Poulomi; Palomino, Pedro

    2011-10-15

    Excess phosphorus (P) in lakes and rivers remains a major water quality problem on a global scale. As a result, new materials and innovative approaches to P remediation are required. Natural materials and waste byproduct materials from industrial processes have the potential to be effective materials for P removal from surface water. Advantages of natural and waste byproduct materials include their low-cost, abundant supply, and minimal preparation, especially compared with engineered materials, such as ion exchange resins and polymeric adsorbents. As a result, natural and waste byproduct materials are commonly referred to as low-cost materials. Despite the potential advantages of low-cost materials, there are critical gaps in knowledge that are preventing their effective use. In particular, there are limited data on the performance of low-cost materials in surface waters that have high concentrations of natural organic matter (NOM), and there are no systematic studies that track the changes in water chemistry following treatment with low-cost materials or compare their performance with engineered materials. Accordingly, the goal of this work was to evaluate and compare the effectiveness of low-cost and engineered materials for P removal from NOM-rich surface water. Seven low-cost materials and three engineered materials were evaluated using jar tests and mini-column experiments. The test water was a surface water that had a total P concentration of 132-250 μg P/L and a total organic carbon concentration of 15-32 mg C/L. Alum sludge, a byproduct of drinking water treatment, and a hybrid anion exchange resin loaded with nanosize iron oxide were the best performing materials in terms of selective P removal in the presence of NOM and minimum undesirable secondary changes to the water chemistry. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Analysis of Ventilation Regimes of the Oblique Wedge-Shaped Surface Piercing Hydrofoil During Initial Water Entry Process

    Directory of Open Access Journals (Sweden)

    Ghadimi Parviz

    2018-03-01

    Full Text Available The suction side of a surface piercing hydrofoil, as a section of a Surface Piercing Propeller (SPP, is usually exposed to three phases of flow consisting air, water, and vapour. Hence, ventilation and cavitation pattern of such section during the initial phase of water entry plays an essential role for the propeller’s operational curves. Accordingly, in the current paper a numerical simulation of a simple surface piercing hydrofoil in the form of an oblique wedge is conducted in three-phase environment by using the coupled URANS and VOF equations. The obtained results are validated against water entry experiments and super-cavitation tunnel test data. The resulting pressure curves and free surface profiles of the wedge water entry are presented for different velocity ratios ranging from 0.12 to 0.64. Non-dimensional forces and efficiency relations are defined in order to present the wedge water entry characteristics. Congruent patterns are observed between the performance curves of the propeller and the wedge in different fully ventilated or partially cavitated operation modes. The transition trend from fully ventilated to partially cavitated operation of the surface piercing section of a SPP is studied and analyzed through wedge’s performance during the transitional period.

  2. Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

    KAUST Repository

    Jin, Yong; Zhang, Lianbin; Wang, Peng

    2017-01-01

    Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH

  3. Evaluation of Human Enteric Viruses in Surface Water and Drinking Water Resources in Southern Ghana

    Science.gov (United States)

    Gibson, Kristen E.; Opryszko, Melissa C.; Schissler, James T.; Guo, Yayi; Schwab, Kellogg J.

    2011-01-01

    An estimated 884 million people worldwide do not have access to an improved drinking water source, and the microbial quality of these sources is often unknown. In this study, a combined tangential flow, hollow fiber ultrafiltration (UF), and real-time PCR method was applied to large volume (100 L) groundwater (N = 4), surface water (N = 9), and finished (i.e., receiving treatment) drinking water (N = 6) samples for the evaluation of human enteric viruses and bacterial indicators. Human enteric viruses including norovirus GI and GII, adenovirus, and polyomavirus were detected in five different samples including one groundwater, three surface water, and one drinking water sample. Total coliforms and Escherichia coli assessed for each sample before and after UF revealed a lack of correlation between bacterial indicators and the presence of human enteric viruses. PMID:21212196

  4. Surface Water Data at Los Alamos National Laboratory 1998 Water Year

    International Nuclear Information System (INIS)

    Shaull, D.A.; Alexander, M.R.; Reynolds, R.P.; McLean, C.T.; Romero, R.P.

    1999-01-01

    The principal investigators collected and computed surface water discharge data from 19 stream-gaging stations that cover most of Los Alamos National Laboratory. Also included are discharge data from three springs that flow into Caiion de Vane

  5. Seasonal Distribution of Trace Metals in Ground and Surface Water of Golaghat District, Assam, India

    Directory of Open Access Journals (Sweden)

    M. Boarh

    2010-01-01

    Full Text Available A study has been carried out on the quality of ground and surface water with respect to chromium, manganese, zinc, copper, nickel, cadmium and arsenic contamination from 28 different sources in the predominantly rural Golaghat district of Assam (India. The metals were analysed by using atomic absorption spectrometer. Water samples were collected from groundwater and surface water during the dry and wet seasons of 2008 from the different sources in 28 locations (samples. The results are discussed in the light of possible health hazards from the metals in relation to their maximum permissible limits. The study shows the quality of ground and surface water in a sizeable number of water samples in the district not to be fully satisfactory with respect to presence of the metals beyond permissible limits of WHO. The metal concentration of groundwater in the district follows the trend As>Zn>Mn>Cr>Cu>Ni>Cd in both the seasons.

  6. Evaporation kinetics of sessile water droplets on micropillared superhydrophobic surfaces.

    Science.gov (United States)

    Xu, Wei; Leeladhar, Rajesh; Kang, Yong Tae; Choi, Chang-Hwan

    2013-05-21

    Evaporation modes and kinetics of sessile droplets of water on micropillared superhydrophobic surfaces are experimentally investigated. The results show that a constant contact radius (CCR) mode and a constant contact angle (CCA) mode are two dominating evaporation modes during droplet evaporation on the superhydrophobic surfaces. With the decrease in the solid fraction of the superhydrophobic surfaces, the duration of a CCR mode is reduced and that of a CCA mode is increased. Compared to Rowan's kinetic model, which is based on the vapor diffusion across the droplet boundary, the change in a contact angle in a CCR (pinned) mode shows a remarkable deviation, decreasing at a slower rate on the superhydrophobic surfaces with less-solid fractions. In a CCA (receding) mode, the change in a contact radius agrees well with the theoretical expectation, and the receding speed is slower on the superhydrophobic surfaces with lower solid fractions. The discrepancy between experimental results and Rowan's model is attributed to the initial large contact angle of a droplet on superhydrophobic surfaces. The droplet geometry with a large contact angle results in a narrow wedge region of air along the contact boundary, where the liquid-vapor diffusion is significantly restricted. Such an effect becomes minor as the evaporation proceeds with the decrease in a contact angle. In both the CCR and CCA modes, the evaporative mass transfer shows the linear relationship between mass(2/3) and evaporation time. However, the evaporation rate is slower on the superhydrophobic surfaces, which is more significant on the surfaces with lower solid fractions. As a result, the superhydrophobic surfaces slow down the drying process of a sessile droplet on them.

  7. Safety assessment of greenhouse hydroponic tomatoes irrigated with reclaimed and surface water.

    Science.gov (United States)

    Lopez-Galvez, Francisco; Allende, Ana; Pedrero-Salcedo, Francisco; Alarcon, Juan Jose; Gil, Maria Isabel

    2014-11-17

    The impact of reclaimed and surface water on the microbiological safety of hydroponic tomatoes was assessed. Greenhouse tomatoes were irrigated with reclaimed and surface water and grown on two hydroponic substrates (coconut fiber and rock wool). Water samples (n=208) were taken from irrigation water, with and without the addition of fertilizers and drainage water, and hydroponic tomatoes (n=72). Samples were analyzed for indicator microorganisms, generic Escherichia coli and Listeria spp., and pathogenic bacteria such as Salmonella spp. and Shiga-toxigenic E. coli (STEC), using multiplex real-time PCR (RT-PCR) after enrichment. The correlation between climatological parameters such as temperature and the levels of microorganisms in water samples was also determined. In irrigation water, generic E. coli counts were higher in reclaimed than in surface water whereas Listeria spp. numbers increased after adding the fertilizers in both water sources. In drainage water, no clear differences in E. coli and Listeria numbers were observed between reclaimed and surface water. No positive samples for STEC were found in irrigation water. Presumptive positives for Salmonella spp. were found in 7.7% of the water samples and 62.5% of these samples were reclaimed water. Salmonella-positive samples by RT-PCR could not be confirmed by conventional methods. Higher concentrations of E. coli were associated with Salmonella-presumptive positive samples. Climatological parameters, such as temperature, were not correlated with the E. coli and Listeria spp. counts. Tomato samples were negative for bacterial pathogens, while generic E. coli and Listeria spp. counts were below the detection limit. The prevalence of presumptive Salmonella spp. found in irrigation water (reclaimed and surface water) was high, which might present a risk of contamination. The absence of pathogens on greenhouse hydroponic tomatoes indicates that good agricultural practices (GAP) were in place, avoiding the

  8. Wavefront modulation of water surface wave by a metasurface

    International Nuclear Information System (INIS)

    Sun Hai-Tao; Cheng Ying; Liu Xiao-Jun; Wang Jing-Shi

    2015-01-01

    We design a planar metasurface to modulate the wavefront of a water surface wave (WSW) on a deep sub-wavelength scale. The metasurface is composed of an array of coiling-up-space units with specially designed parameters, and can take on the work of steering the wavefront when it is pierced into water. Like their acoustic counterparts, the modulation of WSW is ascribed to the gradient phase shift of the coiling-up-space units, which can be perfectly tuned by changing the coiling plate length and channel number inside the units. According to the generalized Snell’s law, negative refraction and ‘driven’ surface mode of WSW are also demonstrated at certain incidences. Specially, the transmitted WSW could be efficiently guided out by linking a symmetrically-corrugated channel in ‘driven’ surface mode. This work may have potential applications in water wave energy extraction and coastal protection. (paper)

  9. Ultimate Cavity Dynamics of Hydrophobic Spheres Impacting on Free Water Surfaces

    KAUST Repository

    Mansoor, Mohammad M.

    2012-12-01

    Cavity formation resulting from the water-entry of solid objects has been the subject of extensive research owing to its practical relevance in naval, military, industrial, sports and biological applications. The cavity formed by an impacting hydrophobic sphere normally seals at two places, one below (deep seal) and the other above the water surface (surface seal). For Froude numbers , the air flow into the resulting cavity is strong enough to suck the splash crown above the surface and disrupt the cavity dynamics before it deep seals. In this research work we eliminate surface seals by means of a novel practice of using cone splash-guards and examine the undisturbed transient cavity dynamics by impact of hydrophobic spheres for Froude numbers ranging . This enabled the measurement of extremely accurate pinch-off heights, pinch-off times, radial cavity collapse rates, and jet speeds in an extended range of Froude numbers compared to the previous work of Duclaux et al. (2007). Results in the extended regime were in remarkable agreement with the theoretical prediction of scaled pinch-off depth, and experimentally derived pinch-off time for . Furthermore, we investigated the influence of confinement on cavity formation by varying the cross-sectional area of the tank of liquid. In conjunction with surface seal elimination we observed the formation of multiple pinch-off points where a maximum of four deep seals were obtained in a sequential order for the Froude number range investigated. The presence of an elongated cavity beneath the first pinch-off point 5 resulted in evident "kinks" primarily related to the greatly diminished air pressure at the necking region caused by supersonic air flows (Gekle et al. 2010). Such flows passing through second pinch-offs were also found to choke the cavities beneath the first pinch- off depths causing radial expansion and hence disappearance of downward jets.

  10. Molecular Dynamics Simulation and Analysis of Interfacial Water at Selected Sulfide Mineral Surfaces under Anaerobic Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Jiaqi; Miller, Jan D.; Dang, Liem X.

    2014-04-10

    In this paper, we report on a molecular dynamics simulation (MDS) study of the behavior of interfacial water at selected sulfide mineral surfaces under anaerobic conditions. The study revealed the interfacial water structure and wetting characteristics of the pyrite (100) surface, galena (100) surface, chalcopyrite (012) surface, sphalerite (110) surface, and molybdenite surfaces (i.e., the face, armchair-edge, and zigzag-edge surfaces), including simulated contact angles, relative number density profiles, water dipole orientations, hydrogen-bonding, and residence times. For force fields of the metal and sulfur atoms in selected sulfide minerals used in the MDS, we used the universal force field (UFF) and another set of force fields optimized by quantum chemical calculations for interactions with interfacial water molecules at selected sulfide mineral surfaces. Simulation results for the structural and dynamic properties of interfacial water molecules indicate the natural hydrophobic character for the selected sulfide mineral surfaces under anaerobic conditions as well as the relatively weak hydrophobicity for the sphalerite (110) surface and two molybdenite edge surfaces. Part of the financial support for this study was provided by the U.S. Department of Energy (DOE) under Basic Science Grant No. DE-FG-03-93ER14315. The Division of Chemical Sciences, Geosciences, and Biosciences, Office of Basic Energy Sciences (BES), of the DOE, funded work performed by Liem X. Dang. Battelle operates Pacific Northwest National Laboratory for DOE. The calculations were carried out using computer resources provided by BES. The authors are grateful to Professor Tsun-Mei Chang for valuable discussions.

  11. Surface-Enhanced Separation of Water from Hydrocarbons: Potential Dewatering Membranes for the Catalytic Fast Pyrolysis of Pine Biomass

    Energy Technology Data Exchange (ETDEWEB)

    Engtrakul, Chaiwat; Hu, Michael Z.; Bischoff, Brian L.; Jang, Gyoung G.

    2016-10-20

    The impact of surface-selective coatings on water permeation through a membrane when exposed to catalytic fast pyrolysis (CFP) vapor products was studied by tailoring the surface properties of the membrane coating from superhydrophilic to superhydrophobic. Our approach used high-performance architectured surface-selective (HiPAS) membranes that were inserted after a CFP reactor. At this insertion point, the inner wall surface of a tubular membrane was exposed to a mixture of water and upgraded product vapors, including light gases and deoxygenated hydrocarbons. Under proper membrane operating conditions, a high selectivity for water over one-ring upgraded biomass pyrolysis hydrocarbons was observed as a result of a surface-enhanced capillary condensation process. Owing to this surface-enhanced effect, HiPAS membranes have the potential to enable high flux separations, suggesting that water can be selectively removed from the CFP product vapors.

  12. Treatability of South African surface waters by enhanced coagulation

    African Journals Online (AJOL)

    The majority of South African inland surface water sources are compromised due to a long-standing national policy of mandatory return flows. With renewed emphasis on the removal of organic carbon in the latest SANS 241 water quality standard, many South African water treatment managers may need to consider ...

  13. Environmental impact of by pass channel of surface waters

    International Nuclear Information System (INIS)

    Vismara, R.; Renoldi, M.; Torretta, V.

    1996-01-01

    In this paper are analyzed the impacts generated by surface waters drawing on river course. This impacts are generated also by reduction of water flow. This effect is most important for the presence of biological community: algae, fiches, micro invertebrates. Are also reported regional laws, water master plan of Lombardia region

  14. Natural sunlight shapes crude oil-degradingbacterial communities in northern Gulf of Mexico surface waters

    Directory of Open Access Journals (Sweden)

    Hernando P Bacosa

    2015-12-01

    Full Text Available Following the Deepwater Horizon (DWH spill in 2010, an enormous amount of oil was observed in the deep and surface waters of the northern Gulf of Mexico. Surface waters are characterized by intense sunlight and high temperature during summer. While the oil-degrading bacterial communities in the deep-sea plume have been widely investigated, the effect of natural sunlight on those in oil polluted surface waters remains unexplored to date. In this study, we incubated surface water from the DWH site with amendments of crude oil, Corexit dispersant, or both for 36 d under natural sunlight in the northern Gulf of Mexico. The bacterial community was analyzed over time for total abundance, density of alkane and polycyclic aromatic hydrocarbon degraders, and community composition via pyrosequencing. Our results showed that, for treatments with oil and/or Corexit, sunlight significantly reduced bacterial diversity and evenness and was a key driver of shifts in bacterial community structure. In samples containing oil or dispersant, sunlight greatly reduced abundance of the Cyanobacterium Synechococcus but increased the relative abundances of Alteromonas, Marinobacter, Labrenzia, Sandarakinotalea, Bartonella, and Halomonas. Dark samples with oil were represented by members of Thalassobius, Winogradskyella, Alcanivorax, Formosa, Pseudomonas, Eubacterium, Erythrobacter, Natronocella, and Coxiella. Both oil and Corexit inhibited the Candidatus Pelagibacter with or without sunlight exposure. For the first time, we demonstrated the effects of light in structuring microbial communities in water with oil and/or Corexit. Overall, our findings improve understanding of oil pollution in surface water, and provide unequivocal evidence that sunlight is a key factor in determining bacterial community composition and dynamics in oil polluted marine waters.

  15. Temporal aspects of surface water quality variation using robust statistical tools.

    Science.gov (United States)

    Mustapha, Adamu; Aris, Ahmad Zaharin; Ramli, Mohammad Firuz; Juahir, Hafizan

    2012-01-01

    Robust statistical tools were applied on the water quality datasets with the aim of determining the most significance parameters and their contribution towards temporal water quality variation. Surface water samples were collected from four different sampling points during dry and wet seasons and analyzed for their physicochemical constituents. Discriminant analysis (DA) provided better results with great discriminatory ability by using five parameters with (P < 0.05) for dry season affording more than 96% correct assignation and used five and six parameters for forward and backward stepwise in wet season data with P-value (P < 0.05) affording 68.20% and 82%, respectively. Partial correlation results revealed that there are strong (r(p) = 0.829) and moderate (r(p) = 0.614) relationships between five-day biochemical oxygen demand (BOD(5)) and chemical oxygen demand (COD), total solids (TS) and dissolved solids (DS) controlling for the linear effect of nitrogen in the form of ammonia (NH(3)) and conductivity for dry and wet seasons, respectively. Multiple linear regression identified the contribution of each variable with significant values r = 0.988, R(2) = 0.976 and r = 0.970, R(2) = 0.942 (P < 0.05) for dry and wet seasons, respectively. Repeated measure t-test confirmed that the surface water quality varies significantly between the seasons with significant value P < 0.05.

  16. Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

    Science.gov (United States)

    van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

    2014-05-01

    Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in surface waters is controlled strongly by biogeochemical nutrient cycling processes at the soil-water interface. The mechanisms and rates of the iron oxidation process with associated binding of phosphate during exfiltration of anaerobic Fe(II) bearing groundwater are among the key unknowns in P retention processes in surface waters in delta areas where the shallow groundwater is typically pH-neutral to slightly acid, anoxic, iron-rich. We developed an experimental field set-up to study the dynamics in Fe(II) oxidation and mechanisms of P immobilization at the groundwater-surface water interface in an agricultural experimental catchment of a small lowland river. We physically separated tube drain effluent from groundwater discharge before it entered a ditch in an agricultural field. The exfiltrating groundwater was captured in in-stream reservoirs constructed in the ditch. Through continuous discharge measurements and weekly water quality sampling of groundwater, tube drain water, exfiltrated groundwater, and ditch water, we quantified Fe(II) oxidation kinetics and P immobilization processes across the seasons. This study showed that seasonal changes in climatic conditions affect the Fe(II) oxidation process. In winter time the dissolved iron concentrations in the in-stream reservoirs reached the levels of the anaerobic groundwater. In summer time, the dissolved iron concentrations of the water in the reservoirs are low, indicating that dissolved Fe(II) is completely oxidized prior to inflow into the reservoirs. Higher discharges, lower temperatures and lower pH of the exfiltrated groundwater in winter compared to summer shifts the location of the redox transition zone

  17. On the influence of the intermolecular potential on the wetting properties of water on silica surfaces

    Science.gov (United States)

    Pafong, E.; Geske, J.; Drossel, B.

