WorldWideScience

Sample records for surface water molecules

  1. The adsorption and dissociation of water molecule on goethite (010) surface: A DFT approach

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Long, E-mail: shuweixia@ouc.edu.cn [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Xiu, Fangyuan [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Qiu, Meng [Qingdao Institute of Bioenergy and Bioprocess Technology (China); Xia, Shuwei; Yu, Liangmin [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China)

    2017-01-15

    Graphical abstract: The optimized structure of hydrated goethite (010) surface with medium water coverage (water density about 6.7 H{sub 2}O/nm{sup 2}). - Highlights: • Stable adsorption and dissociation structure of H{sub 2}O on goethite (010) surface was investigated by DFT. • Reasonable path for water dissociation was proposed by transitional state analysis. • The mechanism of water adsorption on goethite and binding nature were revealed by PDOS. - Abstract: Using density functional theory (DFT) calculation, we investigate the configuration, stability and electronic properties of fresh cleaved (010) goethite surface (Pnma) and this surface exposed to water monolayer at low, medium and high coverage. Water is predicted to be chemisorbed to the surface, together with the surface reconstruction. The interaction energy of the most stable configuration of both low and medium coverage per water molecule is almost the same (−1.17 eV), while that of high coverage is much lower (less than 1.03 eV). It indicates that highly hydrated surface is less stable. PDOS analysis reveals the adsorption of H{sub 2}O is due to the formation of Fe−O bond, caused by overlapping of Fe's 3d and O's 2p orbitals. Dissociation processes at low and medium water coverage are non-spontaneous; while at high coverage, it can undertake spontaneously both thermodynamically and dynamically. The dissociation paths of all three water coverage are the similar. The proton from one adsorbed water is likely to dissociate to bind to the vicinal surface μ{sub 3}−O as an intermediate product; the proton belonged to μ{sub 3}−O transferred to the neighbor surface μ{sub 2}−O as the dissociative configuration.

  2. Adsorption of ethyl xanthate on ZnS(110) surface in the presence of water molecules: A DFT study

    Energy Technology Data Exchange (ETDEWEB)

    Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Guangxi Colleges and University Key Laboratory of Minerals Engineering, 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China)

    2016-05-01

    Graphical abstract: - Highlights: • Adsorption of water molecules decreases the reactivity of surface Zn atom. • Copper impurities decrease the band gap of ZnS surface. • Copper impurities enhance the adsorption of xanthate on the ZnS surface. • Water molecules have little influence on the properties of Cu-substituted ZnS surface. • The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface. - Abstracts: The interaction of collector with the mineral surface plays a very important role in the froth flotation of sphalerite. The adsorptions occurred at the interface between the mineral surface and waters; however most of DFT simulations are performed in vacuum, without consideration of water effect. Semiconductor surface has an obvious proximity effect, which will greatly influence the surface reactivity. To understand the mechanism of xanthate interacting with sphalerite surface in the presence of water molecules, the ethyl xanthate molecule adsorption on un-activated and Cu-activated ZnS(110) surface in the absence and presence of water molecules were performed using the density functional theory (DFT) method. The calculated results show that the adsorption of water molecules dramatically changes the properties of ZnS surface, resulting in decreasing the reactivity of surface Zn atoms with xanthate. Copper activation of ZnS surface changes the surface properties, leading to the totally different adsorption behaviors of xanthate. The presence of waters has little influence on the properties of Cu-activated ZnS surface. The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface, which would result in the formation of dixanthogen.

  3. A Raman spectroscopy study on the effects of intermolecular hydrogen bonding on water molecules absorbed by borosilicate glass surface

    Science.gov (United States)

    Li, Fabing; Li, Zhanlong; Wang, Ying; Wang, Shenghan; Wang, Xiaojun; Sun, Chenglin; Men, Zhiwei

    2018-05-01

    The structural forms of water/deuterated water molecules located on the surface of borosilicate capillaries have been first investigated in this study on the basis of the Raman spectral data obtained at different temperatures and under atmospheric pressure for molecules in bulk and also for molecules absorbed by borosilicate glass surface. The strongest two fundamental bands locating at 3063 cm-1 (2438 cm-1) in the recorded Raman spectra are assigned here to the Osbnd H (Osbnd D) bond stretching vibrations and they are compared with the corresponding bands observed at 3124 cm-1 (2325 cm-1) in the Raman spectrum of ice Ih. Our spectroscopic observations have indicated that the structure of water and deuterated water molecules on borosilicate surface is similar to that of ice Ih (hexagonal phase of ice). These observations have also indicated that water molecules locate on the borosilicate surface so as to construct a bilayer structure and that strong and weak intermolecular hydrogen bonds are formed between water/deuterated molecules and silanol groups on borosilicate surface. In accordance with these findings, water and deuterated water molecules at the interface of capillary have a higher melting temperature.

  4. Energy-switching potential energy surface for the water molecule revisited: A highly accurate singled-sheeted form.

    Science.gov (United States)

    Galvão, B R L; Rodrigues, S P J; Varandas, A J C

    2008-07-28

    A global ab initio potential energy surface is proposed for the water molecule by energy-switching/merging a highly accurate isotope-dependent local potential function reported by Polyansky et al. [Science 299, 539 (2003)] with a global form of the many-body expansion type suitably adapted to account explicitly for the dynamical correlation and parametrized from extensive accurate multireference configuration interaction energies extrapolated to the complete basis set limit. The new function mimics also the complicated Sigma/Pi crossing that arises at linear geometries of the water molecule.

  5. Influence of the water molecules near surface of viral protein on virus activation process

    Energy Technology Data Exchange (ETDEWEB)

    O, Shepelenko S; S, Salnikov A; V, Rak S; P, Goncharova E; B, Ryzhikov A, E-mail: shep@vector.nsc.r, E-mail: shep@ngs.r [Federal State Research Institution State Research Center of Virology and Biotechnology VECTOR of the Federal Service for Surveillance in Consumer Rights Protection and Human Well-being (FSRI SRC VB VECTOR) Koltsovo, Novosibirsk Region (Russian Federation)

    2009-06-01

    The infection of a cell with influenza virus comprises the stages of receptor binding to the cell membrane, endocytosis of virus particle, and fusion of the virus envelope and cell endosome membrane, which is determined by the conformational changes in hemagglutinin, a virus envelope protein, caused by pH decrease within the endosome. The pH value that induces conformation rearrangements of hemagglutinin molecule considerably varies for different influenza virus strains, first and foremost, due to the differences in amino acid structure of the corresponding proteins. The main goal of this study was to construct a model making it possible to assess the critical pH value characterizing the fusogenic activity of influenza virus hemagglutinin from the data on hemagglutinin structure and experimental verification of this model. Under this model, we assume that when the electrostatic force between interacting hemagglutinin molecules in the virus envelop exceeds a certain value, the hemagglutinin HA1 subunits are arranged so that they form a cavity sufficient for penetration of water molecules. This event leads to an irreversible hydration of the inner fragments of hemagglutinin molecule in a trimer and to the completion of conformational changes. The geometry of electrostatic field in hemagglutinin trimer was calculated taking into account the polarization effects near the interface of two dielectrics, aqueous medium and protein macromolecule. The critical pH values for the conformational changes in hemagglutinin were measured by the erythrocyte hemolysis induced by influenza virus particles when decreasing pH. The critical pH value conditionally separating the pH range into the regions with and without the conformational changes was calculated for several influenza virus H1N1 and H3N2 strains based on the data on the amino acid structure of the corresponding hemagglutinin molecules. Comparison of the theoretical and experimental values of critical pH values for

  6. Thermodynamic analysis of water molecules at the surface of proteins and applications to binding site prediction and characterization.

    Science.gov (United States)

    Beuming, Thijs; Che, Ye; Abel, Robert; Kim, Byungchan; Shanmugasundaram, Veerabahu; Sherman, Woody

    2012-03-01

    Water plays an essential role in determining the structure and function of all biological systems. Recent methodological advances allow for an accurate and efficient estimation of the thermodynamic properties of water molecules at the surface of proteins. In this work, we characterize these thermodynamic properties and relate them to various structural and functional characteristics of the protein. We find that high-energy hydration sites often exist near protein motifs typically characterized as hydrophilic, such as backbone amide groups. We also find that waters around alpha helices and beta sheets tend to be less stable than waters around loops. Furthermore, we find no significant correlation between the hydration site-free energy and the solvent accessible surface area of the site. In addition, we find that the distribution of high-energy hydration sites on the protein surface can be used to identify the location of binding sites and that binding sites of druggable targets tend to have a greater density of thermodynamically unstable hydration sites. Using this information, we characterize the FKBP12 protein and show good agreement between fragment screening hit rates from NMR spectroscopy and hydration site energetics. Finally, we show that water molecules observed in crystal structures are less stable on average than bulk water as a consequence of the high degree of spatial localization, thereby resulting in a significant loss in entropy. These findings should help to better understand the characteristics of waters at the surface of proteins and are expected to lead to insights that can guide structure-based drug design efforts. Copyright © 2011 Wiley Periodicals, Inc.

  7. MSINDO quantum chemical modeling study of water molecule adsorption at nano-sized anatase TiO2 surfaces

    International Nuclear Information System (INIS)

    Wahab, Hilal S.; Bredow, Thomas; Aliwi, Salah M.

    2008-01-01

    In this work, we studied the adsorption of water molecule onto the (1 0 0), (0 1 0) and (0 0 1) surfaces of nano-sized anatase TiO 2 with semiempirical SCF MO method, MSINDO. The anatase TiO 2 particles are modeled with free clusters (TiO 2 ) n, where n = 20-80. Whereas, the surfaces have been modeled with two saturated clusters, Ti 21 O 58 H 32 and Ti 36 O 90 H 36 . The surface lattice fivefold coordinated titanium atoms (Ti 5C ), which represent the Lewis acid sites, are selected as adsorption centers. We also investigated the effect of TiO 2 cluster size on the computed band gap energy. Results reveal that the electronic properties of a cluster in the lowest excited state differ from that of the ground state. Furthermore, the MSINDO band gap energies of 3.68-3.77 eV for the anatase TiO 2 are in a fair accordance with other literature data. In agreement with other computational and experimental studies, the dissociated form of water molecule adsorption on anatase TiO 2 surfaces is always more stabilized than the molecular form

  8. The effect of water molecules on the thiol collector interaction on the galena (PbS) and sphalerite (ZnS) surfaces: A DFT study

    Energy Technology Data Exchange (ETDEWEB)

    Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Xu, Zhenghe; Liu, Qingxia [Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB T6G 2V4 (Canada); Du, Zheng [National Supercomputing Center in Shenzhen, Shenzhen 518055 (China)

    2016-12-15

    Highlights: • Water adsorption has a greater effect on the electron distribution of ZnS surface than PbS surface. • Water adsorption decreases the reactivity of ZnS surface atoms but improves that of PbS. • Thiol collectors cannot interact with the hydrated ZnS surface. • The hydration has little influence on the interaction of thiol collectors with PbS surface. - Abstracts: In froth flotation the molecular interaction between reagents and mineral surfaces take place at the solid liquid interface. In this paper, the effect of water molecule on the three typical thiol collectors (xanthate, dithiocarbomate and dithiophosphate) interactions at the galena (PbS) and sphalerite (ZnS) surfaces has been studied adopting density functional theory (DFT). The results suggests that the presence of water molecule shows a greater influence on the electron distribution of ZnS surface than PbS surface, and reduce the reactivity of ZnS surface atoms but improves the reactivity of PbS surface atoms during the reaction with xanthate. Water adsorption could also reduce the covalent binding between Zn and S atoms but have little influence on Pb-S bond. In the presence of water, xanthate, dithiocarbomate (DTC) and dithiophosphate (DTP) could not adsorb on the sphalerite surface. And for galena (PbS) surface, the interaction of DTP is the strongest, then the DTC and the interaction of xanthate is the weakest. These results agree well with the flotation practice.

  9. Conserved water molecules in bacterial serine hydroxymethyltransferases.

    Science.gov (United States)

    Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

    2015-10-01

    Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Photoluminescence behaviors of single CdSe/ZnS/TOPO nanocrystals: Adsorption effects of water molecules onto nanocrystal surfaces

    International Nuclear Information System (INIS)

    Oda, Masaru; Hasegawa, Atsushi; Iwami, Noriya; Nishiura, Ken; Ando, Naohisa; Nishiyama, Akira; Horiuchi, Hiromi; Tani, Toshiro

    2007-01-01

    We report here the distinctive modifications of photoluminescence (PL) behaviors in single CdSe/ZnS/TOPO nanocrystals depending on their environments. Long-time traces of PL intensity from single nanocrystals have been obtained in both vacuum and a wet nitrogen atmosphere. While all of the nanocrystals in both environments exhibit PL blinking behaviors, i.e. on-off intermittency of PL intensity, as usual, some of the nanocrystals in the wet nitrogen atmosphere show significant increase in duration time of on-events. As for the duration time of blinking off-events, it is for the moment associated with the occasional events of carrier capturing at trap sites on or near the nanocrystal surfaces. We propose a model in which adsorbed water molecules at the trap sites on the nanocrystal surfaces transform them under light irradiation, which eventually decreases the occurrence of the trapping events due to their inactivation. It in turn increases the PL on-times. In addition to the drastic modification of the blinking profile, we also found that in the PL time traces some kinds of undulated behaviors, i.e. continuous and rather low frequency fluctuation of PL intensity, appear during each on-event in vacuum while they disappear totally in the wet nitrogen atmosphere. These results are also described on the basis of the inactivation model of the trap sites introduced above

  11. Tapping mode AFM study on the surface dynamics of a single glucose oxidase molecule on a Au(1 1 1) surface in water with implication for a surface-induced unfolding pathway

    International Nuclear Information System (INIS)

    Otsuka, Ichiro; Yaoita, Masashi; Higano, Michi; Nagashima, Seiiichi; Kataoka, Ryoichi

    2004-01-01

    We have investigated a surface-induced unfolding dynamics of a single glucose oxidase (GO) molecule on Au(1 1 1) in air-saturated water, using tapping mode atomic force microscopy (TMAFM). We followed the unfolding process by measuring the maximum height of a well-isolated GO molecule on a terrace near a step-edge of the surface as a function of contact time. We find three linear portions with two intersections in a power-law fit to the selected values of the observed heights. The kinetic TMAFM result implies that there exist at least two distinct dynamic regimes in the unfolding

  12. A nonpolar, nonamphiphilic molecule can accelerate adsorption of phospholipids and lower their surface tension at the air/water interface.

    Science.gov (United States)

    Nguyen, Phuc Nghia; Trinh Dang, Thuan Thao; Waton, Gilles; Vandamme, Thierry; Krafft, Marie Pierre

    2011-10-04

    The adsorption dynamics of a series of phospholipids (PLs) at the interface between an aqueous solution or dispersion of the PL and a gas phase containing the nonpolar, nonamphiphilic linear perfluorocarbon perfluorohexane (PFH) was studied by bubble profile analysis tensiometry. The PLs investigated were dioctanoylphosphatidylcholine (DiC(8)-PC), dilaurylphosphatidylcholine, dimyristoylphosphatidylcholine, and dipalmitoylphosphatidylcholine. The gas phase consisted of air or air saturated with PFH. The perfluorocarbon gas was found to have an unexpected, strong effect on both the adsorption rate and the equilibrium interfacial tension (γ(eq)) of the PLs. First, for all of the PLs, and at all concentrations investigated, the γ(eq) values were significantly lower (by up to 10 mN m(-1)) when PFH was present in the gas phase. The efficacy of PFH in decreasing γ(eq) depends on the ability of PLs to form micelles or vesicles in water. For vesicles, it also depends on the gel or fluid state of the membranes. Second, the adsorption rates of all the PLs at the interface (as assessed by the time required for the initial interfacial tension to be reduced by 30%) are significantly accelerated (by up to fivefold) by the presence of PFH for the lower PL concentrations. Both the surface-tension reducing effect and the adsorption rate increasing effect establish that PFH has a strong interaction with the PL monolayer and acts as a cosurfactant at the interface, despite the absence of any amphiphilic character. Fitting the adsorption profiles of DiC(8)-PC at the PFH-saturated air/aqueous solution interface with the modified Frumkin model indicated that the PFH molecule lay horizontally at the interface. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Surface Water & Surface Drainage

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This data set contains boundaries for all surface water and surface drainage for the state of New Mexico. It is in a vector digital data structure digitized from a...

  14. Formation of the prebiotic molecule NH2CHO on astronomical amorphous solid water surfaces: accurate tunneling rate calculations.

    Science.gov (United States)

    Song, Lei; Kästner, Johannes

    2016-10-26

    Investigating how formamide forms in the interstellar medium is a hot topic in astrochemistry, which can contribute to our understanding of the origin of life on Earth. We have constructed a QM/MM model to simulate the hydrogenation of isocyanic acid on amorphous solid water surfaces to form formamide. The binding energy of HNCO on the ASW surface varies significantly between different binding sites, we found values between ∼0 and 100 kJ mol -1 . The barrier for the hydrogenation reaction is almost independent of the binding energy, though. We calculated tunneling rate constants of H + HNCO → NH 2 CO at temperatures down to 103 K combining QM/MM with instanton theory. Tunneling dominates the reaction at such low temperatures. The tunneling reaction is hardly accelerated by the amorphous solid water surface compared to the gas phase for this system, even though the activation energy of the surface reaction is lower than the one of the gas-phase reaction. Both the height and width of the barrier affect the tunneling rate in practice. Strong kinetic isotope effects were observed by comparing to rate constants of D + HNCO → NHDCO. At 103 K we found a KIE of 231 on the surface and 146 in the gas phase. Furthermore, we investigated the gas-phase reaction NH 2 + H 2 CO → NH 2 CHO + H and found it unlikely to occur at cryogenic temperatures. The data of our tunneling rate constants are expected to significantly influence astrochemical models.

  15. Modelling of energetic molecule-surface interactions

    International Nuclear Information System (INIS)

    Kerford, M.

    2000-09-01

    This thesis contains the results of molecular dynamics simulations of molecule-surface interactions, looking particularly at fullerene molecules and carbon surfaces. Energetic impacts of fullerene molecules on graphite create defect craters. The relationship between the parameters of the impacting molecule and the parameters of the crater axe examined and found to be a function of the energy and velocity of the impacting molecule. Less energetic fullerene molecules can be scattered from a graphite surface and the partitioning of energy after a scattering event is investigated. It is found that a large fraction of the kinetic energy retained after impact is translational energy, with a small fraction of rotational energy and a number of vibrational modes. At impact energies where the surface is not broken and at normal incidence, surface waves axe seen to occur. These waves axe used to develop a method of desorbing molecules from a graphite surface without damage to either the surface or the molecules being desorbed. A number of fullerene molecules are investigated and ways to increase the desorption yield are examined. It is found that this is a successful technique for desorbing large numbers of intact molecules from graphite. This technique could be used for desorbing intact molecules into a gas phase for mass spectrometric analysis. (author)

  16. Individual Magnetic Molecules on Ultrathin Insulating Surfaces

    Science.gov (United States)

    El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus

    2012-02-01

    Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.

  17. Molecular recognition of chromophore molecules to amine terminated surfaces

    International Nuclear Information System (INIS)

    Flores-Perez, Rosangelly; Ivanisevic, Albena

    2007-01-01

    We report the design and characterization of quartz surfaces that can bind to three retinal based chromophores. The amine terminated surfaces were engineered in order to mimic the environment of the opsin protein that accommodates binding of chromophore molecules in the human eye. Each surface coupling step was characterized by water contact angle measurements, ellipsometry, atomic force microscopy, X-ray photoelectron spectroscopy, and transmission infrared spectroscopy. The spectroscopic techniques confirmed that the three chromophore molecules can bind to the surface using a Schiff base mode. Our data suggests that the availability of the amine groups on the surface is critical in the accommodation of the binding of different chromophores

  18. Surface species formed by the adsorption and dissociation of water molecules on Ru(0001) surface containing a small coverage of carbon atoms studied by scanning tunneling microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Dept of Materials Science and Engineering UCB; Dept of Applied Science and Technology, UCB; Institut de Ciencia de Materials de Barcelona, Barcelona, Spain; Instituto de Ciencia de Materiales de Madrid, Madrid, Spain; Department of Mechanical Engineering, Yale University; Salmeron, Miquel; Shimizu, Tomoko K.; Mugarza, Aitor; Cerda, Jorge I.; Heyde, Markus; Qi, Yabing; Schwarz, Udo D.; Ogletree, D. Frank; Salmeron, Miquel

    2008-04-26

    The adsorption and dissociation of water on a Ru(0001) surface containing a small amount ({le} 3 %) of carbon impurities was studied by scanning tunneling microscopy (STM). Various surface species are formed depending on the temperature. These include molecular H{sub 2}O, H{sub 2}O-C complexes, H, O, OH and CH. Clusters of either pure H{sub 2}O or mixed H{sub 2}O-OH species are also formed. Each of these species produces a characteristic contrast in the STM images and can be identified by experiment and by ab initio total energy calculations coupled with STM image simulations. Manipulation of individual species via excitation of vibrational modes with the tunneling electrons has been used as supporting evidence.

  19. Molecule scattering from insulator and metal surfaces

    International Nuclear Information System (INIS)

    Moroz, Iryna; Ambaye, Hailemariam; Manson, J R

    2004-01-01

    Calculations are carried out and compared with data for the scattering of CH 4 molecules from a LiF(001) surface and for O 2 scattering from Al(111). The theory is a mixed classical-quantum formalism that includes energy and momentum transfers between the surface and projectile for translational and rotational motions as well as internal mode excitation of the projectile molecule. The translational and rotational degrees of freedom couple most strongly to multiphonon excitations of the surface and are treated with classical dynamics. Internal vibrational excitations of the molecules are treated with a semiclassical formalism with extension to arbitrary numbers of modes and arbitrary quantum numbers. Calculations show good agreement for the dependence on incident translational energy, incident beam angle and surface temperature when compared with data for energy-resolved intensity spectra and angular distributions

  20. Photochemical dynamics of surface oriented molecules

    International Nuclear Information System (INIS)

    Ho, W.

    1992-01-01

    The period 8/01/91-7/31/92 is the first year of a new project titled ''Photochemical Dynamics of Surface Oriented Molecules'', initiated with DOE Support. The main objective of this project is to understand the dynamics of elementary chemical reactions by studying photochemical dynamics of surface-oriented molecules. In addition, the mechanisms of photon-surface interactions need to be elucidated. The strategy is to carry out experiments to measure the translational energy distribution, as a function of the angle from the surface normal, of the photoproducts by time-of-flight (TOF) technique by varying the photon wavelength, intensity, polarization, and pulse duration. By choosing adsorbates with different bonding configuration, the effects of adsorbate orientation on surface photochemical dynamics can be studied

  1. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  2. Surface functionalization of aluminosilicate nanotubes with organic molecules

    Directory of Open Access Journals (Sweden)

    Wei Ma

    2012-02-01

    Full Text Available The surface functionalization of inorganic nanostructures is an effective approach for enriching the potential applications of existing nanomaterials. Inorganic nanotubes attract great research interest due to their one-dimensional structure and reactive surfaces. In this review paper, recent developments in surface functionalization of an aluminosilicate nanotube, “imogolite”, are introduced. The functionalization processes are based on the robust affinity between phosphate groups of organic molecules and the aluminol (AlOH surface of imogolite nanotubes. An aqueous modification process employing a water soluble ammonium salt of alkyl phosphate led to chemisorption of molecules on imogolite at the nanotube level. Polymer-chain-grafted imogolite nanotubes were prepared through surface-initiated polymerization. In addition, the assembly of conjugated molecules, 2-(5’’-hexyl-2,2’:5’,2’’-terthiophen-5-ylethylphosphonic acid (HT3P and 2-(5’’-hexyl-2,2’:5’,2’’-terthiophen-5-ylethylphosphonic acid 1,1-dioxide (HT3OP, on the imogolite nanotube surface was achieved by introducing a phosphonic acid group to the corresponding molecules. The optical and photophysical properties of these conjugated-molecule-decorated imogolite nanotubes were characterized. Moreover, poly(3-hexylthiophene (P3HT chains were further hybridized with HT3P modified imogolite to form a nanofiber hybrid.

  3. Energy redistribution in diatomic molecules on surfaces

    International Nuclear Information System (INIS)

    Asscher, M.; Somorjai, G.A.

    1984-04-01

    Translational and internal degrees of freedom of a scattered beam of NO molecules from a Pt(111) single crystal surface were measured as a function of scattering angle and crystal temperature in the range 450 to 1250K. None of the three degrees of freedom were found to fully accommodate to the crystal temperature, the translational degree being the most accommodated and the rotational degree of freedom the least. A precursor state model is suggested to account for the incomplete accommodation of translational and vibrational degrees of freedom as a function of crystal temperature and incident beam energy. The vibrational accommodation is further discussed in terms of a competition between desorption and vibrational excitation processes, thus providing valuable information on the interaction between vibrationally excited molecules and surfaces. Energy transfer into rotational degrees of freedom is qualitatively discussed

  4. Water at surfaces with tunable surface chemistries

    Science.gov (United States)

    Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

    2018-03-01

    Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

  5. Surface freezing of water

    OpenAIRE

    P?rez-D?az, J. L.; ?lvarez-Valenzuela, M. A.; Rodr?guez-Celis, F.