    2016-09-01

    We study the wetting properties of water on silica surfaces using molecular dynamics (MD) simulations. To describe the intermolecular interaction between water and silica atoms, two types of interaction potential models are used: the standard BródkA and Zerda (BZ) model and the Gulmen and Thompson (GT) model. We perform an in-depth analysis of the influence of the choice of the potential on the arrangement of the water molecules in partially filled pores and on top of silica slabs. We find that at moderate pore filling ratios, the GT silica surface is completely wetted by water molecules, which agrees well with experimental findings, while the commonly used BZ surface is less hydrophilic and is only partially wetted. We interpret our simulation results using an analytical calculation of the phase diagram of water in partially filled pores. Moreover, an evaluation of the contact angle of the water droplet on top of the silica slab reveals that the interaction becomes more hydrophilic with increasing slab thickness and saturates around 2.5-3 nm, in agreement with the experimentally found value. Our analysis also shows that the hydroaffinity of the surface is mainly determined by the electrostatic interaction, but the van der Waals interaction nevertheless is strong enough that it can turn a hydrophobic surface into a hydrophilic surface.

  18. Hydrology of the Beryl-Enterprise area, Escalante Desert, Utah, with emphasis on ground water; With a section on surface water

    Science.gov (United States)

    Mower, Reed W.; Sandberg, George Woodard

    1982-01-01

    An investigation of the water resources of the Beryl-Enterprise area, Escalante Desert, Utah (pl. 1), was made during 1976-78 as part of a cooperative program with the Utah Department of Natural Resources, Division of Water Rights. Wells were the most important source of water for all purposes in the Beryl-Enterprise area during 1978, but it has not always been so. For nearly a century after the first settlers arrived in about 1860, streams supplied most of the irrigation water and springs supplied much of the water for domestic and stock use. A few shallow wells were dug by the early settlers for domestic and stock water, but the widespread use of ground water did not start until the 1920's when shallow wells were first dug to supply irrigation water. Ground-water withdrawals from wells, principally for irrigation, have increased nearly every year since the 1920's. The quantity withdrawn from wells surpassed that diverted from surface sources during the mid-1940's and was about eight times that amount during the 1970's. As a result, water levels have declined measurably throughout the area resulting in administrative water-rights problems.The primary purpose of this report is to describe the water resources with emphasis on ground water. The surface-water resources are evaluated only as they pertain to the understanding of the ground-water resources. A secondary purpose is to discuss the extent and effects of the development of ground water in order to provide the hydrologic information needed for the orderly and optimum development of the resource and for the effective administration and adjudication of water rights in the area. The hydrologic data on which this report is based are given in a companion report by Mower (1981).

  19. Understanding surface-water availability in the Central Valley as a means to projecting future groundwater storage with climate variability

    Science.gov (United States)

    Goodrich, J. P.; Cayan, D. R.

    2017-12-01

    California's Central Valley (CV) relies heavily on diverted surface water and groundwater pumping to supply irrigated agriculture. However, understanding the spatiotemporal character of water availability in the CV is difficult because of the number of individual farms and local, state, and federal agencies involved in using and managing water. Here we use the Central Valley Hydrologic Model (CVHM), developed by the USGS, to understand the relationships between climatic variability, surface water inputs, and resulting groundwater use over the historical period 1970-2013. We analyzed monthly surface water diversion data from >500 CV locations. Principle components analyses were applied to drivers constructed from meteorological data, surface reservoir storage, ET, land use cover, and upstream inflows, to feed multiple regressions and identify factors most important in predicting surface water diversions. Two thirds of the diversion locations ( 80% of total diverted water) can be predicted to within 15%. Along with monthly inputs, representations of cumulative precipitation over the previous 3 to 36 months can explain an additional 10% of variance, depending on location, compared to results that excluded this information. Diversions in the southern CV are highly sensitive to inter-annual variability in precipitation (R2 = 0.8), whereby more surface water is used during wet years. Until recently, this was not the case in the northern and mid-CV, where diversions were relatively constant annually, suggesting relative insensitivity to drought. In contrast, this has important implications for drought response in southern regions (eg. Tulare Basin) where extended dry conditions can severely limit surface water supplies and lead to excess groundwater pumping, storage loss, and subsidence. In addition to fueling our understanding of spatiotemporal variability in diversions, our ability to predict these water balance components allows us to update CVHM predictions before

  20. Suitability of artificial sweeteners as indicators of raw wastewater contamination in surface water and groundwater.

    Science.gov (United States)

    Tran, Ngoc Han; Hu, Jiangyong; Li, Jinhua; Ong, Say Leong

    2014-01-01

    There is no quantitative data on the occurrence of artificial sweeteners in the aquatic environment in Southeast Asian countries, particularly no information on their suitability as indicators of raw wastewater contamination on surface water and groundwater. This study provided the first quantitative information on the occurrence of artificial sweeteners in raw wastewater, surface water and groundwater in the urban catchment area in Singapore. Acesulfame, cyclamate, saccharin, and sucralose were ubiquitous in raw wastewater samples at concentrations in the range of ng/L-μg/L, while other sweeteners were not found or found only in a few of the raw wastewater samples. Residential and commercial effluents were demonstrated to be the two main sources of artificial sweeteners entering the municipal sewer systems. Relatively higher concentrations of the detected sweeteners were frequently found in surface waters at the sampling sites located in the residential/commercial areas. No significant difference in the concentrations of the detected sweeteners in surface water or groundwater was noted between wet and dry weather conditions (unpaired T-test, p> 0.05). Relatively higher concentrations and detection frequencies of acesulfame, cyclamate and saccharin in surface water samples were observed at the potentially impacted sampling sites, while these sweeteners were absent in most of the background surface water samples. Similarly, acesulfame, cyclamate, and saccharin were found in most groundwater samples at the monitoring well (GW6), which is located close to known leaking sewer segment; whereas these were absent in the background monitoring well, which is located in the catchment with no known wastewater sources. Taken together, the results suggest that acesulfame, cyclamate, and saccharin can be used as potential indicators of raw wastewater contamination in surface water and groundwater. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Thermodynamic data of water on smectite surface and those applications to swelling pressure of compacted bentonite

    International Nuclear Information System (INIS)

    Sato, H.

    2009-01-01

    Swelling pressure was discussed focusing on the thermodynamic properties of water on smectite (montmorillonite) which is the major clay mineral constituent of the bentonite buffer. The thermodynamic data of the water on the smectite surface were obtained as a function of water content and temperature in a range of dry density 0.6-0.9 Mg/m 3 . Purified Na-smectite of which all interlayer cations were exchanged with Na+ ions, was used. The activity (a H 2 O ) and the relative partial molar Gibbs free energy (ΔG H 2 O ) of the water were obtained at 25 C. Both a H 2 O and ΔG H 2 O decreased with a decrease of water content, and similar results were obtained to data reported for montmorillonite (Kunipia-F bentonite). Since the specific surface area of smectite is about 800 m 2 /g, water up to approximately 2 water layers from smectite surface is thermodynamically evaluated to be bound. Swelling pressure versus smectite partial density was calculated based on ΔG H 2 O and compared to data experimentally obtained for various kinds of bentonites. The calculated results were in good agreement with the measured data over the range of smectite partial density between 1.0 and 2.0 Mg/m 3 . (author)

  2. Field Evaluation Of Arsenic Transport Across The Ground-Water/Surface Water Interface: Ground-Water Discharge And Iron Oxide Precipitation

    Science.gov (United States)

    A field investigation was conducted to examine the distribution of arsenic in ground water, surface water, and sediments at a Superfund Site in the northeastern United States (see companion presentation by K. G. Scheckel et al). Ground-water discharge into the study area was cha...

  3. Organic acids in naturally colored surface waters

    Science.gov (United States)

    Lamar, William L.; Goerlitz, D.F.

    1966-01-01

    Most of the organic matter in naturally colored surface waters consists of a mixture of carboxylic acids or salts of these acids. Many of the acids color the water yellow to brown; however, not all of the acids are colored. These acids range from simple to complex, but predominantly they are nonvolatile polymeric carboxylic acids. The organic acids were recovered from the water by two techniques: continuous liquid-liquid extraction with n-butanol and vacuum evaporation at 50?C (centigrade). The isolated acids were studied by techniques of gas, paper, and column chromatography and infrared spectroscopy. About 10 percent of the acids recovered were volatile or could be made volatile for gas chromatographic analysis. Approximately 30 of these carboxylic acids were isolated, and 13 of them were individually identified. The predominant part of the total acids could not be made volatile for gas chromatographic analysis. Infrared examination of many column chromatographic fractions indicated that these nonvolatile substances are primarily polymeric hydroxy carboxylic acids having aromatic and olefinic unsaturation. The evidence suggests that some of these acids result from polymerization in aqueous solution. Elemental analysis of the sodium fusion products disclosed the absence of nitrogen, sulfur, and halogens.

  4. UO{sub 2} surface oxidation by mixtures of water vapor and hydrogen as a function of temperature

    Energy Technology Data Exchange (ETDEWEB)

    Espriu-Gascon, A., E-mail: alexandra.espriu@upc.edu [Department of Chemical Engineering, Universitat Politècnica Catalunya-Barcelona Tech, Diagonal 647, E-08028 Barcelona (Spain); Llorca, J.; Domínguez, M. [Institut de Tècniques Energètiques (INTE), Universitat Politècnica Catalunya-Barcelona Tech, Diagonal 647, E-08028 Barcelona (Spain); Centre for Research in NanoEngineering (CRNE), Universitat Politècnica Catalunya-Barcelona Tech, Diagonal 647, E-08028 Barcelona (Spain); Giménez, J.; Casas, I. [Department of Chemical Engineering, Universitat Politècnica Catalunya-Barcelona Tech, Diagonal 647, E-08028 Barcelona (Spain); Pablo, J. de [Department of Chemical Engineering, Universitat Politècnica Catalunya-Barcelona Tech, Diagonal 647, E-08028 Barcelona (Spain); Fundació CTM Centre Tecnològic, Plaça de la Ciència 2, E-08243 Manresa (Spain)

    2015-12-15

    In the present work, X-Ray Photoelectron Spectroscopy (XPS) was used to study the effect of water vapor on the UO{sub 2} surface as a function of temperature. The experiments were performed in situ inside a high pressure chamber attached to the XPS instrument. UO{sub 2} samples were put in contact with either hydrogen or argon streams, saturated with water at room temperature, and the sample surface evolution was analyzed by XPS. In the case of the water vapor/argon experiments, one experiment at 350 °C was performed and, in the case of the water vapor/hydrogen experiments, the temperatures used inside the reactor were 60, 120, 200 and 350 °C. On one hand, in presence of argon, the results obtained showed that the water vapor in the argon stream oxidized 93% of the U(IV) in the sample surface. On the other hand, the degree of UO{sub 2} surface oxidation showed a different dependence on the temperature in the experiments performed in the presence of hydrogen: the maximum surface oxidation occurred at 120 °C, where 65.4% of U(IV) in the sample surface was oxidized, while at higher temperatures, the surface oxidation decreased. This observation is attributed to the increase of hydrogen reducing effect when temperature increases which prevents part of the oxidation of the UO{sub 2} surface by the water vapor. - Highlights: • UO{sub 2} surface has been oxidized by water vapor in an argon stream at 350 °C. • H{sub 2} reduced more uranium oxidation produced by water at 350 °C when compared to Ar. • In H{sub 2} presence, the uranium oxidation produced by water depends on the temperature.

  5. Review: Impacts of permafrost degradation on inorganic chemistry of surface fresh water

    Science.gov (United States)

    Colombo, Nicola; Salerno, Franco; Gruber, Stephan; Freppaz, Michele; Williams, Mark; Fratianni, Simona; Giardino, Marco

    2018-03-01

    Recent studies have shown that climate change is impacting the inorganic chemical characteristics of surface fresh water in permafrost areas and affecting aquatic ecosystems. Concentrations of major ions (e.g., Ca2 +, Mg2 +, SO42 -, NO3-) can increase following permafrost degradation with associated deepening of flow pathways and increased contributions of deep groundwater. In addition, thickening of the active layer and melting of near-surface ground ice can influence inorganic chemical fluxes from permafrost into surface water. Permafrost degradation has also the capability to modify trace element (e.g., Ni, Mn, Al, Hg, Pb) contents in surface water. Although several local and regional modifications of inorganic chemistry of surface fresh water have been attributed to permafrost degradation, a comprehensive review of the observed changes is lacking. The goal of this paper is to distil insight gained across differing permafrost settings through the identification of common patterns in previous studies, at global scale. In this review we focus on three typical permafrost configurations (pervasive permafrost degradation, thermokarst, and thawing rock glaciers) as examples and distinguish impacts on (i) major ions and (ii) trace elements. Consequences of warming climate have caused spatially-distributed progressive increases of major ion and trace element delivery to surface fresh water in both polar and mountain areas following pervasive permafrost degradation. Moreover, localised releases of major ions and trace elements to surface water due to the liberation of soluble materials sequestered in permafrost and ground ice have been found in ice-rich terrains both at high latitude (thermokarst features) and high elevation (rock glaciers). Further release of solutes and related transport to surface fresh water can be expected under warming climatic conditions. However, complex interactions among several factors able to influence the timing and magnitude of the impacts

  6. [Occurrence of bacteria of the Yersinia genus in surface water].

    Science.gov (United States)

    Krogulska, B; Maleszewska, J

    1992-01-01

    The aim of the study was determination of the frequency of occurrence of Yersinia genus bacteria in surface waters polluted to various degrees with bacteria of the coliform and of fecal coli. For detection of Yersinia rods the previously elaborated medium Endo MLCe and the membrane filter method were applied. Samples of 42 surface waters were examined, including 26 from rivers and 16 from lakes, ponds and clay-pits. On the basis of sanitary bacteriological analysis 16 surface waters were classified to class I purity, 10 to class II, the remaining ones to class III or beyond classification. Yersinia rods were detected in 15 water bodies that is 35.7% of the examined waters. A total of 27 Yersinia strains were identified with dominance of Y. intermedia (14 strains) and Y. enterocolitica (10 strains). Three strains represented by the species Yersinia frederiksenii. Most of the Y. enterocolitica strains belonged to biotype 1, the particular strains being represented by various serotypes. Hence their different origin may be concluded. The pathogenic serotypes 0:3 and 0:9 of Yersinia enterocolitica were not detected.

  7. Radionuclides as natural tracers of the interaction between groundwater and surface water in the River Andarax, Spain.

    Science.gov (United States)

    Navarro-Martinez, Francisco; Salas Garcia, Alejandro; Sánchez-Martos, Francisco; Baeza Espasa, Antonio; Molina Sánchez, Luis; Rodríguez Perulero, Antonio

    2017-12-01

    The identification of specific aquifers that supply water to river systems is fundamental to understanding the dynamics of the rivers' hydrochemistry, particularly in arid and semiarid environments where river flow may be discontinuous. There are multiple methods to identify the source of river water. In this study of the River Andarax, in the Southeast of Spain, an analysis of natural tracers (physico-chemical parameters, uranium, radium and radon) in surface water and groundwater indicates that chemical parameters and uranium clearly identify the areas where there is groundwater-surface water interaction. The concentration of uranium found in the river defines two areas: the headwaters with U concentrations of 2 μg L -1 and the lower reaches, with U of 6 μg L -1 . Furthermore, variation in the 234 U/ 238 U isotopic ratio allowed us to detect the influence that groundwater from the carbonate aquifer has on surface water in the headwaters of the river, where the saline content is lower and the water has a calcium bicarbonate facies. The concentration of 226 Ra and 222 Rn are low in the surface waters: aquifer on the surface waters. The results of this study indicate the utility in the use of physico-chemical and radiological data conjointly as tracers of groundwater-surface water interaction in semiarid areas where the lithology of aquifers is diverse (carbonate and detritic) and where evaporitic rocks are present. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Designing robust alumina nanowires-on-nanopores structures: superhydrophobic surfaces with slippery or sticky water adhesion.

    Science.gov (United States)

    Peng, Shan; Tian, Dong; Miao, Xinrui; Yang, Xiaojun; Deng, Wenli

    2013-11-01

    Hierarchical alumina surfaces with different morphologies were fabricated by a simple one-step anodization method. These alumina films were fabricated by a new raw material: silica gel plate (aluminum foil with a low purity of 97.17%). The modulation of anodizing time enabled the formation of nanowires-on-nanopores hybrid nanostructures having controllable nanowires topographies through a self-assembly process. The resultant structures were demonstrated to be able to achieve superhydrophobicity without any hydrophobic coating layer. More interestingly, it is found that the as-prepared superhydrophobic alumina surfaces exhibited high contrast water adhesion. Hierarchical alumina film with nanowire bunches-on-nanopores (WBOP) morphology presents extremely slippery property which can obtain a sliding angle (SA) as low as 1°, nanowire pyramids-on-nanopores (WPOP) structure shows strongly sticky water adhesion with the adhesive ability to support 15 μL inverted water droplet at most. The obtained superhydrophobic alumina surfaces show remarkable mechanical durability even treated by crimping or pressing without impact on the water-repellent performance. Moreover, the created surfaces also show excellent resistivity to ice water, boiling water, high temperature, organic solvent and oil contamination, which could expand their usefulness and efficacy in harsh conditions. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Estimation of the amount of surface contamination of a water cooled nuclear reactor by cooling water analysis

    Energy Technology Data Exchange (ETDEWEB)

    Nagy, G. [KFKI Atomic Energy Research Institute, P.O. Box 49, Budapest H-1525 (Hungary)]. E-mail: nagyg@sunserv.kfki.hu; Somogyi, A. [KFKI Atomic Energy Research Institute, P.O. Box 49, Budapest H-1525 (Hungary); Patek, G. [Paks Nuclear Power Plant, P.O. Box 71, Paks H-7031 (Hungary); Pinter, T. [Paks Nuclear Power Plant, P.O. Box 71, Paks H-7031 (Hungary); Schiller, R. [KFKI Atomic Energy Research Institute, P.O. Box 49, Budapest H-1525 (Hungary)

    2007-06-15

    Calculations, based upon on-the-spot measurements, were performed to estimate the contamination of NPP primary circuit and spent fuel storage pool solid surfaces via the composition of the cooling water in connection with a non-nuclear incident in the Paks NPP. Thirty partially burnt-up fuel element bundles were damaged during a cleaning process, an incident which resulted in the presence of fission products in the cooling water of the cleaning tank (CT) situated in a separate pool (P1). Since this medium was in contact for an extended period of time with undamaged fuel elements to be used later and also with other structural materials of the spent fuel storage pool (SP), it was imperative to assess the surface contamination of these latter ones with a particular view to the amount of fission material. In want of direct methods, one was restricted to indirect information which rested mainly on the chemical and radiochemical data of the cooling water. It was found that (i) the most important contaminants were uranium, plutonium, cesium and cerium; (ii) after the isolation of P1 and SP and an extended period of filtering the only important contaminants were uranium and plutonium; (iii) the surface contamination of the primary circuit (PC) was much lower than that of either SP or P1; (iv) some 99% of the contamination was removed from the water by the end of the filtering process.

  10. Screening and human health risk assessment of pharmaceuticals and their transformation products in Dutch surface waters and drinking water

    NARCIS (Netherlands)

    de Jongh, C.M.; Kooij, P.J.F.; de Voogt, P.; ter Laak, T.L.