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered?exclusively?by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on ...

  6. STICKING OF MOLECULES ON NONPOROUS AMORPHOUS WATER ICE

    Energy Technology Data Exchange (ETDEWEB)

    He, Jiao; Vidali, Gianfranco [Physics Department, Syracuse University, Syracuse, NY 13244 (United States); Acharyya, Kinsuk, E-mail: gvidali@syr.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-05-20

    Accurate modeling of physical and chemical processes in the interstellar medium (ISM) requires detailed knowledge of how atoms and molecules adsorb on dust grains. However, the sticking coefficient, a number between 0 and 1 that measures the first step in the interaction of a particle with a surface, is usually assumed in simulations of ISM environments to be either 0.5 or 1. Here we report on the determination of the sticking coefficient of H{sub 2}, D{sub 2}, N{sub 2}, O{sub 2}, CO, CH{sub 4}, and CO{sub 2} on nonporous amorphous solid water. The sticking coefficient was measured over a wide range of surface temperatures using a highly collimated molecular beam. We showed that the standard way of measuring the sticking coefficient—the King–Wells method—leads to the underestimation of trapping events in which there is incomplete energy accommodation of the molecule on the surface. Surface scattering experiments with the use of a pulsed molecular beam are used instead to measure the sticking coefficient. Based on the values of the measured sticking coefficient, we suggest a useful general formula of the sticking coefficient as a function of grain temperature and molecule-surface binding energy. We use this formula in a simulation of ISM gas–grain chemistry to find the effect of sticking on the abundance of key molecules both on grains and in the gas phase.

  7. Density, distribution, and orientation of water molecules inside and outside carbon nanotubes.

    Science.gov (United States)

    Thomas, J A; McGaughey, A J H

    2008-02-28

    The behavior of water molecules inside and outside 1.1, 2.8, 6.9, and 10.4 nm diameter armchair carbon nanotubes (CNTs) is predicted using molecular dynamics simulations. The effects of CNT diameter on mass density, molecular distribution, and molecular orientation are identified for both the confined and unconfined fluids. Within 1 nm of the CNT surface, unconfined water molecules assume a spatially varying density profile. The molecules distribute nonuniformly around the carbon surface and have preferred orientations. The behavior of the unconfined water molecules is invariant with CNT diameter. The behavior of the confined water, however, can be correlated to tube diameter. Inside the 10.4 nm CNT, the molecular behavior is indistinguishable from that of the unconfined fluid. Within the smaller CNTs, surface curvature effects reduce the equilibrium water density and force water molecules away from the surface. This effect changes both the molecular distribution and preferred molecular orientations.

  8. Surface freezing of water.

    Science.gov (United States)

    Pérez-Díaz, J L; Álvarez-Valenzuela, M A; Rodríguez-Celis, F

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered-exclusively-by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on humidity, presenting at least three different types of surface crystals. Humidity triggers surface freezing as soon as it overpasses a defined value for a given temperature, generating a plurality of nucleation nodes. An evidence of simultaneous nucleation of surface ice crystals is also provided.

  9. Surface-water surveillance

    Energy Technology Data Exchange (ETDEWEB)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995).

  10. Surface-water surveillance

    International Nuclear Information System (INIS)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995)

  11. Surface Water in Hawaii

    Science.gov (United States)

    Oki, Delwyn S.

    2003-01-01

    Surface water in Hawaii is a valued resource as well as a potential threat to human lives and property. The surface-water resources of Hawaii are of significant economic, ecologic, cultural, and aesthetic importance. Streams supply more than 50 percent of the irrigation water in Hawaii, and although streams supply only a few percent of the drinking water statewide, surface water is the main source of drinking water in some places. Streams also are a source of hydroelectric power, provide important riparian and instream habitats for many unique native species, support traditional and customary Hawaiian gathering rights and the practice of taro cultivation, and possess valued aesthetic qualities. Streams affect the physical, chemical, and aesthetic quality of receiving waters, such as estuaries, bays, and nearshore waters, which are critical to the tourism-based economy of the islands. Streams in Hawaii pose a danger because of their flashy nature; a stream's stage, or water level, can rise several feet in less than an hour during periods of intense rainfall. Streams in Hawaii are flashy because rainfall is intense, drainage basins are small, basins and streams are steep, and channel storage is limited. Streamflow generated during periods of heavy rainfall has led to loss of property and human lives in Hawaii. Most Hawaiian streams originate in the mountainous interiors of the islands and terminate at the coast. Streams are significant sculptors of the Hawaiian landscape because of the erosive power of the water they convey. In geologically young areas, such as much of the southern part of the island of Hawaii, well-defined stream channels have not developed because the permeability of the surface rocks generally is so high that rainfall infiltrates before flowing for significant distances on the surface. In geologically older areas that have received significant rainfall, streams and mass wasting have carved out large valleys.

  12. Autodissociation of a water molecule in liquid water

    Energy Technology Data Exchange (ETDEWEB)

    Geissler, Phillip L.; Dellago, Christoph; Chandler, David; Hutter, Jurg; Parrinello, Michele

    2000-04-01

    The dissociation of a water molecule in liquid water is the fundamental event in acid-base chemistry, determining the pH of water.Because the microscopic dynamics of this autodissociation are difficult to probe, both by experiment and by computer simulation, its mechanism has been unknown. Here we report several autodissociation trajectories generated by ab initio molecular dynamics [1]. These trajectories, which were harvested using transition path sampling [2-4], reveal the mechanism for the first time. Rare fluctuations in solvation energies destabilize an oxygen-hydrogen bond. Through the transfer of one or more protons along a hydrogen bond.

  13. Adsorption Mechanism of Inhibitor and Guest Molecules on the Surface of Gas Hydrates.

    Science.gov (United States)

    Yagasaki, Takuma; Matsumoto, Masakazu; Tanaka, Hideki

    2015-09-23

    The adsorption of guest and kinetic inhibitor molecules on the surface of methane hydrate is investigated by using molecular dynamics simulations. We calculate the free energy profile for transferring a solute molecule from bulk water to the hydrate surface for various molecules. Spherical solutes with a diameter of ∼0.5 nm are significantly stabilized at the hydrate surface, whereas smaller and larger solutes exhibit lower adsorption affinity than the solutes of intermediate size. The range of the attractive force is subnanoscale, implying that this force has no effect on the macroscopic mass transfer of guest molecules in crystal growth processes of gas hydrates. We also examine the adsorption mechanism of a kinetic hydrate inhibitor. It is found that a monomer of the kinetic hydrate inhibitor is strongly adsorbed on the hydrate surface. However, the hydrogen bonding between the amide group of the inhibitor and water molecules on the hydrate surface, which was believed to be the driving force for the adsorption, makes no contribution to the adsorption affinity. The preferential adsorption of both the kinetic inhibitor and the spherical molecules to the surface is mainly due to the entropic stabilization arising from the presence of cavities at the hydrate surface. The dependence of surface affinity on the size of adsorbed molecules is also explained by this mechanism.

  14. Slow neutron scattering by water molecules

    Energy Technology Data Exchange (ETDEWEB)

    Stancic, V [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

    1970-07-01

    In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

  15. Slow neutron scattering by water molecules

    International Nuclear Information System (INIS)

    Stancic, V.

    1970-01-01

    In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

  16. Single atom and-molecules chemisorption on solid surfaces

    International Nuclear Information System (INIS)

    Anda, E.V.; Ure, J.E.; Majlis, N.

    1981-01-01

    A simplified model for the microscopic interpretation of single atom and- molecules chemisorption on metallic surfaces is presented. An appropriated hamiltonian for this problem is resolved, through the Green's function formalism. (L.C.) [pt

  17. Chemical reactions of water molecules on Ru(0001) induced by selective excitation of vibrational modes

    Energy Technology Data Exchange (ETDEWEB)

    Mugarza, Aitor; Shimizu, Tomoko K.; Ogletree, D. Frank; Salmeron, Miquel

    2009-05-07

    Tunneling electrons in a scanning tunneling microscope were used to excite specific vibrational quantum states of adsorbed water and hydroxyl molecules on a Ru(0 0 0 1) surface. The excited molecules relaxed by transfer of energy to lower energy modes, resulting in diffusion, dissociation, desorption, and surface-tip transfer processes. Diffusion of H{sub 2}O molecules could be induced by excitation of the O-H stretch vibration mode at 445 meV. Isolated molecules required excitation of one single quantum while molecules bonded to a C atom required at least two quanta. Dissociation of single H{sub 2}O molecules into H and OH required electron energies of 1 eV or higher while dissociation of OH required at least 2 eV electrons. In contrast, water molecules forming part of a cluster could be dissociated with electron energies of 0.5 eV.

  18. Surface Passivation for Single-molecule Protein Studies

    Science.gov (United States)

    Chandradoss, Stanley D.; Haagsma, Anna C.; Lee, Young Kwang; Hwang, Jae-Ho; Nam, Jwa-Min; Joo, Chirlmin

    2014-01-01

    Single-molecule fluorescence spectroscopy has proven to be instrumental in understanding a wide range of biological phenomena at the nanoscale. Important examples of what this technique can yield to biological sciences are the mechanistic insights on protein-protein and protein-nucleic acid interactions. When interactions of proteins are probed at the single-molecule level, the proteins or their substrates are often immobilized on a glass surface, which allows for a long-term observation. This immobilization scheme may introduce unwanted surface artifacts. Therefore, it is essential to passivate the glass surface to make it inert. Surface coating using polyethylene glycol (PEG) stands out for its high performance in preventing proteins from non-specifically interacting with a glass surface. However, the polymer coating procedure is difficult, due to the complication arising from a series of surface treatments and the stringent requirement that a surface needs to be free of any fluorescent molecules at the end of the procedure. Here, we provide a robust protocol with step-by-step instructions. It covers surface cleaning including piranha etching, surface functionalization with amine groups, and finally PEG coating. To obtain a high density of a PEG layer, we introduce a new strategy of treating the surface with PEG molecules over two rounds, which remarkably improves the quality of passivation. We provide representative results as well as practical advice for each critical step so that anyone can achieve the high quality surface passivation. PMID:24797261

  19. Water on graphene surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Gordillo, M C [Departamento de Sistemas Fisicos, Quimicos y Naturales, Facultad de Ciencias Experimentales, Universidad Pablo de Olavide, Carretera de Utrera, km 1, E-41013 Sevilla (Spain); Marti, J, E-mail: cgorbar@upo.e, E-mail: jordi.marti@upc.ed [Departament de Fisica i Enginyeria Nuclear, Universitat Politecnica de Catalunya, B4-B5 Campus Nord, E-08034 Barcelona, Catalonia (Spain)

    2010-07-21

    In this paper, we summarize the main results obtained in our group about the behavior of water confined inside or close to different graphene surfaces by means of molecular dynamics simulations. These include the inside and outside of carbon nanotubes, and the confinement inside a slit pore or a single graphene sheet. We paid special attention to some thermodynamical (binding energies), structural (hydrogen-bond distributions) and dynamic (infrared spectra) properties, and their comparison to their bulk counterparts.

  20. Dependence of partial molecules surface area on the third component in lyotropic liquid crystals

    International Nuclear Information System (INIS)

    Badalyan, H.G.; Ghazaryan, Kh.M.; Yayloyan, S.M.

    2015-01-01

    Free surface of one amphiphilic molecule head of a lyotropic liquid crystal has been investigated by X-Ray diffraction method, at small and large angles, in the presence of the third component. The pentadecilsulphonat-water system in the presence of cholesterol as well as the lecithin-water system in the presence of decanol were investigated. It is shown that the above mentioned free surface decreases if the cholesterol concentration increases, while this surface increases in the case of water concentration increase. However, it increases slower than in the case of the two-component system. The same is observed for the lecithin-water-decanol system

  1. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  2. A Classical Potential to Model the Adsorption of Biological Molecules on Oxidized Titanium Surfaces.

    Science.gov (United States)

    Schneider, Julian; Ciacchi, Lucio Colombi

    2011-02-08

    The behavior of titanium implants in physiological environments is governed by the thin oxide layer that forms spontaneously on the metal surface and mediates the interactions with adsorbate molecules. In order to study the adsorption of biomolecules on titanium in a realistic fashion, we first build up a model of an oxidized Ti surface in contact with liquid water by means of extensive first-principles molecular dynamics simulations. Taking the obtained structure as reference, we then develop a classical potential to model the Ti/TiOx/water interface. This is based on the mapping with Coulomb and Lennard-Jones potentials of the adsorption energy landscape of single water and ammonia molecules on the rutile TiO2(110) surface. The interactions with arbitrary organic molecules are obtained via standard combination rules to established biomolecular force fields. The transferability of our potential to the case of organic molecules adsorbing on the oxidized Ti surface is checked by comparing the classical potential energy surfaces of representative systems to quantum mechanical results at the level of density functional theory. Moreover, we calculate the heat of immersion of the TiO2 rutile surface and the detachment force of a single tyrosine residue from steered molecular dynamics simulations, finding good agreement with experimental reference data in both cases. As a first application, we study the adsorption behavior of the Arg-Gly-Asp (RGD) peptide on the oxidized titanium surface, focusing particularly on the calculation of the free energy of desorption.