    2012-01-01

    Numerous studies describe the presence of pharmaceuticals in the water cycle, while their transformation products are usually not included. In the current study 17 common pharmaceuticals and 9 transformation products were monitored in the Dutch waters, including surface waters, pre-treated surface

  11. Water and nutrient budgets at field and regional scale : travel times of drainage water and nutrient loads to surface water

    NARCIS (Netherlands)

    Eertwegh, van den G.A.P.H.

    2002-01-01

    Keywords : water and nutrient budget, travel time of drainage water, dual-porosity concept, agricultural nutrient losses, loads to surface water, field-scale experiments, regional-scale

  12. Issues of the presence of parasitic protozoa in surface waters

    Science.gov (United States)

    Hawrylik, Eliza

    2018-02-01

    Parasitic protozoa are very numerous organisms in the environment that play an important role in the spread of water-borne diseases. Water-borne epidemics caused by parasitic protozoa are noted throughout the world. Within these organisms, intestinal protozoa of the genera Cryptosporidium and Giardia are ones of the most serious health hazards for humans. This paper focuses on the problem of the presence of parasitic protozoa in surface waters. Characteristics of the most frequently recognized pathogens responsible for water-borne outbreaks were described, as well as sources of contamination and surface waters contamination due to protozoa of the genus Cryptosporidium and Giardia were presented. The methods of destroying the cysts and oocysts of parasitic protozoa used nowadays in the world were also presented in a review.

  13. DRINKING WATER QUALITY IN DISTRIBUTION SYSTEMS OF SURFACE AND GROUND WATERWORKS IN FINLAND

    Directory of Open Access Journals (Sweden)

    Jenni Meirami Ikonen

    2017-06-01

    Full Text Available Physico-chemical and microbiological water quality in the drinking water distribution systems (DWDSs of five waterworks in Finland with different raw water sources and treatment processes was explored. Water quality was monitored during four seasons with on-line equipment and bulk water samples were analysed in laboratory. Seasonal changes in the water quality were more evident in DWDSs of surface waterworks compared to the ground waterworks and artificially recharging ground waterworks (AGR. Between seasons, temperature changed significantly in every system but pH and EC changed only in one AGR system. Seasonal change was seen also in the absorbance values of all systems. The concentration of microbially available phosphorus (MAP, μg PO₄-P/l was the highest in drinking water originating from the waterworks supplying groundwater. Total assimilable organic carbon (AOC, μg AOC-C/l concentrations were significantly different between the DWDSs other than between the two AGR systems. This study reports differences in the water quality between surface and ground waterworks using a wide set of parameters commonly used for monitoring. The results confirm that every distribution system is unique, and the water quality is affected by environmental factors, raw water source, treatment methods and disinfection.

  14. Surface water change as a significant contributor to global evapotranspiration change

    Science.gov (United States)

    Zhan, S.; Song, C.

    2017-12-01

    Water comprises a critical component of global/regional hydrological and biogeochemical cycles and is essential to all organisms including humans. In the past several decades, climate change has intensified the hydrological cycle, with significant implications for ecosystem services and feedback to regional and global climate. Evapotranspiration (ET) as a linking mechanism between land surface and atmosphere is central to the water cycle and an excellent indicator of the intensity of water cycle. Knowledge of the temporal changes of ET is crucial for accurately estimating global or regional water budgets and better understanding climate and hydrological interactions. While studies have examined changes in global ET, they were conducted using a constant land and surface water (SW) area. However, as many studies have found that global SW is very dynamic and their surface areas have generally been increasing since the 1980s. The conversion from land to water and vice versa significantly changes the local ET since water bodies evaporate at a rate that can be much higher than that of the land. Here, we quantify the global changes in ET caused by such land-water conversion using remotely-sensed SW area and various ET and potential ET products. New SW and lost SW between circa-1985 and circa-2015 were derived from remote sensing and were used to modify the local ET estimates. We found an increase in ET in all continents as consistent with the net increase in SW area. The increasing SW area lead to a global increase in ET by 30.38 ± 5.28 km3/yr. This is a significant contribution when compared to the 92.95 km3/yr/yr increase in ET between 1982-1997 and 103.43 km3/yr/yr decrease between 1998-2008 by Jung et al., (2010) assuming a constant SW. The results enhance our understanding of the water fluxes between the land and atmosphere and supplement land water budget estimates. We conclude that changes in SW lead to a significant change in global ET that cannot be neglected in

  15. The Assessment of Instruments for Detecting Surface Water Spills Associated with Oil and Gas Operations

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Aubrey E. [West Virginia Univ., Morgantown, WV (United States); National Energy Technology Lab. (NETL), Morgantown, WV (United States); U.S. Bureau of Reclamation, Albuquerque, NM (United States); Hopkinson, Leslie [West Virginia Univ., Morgantown, WV (United States); Soeder, Daniel [National Energy Technology Lab. (NETL), Morgantown, WV (United States)

    2016-12-02

    Surface water and groundwater risks associated with unconventional oil and gas development result from potential spills of the large volumes of chemicals stored on-site during drilling and hydraulic fracturing operations, and the return to the surface of significant quantities of saline water produced during oil or gas well production. To better identify and mitigate risks, watershed models and tools are needed to evaluate the dispersion of pollutants in possible spill scenarios. This information may be used to determine the placement of in-stream water-quality monitoring instruments and to develop early-warning systems and emergency plans. A chemical dispersion model has been used to estimate the contaminant signal for in-stream measurements. Spills associated with oil and gas operations were identified within the Susquehanna River Basin Commission’s Remote Water Quality Monitoring Network. The volume of some contaminants was found to be sufficient to affect the water quality of certain drainage areas. The most commonly spilled compounds and expected peak concentrations at monitoring stations were used in laboratory experiments to determine if a signal could be detected and positively identified using standard water-quality monitoring equipment. The results were compared to historical data and baseline observations of water quality parameters, and showed that the chemicals tested do commonly affect water quality parameters. This work is an effort to demonstrate that hydrologic and water quality models may be applied to improve the placement of in-stream water quality monitoring devices. This information may increase the capability of early-warning systems to alert community health and environmental agencies of surface water spills associated with unconventional oil and gas operations.

  16. Slowly biodegradable organic compounds impact the biostability of non-chlorinated drinking water produced from surface water.

    Science.gov (United States)

    Hijnen, W A M; Schurer, R; Bahlman, J A; Ketelaars, H A M; Italiaander, R; van der Wal, A; van der Wielen, P W J J

    2018-02-01

    It is possible to distribute drinking water without a disinfectant residual when the treated water is biologically stable. The objective of this study was to determine the impact of easily and slowly biodegradable compounds on the biostability of the drinking water at three full-scale production plants which use the same surface water, and on the regrowth conditions in the related distribution systems. Easily biodegradable compounds in the drinking water were determined with AOC-P17/Nox during 2012-2015. Slowly biodegradable organic compounds measured as particulate and/or high-molecular organic carbon (PHMOC), were monitored at the inlet and after the different treatment stages of the three treatments during the same period. The results show that PHMOC (300-470 μg C L -1 ) was approximately 10% of the TOC in the surface water and was removed to 50-100 μg C L -1 . The PHMOC in the water consisted of 40-60% of carbohydrates and 10% of proteins. A significant and strong positive correlation was observed for PHMOC concentrations and two recently introduced bioassay methods for slowly biodegradable compounds (AOC-A3 and biomass production potential, BPC 14 ). Moreover, these three parameters in the biological active carbon effluent (BACF) of the three plants showed a positive correlation with regrowth in the drinking water distribution system, which was assessed with Aeromonas, heterotrophic plate counts, coliforms and large invertebrates. In contrast, the AOC-P17/Nox concentrations did not correlate with these regrowth parameters. We therefore conclude that slowly biodegradable compounds in the treated water from these treatment plants seem to have a greater impact on regrowth in the distribution system than easily biodegradable compounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Climate change and water table fluctuation: Implications for raised bog surface variability

    Science.gov (United States)

    Taminskas, Julius; Linkevičienė, Rita; Šimanauskienė, Rasa; Jukna, Laurynas; Kibirkštis, Gintautas; Tamkevičiūtė, Marija

    2018-03-01

    Cyclic peatland surface variability is influenced by hydrological conditions that highly depend on climate and/or anthropogenic activities. A low water level leads to a decrease of peatland surface and an increase of C emissions into the atmosphere, whereas a high water level leads to an increase of peatland surface and carbon sequestration in peatlands. The main aim of this article is to evaluate the influence of hydrometeorological conditions toward the peatland surface and its feedback toward the water regime. A regional survey of the raised bog water table fluctuation and surface variability was made in one of the largest peatlands in Lithuania. Two appropriate indicators for different peatland surface variability periods (increase and decrease) were detected. The first one is an 200 mm y- 1 average net rainfall over a three-year range. The second one is an average annual water depth of 25-30 cm. The application of these indicators enabled the reconstruction of Čepkeliai peatland surface variability during a 100 year period. Processes of peatland surface variability differ in time and in separate parts of peatland. Therefore, internal subbasins in peatland are formed. Subbasins involve autogenic processes that can later affect their internal hydrology, nutrient status, and vegetation succession. Internal hydrological conditions, surface fluctuation, and vegetation succession in peatland subbasins should be taken into account during evaluation of their state, nature management projects, and other peatland research works.

  18. Clean Air Markets - Monitoring Surface Water Chemistry

    Science.gov (United States)

    Learn about how EPA uses Long Term Monitoring (LTM) and Temporily Integrated Monitoring of Ecosystems (TIME) to track the effect of the Clean Air Act Amendments on acidity of surface waters in the eastern U.S.

  19. Emerging contaminants in surface waters in China—a short review

    International Nuclear Information System (INIS)

    Yang, Guang; Zhang, Guangming; Fan, Maohong

    2014-01-01

    Emerging contaminants (ECs) have drawn attention to many countries due to their persistent input and potential threat to human health and the environment. This article reviews the current contamination sources and their status for surface waters in China. The contamination levels of ECs in surface waters are in the range ng L −1 to μg L −1 in China, apparently about the same as the situation in other countries. ECs enter surface water via runoff, drainage, rainfall, and wastewater treatment effluent. The frequency of occurrence of ECs increased rapidly from 2006 to 2011; a significant reason is the production and consumption of pharmaceuticals and personal care products. As for the distribution of EC pollution in China, the frequency of occurrence of ECs in eastern regions is higher than in western regions. A majority of EC studies have focused on surface waters of the Haihe River and Pearl River watersheds due to their highly developed industries and intense human activity. Legislative and administrative regulation of ECs is lacking in China. To remove ECs, a number of technologies, such as absorption by activated carbon, membrane filtration technology, and advanced oxidation processes, have been researched. (letter)

  20. Emerging contaminants in surface waters in China—a short review

    Science.gov (United States)

    Yang, Guang; Fan, Maohong; Zhang, Guangming

    2014-07-01

    Emerging contaminants (ECs) have drawn attention to many countries due to their persistent input and potential threat to human health and the environment. This article reviews the current contamination sources and their status for surface waters in China. The contamination levels of ECs in surface waters are in the range ng L-1 to μg L-1 in China, apparently about the same as the situation in other countries. ECs enter surface water via runoff, drainage, rainfall, and wastewater treatment effluent. The frequency of occurrence of ECs increased rapidly from 2006 to 2011; a significant reason is the production and consumption of pharmaceuticals and personal care products. As for the distribution of EC pollution in China, the frequency of occurrence of ECs in eastern regions is higher than in western regions. A majority of EC studies have focused on surface waters of the Haihe River and Pearl River watersheds due to their highly developed industries and intense human activity. Legislative and administrative regulation of ECs is lacking in China. To remove ECs, a number of technologies, such as absorption by activated carbon, membrane filtration technology, and advanced oxidation processes, have been researched.

  1. Determination of Groundwater and Surface Water Qualities at Si Racha, Chon Buri

    International Nuclear Information System (INIS)

    Wangsawang, Jarinee; Naenorn, Warinlada; Khuntong, Soontree; Wongsorntam, Krirk; Udomsomporn, Suchin

    2011-06-01

    Full text: Groundwater (13 wells) and surface water (7 ponds) at Si Racha, Chon Buri province were collected for measurement of water qualities and radionuclides. The water qualities included physical and chemical analysis such as pH, EC, TS, TDS, TSS, TKN, total phosphate, BOD, COD, total hardness and FOG based on standard methods for examination of water and wastewater. Heavy metals (Cd, Cu, Cr, Fe, Mn, Ni and Zn) were analyzed by ICP-AES while total coliform was determined by Multiple Tube Methods. Moreover, radionuclides were analyzed by gamma spectrometer and gross beta and gross alpha were obtained from low background gas proportional counter. Values of most parameters in groundwater were below water qualities standards but all parameters in surface water samples were exceeded water qualities standards. It was found that all radionuclides in water samples were originated from natural uranium and thorium series. The data obtained enabled evaluation of pollutants in groundwater and surface water

  2. Effects of Surface Dipole Lengths on Evaporation of Tiny Water Aggregation

    International Nuclear Information System (INIS)

    Wang Shen; Wan Rongzheng; Fang Haiping; Tu Yusong

    2013-01-01

    Using molecular dynamics simulation, we compared evaporation behavior of a tiny amount of water molecules adsorbed on solid surfaces with different dipole lengths, including surface dipole lengths of 1 fold, 2 folds, 4 folds, 6 folds and 8 folds of 0.14 nm and different charges from 0.1e to 0.9e. Surfaces with short dipole lengths (1-fold system) can always maintain hydrophobic character and the evaporation speeds are not influenced, whether the surface charges are enhanced or weakened; but when surface dipole lengths get to 8 folds, surfaces become more hydrophilic as the surface charge increases, and the evaporation speeds increase gradually and monotonically. By tuning dipole lengths from 1-fold to 8-fold systems, we confirmed non-monotonic variation of the evaporation flux (first increases, then decreases) in 4 fold system with charges (0.1e–0.7e), reported in our previous paper [S. Wang, et al., J. Phys. Chem. B 116 (2012) 13863], and also show the process from the enhancement of this unexpected non-monotonic variation to its vanishment with surface dipole lengths increasing. Herein, we demonstrated two key factors to influence the evaporation flux of a tiny amount of water molecules adsorbed on solid surfaces: the exposed surficial area of water aggregation from where the water molecules can evaporate directly and the attraction potential from the substrate hindering the evaporation. In addition, more interestingly, we showed extra steric effect of surface dipoles on further increase of evaporation flux for 2-folds, 4-folds, 6-folds and 8-folds systems with charges around larger than 0.7e. (The steric effect is first reported by parts of our authors [C. Wang, et al., Sci. Rep. 2 (2012) 358]). This study presents a complete physical picture of the influence of surface dipole lengths on the evaporation behavior of the adsorbed tiny amount of water. (condensed matter: structural, mechanical, and thermal properties)

  3. Evaluation of genotoxic effects of surface waters using a battery of bioassays indicating different mode of action.

    Science.gov (United States)

    Han, Yingnan; Li, Na; Oda, Yoshimitsu; Ma, Mei; Rao, Kaifeng; Wang, Zijian; Jin, Wei; Hong, Gang; Li, Zhiguo; Luo, Yi

    2016-11-01

    With the burgeoning contamination of surface waters threatening human health, the genotoxic effects of surface waters have received much attention. Because mutagenic and carcinogenic compounds in water cause tumors by different mechanisms, a battery of bioassays that each indicate a different mode of action (MOA) is required to evaluate the genotoxic effects of contaminants in water samples. In this study, 15 water samples from two source water reservoirs and surrounding rivers in Shijiazhuang city of China were evaluated for genotoxic effects. Target chemical analyses of 14 genotoxic pollutants were performed according to the Environmental quality standards for surface water of China. Then, the in vitro cytokinesis-block micronucleus (CBMN) assay, based on a high-content screening technique, was used to detect the effect of chromosome damage. The SOS/umu test using strain TA1535/pSK1002 was used to detect effects on SOS repair of gene expression. Additionally, two other strains, NM2009 and NM3009, which are highly sensitive to aromatic amines and nitroarenes, respectively, were used in the SOS/umu test to avoid false negative results. In the water samples, only two of the genotoxic chemicals listed in the water standards were detected in a few samples, with concentrations that were below water quality standards. However, positive results for the CBMN assay were observed in two river samples, and positive results for the induction of umuC gene expression in TA1535/pSK1002 were observed in seven river samples. Moreover, positive results were observed for NM2009 with S9 and NM3009 without S9 in some samples that had negative results using the strain TA1535/pSK1002. Based on the results with NM2009 and NM3009, some unknown or undetected aromatic amines and nitroarenes were likely in the source water reservoirs and the surrounding rivers. Furthermore, these compounds were most likely the causative pollutants for the genotoxic effect of these water samples. Therefore

  4. Variability in chemistry of surface and soil waters of an ...

    African Journals Online (AJOL)

    Water chemistry is important for the maintenance of wetland structure and function. Interpreting ecological patterns in a wetland system therefore requires an in-depth understanding of the water chemistry of that system. We investigated the spatial distribution of chemical solutes both in soil pore water and surface water, ...

  5. Dry deposition of submicron atmospheric aerosol over water surfaces in motion

    International Nuclear Information System (INIS)

    Nevenick, Calec

    2013-01-01

    Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland...). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

  6. Dry deposition of submicron atmospheric aerosol over water surfaces in motion

    International Nuclear Information System (INIS)

    Calec, Nevenick

    2013-01-01

    Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland..). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

  7. Particle dry deposition to water surfaces: Processes and consequences

    DEFF Research Database (Denmark)

    Pryor, S.C.; Barthelmie, R.J.

    2000-01-01

    flux to coastal waters, atmosphere-surface exchange represents a significant component of the total flux and may be particularly critical during the summertime when both the riverine input and ambient nutrient concentrations are often at a minimum. In this chapter, we present an overview...... of the physical and chemical processes which dictate the quantity (and direction) of atmosphere-surface fluxes of trace chemicals to (and above) water surfaces with particular emphasis on the role of particles. Dry deposition (transfer to the surface in the absence of precipitation) of particles is determined...... efforts to simulate and measure fluxes close to the coastline. These arise in part from the complexity of atmospheric flow in this region where energy and chemical fluxes are highly inhomogeneous in space and time and thermally generated atmospheric circulations are commonplace. (C) 2000 Elsevier Science...

  8. Surface restructuring behavior of various types of poly(dimethylsiloxane) in water detected by SFG.

    Science.gov (United States)

    Chen, Chunyan; Wang, Jie; Chen, Zhan

    2004-11-09

    Surface structures of several different poly(dimethylsiloxane) (PDMS) materials, tetraethoxysilane-cured hydroxy-terminated PDMS (TEOS-PDMS), platinum-cured vinyl-terminated PDMS (Pt-PDMS), platinum-cured vinyl-terminated poly(diphenylsiloxane)-co-poly(dimethylsiloxane) (PDPS-co-PDMS), and PDMS-co-polystyrene (PDMS-co-PS) copolymer in air and water have been investigated by sum frequency generation (SFG) vibrational spectroscopy. The SFG spectra collected from all PDMS surfaces in both air and water are dominated by methyl group stretches, indicating that all the surfaces are mainly covered by methyl groups. Other than surface-dominating methyl groups, some -Si-CH2-CH2- moieties on the Pt-PDMS surface have also been detected in air, which are present at cross-linking points. Information about the average orientation angle and angle distribution of the methyl groups on the PDMS surface has been evaluated. Surface restructuring of the methyl groups has been observed for all PDMS surfaces in water. Upon contacting water, the methyl groups on all PDMS surfaces tilt more toward the surface. The detailed restructuring behaviors of several PDMS surfaces in water and the effects of molecular weight on restructuring behaviors have been investigated. For comparison, in addition to air and water, surface structures of PDMS materials mentioned above in a nonpolar solvent, FC-75, have also been studied. By comparing the different response of phenyl groups to water on both PDPS-co-PDMS and PS-co-PDMS surfaces, we have demonstrated how the restructuring behaviors of surface phenyl groups are affected by the structural flexibility of the molecular chains where they are attached.

  9. Copepod communities from surface and ground waters in the everglades, south Florida

    Science.gov (United States)

    Bruno, M.C.; Cunningham, K.J.; Perry, S.A.

    2003-01-01

    We studied species composition and individual abundance of copepods in the surficial aquifer northeast of Everglades National Park. We identified the spatial distribution of subsurface habitats by assessing the depth of the high porosity layers in the limestone along a canal system, and we used copepods to assess the exchange between surface water and ground water along canal banks, at levels in the wells where high porosity connections to the canals exist. Surface- and ground-water taxa were defined, and species composition was related to areal position, sampling depth, and time. Subsurface copepod communities were dominated by surface copepods that disperse into the aquifer following the groundwater seepage along canal L-31N. The similarities in species composition between wells along canal reaches, suggest that copepods mainly enter ground water horizontally along canals via active and passive dispersal. Thus, the copepod populations indicate continuous connections between surface- and ground waters. The most abundant species were Orthocyclops modestus, Arctodiaptomus floridanus, Mesocyclops edax, and Thermocyclops parvus, all known in literature from surface habitats; however, these species have been collected in ground water in ENP. Only two stygophiles were collected: Diacylcops nearcticus and Diacyclops crassicaudis brachycercus. Restoration of the Everglades ecosystem requires a mosaic of data to reveal a complete picture of this complex system. The use of copepods as indicators of seepage could be a tool in helping to assess the direction and the duration of surface and ground water exchange.

  10. The Relationship Between Microscopic Grain Surface Structure and the Dynamic Capillary-Driven Advance of Water Films over Individual Dry Natural Sand Grains

    Science.gov (United States)

    Kibbey, T. C. G.; Adegbule, A.; Yan, S.

    2017-12-01

    The movement of nonvolatile solutes in unsaturated porous media at low water contents depends on transport in surface-associated water films. The focus of the work described here was on studying solute movement in water films advancing by capillary forces over initially-dry grain surfaces, to understand how microscopic surface roughness features influence the initial velocity of water film advance. For this work, water containing a non-adsorbing conservative tracer was used to track the movement of advancing water films. A stainless steel capillary tube connected to an external reservoir a fixed distance below the grain surface was used to transmit solution to the grain surface under negative pressure (positive capillary pressure), consistent with conditions that might be expected in the unsaturated zone. The small internal diameter of the capillary prevents solution from draining out of the capillary back into the reservoir. When the capillary is contacted with a grain surface, capillary forces that result from contact between the fluid and the rough grain surface cause water films to wick across the grain surface. Multiple experiments were conducted on the same grain, rotating the grain and varying the capillary contact point around the circumference of the grain. Imaging was conducted at fixed intervals using an automated Extended Depth of Field (EDF) imaging system, and images were analyzed to determine initial velocity. Grain surfaces were then characterized through scanning electron microscope (SEM) imaging, using a hybrid stereoscopic reconstruction method designed to extract maximum detail in creating elevation maps of geologic surfaces from tilted pairs of SEM images. The resulting elevation maps were used to relate surface roughness profiles around the grain with initial velocities. Results suggest that velocity varies significant with contact point around an individual grain, and correlates quantitatively with the local grain surface structure

  11. Enhancement of Water Evaporation on Solid Surfaces with Nanoscale Hydrophobic-Hydrophilic Patterns.

    Science.gov (United States)

    Wan, Rongzheng; Wang, Chunlei; Lei, Xiaoling; Zhou, Guoquan; Fang, Haiping

    2015-11-06

    Using molecular dynamics simulations, we show that the evaporation of nanoscale water on hydrophobic-hydrophilic patterned surfaces is unexpectedly faster than that on any surfaces with uniform wettability. The key to this phenomenon is that, on the patterned surface, the evaporation rate from the hydrophilic region only slightly decreases due to the correspondingly increased water thickness; meanwhile, a considerable number of water molecules evaporate from the hydrophobic region despite the lack of water film. Most of the evaporated water from the hydrophobic region originates from the hydrophilic region by diffusing across the contact lines. Further analysis shows that the evaporation rate from the hydrophobic region is approximately proportional to the total length of the contact lines.

  12. E. coli Surface Properties Differ between Stream Water and Sediment Environments

    Directory of Open Access Journals (Sweden)

    Xiao Liang

    2016-11-01

    Full Text Available The importance of E. coli as an indicator organism in fresh water has led to numerous studies focusing on cell properties and transport behavior. However, previous studies have been unable to assess if differences in E. coli cell surface properties and genomic variation are associated with different environmental habitats. In this study, we investigated the variation in characteristics of E. coli obtained from stream water and stream bottom sediments. Cell properties were measured for 77 genomically different E. coli strains (44 strains isolated from sediments and 33 strains isolated from water under common stream conditions in the Upper Midwestern United States: pH 8.0, ionic strength 10mM and 22˚C. Measured cell properties include hydrophobicity, zeta potential, net charge, total acidity and extracellular polymeric substance (EPS composition. Our results indicate that stream sediment E. coli had significantly greater hydrophobicity, greater EPS protein content and EPS sugar content, less negative net charge, and higher point of zero charge than stream water E. coli. A significant positive correlation was observed between hydrophobicity and EPS protein for stream sediment E. coli but not for stream water E. coli. Additionally, E. coli surviving in the same habitat tended to have significantly larger (GTG5 genome similarity. After accounting for the intrinsic impact from the genome, environmental habitat was determined to be a factor influencing some cell surface properties, such as hydrophobicity. The diversity of cell properties and its resulting impact on particle interactions should be considered for environmental fate and transport modeling of aquatic indicator organisms such as E. coli.

  13. E. coli Surface Properties Differ between Stream Water and Sediment Environments.

    Science.gov (United States)

    Liang, Xiao; Liao, Chunyu; Thompson, Michael L; Soupir, Michelle L; Jarboe, Laura R; Dixon, Philip M

    2016-01-01

    The importance of E. coli as an indicator organism in fresh water has led to numerous studies focusing on cell properties and transport behavior. However, previous studies have been unable to assess if differences in E. coli cell surface properties and genomic variation are associated with different environmental habitats. In this study, we investigated the variation in characteristics of E. coli obtained from stream water and stream bottom sediments. Cell properties were measured for 77 genomically different E. coli strains (44 strains isolated from sediments and 33 strains isolated from water) under common stream conditions in the Upper Midwestern United States: pH 8.0, ionic strength 10 mM and 22°C. Measured cell properties include hydrophobicity, zeta potential, net charge, total acidity, and extracellular polymeric substance (EPS) composition. Our results indicate that stream sediment E. coli had significantly greater hydrophobicity, greater EPS protein content and EPS sugar content, less negative net charge, and higher point of zero charge than stream water E. coli . A significant positive correlation was observed between hydrophobicity and EPS protein for stream sediment E. coli but not for stream water E. coli . Additionally, E. coli surviving in the same habitat tended to have significantly larger (GTG) 5 genome similarity. After accounting for the intrinsic impact from the genome, environmental habitat was determined to be a factor influencing some cell surface properties, such as hydrophobicity. The diversity of cell properties and its resulting impact on particle interactions should be considered for environmental fate and transport modeling of aquatic indicator organisms such as E. coli .

  14. Influence of surface topology and electrostatic potential on water/electrode systems

    Science.gov (United States)

    Siepmann, J. Ilja; Sprik, Michiel

    1995-01-01

    We have used the classical molecular dynamics technique to simulate the ordering of a water film adsorbed on an atomic model of a tip of a scanning tunneling microscope approaching a planar metal surface. For this purpose, we have developed a classical model for the water-substrate interactions that solely depends on the coordinates of the particles and does not require the definition of geometrically smooth boundary surfaces or image planes. The model includes both an electrostatic induction for the metal atoms (determined by means of an extended Lagrangian technique) and a site-specific treatment of the water-metal chemisorption. As a validation of the model we have investigated the structure of water monolayers on metal substrates of various topology [the (111), (110), and (100) crystallographic faces] and composition (Pt, Ag, Cu, and Ni), and compared the results to experiments. The modeling of the electrostatic induction is compatible with a finite external potential imposed on the metal. This feature is used to investigate the structural rearrangements of the water bilayer between the pair of scanning tunneling microscope electrodes in response to an applied external voltage difference. We find significant asymmetry in the dependence on the sign of the applied voltage. Another result of the calculation is an estimate of the perturbation to the work function caused by the wetting film. For the conditions typical for operation of a scanning tunneling microscope probe, the change in the work function is found to be comparable to the applied voltage (a few hundred millivolts).

  15. Pharmaceuticals and personal care products (PPCPs) in surface and treated waters of Louisiana, USA and Ontario, Canada.

    Science.gov (United States)

    Boyd, Glen R; Reemtsma, Helge; Grimm, Deborah A; Mitra, Siddhartha

    2003-07-20

    A newly developed analytical method was used to measure concentrations of nine pharmaceuticals and personal care products (PPCPs) in samples from two surface water bodies, a sewage treatment plant effluent and various stages of a drinking water treatment plant in Louisiana, USA, and from one surface water body, a drinking water treatment plant and a pilot plant in Ontario, Canada. The analytical method provides for simultaneous extraction and quantification of the following broad range of PPCPs and endocrine-disrupting chemicals: naproxen; ibuprofen; estrone; 17beta-estradiol; bisphenol A; clorophene; triclosan; fluoxetine; and clofibric acid. Naproxen was detected in Louisiana sewage treatment plant effluent at 81-106 ng/l and Louisiana and Ontario surface waters at 22-107 ng/l. Triclosan was detected in Louisiana sewage treatment plant effluent at 10-21 ng/l. Of the three surface waters sampled, clofibric acid was detected in Detroit River water at 103 ng/l, but not in Mississippi River or Lake Pontchartrain waters. None of the other target analytes were detected above their method detection limits. Based on results at various stages of treatment, conventional drinking-water treatment processes (coagulation, flocculation and sedimentation) plus continuous addition of powdered activated carbon at a dosage of 2 mg/l did not remove naproxen from Mississippi River waters. However, chlorination, ozonation and dual media filtration processes reduced the concentration of naproxen below detection in Mississippi River and Detroit River waters and reduced clofibric acid in Detroit River waters. Results of this study demonstrate that existing water treatment technologies can effectively remove certain PPCPs. In addition, our study demonstrates the importance of obtaining data on removal mechanisms and byproducts associated with PPCPs and other endocrine-disrupting chemicals in drinking water and sewage treatment processes.

  16. Bacterial community diversity and variation in spray water sources and the tomato fruit surface.

    Science.gov (United States)

    Telias, Adriana; White, James R; Pahl, Donna M; Ottesen, Andrea R; Walsh, Christopher S

    2011-04-21

    Tomato (Solanum lycopersicum) consumption has been one of the most common causes of produce-associated salmonellosis in the United States. Contamination may originate from animal waste, insects, soil or water. Current guidelines for fresh tomato production recommend the use of potable water for applications coming in direct contact with the fruit, but due to high demand, water from other sources is frequently used. We sought to describe the overall bacterial diversity on the surface of tomato fruit and the effect of two different water sources (ground and surface water) when used for direct crop applications by generating a 454-pyrosequencing 16S rRNA dataset of these different environments. This study represents the first in depth characterization of bacterial communities in the tomato fruit surface and the water sources commonly used in commercial vegetable production. The two water sources tested had a significantly different bacterial composition. Proteobacteria was predominant in groundwater samples, whereas in the significantly more diverse surface water, abundant phyla also included Firmicutes, Actinobacteria and Verrucomicrobia. The fruit surface bacterial communities on tomatoes sprayed with both water sources could not be differentiated using various statistical methods. Both fruit surface environments had a high representation of Gammaproteobacteria, and within this class the genera Pantoea and Enterobacter were the most abundant. Despite the major differences observed in the bacterial composition of ground and surface water, the season long use of these very different water sources did not have a significant impact on the bacterial composition of the tomato fruit surface. This study has provided the first next-generation sequencing database describing the bacterial communities living in the fruit surface of a tomato crop under two different spray water regimes, and therefore represents an important step forward towards the development of science

  17. High prevalence of enteric viruses in untreated individual drinking water sources and surface water in Slovenia.

    Science.gov (United States)

    Steyer, Andrej; Torkar, Karmen Godič; Gutiérrez-Aguirre, Ion; Poljšak-Prijatelj, Mateja

    2011-09-01

    Waterborne infections have been shown to be important in outbreaks of gastroenteritis throughout the world. Although improved sanitary conditions are being progressively applied, fecal contaminations remain an emerging problem also in developed countries. The aim of our study was to investigate the prevalence of fecal contaminated water sources in Slovenia, including surface waters and groundwater sources throughout the country. In total, 152 water samples were investigated, of which 72 samples represents groundwater from individual wells, 17 samples from public collection supplies and 63 samples from surface stream waters. Two liters of untreated water samples were collected and concentrated by the adsorption/elution technique with positively charged filters followed by an additional ultracentrifugation step. Group A rotaviruses, noroviruses (genogroups I and II) and astroviruses were detected with real-time RT-PCR method in 69 (45.4%) out of 152 samples collected, of which 31/89 (34.8%) drinking water and 38/63 (60.3%) surface water samples were positive for at least one virus tested. In 30.3% of drinking water samples group A rotaviruses were detected (27/89), followed by noroviruses GI (2.2%; 2/89) and astroviruses (2.2%; 2/89). In drinking groundwater samples group A rotaviruses were detected in 27 out of 72 tested samples (37.5%), genogroup I noroviruses in two (2.8%), and human astroviruses in one (1.4%) samples. In surface water samples norovirus genogroup GII was the most frequently detected (41.3%; 26/63), followed by norovirus GI (33.3%; 21/63), human astrovirus (27.0%; 17/63) and group A rotavirus (17.5%; 11/63). Our study demonstrates relatively high percentage of groundwater contamination in Slovenia and, suggests that raw groundwater used as individual drinking water supply may constitute a possible source of enteric virus infections. In the future, testing for enteric viruses should be applied for drinking water sources in waterborne outbreaks

  18. A numerical study on the behavior of the water meniscus formed between a flat surface and a flat or circular tip

    Energy Technology Data Exchange (ETDEWEB)

    Son, Sung Wan; Ha, Man Yeong; Yoon, Hyun Sik; Kim, Chang Min [Pusan National University, Busan (Korea, Republic of); Kim, Sang Sun [Korea Aerospace Industries, Sacheon (Korea, Republic of)

    2014-04-15

    We numerically investigated the behavior of the water meniscus formed between a flat surface and a tip surface, which is flat or circular in shape, using the lattice Boltzmann method (LBM). The shape of the water meniscus formed between the flat bottom surface and the tip surface depends on the tip shape and the interaction between the water meniscus and the bottom or tip surface. The interaction is determined by the contact angles of the bottom and tip surfaces, resulting in different contact lengths between the water meniscus and the bottom or tip surface. The difference in these contact lengths depends on the effects of both the tip curvature and the interaction between the water meniscus and the bottom or tip surface. We classified the shapes of the water meniscus into seven different patterns as a function of the contact angles of the flat bottom and tip surfaces: concave, semi-concave, inverse semi-concave, column, convex, semiconvex, and inverse semi-convex.

  19. A numerical study on the behavior of the water meniscus formed between a flat surface and a flat or circular tip

    International Nuclear Information System (INIS)

    Son, Sung Wan; Ha, Man Yeong; Yoon, Hyun Sik; Kim, Chang Min; Kim, Sang Sun

    2014-01-01

    We numerically investigated the behavior of the water meniscus formed between a flat surface and a tip surface, which is flat or circular in shape, using the lattice Boltzmann method (LBM). The shape of the water meniscus formed between the flat bottom surface and the tip surface depends on the tip shape and the interaction between the water meniscus and the bottom or tip surface. The interaction is determined by the contact angles of the bottom and tip surfaces, resulting in different contact lengths between the water meniscus and the bottom or tip surface. The difference in these contact lengths depends on the effects of both the tip curvature and the interaction between the water meniscus and the bottom or tip surface. We classified the shapes of the water meniscus into seven different patterns as a function of the contact angles of the flat bottom and tip surfaces: concave, semi-concave, inverse semi-concave, column, convex, semiconvex, and inverse semi-convex

  20. Water Induced Surface Reconstruction of the Oxygen (2x1) covered Ru(0001)

    Energy Technology Data Exchange (ETDEWEB)

    Maier, Sabine; Cabrera-Sanfelix, Pepa; Stass, Ingeborg; Sanchez-Portal, Daniel; Arnau, Andres; Salmeron, Miquel

    2010-08-06

    Low temperature scanning tunneling microscopy (STM) and density functional theory (DFT) were used to study the adsorption of water on a Ru(0001) surface covered with half monolayer of oxygen. The oxygen atoms occupy hcp sites in an ordered structure with (2x1) periodicity. DFT predicts that water is weakly bound to the unmodified surface, 86 meV compared to the ~;;200 meV water-water H-bond. Instead, we found that water adsorption causes a shift of half of the oxygen atoms from hcp sites to fcc sites, creating a honeycomb structure where water molecules bind strongly to the exposed Ru atoms. The energy cost of reconstructing the oxygen overlayer, around 230 meV per displaced oxygen atom, is more than compensated by the larger adsorption energy of water on the newly exposed Ru atoms. Water forms hydrogen bonds with the fcc O atoms in a (4x2) superstructure due to alternating orientations of the molecules. Heating to 185 K results in the complete desorption of the water layer, leaving behind the oxygen honeycomb structure, which is metastable relative to the original (2x1). This stable structure is not recovered until after heating to temperatures close to 260K.

  1. Mixing and remineralization in waters detrained from the surface into Subantarctic Mode Water and Antarctic Intermediate Water in the southeastern Pacific

    Science.gov (United States)

    Carter, B. R.; Talley, L. D.; Dickson, A. G.

    2014-06-01

    A hydrographic data set collected in the region and season of Subantarctic Mode Water and Antarctic Intermediate Water (SAMW and AAIW) formation in the southeastern Pacific allows us to estimate the preformed properties of surface water detrained into these water masses from deep mixed layers north of the Subantarctic Front and Antarctic Surface Water south of the front. Using 10 measured seawater properties, we estimate: the fractions of SAMW/AAIW that originate as surface source waters, as well as fractions that mix into these water masses from subtropical thermocline water above and Upper Circumpolar Deep Water below the subducted SAMW/AAIW; ages associated with the detrained surface water; and remineralization and dissolution rates and ratios. The mixing patterns imply that cabbeling can account for ˜0.005-0.03 kg m-3 of additional density in AAIW, and ˜0-0.02 kg m-3 in SAMW. We estimate a shallow depth (˜300-700 m, above the aragonite saturation horizon) calcium carbonate dissolution rate of 0.4 ± 0.2 µmol CaCO3 kg-1 yr-1, a phosphate remineralization rate of 0.031 ± 0.009 µmol P kg-1 yr-1, and remineralization ratios of P:N:-O2:Corg of 1:(15.5 ± 0.6):(143 ± 10):(104 ± 22) for SAMW/AAIW. Our shallow depth calcium carbonate dissolution rate is comparable to previous estimates for our region. Our -O2:P ratio is smaller than many global averages. Our model suggests neglecting diapycnal mixing of preformed phosphate has likely biased previous estimates of -O2:P and Corg:P high, but that the Corg:P ratio bias may have been counteracted by a second bias in previous studies from neglecting anthropogenic carbon gradients.