  3. Surface-confined electroactive molecules for multistate charge storage information.

    Science.gov (United States)

    Mas-Torrent, M; Rovira, C; Veciana, J

    2013-01-18

    Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.

  4. Scattering of atoms by molecules adsorbed at solid surfaces

    International Nuclear Information System (INIS)

    Parra, Zaida.

    1988-01-01

    The formalism of collisional time-correlation functions, appropriate for scattering by many-body targets, is implemented to study energy transfer in the scattering of atoms and ions from molecules adsorbed on metal surfaces. Double differential cross-sections for the energy and angular distributions of atoms and ions scattered by a molecule adsorbed on a metal surface are derived in the limit of impulsive collisions and within a statistical model that accounts for single and double collisions. They are found to be given by the product of an effective cross-section that accounts for the probability of deflection into a solid angle times a probability per unit energy transfer. A cluster model is introduced for the vibrations of an adsorbed molecule which includes the molecular atoms, the surface atoms binding the molecule, and their nearest neighbors. The vibrational modes of CO adsorbed on a Ni(001) metal surface are obtained using two different cluster models to represent the on-top and bridge-bonding situations. A He/OC-Ni(001) potential is constructed from a strongly repulsive potential of He interacting with the oxygen atom in the CO molecule and a van der Waals attraction accounting for the He interaction with the free Ni(001) surface. A potential is presented for the Li + /OC-Ni(001) where a coulombic term is introduced to account for the image force. Trajectory studies are performed and analyzed in three dimensions to obtain effective classical cross-sections for the He/OC-Ni(001) and Li + /OC-Ni(001) systems. Results for the double differential cross-sections are presented as functions of scattering angles, energy transfer and collisional energy. Temperature dependence results are also analyzed. Extensions of the approach and inclusion of effects such as anharmonicity, collisions at lower energies, and applications of the approach to higher coverages are discussed

  5. Thermodynamic properties of water solvating biomolecular surfaces

    Science.gov (United States)

    Heyden, Matthias

    Changes in the potential energy and entropy of water molecules hydrating biomolecular interfaces play a significant role for biomolecular solubility and association. Free energy perturbation and thermodynamic integration methods allow calculations of free energy differences between two states from simulations. However, these methods are computationally demanding and do not provide insights into individual thermodynamic contributions, i.e. changes in the solvent energy or entropy. Here, we employ methods to spatially resolve distributions of hydration water thermodynamic properties in the vicinity of biomolecular surfaces. This allows direct insights into thermodynamic signatures of the hydration of hydrophobic and hydrophilic solvent accessible sites of proteins and small molecules and comparisons to ideal model surfaces. We correlate dynamic properties of hydration water molecules, i.e. translational and rotational mobility, to their thermodynamics. The latter can be used as a guide to extract thermodynamic information from experimental measurements of site-resolved water dynamics. Further, we study energy-entropy compensations of water at different hydration sites of biomolecular surfaces. This work is supported by the Cluster of Excellence RESOLV (EXC 1069) funded by the Deutsche Forschungsgemeinschaft.

  6. Hyperthermal surface ionization mass spectrometry of organic molecules: monoterpenes

    International Nuclear Information System (INIS)

    Kishi, Hiroshi; Fujii, Toshihiro.

    1997-01-01

    This paper describes an experimental study on the influence of kinetic energy of fast monoterpene molecules on the surface ionization efficiency and on the mass spectral patterns, using rhenium oxide (ReO 2 ) surface. Molecular kinetic energy, given to the molecules through the acceleration in the seeded supersonic molecular beam, ranged from 1 to 10 eV. Hyperthermal surface ionization mass spectra (HSIMS) were taken for various incident kinetic energies and surface temperatures. The observed mass spectra were interpreted in a purely empirical way, by means of evidence from the previous investigations, and they were compared with conventional EI techniques and with the thermal energy surface ionization technique (SIOMS; Surface Ionization Organic Mass Spectrometry). Ionization efficiency (β) was also studied. Under hyperthermal surface ionization (HSI) conditions, many kinds of fragment ions, including quite abundant odd electron ions (OE +· ) are observed. HSIMS patterns of monoterpenes are different among 6-isomers, contrary to those of SIOMS and EIMS, where very similar patterns for isomers are observed. HSIMS patterns are strongly dependent on the molecular kinetic energies. The surface temperature does not affect much the spectral patterns, but it controls the total amount of ion formation. We conclude from these mass spectral findings, HSI-mechanism contains an impulsive process of ion formation, followed by the fragmentation process as a results of the internal energies acquired through the collision processes. (author)

  7. Internal state distributions of molecules scattering and desorbing from surfaces

    International Nuclear Information System (INIS)

    Auerbach, D.J.

    1983-01-01

    Attempts are made to interpret scattering experiments of NO molecules on Ag(111) where a (rotational) state-specific detector has been used. A model using an anisotropic potential is proposed to explain the observed incoming energy- and angle dependence. The so-called rotational rainbows are explained. It is concluded, that in this way information on intermolecular potentials and the transfer of translational to rotational energy in the dynamics of trapping and sticking of molecules on surfaces can be extracted. (G.Q.)

  8. Low-energy electron scattering from molecules, biomolecules and surfaces

    CERN Document Server

    Carsky, Petr

    2011-01-01

    Since the turn of the 21st century, the field of electron molecule collisions has undergone a renaissance. The importance of such collisions in applications from radiation chemistry to astrochemistry has flowered, and their role in industrial processes such as plasma technology and lighting are vital to the advancement of next generation devices. Furthermore, the development of the scanning tunneling microscope highlights the role of such collisions in the condensed phase, in surface processing, and in the development of nanotechnology.Low-Energy Electron Scattering from Molecules, Biomolecule

  9. On the Several Molecules and Nanostructures of Water

    Directory of Open Access Journals (Sweden)

    Cynthia Kolb Whitney

    2012-01-01

    Full Text Available This paper investigates the water molecule from a variety of viewpoints. Water can involve different isotopes of Hydrogen and Oxygen, it can form differently shaped isomer molecules, and, when frozen, it occupies space differently than most other substances do. The tool for conducting the investigation of all this is called ‘Algebraic Chemistry’. This tool is a quantitative model for predicting the energy budget for all sorts of changes between different ionization states of atoms that are involved in chemical reactions and in changes of physical state. The model is based on consistent patterns seen in empirical data about ionization potentials, together with rational scaling laws that can interpolate and extrapolate for situations where no data are available. The results of the investigation of the water molecule include comments, both positive and negative, about technologies involving heavy water, poly water, Brown’s gas, and cold fusion.

  10. Quantum Behavior of Water Molecules Confined to Nanocavities in Gemstones.

    Science.gov (United States)

    Gorshunov, Boris P; Zhukova, Elena S; Torgashev, Victor I; Lebedev, Vladimir V; Shakurov, Gil'man S; Kremer, Reinhard K; Pestrjakov, Efim V; Thomas, Victor G; Fursenko, Dimitry A; Dressel, Martin

    2013-06-20

    When water is confined to nanocavities, its quantum mechanical behavior can be revealed by terahertz spectroscopy. We place H2O molecules in the nanopores of a beryl crystal lattice and observe a rich and highly anisotropic set of absorption lines in the terahertz spectral range. Two bands can be identified, which originate from translational and librational motions of the water molecule isolated within the cage; they correspond to the analogous broad bands in liquid water and ice. In the present case of well-defined and highly symmetric nanocavities, the observed fine structure can be explained by macroscopic tunneling of the H2O molecules within a six-fold potential caused by the interaction of the molecule with the cavity walls.

  11. Improved density functional calculations for atoms, molecules and surfaces

    International Nuclear Information System (INIS)

    Fricke, B.; Anton, J.; Fritzsche, S.; Sarpe-Tudoran, C.

    2005-01-01

    The non-collinear and collinear descriptions within relativistic density functional theory is described. We present results of both non-collinear and collinear calculations for atoms, diatomic molecules, and some surface simulations. We find that the accuracy of our density functional calculations for the smaller systems is comparable to good quantum chemical calculations, and thus this method provides a sound basis for larger systems where no such comparison is possible. (author)

  12. Sustaining dry surfaces under water

    DEFF Research Database (Denmark)

    Jones, Paul R.; Hao, Xiuqing; Cruz-Chu, Eduardo R.

    2015-01-01

    Rough surfaces immersed under water remain practically dry if the liquid-solid contact is on roughness peaks, while the roughness valleys are filled with gas. Mechanisms that prevent water from invading the valleys are well studied. However, to remain practically dry under water, additional...... mechanisms need consideration. This is because trapped gas (e.g. air) in the roughness valleys can dissolve into the water pool, leading to invasion. Additionally, water vapor can also occupy the roughness valleys of immersed surfaces. If water vapor condenses, that too leads to invasion. These effects have...... not been investigated, and are critically important to maintain surfaces dry under water.In this work, we identify the critical roughness scale, below which it is possible to sustain the vapor phase of water and/or trapped gases in roughness valleys – thus keeping the immersed surface dry. Theoretical...

  13. Water on a Hydrophobic surface

    Science.gov (United States)

    Scruggs, Ryan; Zhu, Mengjue; Poynor, Adele

    2012-02-01

    Hydrophobicity, meaning literally fear of water, is exhibited on the surfaces of non-stick cooking pans and water resistant clothing, on the leaves of the lotus plan, or even during the protein folding process in our bodies. Hydrophobicity is directly measured by determining a contact angle between water and an objects surface. Associated with a hydrophobic surface is the depletion layer, a low density region approximately 0.2 nm thick. We study this region by comparing data found in lab using surface plasmon resonance techniques to theoretical calculations. Experiments use gold slides coated in ODT and Mercapto solutions to model both hydrophobic and hydrophilic surfaces respectively.

  14. Towards ligand docking including explicit interface water molecules.

    Directory of Open Access Journals (Sweden)

    Gordon Lemmon

    Full Text Available Small molecule docking predicts the interaction of a small molecule ligand with a protein at atomic-detail accuracy including position and conformation the ligand but also conformational changes of the protein upon ligand binding. While successful in the majority of cases, docking algorithms including RosettaLigand fail in some cases to predict the correct protein/ligand complex structure. In this study we show that simultaneous docking of explicit interface water molecules greatly improves Rosetta's ability to distinguish correct from incorrect ligand poses. This result holds true for both protein-centric water docking wherein waters are located relative to the protein binding site and ligand-centric water docking wherein waters move with the ligand during docking. Protein-centric docking is used to model 99 HIV-1 protease/protease inhibitor structures. We find protease inhibitor placement improving at a ratio of 9:1 when one critical interface water molecule is included in the docking simulation. Ligand-centric docking is applied to 341 structures from the CSAR benchmark of diverse protein/ligand complexes [1]. Across this diverse dataset we see up to 56% recovery of failed docking studies, when waters are included in the docking simulation.

  15. Electrolysis of water on (oxidized) metal surfaces

    DEFF Research Database (Denmark)

    Rossmeisl, Jan; Logadottir, Ashildur; Nørskov, Jens Kehlet

    2005-01-01

    Density functional theory calculations are used as the basis for an analysis of the electrochemical process, where by water is split to form molecular oxygen and hydrogen. We develop a method for obtaining the thermochemistry of the electrochemical water splitting process as a function of the bias...... directly from the electronic structure calculations. We consider electrodes of Pt(111) and Au(111) in detail and then discuss trends for a series of different metals. We show that the difficult step in the water splitting process is the formation of superoxy-type (OOH) species on the surface...... by the splitting of a water molecule on top an adsorbed oxygen atom. One conclusion is that this is only possible on metal surfaces that are (partly) oxidized. We show that the binding energies of the different intermediates are linearly correlated for a number of metals. In a simple analysis, where the linear...

  16. Wetland Surface Water Processes

    National Research Council Canada - National Science Library

    1993-01-01

    .... Temporary storage includes channel, overbank, basin, and groundwater storage. Water is removed from the wetland through evaporation, plant transpiration, channel, overland and tidal flow, and groundwater recharge...