  2. Tile Drainage Management Influences on Surface-Water and Groundwater Quality following Liquid Manure Application.

    Science.gov (United States)

    Frey, Steven K; Topp, Ed; Ball, Bonnie R; Edwards, Mark; Gottschall, Natalie; Sunohara, Mark; Zoski, Erin; Lapen, David R

    2013-01-01

    This study investigated the potential for controlled tile drainage (CD) to reduce bacteria and nutrient loading to surface water and groundwater from fall-season liquid manure application (LMA) on four macroporous clay loam plots, of which two had CD and two had free-draining (FD) tiles. Rhodamine WT (RWT) was mixed into the manure and monitored in the tile water and groundwater following LMA. Tile water and groundwater quality were influenced by drainage management. Following LMA on the FD plots, RWT, nutrients, and bacteria moved rapidly via tiles to surface water; at the CD plots, tiles did not flow until the first post-LMA rainfall, so the immediate risk of LMA-induced contamination of surface water was abated. During the 36-d monitoring period, flow-weighted average specific conductance, redox potential, and turbidity, as well as total Kjeldahl N (TKN), total P (TP), NH-N, reactive P, and RWT concentrations, were higher in the CD tile effluent; however, because of lower tile discharge from the CD plots, there was no significant ( ≤ 0.05) difference in surface water nutrient and RWT loading between the CD and FD plots when all tiles were flowing. The TKN, TP, and RWT concentrations in groundwater also tended to be higher at the CD plots. Bacteria behaved differently than nutrients and RWT, with no significant difference in total coliform, , fecal coliform, fecal streptococcus, and concentrations between the CD and FD tile effluent; however, for all but , hourly loading was higher from the FD plots. Results indicate that CD has potential for mitigating bacteria movement to surface water. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  3. Modeling the impact of soil and water conservation on surface and ground water based on the SCS and Visual MODFLOW.

    Science.gov (United States)

    Wang, Hong; Gao, Jian-en; Zhang, Shao-long; Zhang, Meng-jie; Li, Xing-hua

    2013-01-01

    Soil and water conservation measures can impact hydrological cycle, but quantitative analysis of this impact is still difficult in a watershed scale. To assess the effect quantitatively, a three-dimensional finite-difference groundwater flow model (MODFLOW) with a surface runoff model-the Soil Conservation Service (SCS) were calibrated and applied based on the artificial rainfall experiments. Then, three soil and water conservation scenarios were simulated on the sand-box model to assess the effect of bare slope changing to grass land and straw mulching on water volume, hydraulic head, runoff process of groundwater and surface water. Under the 120 mm rainfall, 60 mm/h rainfall intensity, 5 m(2) area, 3° slope conditions, the comparative results indicated that the trend was decrease in surface runoff and increase in subsurface runoff coincided with the land-use converted from bare slope to grass land and straw mulching. The simulated mean surface runoff modulus was 3.64×10(-2) m(3)/m(2)/h in the bare slope scenario, while the observed values were 1.54×10(-2) m(3)/m(2)/h and 0.12×10(-2) m(3)/m(2)/h in the lawn and straw mulching scenarios respectively. Compared to the bare slope, the benefits of surface water reduction were 57.8% and 92.4% correspondingly. At the end of simulation period (T = 396 min), the simulated mean groundwater runoff modulus was 2.82×10(-2) m(3)/m(2)/h in the bare slope scenario, while the observed volumes were 3.46×10(-2) m(3)/m(2)/h and 4.91×10(-2) m(3)/m(2)/h in the lawn and straw mulching scenarios respectively. So the benefits of groundwater increase were 22.7% and 60.4% correspondingly. It was concluded that the soil and water conservation played an important role in weakening the surface runoff and strengthening the underground runoff. Meanwhile the quantitative analysis using a modeling approach could provide a thought for the study in a watershed scale to help decision-makers manage water resources.

  4. Modeling the impact of soil and water conservation on surface and ground water based on the SCS and Visual MODFLOW.

    Directory of Open Access Journals (Sweden)

    Hong Wang

    Full Text Available Soil and water conservation measures can impact hydrological cycle, but quantitative analysis of this impact is still difficult in a watershed scale. To assess the effect quantitatively, a three-dimensional finite-difference groundwater flow model (MODFLOW with a surface runoff model-the Soil Conservation Service (SCS were calibrated and applied based on the artificial rainfall experiments. Then, three soil and water conservation scenarios were simulated on the sand-box model to assess the effect of bare slope changing to grass land and straw mulching on water volume, hydraulic head, runoff process of groundwater and surface water. Under the 120 mm rainfall, 60 mm/h rainfall intensity, 5 m(2 area, 3° slope conditions, the comparative results indicated that the trend was decrease in surface runoff and increase in subsurface runoff coincided with the land-use converted from bare slope to grass land and straw mulching. The simulated mean surface runoff modulus was 3.64×10(-2 m(3/m(2/h in the bare slope scenario, while the observed values were 1.54×10(-2 m(3/m(2/h and 0.12×10(-2 m(3/m(2/h in the lawn and straw mulching scenarios respectively. Compared to the bare slope, the benefits of surface water reduction were 57.8% and 92.4% correspondingly. At the end of simulation period (T = 396 min, the simulated mean groundwater runoff modulus was 2.82×10(-2 m(3/m(2/h in the bare slope scenario, while the observed volumes were 3.46×10(-2 m(3/m(2/h and 4.91×10(-2 m(3/m(2/h in the lawn and straw mulching scenarios respectively. So the benefits of groundwater increase were 22.7% and 60.4% correspondingly. It was concluded that the soil and water conservation played an important role in weakening the surface runoff and strengthening the underground runoff. Meanwhile the quantitative analysis using a modeling approach could provide a thought for the study in a watershed scale to help decision-makers manage water resources.

  5. Impact of catchment geophysical characteristics and climate on the regional variability of dissolved organic carbon (DOC) in surface water.

    Science.gov (United States)

    Cool, Geneviève; Lebel, Alexandre; Sadiq, Rehan; Rodriguez, Manuel J

    2014-08-15

    Dissolved organic carbon (DOC) is a recognized indicator of natural organic matter (NOM) in surface waters. The aim of this paper is twofold: to evaluate the impact of geophysical characteristics, climate and ecological zones on DOC concentrations in surface waters and, to develop a statistical model to estimate the regional variability of these concentrations. In this study, multilevel statistical analysis was used to achieve three specific objectives: (1) evaluate the influence of climate and geophysical characteristics on DOC concentrations in surface waters; (2) compare the influence of geophysical characteristics and ecological zones on DOC concentrations in surface waters; and (3) develop a model to estimate the most accurate DOC concentrations in surface waters. The case study involved 115 catchments from surface waters in the Province of Quebec, Canada. Results showed that mean temperatures recorded 60 days prior to sampling, total precipitation 10 days prior to sampling and percentages of wetlands, coniferous forests and mixed forests have a significant positive influence on DOC concentrations in surface waters. The catchment mean slope had a significant negative influence on DOC concentrations in surface waters. Water type (lake or river) and deciduous forest variables were not significant. The ecological zones had a significant influence on DOC concentrations. However, geophysical characteristics (wetlands, forests and slope) estimated DOC concentrations more accurately. A model describing the variability of DOC concentrations was developed and can be used, in future research, for estimating DBPs in drinking water as well evaluating the impact of climate change on the quality of surface waters and drinking water. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Wettability modification of human tooth surface by water and UV and electron-beam radiation

    International Nuclear Information System (INIS)

    Tiznado-Orozco, Gaby E.; Reyes-Gasga, José; Elefterie, Florina; Beyens, Christophe; Maschke, Ulrich; Brès, Etienne F.

    2015-01-01

    The wettability of the human tooth enamel and dentin was analyzed by measuring the contact angles of a drop of distilled water deposited on the surface. The samples were cut along the transverse and longitudinal directions, and their surfaces were subjected to metallographic mirror-finish polishing. Some samples were also acid etched until their microstructure became exposed. Wettability measurements of the samples were done in dry and wet conditions and after ultraviolet (UV) and electron beam (EB) irradiations. The results indicate that water by itself was able to increase the hydrophobicity of these materials. The UV irradiation momentarily reduced the contact angle values, but they recovered after a short time. EB irradiation raised the contact angle and maintained it for a long time. Both enamel and dentin surfaces showed a wide range of contact angles, from approximately 10° (hydrophilic) to 90° (hydrophobic), although the contact angle showed more variability on enamel than on dentin surfaces. Whether the sample's surface had been polished or etched did not influence the contact angle value in wet conditions. - Highlights: • Human tooth surface wettability changes in dry/wet and UV/EB radiation conditions. • More variability in contact angle is observed on enamel than on dentin surfaces. • Water by itself increases the hydrophobicity of the human tooth surface. • UV irradiation reduces momentarily the human tooth surface hydrophobicity. • EB irradiation increases and maintains the hydrophobicity for a long time

  7. Wettability modification of human tooth surface by water and UV and electron-beam radiation

    Energy Technology Data Exchange (ETDEWEB)

    Tiznado-Orozco, Gaby E., E-mail: gab0409@gmail.com [UMET, Bâtiment C6, Université de Lille 1, Sciences et Technologies, 59650 Villeneuve d' Ascq (France); Unidad Académica de Odontología, Universidad Autónoma de Nayarit, Edificio E7, Ciudad de la Cultura “Amado Nervo”, C.P. 63190 Tepic, Nayarit (Mexico); Reyes-Gasga, José, E-mail: jreyes@fisica.unam.mx [UMET, Bâtiment C6, Université de Lille 1, Sciences et Technologies, 59650 Villeneuve d' Ascq (France); Instituto de Física, UNAM, Circuito de la Investigación s/n, Ciudad Universitaria, 04510 Coyoacan, México, D.F. (Mexico); Elefterie, Florina, E-mail: elefterie_florina@yahoo.com [UMET, Bâtiment C6, Université de Lille 1, Sciences et Technologies, 59650 Villeneuve d' Ascq (France); Beyens, Christophe, E-mail: christophe.beyens@ed.univ-lille1.fr [UMET, Bâtiment C6, Université de Lille 1, Sciences et Technologies, 59650 Villeneuve d' Ascq (France); Maschke, Ulrich, E-mail: Ulrich.Maschke@univ-lille1.fr [UMET, Bâtiment C6, Université de Lille 1, Sciences et Technologies, 59650 Villeneuve d' Ascq (France); Brès, Etienne F., E-mail: etienne.bres@univ-lille1.fr [UMET, Bâtiment C6, Université de Lille 1, Sciences et Technologies, 59650 Villeneuve d' Ascq (France)

    2015-12-01

    The wettability of the human tooth enamel and dentin was analyzed by measuring the contact angles of a drop of distilled water deposited on the surface. The samples were cut along the transverse and longitudinal directions, and their surfaces were subjected to metallographic mirror-finish polishing. Some samples were also acid etched until their microstructure became exposed. Wettability measurements of the samples were done in dry and wet conditions and after ultraviolet (UV) and electron beam (EB) irradiations. The results indicate that water by itself was able to increase the hydrophobicity of these materials. The UV irradiation momentarily reduced the contact angle values, but they recovered after a short time. EB irradiation raised the contact angle and maintained it for a long time. Both enamel and dentin surfaces showed a wide range of contact angles, from approximately 10° (hydrophilic) to 90° (hydrophobic), although the contact angle showed more variability on enamel than on dentin surfaces. Whether the sample's surface had been polished or etched did not influence the contact angle value in wet conditions. - Highlights: • Human tooth surface wettability changes in dry/wet and UV/EB radiation conditions. • More variability in contact angle is observed on enamel than on dentin surfaces. • Water by itself increases the hydrophobicity of the human tooth surface. • UV irradiation reduces momentarily the human tooth surface hydrophobicity. • EB irradiation increases and maintains the hydrophobicity for a long time.

  8. How to repel hot water from a superhydrophobic surface?

    KAUST Repository

    Yu, Zhejun; Yang, Jieyi; Wan, Fang; Ge, Quan; Yang, Longlai; Ding, Zunliang; Yang, Dequan; Sacher, Edward R.; Isimjan, Tayirjan T.

    2014-01-01

    Superhydrophobic surfaces, with water contact angles greater than 150° and slide angles less than 10°, have attracted a great deal of attention due to their self-cleaning ability and excellent water-repellency. It is commonly accepted that a

  9. An integrated model for assessing the risk of TCE groundwater contamination to human receptors and surface water ecosystems

    DEFF Research Database (Denmark)

    McKnight, Ursula S.; Funder, S.G.; Rasmussen, J.J.

    2010-01-01

    The practical implementation of the European Water Framework Directive has resulted in an increased focus on the hyporheic zone. In this paper, an integrated model was developed for evaluating the impact of point sources in groundwater on human health and surface water ecosystems....... This was accomplished by coupling the system dynamics-based decision support system CARO-PLUS to the aquatic ecosystem model AQUATOX using an analytical volatilization model for the stream. The model was applied to a case study where a TCE contaminated groundwater plume is discharging to a stream. The TCE source...... will not be depleted for many decades, however measured and predicted TCE concentrations in surface water were found to be below human health risk management targets. Volatilization rapidly attenuates TCE concentrations in surface water. Thus, only a 300 m stream reach fails to meet surface water quality criteria...

  10. Water quality responses to the interaction between surface water and groundwater along the Songhua River, NE China

    Science.gov (United States)

    Teng, Yanguo; Hu, Bin; Zheng, Jieqiong; Wang, Jinsheng; Zhai, Yuanzheng; Zhu, Chen

    2018-03-01

    Investigation of surface water and groundwater interaction (SW-GW interaction) provides basic information for regional water-resource protection, management, and development. In this survey of a 10-km-wide area along both sides of the Songhua River, northeast China, the hydrogeochemical responses to different SW-GW interactions were studied. Three types of SW-GW interactions were identified—"recharge", "discharge", and "flow-through"—according to the hydraulic connection between the surface water and groundwater. The single factor index, principal component analysis, and hierarchical cluster analysis of the hydrogeochemistry and pollutant data illuminated the hydrogeochemical response to the various SW-GW interactions. Clear SW-GW interactions along the Songhua River were revealed: (1) upstream in the study area, groundwater usually discharges into the surface water, (2) groundwater is recharged by surface water downstream, and (3) discharge and flow-through coexist in between. Statistical analysis indicated that the degree of hydrogeochemical response in different types of hydraulic connection varied, being clear in recharge and flow-through modes, and less obvious in discharge mode. During the interaction process, dilution, adsorption, redox reactions, nitrification, denitrification, and biodegradation contributed to the pollutant concentration and affected hydrogeochemical response in the hyporheic zone.

  11. Adsorption of water vapour and the specific surface area of arctic zone soils (Spitsbergen)

    Science.gov (United States)

    Cieśla, Jolanta; Sokołowska, Zofia; Witkowska-Walczak, Barbara; Skic, Kamil

    2018-01-01

    Water vapour/nitrogen adsorption were investigated and calculated the specific surface areas of arctic-zone soil samples (Turbic Cryosols) originating from different micro-relief forms (mud boils, cell forms and sorted circles) and from different depths. For the characterisation of the isotherms obtained for arctic soils, the Brunauer-Emmet-Teller model was then compared with the two other models (Aranovich-Donohue and Guggenheim-Anderson-de Boer) which were developed from Brunauer-Emmet-Teller. Specific surface area was calculated using the Brunauer-Emmet-Teller model at p p0-1 range of 0.05-0.35 for the water vapour desorption and nitrogen adsorption isotherms. The values of total specific surface area were the highest in Cryosols on mud boils, lower on cell forms, and the lowest on sorted circles. Such tendency was observed for the results obtained by both the water vapour and nitrogen adsorption. The differences in the values of specific surface area at two investigated layers were small. High determination coefficients were obtained for relationships between the specific surface areas and contents of clay and silt fraction in Cryosols. No statistically significant correlation between the total carbon amount and the values of specific surface area in Cryosols has been found.

  12. Pesticide volatilization from small surface waters : rationale of a new parameterization for TOXSWA

    NARCIS (Netherlands)

    Jacobs, C.M.J.; Adriaanse, P.I.

    2012-01-01

    In the TOXSWA (TOXic substances in Surface WAters) model volatilization of pesticides from surface water is computed because it may be an important component of the mass balance of pesticides in water bodies. Here, we briefly review the physics of air-water gas exchange relevant in this context. A

  13. Ground and surface water for drinking: a laboratory study on genotoxicity using plant tests

    Directory of Open Access Journals (Sweden)

    Donatella Feretti

    2012-02-01

    Full Text Available Surface waters are increasingly utilized for drinking water because groundwater sources are often polluted. Several monitoring studies have detected the presence of mutagenicity in drinking water, especially from surface sources due to the reaction of natural organic matter with disinfectant. The study aimed to investigate the genotoxic potential of the products of reaction between humic substances, which are naturally present in surface water, and three disinfectants: chlorine dioxide, sodium hypochlorite and peracetic acid. Commercial humic acids dissolved in distilled water at different total organic carbon (TOC concentrations were studied in order to simulate natural conditions of both ground water (TOC=2.5 mg/L and surface water (TOC=7.5 mg/L. These solutions were treated with the biocides at a 1:1 molar ratio of C:disinfectant and tested for genotoxicity using the anaphase chromosomal aberration and micronucleus tests in Allium cepa, and the Vicia faba and Tradescantia micronucleus tests. The tests were carried out after different times and with different modes of exposure, and at 1:1 and 1:10 dilutions of disinfected and undisinfected humic acid solutions. A genotoxic effect was found for sodium hypochlorite in all plant tests, at both TOCs considered, while chlorine dioxide gave positive results only with the A.cepa tests. Some positive effects were also detected for PAA (A.cepa and Tradescantia. No relevant differences were found in samples with different TOC values. The significant increase in all genotoxicity end-points induced by all tested disinfectants indicates that a genotoxic potential is exerted even in the presence of organic substances at similar concentrations to those frequently present in drinking water.

  14. Simulation of Intra- or transboundary surface-water-rights hierarchies using the farm process for MODFLOW-2000

    Science.gov (United States)

    Schmid, W.; Hanson, R.T.

    2007-01-01

    Water-rights driven surface-water allocations for irrigated agriculture can be simulated using the farm process for MODFLOW-2000. This paper describes and develops a model, which simulates routed surface-water deliveries to farms limited by streamflow, equal-appropriation allotments, or a ranked prior-appropriation system. Simulated diversions account for deliveries to all farms along a canal according to their water-rights ranking and for conveyance losses and gains. Simulated minimum streamflow requirements on diversions help guarantee supplies to senior farms located on downstream diverting canals. Prior appropriation can be applied to individual farms or to groups of farms modeled as "virtual farms" representing irrigation districts, irrigated regions in transboundary settings, or natural vegetation habitats. The integrated approach of jointly simulating canal diversions, surface-water deliveries subject to water-rights constraints, and groundwater allocations is verified on numerical experiments based on a realistic, but hypothetical, system of ranked virtual farms. Results are discussed in light of transboundary water appropriation and demonstrate the approach's suitability for simulating effects of water-rights hierarchies represented by international treaties, interstate stream compacts, intrastate water rights, or ecological requirements. ?? 2007 ASCE.

  15. Radiocaesium and plutonium in Atlantic surface waters from 73oN to 72oS

    International Nuclear Information System (INIS)

    Holm, E.; Roos, P.; Persson, R.B.R.; Livingston, H.D.