  17. Transport behavior of water molecules through two-dimensional nanopores

    International Nuclear Information System (INIS)

    Zhu, Chongqin; Li, Hui; Meng, Sheng

    2014-01-01

    Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules

  18. Structures of water molecules in carbon nanotubes under electric fields

    International Nuclear Information System (INIS)

    Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji

    2015-01-01

    Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate

  19. The role of water molecules in computational drug design.

    Science.gov (United States)

    de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris

    2010-01-01

    Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.

  20. Water-mediated influence of a crowded environment on internal vibrations of a protein molecule.

    Science.gov (United States)

    Kuffel, Anna; Zielkiewicz, Jan

    2016-02-14

    The influence of crowding on the protein inner dynamics is examined by putting a single protein molecule close to one or two neighboring protein molecules. The presence of additional molecules influences the amplitudes of protein fluctuations. Also, a weak dynamical coupling of collective velocities of surface atoms of proteins separated by a layer of water is detected. The possible mechanisms of these phenomena are described. The cross-correlation function of the collective velocities of surface atoms of two proteins was decomposed into the Fourier series. The amplitude spectrum displays a peak at low frequencies. Also, the results of principal component analysis suggest that the close presence of an additional protein molecule influences the high-amplitude, low-frequency modes in the most prominent way. This part of the spectrum covers biologically important protein motions. The neighbor-induced changes in the inner dynamics of the protein may be connected with the changes in the velocity power spectrum of interfacial water. The additional protein molecule changes the properties of solvation water and in this way it can influence the dynamics of the second protein. It is suggested that this phenomenon may be described, at first approximation, by a damped oscillator driven by an external random force. This model was successfully applied to conformationally rigid Choristoneura fumiferana antifreeze protein molecules.

  1. Adhesion of Model Molecules to Metallic Surfaces, the Implications for Corrosion Protection

    International Nuclear Information System (INIS)

    De Wit, J. H. W.; Van den Brand, J.; De Wit, F. M.; Mol, J. M. C.

    2008-01-01

    The majority of the described experimental results deal with relatively pure aluminium. Variations were made in the pretreatment of the aluminum substrates and an investigation was performed on the resulting changes in oxide layer composition and chemistry. Subsequently, the bonding behavior of the surfaces was investigated by using model adhesion molecules. These molecules were chosen to represent the bonding functionality of an organic polymer. They were applied onto the pretreated surfaces as a monolayer and the bonding behavior was studied using infrared reflection absorption spectroscopy. A direct and clear relation was found between the hydroxyl fraction on the oxide surfaces and the amount of molecules that subsequently bonded to the surface. Moreover, it was found that most bonds between the oxide surface and organic functional groups are not stable in the presence of water. The best performance was obtained using molecules, which are capable of chemisorption with the oxide surface. Finally, it was found that freshly prepared relatively pure aluminum substrates, which are left in air, rapidly lose their bonding capacity towards organic functional groups. This can be attributed to the adsorption of contamination and water to the oxide surface. in addition the adhesion of a typical epoxy-coated aluminum system was investigated during exposure to water at different temperatures. The coating was found to quite rapidly lose its adhesion upon exposure to water. This rapid loss of adhesion corresponds well with the data where it was demonstrated that the studied epoxy coating only bonds through physisorptive hydrogen bonding, these bonds not being stable in the presence of water. After the initial loss the adhesion of the coating was however found to recover again and even exceeded the adhesion prior to exposure. The improvement could be ascribed to the growth of a thin oxyhydroxide layer on the aluminum substrate, which forms a new, water-stable and stronger bond

  2. Microassay for measurement of binding of radiolabelled ligands to cell surface molecules

    International Nuclear Information System (INIS)

    Woof, J.M.; Burton, D.R.

    1988-01-01

    An improved technique for measuring the binding of radiolabelled ligands to cell surface molecules has been developed by modification of a procedure using centrifugation through a water-immiscible oil to separate free and cell-bound ligand. It maximises the percentage of ligand bound since cell-bound and free ligand can be separated easily and reproducibly even when very small reaction volumes are used. This permits low levels of ligand radiolabelling and relatively low numbers of cells to be used

  3. Structure determination by photoelectron diffraction of small molecules on surfaces

    International Nuclear Information System (INIS)

    Booth, N.A.

    1998-05-01

    The synchrotron radiation based technique of Photoelectron Diffraction (PhD) has been applied to three adsorption systems. Structure determinations, are presented for each system which involve the adsorption of small molecules on the low index {110} plane of single crystal Cu and Ni substrates. For the NH 3 -Cu(110) system PhD was successful in determining a N-Cu bondlength of 2.05 ± 0.03 A as well as values for the anisotropic vibrational amplitudes of the N and an expansion of the 1st to 2nd Cu substrate layer spacing from the bulk value of 0.08 ± 0.08 A. The most significant and surprising structural parameter determined for this system was that the N atom occupies an asymmetric adsorption site. Rather than being situated in the expected high symmetry atop site the N atom was found to be offset parallel to the surface by 0.37 ± 0.12 A in the [001] azimuth. In studying the glycine-Cu(110) system the adsorption structure of an amino-acid has been quantified. The local adsorption geometries of all the atoms involved in the molecule to surface bond have been determined. The glycine molecule is found to be bonded to the surface via both its amino and carboxylate functional groups. The molecule straddles two [11-bar0] rows of the Cu substrate. The two O atoms are found to be in identical sites both approximately atop Cu atoms on the [11-bar0] rows offset parallel to the surface by 0.80 ± 0.05 A in the [001] azimuth, the O-Cu bondlength was found to be 2.03 ± 0.05 A. The N atom was also found to adsorb in an approximately atop geometry but offset parallel to the surface by 0.24 ± 0.10A in the [11-bar0] direction, the N-Cu bondlength was found to be 2.05± 0.05 A. PhD was unsuccessful in determining the positions of the two C atoms that form a bridge between the two functional groups bonded to the surface due to difficulties in separating the two inequivalent contributions to the final intensity modulation function. For the CN-Ni(110) system both PhD and Near Edge

  4. Total Nitrogen in Surface Water

    Data.gov (United States)

    U.S. Environmental Protection Agency — Excess nitrogen in surface water can result in eutrophication. TOTALN is reported in kilograms/hectare/year. More information about these resources, including the...

  5. Total Phosphorus in Surface Water

    Data.gov (United States)

    U.S. Environmental Protection Agency — Excess phosphorus in surface water can result in eutrophication. TOTALP is reported in kilograms/hectare/year. More information about these resources, including the...

  6. Free Surface Water Tunnel (FSWT)

    Data.gov (United States)

    Federal Laboratory Consortium — Description: The Free Surface Water Tunnel consists of the intake plenum, the test section and the exit plenum. The intake plenum starts with a perforated pipe that...

  7. Water-assisted dehalogenation of thionyl chloride in the presence of water molecules.

    Science.gov (United States)

    Yeung, Chi Shun; Ng, Ping Leung; Guan, Xiangguo; Phillips, David Lee

    2010-04-01

    A second-order Møller-Plesset perturbation theory (MP2) and density functional theory (DFT) investigation of the dehalogenation reactions of thionyl chloride is reported, in which water molecules (up to seven) were explicitly involved in the reaction complex. The dehalogenation processes of thionyl chloride were found to be dramatically catalyzed by water molecules. The reaction rate became significantly faster as more water molecules became involved in the reaction complex. The dehalogenation processes can be reasonably simulated by the gas-phase water cluster models, which reveals that water molecules can help to solvate the thionyl chloride molecules and activate the release of the Cl(-) leaving group. The computed activation energies were used to compare the calculations to available experimental data.

  8. Vibrational properties of water molecules adsorbed in different zeolitic frameworks

    International Nuclear Information System (INIS)

    Crupi, V; Longo, F; Majolino, D; Venuti, V

    2006-01-01

    The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different

  9. Controllability of Surface Water Networks

    Science.gov (United States)

    Riasi, M. Sadegh; Yeghiazarian, Lilit

    2017-12-01

    To sustainably manage water resources, we must understand how to control complex networked systems. In this paper, we study surface water networks from the perspective of structural controllability, a concept that integrates classical control theory with graph-theoretic formalism. We present structural controllability theory and compute four metrics: full and target controllability, control centrality and control profile (FTCP) that collectively determine the structural boundaries of the system's control space. We use these metrics to answer the following questions: How does the structure of a surface water network affect its controllability? How to efficiently control a preselected subset of the network? Which nodes have the highest control power? What types of topological structures dominate controllability? Finally, we demonstrate the structural controllability theory in the analysis of a wide range of surface water networks, such as tributary, deltaic, and braided river systems.

  10. Mobility of chemisorbed molecules and surface regeneration of active centers during dehydration of isopropanol on aluminium oxide and aluminosilicate

    International Nuclear Information System (INIS)

    Makhlis, L.A.; Vasserberg, V.Eh.

    1976-01-01

    By a differential isotope method involving 14 C the authors have investigated the surface mobility of chemisorbed molecules of isopropanol during its dehydration in an adsorption layer on aluminium oxide and aluminosilicate. The chemisorbed alcohol molecules possess marked surface mobility which plays a decisive part in the mechanism of surface regeneration of the active catalyst centers in the process of dehydration. The cessation of the reaction long before the adsorbed alcohol is completely used up is explained by the hypothesis that there is local overpopulation of the active sectors by water formed by the reaction; this hinders further surface regeneration and repetition of the elementary events of dehydration

  11. Reaction dynamics of small molecules at metal surfaces

    International Nuclear Information System (INIS)

    Samson, P.A.

    1999-09-01

    The dissociation-desorption dynamics of D 2 upon the Sn/Pt(111) surface alloy are dependent on the surface concentration of Sn. The p(2 x 2) Sn/Pt(111) alloy surface (Θ Sn = 0.25 ML), is initially ∼30 times less reactive towards D 2 adsorption than clean Pt(111). On the (√3 x √3) R30 deg Sn/Pt(111) alloy surface (Θ Sn = 0.33 ML), increased inhibition of D 2 adsorption is reported, with S o ∼ 10 -5 at low energy, coinciding with the loss of stable Pt 3 hollow sites and a significant reduction in the D atom binding energy. Sticking on the √3 alloy is activated with an increased energy threshold of ∼280 meV, with no evidence that vibration enhances dissociation. The barrier to dissociation remains in the entrance channel before the D 2 bond begins to stretch. Vibrational excitation is, however, observed in nitrogen desorption from the catalytic reaction of NO + H 2 over Pd(110). For a surface at 600 K, N 2 vibrational state population ratios of P(v=1/v=0) = 0.50 ± 0.05 and P(v=2/v=0) = 0.60 ± 0.20 are reported. Desorption occurs via the N(ad) + N(ad) recombination channel with little energy released into translation and rotation. The translational energy release observed is dependent on the N 2 vibrational state, with translational temperatures of 425 K, 315 K and 180 K reported for the v=0, 1 and 2 states respectively. Sub-thermal energy releases and normally directed angular distributions suggest the influence of a trapping mechanism, recombining molecules scattering through a molecularly adsorbed state, with a transition state of large d NN responsible for the product vibrational excitation. Although N 2 dissociation on Fe(100) forms a simple overlayer structure, on Fe(110), molecular chemisorption does not occur at or above room temperature and the sticking is extremely small (∼10 -6 to 10 -7 ). Activated nitrogen bombardment can be used to prepare a 'surface nitride' with a structure related to the geometry of bulk Fe 4 N. Scanning tunnelling

  12. Photoionization of water molecules by high energy photons

    Directory of Open Access Journals (Sweden)

    Lara Martini

    2017-07-01

    Full Text Available We theoretically study the photoionization of water molecules by high energy photon impact. We develop a model in which the final state wavefunction is given by a Coulomb continuum wavefunction with effective charges and the water molecule bound states are represented using the Moccia's monocentric wavefunctions. We obtain analytical expressions for the transition matrix element that enable the computation of cross sections by numerical quadratures. We compare our predictions for photon energies between 20 and 300 eV with more elaborated theoretical results and experiments. We obtain a very good agreement with experiments, in particular, at enough high energies where there is a lack of elaborated results due to their high computational cost. Received: 15 March 2017, Accepted: 25 June 2017; Edited by: S. Kais; DOI: http://dx.doi.org/10.4279/PIP.090006 Cite as: L Martini, D I R Boll, O A Fojón, Papers in Physics 9, 090006 (2017

  13. Integration or segregation: how do molecules behave at oil/water interfaces?

    Science.gov (United States)