    1991-01-01

    During the recent Swedish Antartic research Expedition (SWEDARP 89/89) samples of surface sea water were collected on board the Stena Arctica between Gothenburgh, Sweden and the Antarctic Peninsula. Radio chemical separation was performed for radiocaesium on 200 1 samples and for plutonium on samples between 200 and 1500 1. The results are compared with those of the GEOSECS expedition in the North and South Atlantic in 1972-73 and the Polish expedition in 1977-78. They show that radiocaesium has behaved rather conservatively and that the decrease in surface water concentrations during 16 years is due to physical decay. On the other hand levels of 239+240 Pu have decreased by a factor of 4-5 giving a half life of 7-8 years in open Atlantic surface waters. (Author)

  16. Treatment and utilization of waste waters of surface mines in Ukraine

    Energy Technology Data Exchange (ETDEWEB)

    Khmel' , N S

    1981-01-01

    Waste water of brown coal surface mines in the Dnieper basin is characterized. The water's pH value is 7, alkalinity ranges from 5.1 to 5.9 mg equivalent/1, it has no odor, a low mineralization level ranging from 1000 to 1100 mg/l. Concentration of mechanical impurities (suspended matter) ranges from 90 to 900 mg/l, and its maximum level can reach 5000 mg/l. An improved design of tanks in which waste water from surface mines is treated, and mechanical impurities settle, is proposed. Conventional design of a water sedimentation tank consists of a long ditch in which suspended matter settles, and a rectangular water reservoir at its end. In the improved version the long ditch is enlarged in some places to create additional tanks and to reduce velocity of flowing waste water. This improvement increases the amount of suspended matter which settles in the ditch and in its enlarged zones. When water reaches the rectangular sedimentation tank at the end of the system its suspended matter content is reduced to 40-45 mg/l. Formulae used to calculate dimensions of water treatment system, gradient of the ditch and size of sedimentation tank are presented. Methods of discharging treated waste water to surface water, rivers and stagnant waters, are evaluated. (In Russian)

  17. Friction Regimes of Water-Lubricated Diamond (111): Role of Interfacial Ether Groups and Tribo-Induced Aromatic Surface Reconstructions

    Science.gov (United States)

    Kuwahara, Takuya; Moras, Gianpietro; Moseler, Michael

    2017-09-01

    Large-scale quantum molecular dynamics of water-lubricated diamond (111) surfaces in sliding contact reveals multiple friction regimes. While water starvation causes amorphization of the tribological interface, small H2O traces are sufficient to preserve crystallinity. This can result in high friction due to cold welding via ether groups or in ultralow friction due to aromatic surface passivation triggered by tribo-induced Pandey reconstruction. At higher water coverage, Grotthuss-type diffusion and H2O dissociation yield dense H /OH surface passivation leading to another ultralow friction regime.

  18. Interpretation of surface-water circulation, Aransas Pass, Texas, using Landsat imagery

    Science.gov (United States)

    Finley, R. J.; Baumgardner, R. W., Jr.

    1980-01-01

    The development of plumes of turbid surface water in the vicinity of Aransas Pass, Texas has been analyzed using Landsat imagery. The shape and extent of plumes present in the Gulf of Mexico is dependent on the wind regime and astronomical tide prior to and at the time of satellite overpass. The best developed plumes are evident when brisk northerly winds resuspend bay-bottom muds and flow through Aransas Pass is increased by wind stress. Seaward diversion of nearshore waters by the inlet jetties was also observed. A knowledge of surface-water circulation through Aransas Pass under various wind conditions is potentially valuable for monitoring suspended and surface pollutants

  19. Structure and optical properties of water covered Cu(110) surfaces

    International Nuclear Information System (INIS)

    Baghbanpourasl, A.

    2014-01-01

    In this thesis structural and optical properties of the water covered Cu(110) surface is studied using density functional theory within independent particle approximation. Several stable adsorption structures are studied such as water clusters (monomer, dimer, trimer, tetramer and pentamer), different hexagonal monolayers, partially dissociated water monolayers and three different types of chains among them a chain that consists of pentagon rings. For a copper surface in contact with water vapor, the energetically stable H 2 O/OH adsorbed structures are compared thermodynamically using adsorption free energy (change of free energy due to adsorption). Several phase diagrams with respect to temperature and pressure are calculated. It is found that among the large number of energetically stable structures (i.e. structures with positive adsorption energy ) only limited number of them are thermodynamically stable. These thermodynamically stable structures are the class of almost energetically degenerate hexagonal overlayers, one type of partially dissociated water structure that contains Bjerrum defect in the hydrogen bond network and pentagon chain. Since hydrogen atoms are light weight their vibrational effects can be considerable. Zero point vibration decreases the adsorption energy up to 0.1 eV and free energy of adsorbed molecules arising from vibrational degree of freedom can go up to -0.2 eV per adsorbed molecule at 500 Kelvin. However zero point energy and vibrational free energy of adsorbed molecules do not alter relative stability of the adsorbed structures. To account for the long range van der Waals interactions, a semi-empirical scheme is applied. Reflectance Anisotropy Spectroscopy (RAS) is a fast and non destructive optical method that can be used to prob the surface in different conditions such as vacuum and electro-chemical environment. Elasto-optic coeficients of bulk are calculated from first principles and the change of the RA spectrum of the bare Cu

  20. The environmental cost of a reference withdrawal from surface waters: Definition and geography

    Science.gov (United States)

    Soligno, Irene; Ridolfi, Luca; Laio, Francesco

    2017-12-01

    World freshwater ecosystems are significantly deteriorating at a faster rate than other ecosystems. Water withdrawals are recognized as one of the main drivers of growing water stress in river basins worldwide. Over the years, much effort has been devoted to quantify water withdrawals at a global scale; however, comparisons are not simple because the uneven spatiotemporal distribution of surface water resources entails that the same amount of consumed water does not have the same environmental cost in different times or places. In order to account for this spatiotemporal heterogeneity, this work proposes a novel index to assess the environmental cost of a withdrawal from a generic river section. The index depends on (i) the environmental relevance of the impacted fluvial ecosystem (e.g., bed-load transport capacity, width of the riparian belt, biodiversity richness) and (ii) the downstream river network affected by the water withdrawal. The environmental cost has been estimated in each and every river section worldwide considering a reference withdrawal. Being referred to a unitary reference withdrawal that can occur in any river section worldwide, our results can be suitably arranged for describing any scenario of surface water consumption (i.e., as the superposition of the actual pattern of withdrawals). The index aims to support the interpretation of the volumetric measure of surface water withdrawal with a perspective that takes into account the fluvial system where the withdrawal actually occurs. The application of the index highlights the river regions where withdrawals can cause higher environmental costs, with the challenge of weighting each water withdrawal considering the responsibilities that it has on downstream freshwater ecosystems.

  1. Evaluation of ATP measurements to detect microbial ingress by wastewater and surface water in drinking water.

    Science.gov (United States)

    Vang, Óluva K; Corfitzen, Charlotte B; Smith, Christian; Albrechtsen, Hans-Jørgen

    2014-11-01

    Fast and reliable methods are required for monitoring of microbial drinking water quality in order to protect public health. Adenosine triphosphate (ATP) was investigated as a potential real-time parameter for detecting microbial ingress in drinking water contaminated with wastewater or surface water. To investigate the ability of the ATP assay in detecting different contamination types, the contaminant was diluted with non-chlorinated drinking water. Wastewater, diluted at 10(4) in drinking water, was detected with the ATP assay, as well as 10(2) to 10(3) times diluted surface water. To improve the performance of the ATP assay in detecting microbial ingress in drinking water, different approaches were investigated, i.e. quantifying microbial ATP or applying reagents of different sensitivities to reduce measurement variations; however, none of these approaches contributed significantly in this respect. Compared to traditional microbiological methods, the ATP assay could detect wastewater and surface water in drinking water to a higher degree than total direct counts (TDCs), while both heterotrophic plate counts (HPC 22 °C and HPC 37 °C) and Colilert-18 (Escherichia coli and coliforms) were more sensitive than the ATP measurements, though with much longer response times. Continuous sampling combined with ATP measurements displays definite monitoring potential for microbial drinking water quality, since microbial ingress in drinking water can be detected in real-time with ATP measurements. The ability of the ATP assay to detect microbial ingress is influenced by both the ATP load from the contaminant itself and the ATP concentration in the specific drinking water. Consequently, a low ATP concentration of the specific drinking water facilitates a better detection of a potential contamination of the water supply with the ATP assay. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Application of new point measurement device to quantify groundwater-surface water interactions

    Science.gov (United States)

    Cremeans, M. M.; Devlin, J. F.; McKnight, U. S.; Bjerg, P. L.

    2018-04-01

    The streambed point velocity probe (SBPVP) measures in situ groundwater velocities at the groundwater-surface water interface without reliance on hydraulic conductivity, porosity, or hydraulic gradient information. The tool operates on the basis of a mini-tracer test that occurs on the probe surface. The SBPVP was used in a meander of the Grindsted Å (stream), Denmark, to determine the distribution of flow through the streambed. These data were used to calculate the contaminant mass discharge of chlorinated ethenes into the stream. SBPVP data were compared with velocities estimated from hydraulic head and temperature gradient data collected at similar scales. Spatial relationships of water flow through the streambed were found to be similar by all three methods, and indicated a heterogeneous pattern of groundwater-surface water exchange. The magnitudes of estimated flow varied to a greater degree. It was found that pollutants enter the stream in localized regions of high flow which do not always correspond to the locations of highest pollutant concentration. The results show the combined influence of flow and concentration on contaminant discharge and illustrate the advantages of adopting a flux-based approach to risk assessment at the groundwater-surface water interface. Chlorinated ethene mass discharges, expressed in PCE equivalents, were determined to be up to 444 kg/yr (with SBPVP data) which compared well with independent estimates of mass discharge up to 438 kg/yr (with mini-piezometer data from the streambed) and up to 372 kg/yr crossing a control plane on the streambank (as determined in a previous, independent study).

  3. Membranes with Surface-Enhanced Antifouling Properties for Water Purification

    Science.gov (United States)

    Shahkaramipour, Nima; Tran, Thien N.; Ramanan, Sankara; Lin, Haiqing

    2017-01-01

    Membrane technology has emerged as an attractive approach for water purification, while mitigation of fouling is key to lower membrane operating costs. This article reviews various materials with antifouling properties that can be coated or grafted onto the membrane surface to improve the antifouling properties of the membranes and thus, retain high water permeance. These materials can be separated into three categories, hydrophilic materials, such as poly(ethylene glycol), polydopamine and zwitterions, hydrophobic materials, such as fluoropolymers, and amphiphilic materials. The states of water in these materials and the mechanisms for the antifouling properties are discussed. The corresponding approaches to coat or graft these materials on the membrane surface are reviewed, and the materials with promising performance are highlighted. PMID:28273869

  4. Linking otolith microchemistry and surface water contamination from natural gas mining.

    Science.gov (United States)

    Keller, David H; Zelanko, Paula M; Gagnon, Joel E; Horwitz, Richard J; Galbraith, Heather S; Velinsky, David J

    2018-09-01

    Unconventional natural gas drilling and the use of hydraulic fracturing technology have expanded rapidly in North America. This expansion has raised concerns of surface water contamination by way of spills and leaks, which may be sporadic, small, and therefore difficult to detect. Here we explore the use of otolith microchemistry as a tool for monitoring surface water contamination from generated waters (GW) of unconventional natural gas drilling. We exposed Brook Trout in the laboratory to three volumetric concentrations of surrogate generated water (SGW) representing GW on day five of drilling. Transects across otolith cross-sections were analyzed for a suite of elements by LA-ICP-MS. Brook Trout exposed to a 0.01-1.0% concentration of SGW for 2, 15, and 30 days showed a significant (p waters and provide support for the use of this technique in natural habitats. To our knowledge, this is the first demonstration of how trace elements in fish otoliths may be used to monitor for surface water contamination from GW. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Surface-Water, Water-Quality, and Ground-Water Assessment of the Municipio of Mayaguez, Puerto Rico, 1999-2002

    Science.gov (United States)

    Rodríguez-Martínez, Jesús; Santiago-Rivera, Luis; Guzman-Rios, Senen; Gómez-Gómez, Fernando; Oliveras-Feliciano, Mario L.

    2004-01-01

    The surface-water assessment portion of this study focused on analysis of low-flow characteristics in local streams and rivers, because the supply of safe drinking water was a critical issue during recent dry periods. Low-flow characteristics were evaluated at one continuous-record gaging station based on graphical curve-fitting techniques and log-Pearson Type III frequency curves. Estimates of low-flow characteristics for 20 partial-record stations were generated using graphical-correlation techniques. Flow-duration characteristics for the continuous- and partial-record stations were estimated using the relation curves developed for the low-flow study. Stream low-flow statistics document the general hydrology under current land use, water-use, and climatic conditions. A survey of streams and rivers utilized 37 sampling stations to evaluate the sanitary quality of about 165 miles of stream channels. River and stream samples for fecal coliform and fecal streptococcus analyses were collected on two occasions at base-flow conditions. Bacteriological analyses indicate that a significant portion of the stream reaches within the municipio of Mayaguez may have fecal coliform bacteria concentrations above the water-quality goal (standard) established by the Puerto Rico Environmental Quality Board (Junta de Calidad Ambiental de Puerto Rico) for inland surface waters. Sources of fecal contamination may include: illegal discharge of sewage to storm-water drains, malfunctioning sanitary sewer ejectors, clogged and leaking sewage pipes, septic tank leakage, unfenced livestock, and runoff from livestock pens. Long-term fecal coliform data from five sampling stations located within or in the vicinity of the municipio of Mayaguez have been in compliance with the water-quality goal for fecal coliform concentration established in July 1990. Geologic, topographic, soil, hydrogeologic, and streamflow data were compiled into a database and used to divide the municipio of Mayaguez into

  6. Spatiotemporal dynamics of surface water networks across a global biodiversity hotspot—implications for conservation

    Science.gov (United States)

    Tulbure, Mirela G.; Kininmonth, Stuart; Broich, Mark

    2014-11-01

    The concept of habitat networks represents an important tool for landscape conservation and management at regional scales. Previous studies simulated degradation of temporally fixed networks but few quantified the change in network connectivity from disintegration of key features that undergo naturally occurring spatiotemporal dynamics. This is particularly of concern for aquatic systems, which typically show high natural spatiotemporal variability. Here we focused on the Swan Coastal Plain, a bioregion that encompasses a global biodiversity hotspot in Australia with over 1500 water bodies of high biodiversity. Using graph theory, we conducted a temporal analysis of water body connectivity over 13 years of variable climate. We derived large networks of surface water bodies using Landsat data (1999-2011). We generated an ensemble of 278 potential networks at three dispersal distances approximating the maximum dispersal distance of different water dependent organisms. We assessed network connectivity through several network topology metrics and quantified the resilience of the network topology during wet and dry phases. We identified ‘stepping stone’ water bodies across time and compared our networks with theoretical network models with known properties. Results showed a highly dynamic seasonal pattern of variability in network topology metrics. A decline in connectivity over the 13 years was noted with potential negative consequences for species with limited dispersal capacity. The networks described here resemble theoretical scale-free models, also known as ‘rich get richer’ algorithm. The ‘stepping stone’ water bodies are located in the area around the Peel-Harvey Estuary, a Ramsar listed site, and some are located in a national park. Our results describe a powerful approach that can be implemented when assessing the connectivity for a particular organism with known dispersal distance. The approach of identifying the surface water bodies that act as

  7. Water resources data, Iowa, water year 2001, Volume 2. surface water--Missouri River basin, and ground water

    Science.gov (United States)

    Nalley, G.M.; Gorman, J.G.; Goodrich, R.D.; Miller, V.E.; Turco, M.J.; Linhart, S.M.

    2002-01-01

    The Water Resources Division of the U.S. Geological Survey, in cooperation with State, county, municipal, and other Federal agencies, obtains a large amount of data pertaining to the water resources of Iowa each water year. These data, accumulated during many water years, constitute a valuable data base for developing an improved understanding of the water resources of the State. To make this data readily available to interested parties outside of the Geological Survey, the data is published annually in this report series entitled “Water Resources Data - Iowa” as part of the National Water Data System. Water resources data for water year 2001 for Iowa consists of records of stage, discharge, and water quality of streams; stage and contents of lakes and reservoirs; and water levels and water quality of ground water. This report, in two volumes, contains stage or discharge records for 132 gaging stations; stage records for 9 lakes and reservoirs; water-quality records for 4 gaging stations; sediment records for 13 gaging stations; and water levels for 163 ground-water observation wells. Also included are peak-flow data for 92 crest-stage partial-record stations, water-quality data from 86 municipal wells, and precipitation data collected at 6 gaging stations and 2 precipitation sites. Additional water data were collected at various sites not included in the systematic data-collection program, and are published here as miscellaneous measurements and analyses. These data represent that part of the National Water Data System operated by the U.S. Geological Survey and cooperating local, State, and Federal agencies in Iowa.Records of discharge or stage of streams, and contents or stage of lakes and reservoirs were first published in a series of U.S. Geological Survey water-supply papers entitled “Surface Water Supply of the United States.” Through September 30, 1960, these water-supply papers were published in an annual series; during 1961-65 and 1966-70, they

  8. High-Resolution Mapping of Urban Surface Water Using ZY-3 Multi-Spectral Imagery

    Directory of Open Access Journals (Sweden)

    Fangfang Yao

    2015-09-01

    Full Text Available Accurate information of urban surface water is important for assessing the role it plays in urban ecosystem services under the content of urbanization and climate change. However, high-resolution monitoring of urban water bodies using remote sensing remains a challenge because of the limitation of previous water indices and the dark building shadow effect. To address this problem, we proposed an automated urban water extraction method (UWEM which combines a new water index, together with a building shadow detection method. Firstly, we trained the parameters of UWEM using ZY-3 imagery of Qingdao, China. Then we verified the algorithm using five other sub-scenes (Aksu, Fuzhou, Hanyang, Huangpo and Huainan ZY-3 imagery. The performance was compared with that of the Normalized Difference Water Index (NDWI. Results indicated that UWEM performed significantly better at the sub-scenes with kappa coefficients improved by 7.87%, 32.35%, 12.64%, 29.72%, 14.29%, respectively, and total omission and commission error reduced by 61.53%, 65.74%, 83.51%, 82.44%, and 74.40%, respectively. Furthermore, UWEM has more stable performances than NDWI’s in a range of thresholds near zero. It reduces the over- and under-estimation issues which often accompany previous water indices when mapping urban surface water under complex environmental conditions.

  9. Methods on estimation of the evaporation from water surface

    International Nuclear Information System (INIS)

    Trajanovska, Lidija; Tanushevska, Dushanka; Aleksovska, Nina

    2001-01-01

    The whole world water supply on the Earth is in close dependence on hydrological cycle connected with water circulation at Earth-Atmosphere route through evaporation, precipitation and water runoff. Evaporation exists worldwide where the atmosphere is unsatiated of water steam (when there is humidity in short supply) and it depends on climatic conditions in some regions. The purpose of this paper is to determine a method for estimation of evaporation of natural water surface in our areas, that means its determination as exact as possible. (Original)

  10. Evaluation of Surface Water Harvesting Potential in Aq Emam Watershed System in the Golestan Province

    Directory of Open Access Journals (Sweden)

    s. nazaryan

    2016-02-01

    Full Text Available Introduction : Given its low and sparse precipitation both in spatial and temporal scales, Iran is nestled in an arid and semiarid part of the world. On the other hand, because of population growth, urbanization and the development of agriculture and industry sector is frequently encountered with increasing water demand. The increasing trend of water demand will widen the gap between water supply and demand in the future. This, in turn, necessitates urgent attention to the fundamentals of economic planning and allocation of water resources. Considering the limited resources and the declining water table and salinization of groundwater, especially in semi-arid areas forces us to exploit surface waters. When we evaluate the various methods of collecting rainwater, surface water that is the outcome of rainfall-runoff responses in a basin, is found to be a potential source of water and it can be useful to meet some of our water demand if managed properly. Water shortages in arid areas are critical, serious and persistent. Thus, water harvesting is an effective and economic goal. The most important step in the implementation of rain water harvesting systems is proper site selection that could cause significant savings in time and cost. In this study the potential of surface waters in the Aq Emam catchment in the east Golestan province was evaluated. The purpose of this study is to provide a framework for locating areas with water harvesting potential. Materials and Methods: For spatial evaluation of potential runoff, first, the amount of runoff is calculated using curve number and runoff potential maps were prepared with three classes: namely, the potential for low, medium and high levels. Finally, to identify suitable areas for rain water harvesting, rainfall maps, soil texture, slope and land use were weighted and multiplied based on their importance in order to determine the appropriate areas to collect runoff Results and Discussion : The results

  11. Enhanced osteoblast responses to poly ether ether ketone surface modified by water plasma immersion ion implantation.