    Moore, F G; Richmond, G L

    2008-06-01

    It has been over 250 years since Benjamin Franklin, fascinated with the wave-stilling effect of oil on water, performed his famous oil-drop experiments; nevertheless, the behavior of water molecules adjacent to hydrophobic surfaces continues to fascinate today. In the 18th century, the calming of the seas seemed the most pertinent application of such knowledge; today, we understand that oil-on-water phenomena underlie a range of important chemical, physical, and biological processes, including micelle and membrane formation, protein folding, chemical separation, oil extraction, nanoparticle formation, and interfacial polymerization. Beyond classical experiments of the oil-water interface, recent interest has focused on deriving a molecular-level picture of this interface or, more generally, of water molecules positioned next to any hydrophobic surface. This Account summarizes more than a decade's work from our laboratories aimed at understanding the nature of the hydrogen bonding occurring between water and a series of organic liquids in contact. Although the common perception is that water molecules and oil molecules positioned at the interface between the immiscible liquids want nothing to do with one another, we have found that weak interactions between these hydrophilic and hydrophobic molecules lead to interesting interfacial behavior, including highly oriented water molecules and layering of the organic medium that extends several molecular layers deep into the bulk organic liquid. For some organic liquids, penetration of oriented water into the organic layer is also apparent, facilitated by molecular interactions established at the molecularly thin region of first contact between the two liquids. The studies involve a combined experimental and computational approach. The primary experimental tool that we have used is vibrational sum frequency spectroscopy (VSFS), a powerful surface-specific vibrational spectroscopic method for measuring the molecular

  14. Fundamental properties of molecules on surfaces. Molecular switching and interaction of magnetic molecules with superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Hatter, Nino

    2016-12-14

    In this thesis, we investigate individual molecular switches and metal-organic complexes on surfaces with scanning tunneling microscopy (STM) and spectroscopy (STS) at low temperatures. One focus addresses the switching ability and mechanism of diarylethene on Ag(111). The other focus lies on resolving and tuning magnetic interactions of individual molecules with superconductors. 4,4'-(4,4'-(perfluorocyclopent-1-ene-1,2-diyl)bis (5-methylthiophene-4,2-diyl)dip yridine (PDTE) is a prototypical photochromic switch. We can induce a structural change of individual PDTE molecules on Ag(111) with the STM tip. This change is accompanied by a reduction of the energy gap between the occupied and unoccupied molecular orbitals. Density functional theory (DFT) calculations reveal that the induced switching corresponds to a ring-closing reaction from an open isomer in a flat adsorption configuration to a ring-closed isomer with its methyl groups in a cis configuration. The final product is thermodynamically stabilized by strong dispersion interactions with the surface. A linear dependence of the switching threshold with the tip-sample distance with a minimal threshold of 1.4 V is found, which we assign to a combination of an electric-field induced process and a tunneling-electron contribution. DFT calculations suggest a large activation barrier for a ring-closing reaction from the open flat configuration into the closed cis configuration. The interaction of magnetic molecules with superconductors is studied on manganese phthalocyanine (MnPc) adsorbed on Pb(111). We find triplets of Shiba states inside the superconducting gap. Different adsorption sites of MnPc provide a large variety of exchange coupling strengths, which lead to a collective energy shift of the Shiba triplets. We can assign the splitting of the Shiba states to be an effect of magnetic anisotropy in the system. A quantum phase transition from a ''Kondo screened'' to a &apos

  15. Groundwater–Surface Water Exchange

    DEFF Research Database (Denmark)

    Karan, Sachin

    The exchange of groundwater-surface water has been invetigated in the western part of Denmark. Holtum AA provides the framework for all the performed investigations. Several methods are used, primarily eld based measurements ombined with numerical models to achieve insight to the governing...... processes of interaction between groundwater and surface water. By using heat as a tracer it has been possible to use temperature directly as calibrationtargets in a groundwater and heat transport model. Thus, it is possible to use heat investigate the change in groundwater discharge in dynamic conditions...... by using simple temperature devices along a stream to delineate the areas of interest in regard to GW{SW exchange. Thus, at several locations in a stream a temperature data logger was placed in the water column and right at the streambed-water interface. By looking at the correlation of streambed...

  16. Scattering of thermal neutron by the water molecule

    International Nuclear Information System (INIS)

    Rosa, L.P.

    The calculation of the differenctial cross section for scattering of thermal neutrons by water, taking into account the translational, rotational and vibrational motions of the water molecule, is presented according to Nelkin' model. Some modifications are presented which have been introduced in the original method to improve the results and an application has been made to reactor physics, by calculating the thermal neutron flux in a homogenous medium containing water and absorver. Thirty thermal energy groups have been used to compute the spectra. Within the limits of error, better agreement has been obtained between theory and experiments by using a modified Nelkin kernel consisting of substituting the asymptotic formulae for the rotational and vibrational motions by more exact expressions, similar to the Buttler model for heavy water

  17. Investigating the conformation of polymeric dispersant molecules on nanoparticle surface

    International Nuclear Information System (INIS)

    Yasin, S.; Luckham, P.F.; Iqbal, T

    2016-01-01

    Block copolymers are widely used as stabilizers in industrial dispersions. These polymers adsorb on surfaces by an anchor chain and extend by a hydrophilic chain. Scaling model or de Gennes theory has been used to determine the grafting density of the block copolymers. By implementing this theory to the block copolymers, conformation of the polymer molecules as a function of distance between adjacent anchor chains can be determined. The scaling model was applied to a selection of block copolymers (PE/F 103, PE/F 108, NPE1800, Triton X100, Triton X405, Lugalvan BNO12, Hypermer LP1, Hypermer B246 and OLOA 11000) in this study. The cross sectional area sc, distance s (square root of sc) and the Flory radius (end to end dimension of polymer), Rf, for all the polymers was determined. The cross sectional area per PEO (Poly Ethylene Oxide) chain (nm2) was found to be increasing with the size of stabilizing chain. Triton X100 and Lugalvan BNO12 has the smaller stabilizing chains so occupy smaller cross sectional areas whereas PE/F108 and triton X405 have larger number of PEO units and occupy a larger cross sectional area. This shows that stabilizing chain regulates the adsorption amounts that are lower in case of lower number of EO units. The application of de Gennes theory to experimental results suggested brush configuration of adsorbed polymer molecules in case of PE/F 103, PE/F 108, Triton X100, Triton X405, NPE1800, Lugalvan BNO12, Hypermer B246 and OLOA 11000. Whereas, Hypermer LP1 is more likely found to be adsorbed on graphitic carbon black in loops and trains. (author)

  18. Groundwater and surface water pollution

    Energy Technology Data Exchange (ETDEWEB)

    Chae, Y.S.; Hamidi, A. [eds.

    2000-07-01

    This book contains almost all the technical know-how that is required to clean up the water supply. It provides a survey of up-to-date technologies for remediation, as well as a step-by-step guide to pollution assessment for both ground and surface waters. In addition to focusing on causes, effects, and remedies, the book stresses reuse, recycling, and recovery of resources. The authors suggest that through total recycling wastes can become resources.

  19. Adsorptionof polar organic molecules at oil/water interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Aveyard, R; Chapman, J

    1975-03-15

    A study has been made of the adsorption of several esters of dicarboxylic acids at the alkane/water and the air/water interface. The adsorption of n-butanol and n-heptanol at the air/water surface also has been investigated. The surface pressure (pi) -surface area (A) isotherms are compared for the various films, and standard free energies of adsorption have been determined. Attempts have been made to fit the pi, A isotherms using surface equations of state based on the models, of both a 2-dimensional gas and a 2-dimensional solution. The solution model has proved reasonably successful for fairly dilute films at the air/water surface. At higher coverages, an equation derived by Smith for liquid expanded monolayers gives a moderately good description of films of heptanol on water. A simple application of the solution model on adsorbed monolayers at the liquid; liquid interface met with little success. However, it is found that 2-dimensional gas equations describe such systems surprisingly well for fairly low surface concentrations. (20 refs.)

  20. The spontaneous synchronized dance of pairs of water molecules

    International Nuclear Information System (INIS)

    Roncaratti, Luiz F.; Cappelletti, David; Pirani, Fernando

    2014-01-01

    Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions

  1. The spontaneous synchronized dance of pairs of water molecules

    Energy Technology Data Exchange (ETDEWEB)

    Roncaratti, Luiz F. [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy); Instituto de Física, Universidade de Brasília, 70910-900 Brasília (Brazil); Cappelletti, David, E-mail: david.cappelletti@unipg.it; Pirani, Fernando [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy)

    2014-03-28

    Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions.

  2. Surface water quality assessment using factor analysis

    African Journals Online (AJOL)

    2006-01-16

    Jan 16, 2006 ... Surface water, groundwater quality assessment and environ- .... Urbanisation influences the water cycle through changes in flow and water ..... tion of aquatic life, CCME water quality Index 1, 0. User`s ... Water, Air Soil Pollut.

  3. Formation of self-assembled monolayer of curcuminoid molecules on gold surfaces

    International Nuclear Information System (INIS)

    Berlanga, Isadora; Etcheverry-Berríos, Álvaro; Mella, Andy; Jullian, Domingo; Gómez, Victoria Alejandra; Aliaga-Alcalde, Núria; Fuenzalida, Victor; Flores, Marcos

    2017-01-01

    Highlights: • Thiophene curcuminoid molecules deposited on a gold surface by immersion. • Molecular dynamic studies of the molecular arrangement approaching the surface. • XPS and STM studies showing different arrangement of the molecules on the surface. • Molecular Interaction with surface depends on the sulfur position in thiophene rings. • Temporal evolution of the molecular arrangement on the surface. - Abstract: We investigated the formation of self-assembled monolayers of two thiophene curcuminoid molecules, 2-thphCCM (1) and 3-thphCCM (2), on polycrystalline gold substrates prepared by immersion of the surfaces in a solution of the molecules during 24 h. The functionalized surfaces were studied by scanning tunneling microscopy (STM) and X-ray photoelectron spectroscopy (XPS). Despite the fact that both molecules have the same composition and almost the same structure, these molecules exhibit different behavior on the gold surface, which can be explained by the different positions of the sulfur atoms in the terminal aromatic rings. In the case of molecule 1, the complete formation of a SAM can be observed after 24 h of immersion. In the case of molecule 2, the transition from flat-lying to upright configuration on the surface is still in process after 24 h of immersion. This is attributed to the fact that molecule 2 have the sulfur atoms more exposed than molecule 1.

  4. Formation of self-assembled monolayer of curcuminoid molecules on gold surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Berlanga, Isadora [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Av. Blanco Encalada 2008, Santiago (Chile); Etcheverry-Berríos, Álvaro; Mella, Andy; Jullian, Domingo [Departamento de Ciencia de los Materiales, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Beaucheff 851, Santiago (Chile); Gómez, Victoria Alejandra [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Av. Blanco Encalada 2008, Santiago (Chile); Aliaga-Alcalde, Núria [ICREA (Institució Catalana de Recerca i Estudis Avançats), Passeig Lluís Companys, 23, 08018, Barcelona (Spain); CSIC-ICMAB (Institut de Ciència dels Materials de Barcelona), Campus de la Universitat Autònoma de Barcelona, 08193 Bellaterra (Spain); Fuenzalida, Victor [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Av. Blanco Encalada 2008, Santiago (Chile); Flores, Marcos, E-mail: mflorescarra@ing.uchile.cl [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Av. Blanco Encalada 2008, Santiago (Chile); and others

    2017-01-15

    Highlights: • Thiophene curcuminoid molecules deposited on a gold surface by immersion. • Molecular dynamic studies of the molecular arrangement approaching the surface. • XPS and STM studies showing different arrangement of the molecules on the surface. • Molecular Interaction with surface depends on the sulfur position in thiophene rings. • Temporal evolution of the molecular arrangement on the surface. - Abstract: We investigated the formation of self-assembled monolayers of two thiophene curcuminoid molecules, 2-thphCCM (1) and 3-thphCCM (2), on polycrystalline gold substrates prepared by immersion of the surfaces in a solution of the molecules during 24 h. The functionalized surfaces were studied by scanning tunneling microscopy (STM) and X-ray photoelectron spectroscopy (XPS). Despite the fact that both molecules have the same composition and almost the same structure, these molecules exhibit different behavior on the gold surface, which can be explained by the different positions of the sulfur atoms in the terminal aromatic rings. In the case of molecule 1, the complete formation of a SAM can be observed after 24 h of immersion. In the case of molecule 2, the transition from flat-lying to upright configuration on the surface is still in process after 24 h of immersion. This is attributed to the fact that molecule 2 have the sulfur atoms more exposed than molecule 1.