    Science.gov (United States)

    Wang, Heying; Lu, Tao; Meng, Fanhao; Zhu, Hongqin; Liu, Xuanyong

    2014-05-01

    Poly ether ether ketone (PEEK) offers a set of characteristics superior for human implants; however, its application is limited by the bio-inert surface property. In this work, PEEK surface was modified using single step plasma immersion ion implantation (PIII) treatment with a gas mixture of water vapor as a plasma resource and argon as an ionization assistant. Field emission scanning electron microscopy, atomic force microscopy and X-ray photoelectron spectroscopy were used to investigate the microstructure and composition of the modified PEEK surface. The water contact angle and zeta-potential of the surfaces were also measured. Osteoblast precursor cells MC3T3-E1 and rat bone mesenchymal stem cells were cultured on the PEEK samples to evaluate their cytocompatibility. The obtained results show that the hydroxyl groups as well as a "ravined structure" are constructed on water PIII modified PEEK. Compared with pristine PEEK, the water PIII treated PEEK is more favorable for osteoblast adhesion, spreading and proliferation, besides, early osteogenic differentiation indicated by the alkaline phosphatase activity is also up-regulated. Our study illustrates enhanced osteoblast responses to the PEEK surface modified by water PIII, which gives positive information in terms of future biomedical applications. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Inference of Stream Network Fragmentation Patterns from Ground Water - Surface Water Interactions on the High Plains Aquifer

    Science.gov (United States)

    Chandler, D. G.; Yang, X.; Steward, D. R.; Gido, K.

    2007-12-01

    Stream networks in the Great Plains integrate fluxes from precipitation as surface runoff in discrete events and groundwater as base flow. Changes in land cover and agronomic practices and development of ground water resources to support irrigated agriculture have resulted in profound changes in the occurrence and magnitude of stream flows, especially near the Ogallala aquifer, where precipitation is low. These changes have demonstrably altered the aquatic habitat of western Kansas, with documented changes in fish populations, riparian communities and groundwater quality due to stream transmission losses. Forecasting future changes in aquatic and riparian ecology and groundwater quality requires a large scale spatially explicit model of groundwater- surface water interaction. In this study, we combine historical data on land use, stream flow, production well development and groundwater level observations with groundwater elevation modeling to support a geospatial framework for assessing changes in refugia for aquatic species in four rivers in western Kansas between 1965 and 2005. Decreased frequency and duration of streamflow occurred in all rivers, but the extent of change depended on the geomorphology of the river basin and the extent of groundwater development. In the absence of streamflow, refugia for aquatic species were defined as the stream reaches below the phreatic surface of the regional aquifer. Changes in extent, location and degree of fragmentation of gaining reaches was found to be a strong predictor of surface water occurrence during drought and a robust hydrological template for the analysis of changes in recharge to alluvial and regional aquifers and riparian and aquatic habitat.

  13. Sensors and OBIA synergy for operational monitoring of surface water

    Science.gov (United States)

    Masson, Eric; Thenard, Lucas

    2010-05-01

    This contribution will focus on combining Object Based Image Analysis (i.e. OBIA with e-Cognition 8) and recent sensors (i.e. Spot 5 XS, Pan and ALOS Prism, Avnir2, Palsar) to address the technical feasibility for an operational monitoring of surface water. Three cases of river meandering (India), flood mapping (Nepal) and dam's seasonal water level monitoring (Morocco) using recent sensors will present various application of surface water monitoring. The operational aspect will be demonstrated either by sensor properties (i.e. spatial resolution and bandwidth), data acquisition properties (i.e. multi sensor, return period and near real-time acquisition) but also with OBIA algorithms (i.e. fusion of multi sensors / multi resolution data and batch processes). In the first case of river meandering (India) we will address multi sensor and multi date satellite acquisition to monitor the river bed mobility within a floodplain using an ALOS dataset. It will demonstrate the possibility of an operational monitoring system that helps the geomorphologist in the analysis of fluvial dynamic and sediment budget for high energy rivers. In the second case of flood mapping (Nepal) we will address near real time Palsar data acquisition at high spatial resolution to monitor and to map a flood extension. This ALOS sensor takes benefit both from SAR and L band properties (i.e. atmospheric transparency, day/night acquisition, low sensibility to surface wind). It's a real achievement compared to optical imagery or even other high resolution SAR properties (i.e. acquisition swath, bandwidth and data price). These advantages meet the operational needs set by crisis management of hydrological disasters but also for the implementation of flood risk management plans. The last case of dam surface water monitoring (Morocco) will address an important issue of water resource management in countries affected by water scarcity. In such countries water users have to cope with over exploitation

  14. Modeling Groundwater-Surface Water Interaction and Contaminant Transport of Chlorinated Solvent Contaminated Site

    Science.gov (United States)

    Yimer Ebrahim, Girma; Jonoski, Andreja; van Griensven, Ann; Dujardin, Juliette; Baetelaan, Okke; Bronders, Jan

    2010-05-01

    Chlorinated-solvent form one of the largest groups of environmental chemicals. Their use and misuse in industry have lead to a large entry of these chemicals into the environment, resulting in widespread dissemination and oftentimes environmental contamination. Chlorinated solvent contamination of groundwater resources has been widely reported. For instance, there has been much interest in the assessment of these contaminant levels and their evolutions with time in the groundwater body below the Vilvoorde-Machelen industrial area (Belgium). The long industrial history of the area has lead to complex patterns of pollution from multiple sources and the site has been polluted to the extent that individual plumes are not definable any more. Understanding of groundwater/surface water interaction is a critical component for determining the fate of contaminant both in streams and ground water due to the fact that groundwater and surface water are in continuous dynamic interaction in the hydrologic cycle. The interaction has practical consequences in the quantity and quality of water in either system in the sense that depletion and/or contamination of one of the system will eventually affect the other one. The transition zone between a stream and its adjacent aquifer referred to as the hyporheic zone plays a critical role in governing contaminant exchange and transformation during water exchange between the two water bodies. The hyporheic zone of Zenne River ( the main receptor ) is further complicated due to the fact that the river banks are artificially trained with sheet piles along its reach extending some 12 m below the surface. This study demonstrates the use of MODFLOW, a widely used modular three-dimensional block-centred finite difference, saturated flow model for simulating the flow and direction of movement of groundwater through aquifer and stream-aquifer interaction and the use of transport model RT3D, a three-dimensional multi-species reactive transport model

  15. Structural and dynamical properties of water confined between two hydrophilic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)

    2009-10-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  16. Structural and dynamical properties of water confined between two hydrophilic surfaces

    International Nuclear Information System (INIS)

    Di Napoli, Solange; Gamba, Zulema

    2009-01-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  17. Descriptive Characteristics of Surface Water Quality in Hong Kong by a Self-Organising Map.

    Science.gov (United States)

    An, Yan; Zou, Zhihong; Li, Ranran

    2016-01-08

    In this study, principal component analysis (PCA) and a self-organising map (SOM) were used to analyse a complex dataset obtained from the river water monitoring stations in the Tolo Harbor and Channel Water Control Zone (Hong Kong), covering the period of 2009-2011. PCA was initially applied to identify the principal components (PCs) among the nonlinear and complex surface water quality parameters. SOM followed PCA, and was implemented to analyze the complex relationships and behaviors of the parameters. The results reveal that PCA reduced the multidimensional parameters to four significant PCs which are combinations of the original ones. The positive and inverse relationships of the parameters were shown explicitly by pattern analysis in the component planes. It was found that PCA and SOM are efficient tools to capture and analyze the behavior of multivariable, complex, and nonlinear related surface water quality data.

  18. The hydrochemistry of glacial Ebba River (Petunia Bay, Central Spitsbergen): Groundwater influence on surface water chemistry

    Science.gov (United States)

    Dragon, Krzysztof; Marciniak, Marek; Szpikowski, Józef; Szpikowska, Grażyna; Wawrzyniak, Tomasz

    2015-10-01

    The article presents the investigation of surface water chemistry changes of the glacial Ebba River (Central Spitsbergen) during three melting seasons of 2008, 2009 and 2010. The twice daily water chemistry analyses allow recognition of the surface water chemistry differentiation. The surface water chemistry changes are related to the river discharge and changes in the influence of different water balance components during each melting season. One of the most important process that influence river water component concentration increase is groundwater inflow from active layer occurring on the valley area. The significance of this process is the most important at the end of the melting season when temperatures below 0 °C occur on glaciers (resulting in a slowdown of melting of ice and snow and a smaller recharge of the river by the water from the glaciers) while the flow of groundwater is still active, causing a relatively higher contribution of groundwater to the total river discharge. The findings presented in this paper show that groundwater contribution to the total polar river water balance is more important than previously thought and its recognition allow a better understanding of the hydrological processes occurring in a polar environment.

  19. Water levels and groundwater and surface-water exchanges in lakes of the northeast Twin Cities Metropolitan Area, Minnesota, 2002 through 2015

    Science.gov (United States)

    Jones, Perry M.; Trost, Jared J.; Erickson, Melinda L.

    2016-10-19

    OverviewThis study assessed lake-water levels and regional and local groundwater and surface-water exchanges near northeast Twin Cities Metropolitan Area lakes applying three approaches: statistical analysis, field study, and groundwater-flow modeling.  Statistical analyses of lake levels were completed to assess the effect of physical setting and climate on lake-level fluctuations of selected lakes. A field study of groundwater and surface-water interactions in selected lakes was completed to (1) estimate potential percentages of surface-water contributions to well water across the northeast Twin Cities Metropolitan Area, (2) estimate general ages for waters extracted from the wells, and (3) assess groundwater inflow to lakes and lake-water outflow to aquifers downgradient from White Bear Lake.  Groundwater flow was simulated using a steady-state, groundwater-flow model to assess regional groundwater and surface-water exchanges and the effects of groundwater withdrawals, climate, and other factors on water levels of northeast Twin Cities Metropolitan Area lakes.

  20. Effect of long-term application of biosolids for land reclamation on surface water chemistry.

    Science.gov (United States)

    Tian, G; Granato, T C; Pietz, R I; Carlson, C R; Abedin, Z

    2006-01-01

    surface water. Application of biosolids did not increase the concentrations of Cd and Hg in surface water. The elevation of Cu in surface water with biosolids application only occurred in some years of the first decade, when land-applied sludges contained high concentrations of trace metals, including Cu. In fact, following the promulgation of 40 CFR Part 503, the concentrations of all three metals fell below the method detection level (MDL) in surface water for nearly all samplings. Nitrate in the surface water tends to be higher in spring, and ammonium, total P, and total Hg in summer and fall. Mean nitrate, ammonium, and total phosphorus concentrations were found to be greater in creeks than reservoirs. The results indicate that application of biosolids for land reclamation at high loading rates from 1972 to 2002, with adequate runoff and soil erosion control, had only a minor impact on surface water quality.

  1. Surface-water investigations at Barrow, Alaska

    Science.gov (United States)

    Jones, Stanley H.

    1972-01-01

    The U.S. Public Health Service is currently developing plans for a long-term water supply and sewage treatment system for the village of Barrow, Alaska. To assist in planning, the U.S. Geological Survey was requested to initiate a cooperative streamflow data-collection program with the U.S. Public Health Service in June 1972 to determine the availability of surface water and the areal distribution of runoff in the Barrow area. This basic-data report summarizes the streamflow data collected from June 1 through July 10, 1972, at three gaging stations in the Barrow area (fig. 1) and discusses the future data-collection program.

  2. Radiation-heterogeneous processes on the surface of stainless steel in contact with water

    International Nuclear Information System (INIS)

    Garibov, A.; Agayev, T.N.; Velibekova, G.Z.; Ismayilov, Sh.S.; Aliyev, A.G.

    2003-01-01

    Full text: Stainless steels are one of prevailing materials of nuclear power engineering. Under operating conditions in real systems they are exposed to influence of ionizing radiation in contact with various environments. Therefore in the processes of corrosion and destruction of stainless steels special significance takes on surface processes and subsequent heterogeneous processes with their participation. In this report the results of research of nuclear-heterogeneous processes regularities in contact with stainless steel of nuclear reactors with water under influence of γ-quanta in the temperature range 300-573 K are given. Radiolytic processes in water are investigated comprehensively and therefore it was taken as modelling system for titration of surface defects and secondary electrons, emitted from metal. It was determined, that radiation processes in stainless steel give rise to the increasing of energy output of molecular hydrogen at water radiolysis from 0.45 molecule/100 eV at pure water radiolysis at 296 K up to 3.4 molecule/100 eV at the presence of stainless steel at 300 K. With increase of temperature the output of molecular hydrogen increases up to 8.2 molecule/100 eV at 573 K. Processes of lattice damage in samples of stainless steel under influence of γ-rays were investigated by electrophysical method. Influence of γ-radiation on stainless steel in contact with water at temperatures T ≤ 423 K and initial values of radiation dose D ≤ 200 kGy given rise to the reduction of electrical resistivity of samples. At doses D≥200 kGy electrical resistivity is increased. Increase of temperature from 333 K up to 423 K lead to the reduction of dose value, at which the transition to resistance increase, from 200 kGy up to 100 kGy occurs. At T≥523 K insoluble oxide phase is formed on a surface of metal which give rise to the increase of electrical resistivity of stainless steel samples. Surface oxide film formed in contact of stainless steel + H 2 O

  3. Hydrophobic Surfaces: Topography Effects on Wetting by Supercooled Water and Freezing Delay

    DEFF Research Database (Denmark)

    Heydari, Golrokh; Thormann, Esben; Järn, Mikael

    2013-01-01

    Hydrophobicity, and in particular superhydrophobicity, has been extensively considered to promote ice-phobicity. Dynamic contact angle measurements above 0 °C have been widely used to evaluate the water repellency. However, it is the wetting properties of supercooled water at subzero temperatures...... and the derived work of adhesion that are important for applications dealing with icing. In this work we address this issue by determining the temperature-dependent dynamic contact angle of microliter-sized water droplets on a smooth hydrophobic and a superhydrophobic surface with similar surface chemistry....... The data highlight how the work of adhesion of water in the temperature interval from about 25 °C to below −10 °C is affected by surface topography. A marked decrease in contact angle on the superhydrophobic surface is observed with decreasing temperature, and we attribute this to condensation below...

  4. The adsorption and dissociation of water molecule on goethite (010) surface: A DFT approach

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Long, E-mail: shuweixia@ouc.edu.cn [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Xiu, Fangyuan [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Qiu, Meng [Qingdao Institute of Bioenergy and Bioprocess Technology (China); Xia, Shuwei; Yu, Liangmin [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China)

    2017-01-15

    Graphical abstract: The optimized structure of hydrated goethite (010) surface with medium water coverage (water density about 6.7 H{sub 2}O/nm{sup 2}). - Highlights: • Stable adsorption and dissociation structure of H{sub 2}O on goethite (010) surface was investigated by DFT. • Reasonable path for water dissociation was proposed by transitional state analysis. • The mechanism of water adsorption on goethite and binding nature were revealed by PDOS. - Abstract: Using density functional theory (DFT) calculation, we investigate the configuration, stability and electronic properties of fresh cleaved (010) goethite surface (Pnma) and this surface exposed to water monolayer at low, medium and high coverage. Water is predicted to be chemisorbed to the surface, together with the surface reconstruction. The interaction energy of the most stable configuration of both low and medium coverage per water molecule is almost the same (−1.17 eV), while that of high coverage is much lower (less than 1.03 eV). It indicates that highly hydrated surface is less stable. PDOS analysis reveals the adsorption of H{sub 2}O is due to the formation of Fe−O bond, caused by overlapping of Fe's 3d and O's 2p orbitals. Dissociation processes at low and medium water coverage are non-spontaneous; while at high coverage, it can undertake spontaneously both thermodynamically and dynamically. The dissociation paths of all three water coverage are the similar. The proton from one adsorbed water is likely to dissociate to bind to the vicinal surface μ{sub 3}−O as an intermediate product; the proton belonged to μ{sub 3}−O transferred to the neighbor surface μ{sub 2}−O as the dissociative configuration.

  5. Natural Sunlight Shapes Crude Oil-Degrading Bacterial Communities in Northern Gulf of Mexico Surface Waters.

    Science.gov (United States)

    Bacosa, Hernando P; Liu, Zhanfei; Erdner, Deana L

    2015-01-01

    Following the Deepwater Horizon (DWH) spill in 2010, an enormous amount of oil was observed in the deep and surface waters of the northern Gulf of Mexico. Surface waters are characterized by intense sunlight and high temperature during summer. While the oil-degrading bacterial communities in the deep-sea plume have been widely investigated, the effect of natural sunlight on those in oil polluted surface waters remains unexplored to date. In this study, we incubated surface water from the DWH site with amendments of crude oil, Corexit dispersant, or both for 36 days under natural sunlight in the northern Gulf of Mexico. The bacterial community was analyzed over time for total abundance, density of alkane and polycyclic aromatic hydrocarbon degraders, and community composition via pyrosequencing. Our results showed that, for treatments with oil and/or Corexit, sunlight significantly reduced bacterial diversity and evenness and was a key driver of shifts in bacterial community structure. In samples containing oil or dispersant, sunlight greatly reduced abundance of the Cyanobacterium Synechococcus but increased the relative abundances of Alteromonas, Marinobacter, Labrenzia, Sandarakinotalea, Bartonella, and Halomonas. Dark samples with oil were represented by members of Thalassobius, Winogradskyella, Alcanivorax, Formosa, Pseudomonas, Eubacterium, Erythrobacter, Natronocella, and Coxiella. Both oil and Corexit inhibited the Candidatus Pelagibacter with or without sunlight exposure. For the first time, we demonstrated the effects of light in structuring microbial communities in water with oil and/or Corexit. Overall, our findings improve understanding of oil pollution in surface water, and provide unequivocal evidence that sunlight is a key factor in determining bacterial community composition and dynamics in oil polluted marine waters.

  6. High volume hydraulic fracturing operations: potential impacts on surface water and human health.

    Science.gov (United States)

    Mrdjen, Igor; Lee, Jiyoung

    2016-08-01

    High volume, hydraulic fracturing (HVHF) processes, used to extract natural gas and oil from underground shale deposits, pose many potential hazards to the environment and human health. HVHF can negatively affect the environment by contaminating soil, water, and air matrices with potential pollutants. Due to the relatively novel nature of the process, hazards to surface waters and human health are not well known. The purpose of this article is to link the impacts of HVHF operations on surface water integrity, with human health consequences. Surface water contamination risks include: increased structural failure rates of unconventional wells, issues with wastewater treatment, and accidental discharge of contaminated fluids. Human health risks associated with exposure to surface water contaminated with HVHF chemicals include increased cancer risk and turbidity of water, leading to increased pathogen survival time. Future research should focus on modeling contamination spread throughout the environment, and minimizing occupational exposure to harmful chemicals.