  5. Electric dipole moments of nanosolvated acid molecules in water clusters.

    Science.gov (United States)

    Guggemos, Nicholas; Slavíček, Petr; Kresin, Vitaly V

    2015-01-30

    The electric dipole moments of (H2O)nDCl (n=3-9) clusters have been measured by the beam-deflection method. Reflecting the (dynamical) charge distribution within the system, the dipole moment contributes information about the microscopic structure of nanoscale solvation. The addition of a DCl molecule to a water cluster results in a strongly enhanced susceptibility. There is evidence for a noticeable rise in the dipole moment occurring at n≈5-6. This size is consistent with predictions for the onset of ionic dissociation. Additionally, a molecular-dynamics model suggests that even with a nominally bound impurity an enhanced dipole moment can arise due to the thermal and zero-point motion of the proton and the water molecules. The experimental measurements and the calculations draw attention to the importance of fluctuations in defining the polarity of water-based nanoclusters and generally to the essential role played by motional effects in determining the response of fluxional nanoscale systems under realistic conditions.

  6. Hydrogen bonding characterization in water and small molecules

    Science.gov (United States)

    Silvestrelli, Pier Luigi

    2017-06-01

    The prototypical hydrogen bond in water dimer and hydrogen bonds in the protonated water dimer, in other small molecules, in water cyclic clusters, and in ice, covering a wide range of bond strengths, are theoretically investigated by first-principles calculations based on density functional theory, considering not only a standard generalized gradient approximation functional but also, for the water dimer, hybrid and van der Waals corrected functionals. We compute structural, energetic, and electrostatic (induced molecular dipole moments) properties. In particular, hydrogen bonds are characterized in terms of differential electron density distributions and profiles, and of the shifts of the centres of maximally localized Wannier functions. The information from the latter quantities can be conveyed to a single geometric bonding parameter that appears to be correlated with the Mayer bond order parameter and can be taken as an estimate of the covalent contribution to the hydrogen bond. By considering the water trimer, the cyclic water hexamer, and the hexagonal phase of ice, we also elucidate the importance of cooperative/anticooperative effects in hydrogen-bonding formation.

  7. Continuum simulations of water flow past fullerene molecules

    DEFF Research Database (Denmark)

    Popadic, A.; Praprotnik, M.; Koumoutsakos, P.

    2015-01-01

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently by continuum flow...

  8. Selective control of photodissociation in deutereted water molecule HOD

    International Nuclear Information System (INIS)

    Adhikari, S.; Deshpande, Sarin; Sarma, Manabendra; Kurkal, Vandana; Mishra, M.K.

    2006-01-01

    Bond dissociation in the deutereted water molecule HOD has been investigated to explore the possibility of selective control of dissociation of O-H and O-D bonds using simple field profiles and initial states that do not require high overtone excitations. Preliminary results indicate that considerable selectivity in dissociation of O-H and O-D bonds can be achieved using fundamental and first overtone excitations only and use of field optimized initial state (FOIST) based scheme with appropriate choice of field parameters and initial states may enhance both selectivity and yield

  9. Influencing the bonding and assembly of a multiterminal molecule on a metal surface

    Energy Technology Data Exchange (ETDEWEB)

    Lukas, Maya; Doessel, Kerrin; Fink, Karin; Fuhr, Olaf [Karlsruhe Institute of Technology (KIT), Institute of Nanotechnology, D-76021 Karlsruhe (Germany); DFG Center of Functional Nanostructures (CFN), D-76049 Karlsruhe (Germany); Schramm, Alexandrina; Stroh, Christophe [Karlsruhe Institute of Technology (KIT), Institute of Nanotechnology, D-76021 Karlsruhe (Germany); Mayor, Marcel [Karlsruhe Institute of Technology (KIT), Institute of Nanotechnology, D-76021 Karlsruhe (Germany); DFG Center of Functional Nanostructures (CFN), D-76049 Karlsruhe (Germany); University of Basel, Department of Chemistry, CH-4056 Basel (Switzerland); Loehneysen, Hilbert von [Karlsruhe Institute of Technology (KIT), Institute of Nanotechnology, D-76021 Karlsruhe (Germany); DFG Center of Functional Nanostructures (CFN), D-76049 Karlsruhe (Germany); Karlsruhe Institute of Technology (KIT), Physics Institute and Institute for Solid State Physics, D-76049 Karlsruhe (Germany)

    2011-07-01

    The bond of a molecule to a metallic electrode is known to have a crucial influence on the molecular conductance. As electronic functionalities are integrated into molecules or several subunits are connected to a three-dimensional multiterminal molecule, it is not obvious that a ''well-known'' chemical linker group will lead to the bonding configuration known from simpler molecules. We investigated a series of tripodal molecules on metal surfaces by STM. The chemical linker groups and the complex connecting the three wire-units are varied. We find that the position of molecules on the surface is governed by a subtle balance of intermolecular and molecule-surface interactions, partly in strong contrast to expectations. This emphasizes the need to characterize the nature of molecule-electrode contacts along with the investigation of the electronic conductance.

  10. How to repel hot water from a superhydrophobic surface?

    KAUST Repository

    Yu, Zhejun

    2014-01-01

    Superhydrophobic surfaces, with water contact angles greater than 150° and slide angles less than 10°, have attracted a great deal of attention due to their self-cleaning ability and excellent water-repellency. It is commonly accepted that a superhydrophobic surface loses its superhydrophobicity in contact with water hotter than 50 °C. Such a phenomenon was recently demonstrated by Liu et al. [J. Mater. Chem., 2009, 19, 5602], using both natural lotus leaf and artificial leaf-like surfaces. However, our work has shown that superhydrophobic surfaces maintained their superhydrophobicity, even in water at 80 °C, provided that the leaf temperature is greater than that of the water droplet. In this paper, we report on the wettability of water droplets on superhydrophobic thin films, as a function of both their temperatures. The results have shown that both the water contact and slide angles on the surfaces will remain unchanged when the temperature of the water droplet is greater than that of the surface. The water contact angle, or the slide angle, will decrease or increase, however, with droplet temperatures increasingly greater than that of the surfaces. We propose that, in such cases, the loss of superhydrophobicity of the surfaces is caused by evaporation of the hot water molecules and their condensation on the cooler surface. © 2014 the Partner Organisations.

  11. Part 2: Surface water quality

    International Nuclear Information System (INIS)

    1997-01-01

    In 1996 the surface water quality measurements were performed, according to the Agreement, at 8 profiles on the Hungarian territory and at 15 profiles on the Slovak territory. Basic physical and chemical parameters (as water temperature, pH values, conductivity, suspended solids, cations and anions (nitrates, ammonium ion, nitrites, total nitrogen, phosphates, total phosphorus, oxygen and organic carbon regime parameters), metals (iron, manganese and heavy metals), biological and microbiological parameters (coliform bacteria, chlorophyll-a, saprobity index and other biological parameters) and quality of sediment were measured

  12. Influence of TiO{sub 2} Surface Properties on Water Pollution Treatment and Photocatalytic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Min [Southwest Univ. of Science and Technology, Mianyang (China)

    2013-03-15

    The titania surface showed different characteristics depending on the charge of the dye molecules. Compared with the MB molecules, the negatively charged MO molecules strongly adsorbed on the titania surface. Furthermore, the decomposition kinetics of the dye molecules by the photocatalytic activity also deepened with the charge of the dye molecules. The relation between the UV irradiation time and the molar ratio of the decomposed dye molecules followed the Avrami equation. According to the results of the analysis by using the Avrami equation, the MO molecules were decomposed on the titania particle surface. In contrast, the MB molecules were decomposed in the aqueous solution. The difference in kinetics was related to the interaction of the dye molecules and the titania surface. These preferential adsorption and decomposition characteristics will improve its applications in water pollution treatment.

  13. Evaporation of tiny water aggregation on solid surfaces with different wetting properties.

    Science.gov (United States)

    Wang, Shen; Tu, Yusong; Wan, Rongzheng; Fang, Haiping

    2012-11-29

    The evaporation of a tiny amount of water on the solid surface with different wettabilities has been studied by molecular dynamics simulations. From nonequilibrium MD simulations, we found that, as the surface changed from hydrophobic to hydrophilic, the evaporation speed did not show a monotonic decrease as intuitively expected, but increased first, and then decreased after it reached a maximum value. The analysis of the simulation trajectory and calculation of the surface water interaction illustrate that the competition between the number of water molecules on the water-gas surface from where the water molecules can evaporate and the potential barrier to prevent those water molecules from evaporating results in the unexpected behavior of the evaporation. This finding is helpful in understanding the evaporation on biological surfaces, designing artificial surfaces of ultrafast water evaporating, or preserving water in soil.

  14. Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

    Energy Technology Data Exchange (ETDEWEB)

    Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

  15. Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

    International Nuclear Information System (INIS)

    Liao Ruijin; Zhu Mengzhao; Yang Lijun; Zhou Xin; Gong Chunyan

    2011-01-01

    Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

  16. Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

    Energy Technology Data Exchange (ETDEWEB)

    Liao Ruijin [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Zhu Mengzhao, E-mail: xiaozhupost@163.co [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Yang Lijun; Zhou Xin; Gong Chunyan [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China)

    2011-03-01

    Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

  17. Single-molecule conductivity of non-redox and redox molecules at pure and gold-mined Au(111)-electrode surfaces

    DEFF Research Database (Denmark)

    Zhang, Jingdong; Chi, Qijin; Ulstrup, Jens

    The structure, two-dimensional organization, and function of molecules immobilized on solid surfaces can be addressed in a degree of detail that has reached the level of the single-molecule. In this context redox molecules are “smart” molecules adding sophisticated electronic function. Redox meta...

  18. Molecular multipole moments of water molecules in ice Ih

    International Nuclear Information System (INIS)

    Batista, E.R.; Xantheas, S.S.; Jonsson, H.

    1998-01-01

    We have used an induction model including dipole, dipole endash quadrupole, quadrupole endash quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments to study the electric field in ice. The self-consistent induction calculations gave an average total dipole moment of 3.09 D, a 67% increase over the dipole moment of an isolated water molecule. A previous, more approximate induction model study by Coulson and Eisenberg [Proc. R. Soc. Lond. A 291, 445 (1966)] suggested a significantly smaller average value of 2.6 D. This value has been used extensively in recent years as a reference point in the development of various polarizable interaction potentials for water as well as for assessment of the convergence of water cluster properties to those of bulk. The reason for this difference is not due to approximations made in the computational scheme of Coulson and Eisenberg but rather due to the use of less accurate values for the molecular multipoles in these earlier calculations. copyright 1998 American Institute of Physics

  19. Advances on the nanostructuration of magnetic molecules on surfaces: the case of single-molecule magnets (SMM).

    Science.gov (United States)

    Gómez-Segura, Jordi; Veciana, Jaume; Ruiz-Molina, Daniel

    2007-09-28

    SMMs exhibit slow magnetization relaxation rates characteristic of nanodomain particles whose origin is however on individual molecules. For this reason, they have attracted much interest due to their potential applications in high-density information storage devices and quantum computing applications, where for instance, each molecule can be used as a magnetic bit of information. However, for this to become a reality, several basic studies such as their deposition on surfaces are still highly required. Here we will revise all the experimental approximations that have been so far reported for their addressing, nanostructuration and study on surfaces, from the use of stamps as templates to their anchorage to gold surface through the use of thiol-based ligands. It is also important to emphasize that the results and methodologies described along this review are applicable not only to SMMs but to any molecular material.

  20. Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations

    International Nuclear Information System (INIS)

    Markovic, M.I.

    1974-01-01

    Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy

  1. Cooperativity in Surface Bonding and Hydrogen Bonding of Water and Hydroxyl at Metal Surfaces

    DEFF Research Database (Denmark)

    Schiros, T.; Ogasawara, H.; Naslund, L. A.

    2010-01-01

    of the mixed phase at metal surfaces. The surface bonding can be considered to be similar to accepting a hydrogen bond, and we can thereby apply general cooperativity rules developed for hydrogen-bonded systems. This provides a simple understanding of why water molecules become more strongly bonded...... to the surface upon hydrogen bonding to OH and why the OH surface bonding is instead weakened through hydrogen bonding to water. We extend the application of this simple model to other observed cooperativity effects for pure water adsorption systems and H3O+ on metal surfaces.......We examine the balance of surface bonding and hydrogen bonding in the mixed OH + H2O overlayer on Pt(111), Cu(111), and Cu(110) via density functional theory calculations. We find that there is a cooperativity effect between surface bonding and hydrogen bonding that underlies the stability...

  2. Site-Specific Molecule-Surface Interactions on Metal Oxides

    National Research Council Canada - National Science Library

    Reisler, Hanna

    1998-01-01

    .... At low incident energies rotational and translational temperatures of scattered HCl were equal to the surface temperature, and residence times in the millisecond regime were observed at low surface temperature. When HCl(v=2, J=1...