  7. Monitoring groundwater-surface water interaction using time-series and time-frequency analysis of transient three-dimensional electrical resistivity changes

    Science.gov (United States)

    Johnson, Timothy C.; Slater, Lee D.; Ntarlagiannis, Dimitris; Day-Lewis, Frederick D.; Elwaseif, Mehrez

    2012-01-01

    Time-lapse resistivity imaging is increasingly used to monitor hydrologic processes. Compared to conventional hydrologic measurements, surface time-lapse resistivity provides superior spatial coverage in two or three dimensions, potentially high-resolution information in time, and information in the absence of wells. However, interpretation of time-lapse electrical tomograms is complicated by the ever-increasing size and complexity of long-term, three-dimensional (3-D) time series conductivity data sets. Here we use 3-D surface time-lapse electrical imaging to monitor subsurface electrical conductivity variations associated with stage-driven groundwater-surface water interactions along a stretch of the Columbia River adjacent to the Hanford 300 near Richland, Washington, USA. We reduce the resulting 3-D conductivity time series using both time-series and time-frequency analyses to isolate a paleochannel causing enhanced groundwater-surface water interactions. Correlation analysis on the time-lapse imaging results concisely represents enhanced groundwater-surface water interactions within the paleochannel, and provides information concerning groundwater flow velocities. Time-frequency analysis using the Stockwell (S) transform provides additional information by identifying the stage periodicities driving groundwater-surface water interactions due to upstream dam operations, and identifying segments in time-frequency space when these interactions are most active. These results provide new insight into the distribution and timing of river water intrusion into the Hanford 300 Area, which has a governing influence on the behavior of a uranium plume left over from historical nuclear fuel processing operations.

  8. Effect of Traditional Gold Mining to Surface Water Quality in Murung Raya District, Central Kalimantan Province

    OpenAIRE

    Wilopo, W; Resili, R; Putra, D P E

    2013-01-01

    There are many locations for traditional gold mining in Indonesia. One of these is in Murung Raya District, Central Kalimantan Province. Mining activities involving the application of traditional gold processing technology have a high potential to pollute the environment, especially surface water. Therefore, this study aims to determine the impact of gold mining and processing on surface water quality around the mine site. Based on the results of field surveys and laboratory analysis, our dat...

  9. First principles study of dissolved oxygen water adsorption on Fe (001 surfaces

    Directory of Open Access Journals (Sweden)

    Dong ZHANG

    2018-02-01

    Full Text Available In order to study the mechanism of dissolved oxygen content on the surface corrosion behavior of Fe-based heat transfer, the first principle is used to study the adsorption of O2 monomolecular, H2O monolayer and dissolved oxygen system on Fe-based heat transfer surface. The GGA/PBE approximation is used to calculate the adsorption energy, state density and population change during the adsorption process. Calculations prove that when the dissolved oxygen is adsorbed on the Fe-based surface, the water molecule tends to adsorb at the top sites, and the oxygen molecule tends to adsorb at Griffiths. When the H2O molecule adsorbs and interacts on the Fe (001 surface, the charge distribution of the interfacial double electric layer changes to cause the Fe atoms to lose electrons, resulting in the change of the surface potential. When the O2 molecule adsorbs on the Fe (001 crystal surfaces, the electrons on the Fe (001 surface are lost and the surface potential increases. O2 molecule and the surface of the Fe atoms are prone to electron transfer, in which O atom's 2p orbit for the adsorption of O2 molecule on Fe (001 crystal surface play a major role. With the increase of the proportion of O2 molecule in the dissolved oxygen water, the absolute value of the adsorption energy increases, and the interaction of the Fe-based heat transfer surface is stronger. This study explores the influence law of different dissolved oxygen on the Fe base heat exchange surface corrosion, and the base metal corrosion mechanism for experimental study provides a theoretical reference.

  10. Adsorption of egg phosphatidylcholine to an air/water and triolein/water bubble interface: use of the 2-dimensional phase rule to estimate the surface composition of a phospholipid/triolein/water surface as a function of surface pressure.

    Science.gov (United States)

    Mitsche, Matthew A; Wang, Libo; Small, Donald M

    2010-03-11

    Phospholipid monolayers play a critical role in the structure and stabilization of biological interfaces, including all membranes, the alveoli of the lungs, fat droplets in adipose tissue, and lipoproteins. The behavior of phospholipids in bilayers and at an air-water interface is well understood. However, the study of phospholipids at oil-water interfaces is limited due to technical challenges. In this study, egg phosphatidylcholine (EPC) was deposited from small unilamellar vesicles onto a bubble of either air or triolein (TO) formed in a low-salt buffer. The surface tension (gamma) was measured using a drop tensiometer. We observed that EPC binds irreversibly to both interfaces and at equilibrium exerts approximately 12 and 15 mN/m of pressure (Pi) at an air and TO interface, respectively. After EPC was bound to the interface, the unbound EPC was washed out of the cuvette, and the surface was compressed to study the Pi/area relationship. To determine the surface concentration (Gamma), which cannot be measured directly, compression isotherms from a Langmuir trough and drop tensiometer were compared. The air-water interfaces had identical characteristics using both techniques; thus, Gamma on the bubble can be determined by overlaying the two isotherms. Both TO and EPC are surface-active, so in a mixed TO/EPC monolayer, both molecules will be exposed to water. Since TO is less surface-active than EPC, as Pi increases, the TO is progressively ejected. To understand the Pi/area isotherm of EPC on a TO bubble, a variety of TO-EPC mixtures were spread at the air-water interface. The isotherms show an abrupt break in the curve caused by the ejection of TO from the monolayer into a new bulk phase. By overlaying the compression isotherm above the ejection point with a TO bubble compression isotherm, Gamma can be estimated. This allows determination of Gamma of EPC on a TO bubble as a function of Pi.

  11. The effect of plutonium dioxide water surface coverage on the generation of hydrogen and oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Veirs, Douglas K. [Los Alamos National Laboratory; Berg, John M. [Los Alamos National Laboratory; Crowder, Mark L. [Savannah River National Laboratory

    2012-06-20

    The conditions for the production of oxygen during radiolysis of water adsorbed onto plutonium dioxide powder are discussed. Studies in the literature investigating the radiolysis of water show that both oxygen and hydrogen can be generated from water adsorbed on high-purity plutonium dioxide powder. These studies indicate that there is a threshold in the amount of water below which oxygen is not generated. The threshold is associated with the number of monolayers of adsorbed water and is shown to occur at approximately two monolayers of molecularly adsorbed water. Material in equilibrium with 50% relative humidity (RH) will be at the threshold for oxygen generation. Using two monolayers of molecularly adsorbed water as the threshold for oxygen production, the total pressure under various conditions is calculated assuming stoichiometric production of hydrogen and oxygen. The specific surface area of the oxide has a strong effect on the final partial pressure. The specific surface areas resulting in the highest pressures within a 3013 container are evaluated. The potential for oxygen generation is mitigated by reduced relative humidity, and hence moisture adsorption, at the oxide surface which occurs if the oxide is warmer than the ambient air. The potential for oxygen generation approaches zero as the temperature difference between the ambient air and the material approaches 6 C.

  12. Surface water pollution and water quality studies at Prestea Goldfields Limited (P. G. L.) Prestea, Ghana

    International Nuclear Information System (INIS)

    Ampong, Charles Horace

    1993-11-01

    Prestea is a mining community developed around Prestea Goldfields Limited, which is engaged in mining Sulphide gold ores known to give rise to several environmental problems like air pollution in the form of emissions of arsenic or arsenous oxides, with concurrent production of large amounts of Sulphur dioxide. As a result of extensive mining since 1929 using underground methods, involving about 18 million tons of ore, an estimated 3.5 - 4 million tons of tailings have been left on the surface in the vicinity of both current and historic treatment sites. Since the mine is located in an area of heavy rainfall, incessant rain will flush contaminants from tailings dumps and waste sites into the downstream environment and subsequently into surface waters. Water supply for the population in the area is derived from rivers and streams flowing in the area, supplemented by boreholes and spring water. Not much is known with respect to pollution levels along the rivers and streams which serve as water for domestic uses by settlers along these river banks and around. It therefore became necessary to carry out studies to ascertain the pollution levels of various water resources and to make some suggestions to guide pollution of these waters and uses of them as well. Water sampling was carried out in the rivers and streams. A spring water and well water were also sampled as reference data to ascertain background levels of pollutants. The work highlights activities of the mine and that of the surrounding inhabitants which are likely to result in the pollution of surface waters. It also discusses results of water samples within the area, Sample analysis included determination of parameters like pH, Temperature, Conductivity, Alkalinity, Total Dissolved Solids (TDS), Total Suspended Solids (TSS), Total Solids (TS), Total hardness, Cyanide and Sulphate concentrations among others. Concentrations of some heavy metals were also determined. Based on standards prevailing in the country

  13. Surface modification of cellulose acetate membrane using thermal annealing to enhance produced water treatment

    Energy Technology Data Exchange (ETDEWEB)

    Kusworo, T. D., E-mail: tdkusworo@che.undip.ac.id; Aryanti, N., E-mail: nita.aryanti@gmail.com; Firdaus, M. M. H.; Sukmawati, H. [Chemical Engineering, Faculty of Engineering, Diponegoro University Prof. Soedarto Street, Tembalang, Semarang, 50239, Phone/Fax : (024)7460058 (Indonesia)

    2015-12-29

    This study is performed primarily to investigate the effect of surface modification of cellulose acetate using thermal annealing on the enhancement of membrane performance for produced water treatment. In this study, Cellulose Acetate membranes were casted using dry/wet phase inversion technique. The effect of additive and post-treatment using thermal annealing on the membrane surface were examined for produced water treatment. Therma annealing was subjected to membrane surface at 60 and 70 °C for 5, 10 and 15 second, respectively. Membrane characterizations were done using membrane flux and rejection with produced water as a feed, Scanning Electron Microscopy (SEM) and Fourier Transform Infra Red (FTIR) analysis. Experimental results showed that asymmetric cellulose acetate membrane can be made by dry/wet phase inversion technique. The results from the Scanning Electron Microscopy (FESEM) analysis was also confirmed that polyethylene glycol as additivie in dope solution and thermal annealing was affected the morphology and membrane performance for produced water treatment, respectively. Scanning electron microscopy micrographs showed that the selective layer and the substructure of membrane became denser and more compact after the thermal annealing processes. Therefore, membrane rejection was significantly increased while the flux was slighty decreased, respectively. The best membrane performance is obtained on the composition of 18 wt % cellulose acetate, poly ethylene glycol 5 wt% with thermal annealing at 70° C for 15 second.

  14. Surface modification of cellulose acetate membrane using thermal annealing to enhance produced water treatment

    International Nuclear Information System (INIS)

    Kusworo, T. D.; Aryanti, N.; Firdaus, M. M. H.; Sukmawati, H.

    2015-01-01

    This study is performed primarily to investigate the effect of surface modification of cellulose acetate using thermal annealing on the enhancement of membrane performance for produced water treatment. In this study, Cellulose Acetate membranes were casted using dry/wet phase inversion technique. The effect of additive and post-treatment using thermal annealing on the membrane surface were examined for produced water treatment. Therma annealing was subjected to membrane surface at 60 and 70 °C for 5, 10 and 15 second, respectively. Membrane characterizations were done using membrane flux and rejection with produced water as a feed, Scanning Electron Microscopy (SEM) and Fourier Transform Infra Red (FTIR) analysis. Experimental results showed that asymmetric cellulose acetate membrane can be made by dry/wet phase inversion technique. The results from the Scanning Electron Microscopy (FESEM) analysis was also confirmed that polyethylene glycol as additivie in dope solution and thermal annealing was affected the morphology and membrane performance for produced water treatment, respectively. Scanning electron microscopy micrographs showed that the selective layer and the substructure of membrane became denser and more compact after the thermal annealing processes. Therefore, membrane rejection was significantly increased while the flux was slighty decreased, respectively. The best membrane performance is obtained on the composition of 18 wt % cellulose acetate, poly ethylene glycol 5 wt% with thermal annealing at 70° C for 15 second

  15. Macro-invertebrate decline in surface water polluted with imidacloprid

    NARCIS (Netherlands)

    van Dijk, T.; van Staalduinen, M.A.; van der Sluijs, J.P.|info:eu-repo/dai/nl/073427489

    Imidacloprid is one of the most widely used insecticides in the world. Its concentration in surface water exceeds the water quality norms in many parts of the Netherlands. Several studies have demonstrated harmful effects of this neonicotinoid to a wide range of non-target species. Therefore we

  16. Analysis of captopril in surface waters by differential pulse voltammetry method

    International Nuclear Information System (INIS)

    Baranowska, I.; Markowski, P.; Wilk, K.

    2009-01-01

    One of the important problems concerning waters ecosystems is the presence of pharmaceuticals remains in different kinds of surface waters. These compounds cause huge changes in waters environment. They cause genetic changes in water organisms, are not also neutral for people in case of penetrating into drinking water. (Author)

  17. Experimental and numerical modelling of surface water-groundwater flow and pollution interactions under tidal forcing

    Science.gov (United States)

    Spanoudaki, Katerina; Bockelmann-Evans, Bettina; Schaefer, Florian; Kampanis, Nikolaos; Nanou-Giannarou, Aikaterini; Stamou, Anastasios; Falconer, Roger

    2015-04-01

    continuous tide on the coastal side. The integrated surface water-groundwater numerical model IRENE (Spanoudaki et al., 2009, Spanoudaki, 2010) was also used in the study, with the numerical model predictions being compared with experimental results, which provide a valuable database for model calibration and validation. IRENE couples the 3D, non-steady state Navier-Stokes equations, after Reynolds averaging and with the assumption of hydrostatic pressure distribution, to the equations describing 3D saturated groundwater flow of constant density. The model uses the finite volume method with a cell-centered structured grid providing thus flexibility and accuracy in simulating irregular boundary geometries. A semi-implicit finite difference scheme is used to solve the surface water flow equations, while a fully implicit finite difference scheme is used for the groundwater equations. Pollution interactions are simulated by coupling the advection-diffusion equation describing the fate and transport of contaminants introduced in a 3D turbulent flow field to the partial differential equation describing the fate and transport of contaminants in 3D transient groundwater flow systems. References Ebrahimi, K., Falconer, R.A. and Lin B. (2007). Flow and solute fluxes in integrated wetland and coastal systems. Environmental Modelling and Software, 22 (9), 1337-1348. Hughes, S.A. (1995). Physical Modelling and Laboratory Techniques in Coastal Engineering. World Scientific Publishing Co. Pte. Ltd., Singapore. Kuan, W.K., Jin, G., Xin, P., Robinson, C. Gibbes, B. and Li. L. (2012). Tidal influence on seawater intrusion in unconfined coastal aquifers. Water Resources Research, 48 (2), doi:10.1029/2011WR010678. Spanoudaki, K., Stamou, A.I. and Nanou-Giannarou, A. (2009). Development and verification of a 3-D integrated surface water-groundwater model. Journal of Hydrology, 375 (3-4), 410-427. Spanoudaki, K. (2010). Integrated numerical modelling of surface water groundwater systems (in Greek

  18. Shift in the microbial community composition of surface water and sediment along an urban river.

    Science.gov (United States)

    Wang, Lan; Zhang, Jing; Li, Huilin; Yang, Hong; Peng, Chao; Peng, Zhengsong; Lu, Lu

    2018-06-15

    Urban rivers represent a unique ecosystem in which pollution occurs regularly, leading to significantly altered of chemical and biological characteristics of the surface water and sediments. However, the impact of urbanization on the diversity and structure of the river microbial community has not been well documented. As a major tributary of the Yangtze River, the Jialing River flows through many cities. Here, a comprehensive analysis of the spatial microbial distribution in the surface water and sediments in the Nanchong section of Jialing River and its two urban branches was conducted using 16S rRNA gene-based Illumina MiSeq sequencing. The results revealed distinct differences in surface water bacterial composition along the river with a differential distribution of Proteobacteria, Cyanobacteria, Actinobacteria, Bacteroidetes and Acidobacteria (P urban water. PICRUSt metabolic inference analysis revealed a growing number of genes associated with xenobiotic metabolism and nitrogen metabolism in the urban water, indicating that urban discharges might act as the dominant selective force to alter the microbial communities. Redundancy analysis suggested that the microbial community structure was influenced by several environmental factors. TP (P urban river. These results highlight that river microbial communities exhibit spatial variation in urban areas due to the joint influence of chemical variables associated with sewage discharging and construction of hydropower stations. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. A conceptual model for the analysis of multi-stressors in linked groundwater-surface water systems.

    Science.gov (United States)

    Kaandorp, Vince P; Molina-Navarro, Eugenio; Andersen, Hans E; Bloomfield, John P; Kuijper, Martina J M; de Louw, Perry G B

    2018-06-15

    Groundwater and surface water are often closely coupled and are both under the influence of multiple stressors. Stressed groundwater systems may lead to a poor ecological status of surface waters but to date no conceptual framework to analyse linked multi-stressed groundwater - surface water systems has been developed. In this paper, a framework is proposed showing the effect of groundwater on surface waters in multiple stressed systems. This framework will be illustrated by applying it to four European catchments, the Odense, Denmark, the Regge and Dinkel, Netherlands, and the Thames, UK, and by assessing its utility in analysing the propagation or buffering of multi-stressors through groundwater to surface waters in these catchments. It is shown that groundwater affects surface water flow, nutrients and temperature, and can both propagate stressors towards surface waters and buffer the effect of stressors in space and time. The effect of groundwater on drivers and states depends on catchment characteristics, stressor combinations, scale and management practises. The proposed framework shows how groundwater in lowland catchments acts as a bridge between stressors and their effects within surface waters. It shows water managers how their management areas might be influenced by groundwater, and helps them to include this important, but often overlooked part of the water cycle in their basin management plans. The analysis of the study catchments also revealed a lack of data on the temperature of both groundwater and surface water, while it is an important parameter considering future climate warming. Copyright © 2018. Published by Elsevier B.V.

  20. Spring and surface water quality of the Cyprus ophiolites

    Directory of Open Access Journals (Sweden)

    C. Neal

    2002-01-01

    Full Text Available A survey of surface, spring and borehole waters associated with the ophiolite rocks of Cyprus shows five broad water types (1 Mg-HCO3, (2 Na-SO4-Cl-HCO3, (3 Na-Ca-Cl-SO4-OH-CO3, (4 Na-Cl-SO4 and (5 Ca-SO4. The waters represent a progression in chemical reactivity from surface waters that evolve within a groundwater setting due to hydrolysis of the basic/ultrabasic rock as modified by CO2-weathering. An increase in salinity is also observed which is due to mixing with a saline end-member (modified sea-water and dissolution of gypsum/anhydrite. In some cases, the waters have pH values greater than 11. Such high values are associated with low temperature serpentinisation reactions. The system is a net sink for CO2. This feature is related not only to the hydrolysis of the primary minerals in the rock, but also to CaCO3 or Ca-Mg-CO3 solubility controls. Under hyperalkaline conditions, virtually all the carbon dioxide is lost from the water due to the sufficiently high calcium levels and carbonate buffering is then insignificant. Calcium sulphate solubility controls may also be operative when calcium and sulphate concentrations are particularly high. Keywords: Cyprus, Troodos, ophiolite, serpentinisation, spring, stream, water quality, bromide, iodine, boron, trace elements, hyperalkaline.