  3. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  4. Water adsorption induced in-plane domain switching on BaTiO{sub 3} surface

    Energy Technology Data Exchange (ETDEWEB)

    Li, X.; Bai, Y.; Su, Y. J., E-mail: yjsu@ustb.edu.cn [Corrosion and Protection Center, Key Laboratory for Environmental Fracture (MOE), University of Science and Technology Beijing, Beijing 100083 (China); Wang, B. C. [Corrosion and Protection Center, Key Laboratory for Environmental Fracture (MOE), University of Science and Technology Beijing, Beijing 100083 (China); Multiscale Materials Modelling group, Department of Materials and Engineering, Royal Institute of Technology, SE-10044 Stockholm (Sweden)

    2015-09-07

    In this study, the influences of the adsorption of water molecules on the changes in the atomic and electric structures of BaTiO{sub 3} surface were investigated using ab initio calculation. Water molecules are molecularly and dissociatively adsorbed on the BaTiO{sub 3} surface, which makes electrons transfer from water molecules to the BaTiO{sub 3} surface. The redistribution of electrons in the BaTiO{sub 3} surface layers weakens the Ba-O interactions and strengthens the Ti-O interactions, so that the Ti atom shifts in TiO{sub 2} plane, i.e., an in-plane domain switching. The adsorption of water molecules on BaTiO{sub 3} surfaces also results in a reduction in the surface rumpling.

  5. Molecules on vicinal Au surfaces studied by scanning tunnelling microscopy

    International Nuclear Information System (INIS)

    Kroeger, J; Neel, N; Jensen, H; Berndt, R; Rurali, R; Lorente, N

    2006-01-01

    Using low-temperature scanning tunnelling microscopy and spectroscopy we investigated the adsorption characteristics of 3,4,9,10-perylenetetracarboxylic-dianhydride and fullerenes on Au(788), Au(433), and Au(778). On Au(788) and Au(778), 3,4,9,10-perylenetetracarboxylic-dianhydride exhibits three coexisting superstructures, which do not reflect the periodicity of the hosting substrate. The adsorption on Au(433) leads to the formation of molecule chains along the step edges after annealing the sample. Fullerene molecules on Au(788) arrange in a mesh of islands, which extends over several hundreds of nanometres with an extraordinarily high periodicity. A combination of fullerene adsorption and annealing leads to facetting of Au(433) and the formation of extraordinarily long fullerene stripes

  6. Modelling global fresh surface water temperature

    NARCIS (Netherlands)

    Beek, L.P.H. van; Eikelboom, T.; Vliet, M.T.H. van; Bierkens, M.F.P.

    2011-01-01

    Temperature directly determines a range of water physical properties including vapour pressure, surface tension, density and viscosity, and the solubility of oxygen and other gases. Indirectly water temperature acts as a strong control on fresh water biogeochemistry, influencing sediment

  7. Theoretical Study of Sodium-Water Surface Reaction Mechanism

    Science.gov (United States)

    Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR).

  8. Theoretical study of sodium-water surface reaction mechanism

    International Nuclear Information System (INIS)

    Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro

    2012-01-01

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR). (author)

  9. Groundwater-surface water interaction

    International Nuclear Information System (INIS)

    White, P.A.; Clausen, B.; Hunt, B.; Cameron, S.; Weir, J.J.

    2001-01-01

    This chapter discusses natural and modified interactions between groundwater and surface water. Theory on recharge to groundwater from rivers is introduced, and the relative importance of groundwater recharge from rivers is illustrated with an example from the Ngaruroro River, Hawke's Bay. Some of the techniques used to identify and measure recharge to groundwater from gravel-bed rivers will be outlined, with examples from the Ngaruroro River, where the recharge reach is relatively well defined, and from the Rakaia River, where it is poorly defined. Groundwater recharged from rivers can have characteristic chemical and isotopic signatures, as shown by Waimakariri River water in the Christchurch-West Melton groundwater system. The incorporation of groundwater-river interaction in a regional groundwater flow model is outlined for the Waimea Plains, and relationships between river scour and groundwater recharge are examined for the Waimakariri River. Springs are the result of natural discharge from groundwater systems and are important water sources. The interactions between groundwater systems, springs, and river flow for the Avon River in New Zealand will be outlined. The theory of depletion of stream flow by groundwater pumpage will be introduced with a case study from Canterbury, and salt-water intrusion into groundwater systems with examples from Nelson and Christchurch. The theory of artificial recharge to groundwater systems is introduced with a case study from Hawke's Bay. Wetlands are important to flora, and the relationship of the wetland environment to groundwater hydrology will be discussed, with an example from the South Taupo wetland. (author). 56 refs., 25 figs., 3 tabs

  10. Distribution of binding energies of a water molecule in the water liquid-vapor interface

    Energy Technology Data Exchange (ETDEWEB)

    Chempath, Shaji [Los Alamos National Laboratory; Pratt, Lawrence R [TULANE UNIV

    2008-01-01

    Distributions of binding energies of a water molecule in the water liquid-vapor interface are obtained on the basis of molecular simulation with the SPC/E model of water. These binding energies together with the observed interfacial density profile are used to test a minimally conditioned Gaussian quasi-chemical statistical thermodynamic theory. Binding energy distributions for water molecules in that interfacial region clearly exhibit a composite structure. A minimally conditioned Gaussian quasi-chemical model that is accurate for the free energy of bulk liquid water breaks down for water molecules in the liquid-vapor interfacial region. This breakdown is associated with the fact that this minimally conditioned Gaussian model would be inaccurate for the statistical thermodynamics of a dilute gas. Aggressive conditioning greatly improves the performance of that Gaussian quasi-chemical model. The analogy between the Gaussian quasi-chemical model and dielectric models of hydration free energies suggests that naive dielectric models without the conditioning features of quasi-chemical theory will be unreliable for these interfacial problems. Multi-Gaussian models that address the composite nature of the binding energy distributions observed in the interfacial region might provide a mechanism for correcting dielectric models for practical applications.

  11. Structure investigation of organic molecules on Au(111) surfaces; Strukturuntersuchung organischer Molekuele auf Au(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Kazempoor, Michel

    2009-02-02

    The present work covers two topics namely the coadsorption of formic acid and water on Au(111) and the structure of biphenylalkanthiole SAMs on Au(111) surfaces. The coadsorption of formic acid and water on Au(111) surfaces has been investigated by means of vibrational and photoelectron spectroscopy (HREELS, XPS). Formic acid adsorbs at 90 K molecularly with vibrational modes characteristic for flat lying zig-zag chains in the mono- and multilayer regime, like in solid formic acid. The structure of the flat lying formic acid chains was determined by low energy electron diffraction (LEED) as a (2r3 x r19) unit cell. Annealing results in a complete desorption at 190 K. Sequential adsorption of formic acid and water at 90 K shows no significant chemical interaction. Upon annealing the coadsorbed layer to 140 K a hydrogenbonded cyclic complex of formic acid with one water molecule could be identified using isotopically labelled adsorbates. Upon further annealing this complex decomposes leaving molecularly adsorbed formic acid on the surface at 160 K, accompanied by a proton exchange between formic acid and water. The influence of the alkane spacer chain length on the structure of biphenylalkanethiols on Au(111) surfaces was investigated as well. A systematic study was done on BPn-SAMs deposited from the gas phase. For every chain length a structure was found by LEED. Furthermore the influence of temperature on the structure was investigated in the range from room temperature up to about 400 K. To obviate influences from different preparation methods BP3 and BP4 was deposited from gas phase and from solution. No LEED spots were observed on BP4 SAMs deposited from solution. For BP3 an influence of the preparation could be excluded. For all BPn-SAMs a good agreement between LEED and STM data's was found. Nevertheless different unit cells were determined by LEED and STM consistent structures could be suggested considering the unit cell size given by LEED and the

  12. Surface functionalization of bioactive glasses with natural molecules of biological significance, Part I: Gallic acid as model molecule

    Science.gov (United States)

    Zhang, Xin; Ferraris, Sara; Prenesti, Enrico; Verné, Enrica

    2013-12-01

    Gallic acid (3,4,5-trihydroxybenzoic acid, GA) and its derivatives are a group of biomolecules (polyphenols) obtained from plants. They have effects which are potentially beneficial to heath, for example they are antioxidant, anticarcinogenic and antibacterial, as recently investigated in many fields such as medicine, food and plant sciences. The main drawbacks of these molecules are both low stability and bioavailability. In this research work the opportunity to graft GA to bioactive glasses is investigated, in order to deliver the undamaged biological molecule into the body, using the biomaterial surfaces as a localized carrier. GA was considered for functionalization since it is a good model molecule for polyphenols and presents several interesting biological activities, like antibacterial, antioxidant and anticarcinogenic properties. Two different silica based bioactive glasses (SCNA and CEL2), with different reactivity, were employed as substrates. UV photometry combined with the Folin&Ciocalteu reagent was adopted to test the concentration of GA in uptake solution after functionalization. This test verified how much GA consumption occurred with surface modification and it was also used on solid samples to test the presence of GA on functionalized glasses. XPS and SEM-EDS techniques were employed to characterize the modification of material surface properties and functional group composition before and after functionalization.

  13. Single OR molecule and OR atomic circuit logic gates interconnected on a Si(100)H surface

    International Nuclear Information System (INIS)

    Ample, F; Joachim, C; Duchemin, I; Hliwa, M

    2011-01-01

    Electron transport calculations were carried out for three terminal OR logic gates constructed either with a single molecule or with a surface dangling bond circuit interconnected on a Si(100)H surface. The corresponding multi-electrode multi-channel scattering matrix (where the central three terminal junction OR gate is the scattering center) was calculated, taking into account the electronic structure of the supporting Si(100)H surface, the metallic interconnection nano-pads, the surface atomic wires and the molecule. Well interconnected, an optimized OR molecule can only run at a maximum of 10 nA output current intensity for a 0.5 V bias voltage. For the same voltage and with no molecule in the circuit, the output current of an OR surface atomic scale circuit can reach 4 μA.

  14. Rapid and accurate prediction and scoring of water molecules in protein binding sites.

    Directory of Open Access Journals (Sweden)

    Gregory A Ross

    Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.

  15. Multilayer Choline Phosphate Molecule Modified Surface with Enhanced Cell Adhesion but Resistance to Protein Adsorption.

    Science.gov (United States)

    Chen, Xingyu; Yang, Ming; Liu, Botao; Li, Zhiqiang; Tan, Hong; Li, Jianshu

    2017-08-22

    Choline phosphate (CP), which is a new zwitterionic molecule, and has the reverse order of phosphate choline (PC) and could bind to the cell membrane though the unique CP-PC interaction. Here we modified a glass surface with multilayer CP molecules using surface-initiated atom-transfer radical polymerization (SI-ATRP) and the ring-opening method. Polymeric brushes of (dimethylamino)ethyl methacrylate (DMAEMA) were synthesized by SI-ATRP from the glass surface. Then the grafted PDMAEMA brushes were used to introduce CP groups to fabricate the multilayer CP molecule modified surface. The protein adsorption experiment and cell culture test were used to evaluate the biocompatibility of the modified surfaces by using human umbilical veinendothelial cells (HUVECs). The protein adsorption results demonstrated that the multilayer CP molecule decorated surface could prevent the adsorption of fibrinogen and serum protein. The adhesion and proliferation of cells were improved significantly on the multilayer CP molecule modified surface. Therefore, the biocompatibility of the material surface could be improved by the modified multilayer CP molecule, which exhibits great potential for biomedical applications, e.g., scaffolds in tissue engineering.

  16. Selection of conformational states in surface self-assembly for a molecule with eight possible pairs of surface enantiomers

    DEFF Research Database (Denmark)

    Nuermaimaiti, Ajiguli; Schultz-Falk, Vickie; Lind Cramer, Jacob

    2016-01-01

    Self-assembly of a molecule with many distinct conformational states, resulting in eight possible pairs of surface enantiomers, is investigated on a Au(111) surface under UHV conditions. The complex molecule is equipped with alkyl and carboxyl moieties to promote controlled self-assembly of lamel......Self-assembly of a molecule with many distinct conformational states, resulting in eight possible pairs of surface enantiomers, is investigated on a Au(111) surface under UHV conditions. The complex molecule is equipped with alkyl and carboxyl moieties to promote controlled self......-assembly of lamellae structures. From statistical analysis of Scanning Tunnelling Microscopy (STM) data we observe a clear selection of specific conformational states after self-assembly. Using Density Functional Theory (DFT) calculations we rationalise how this selection is correlated to the orientation of the alkyl...

  17. On determination of the dynamics of hydrocarbon molecules on catalyst's surfaces by means of neutron scattering

    International Nuclear Information System (INIS)

    Stockmeyer, R.

    1976-01-01

    The intensity distribution of slow neutrons scattered by adsorbed hydrocarbon molecules contains information on the dynamics of the molecules. In this paper the scattering law for incoherently scattering molecules is derived taking into account the very different mobility perpendicular and parallel to the surface. In contrast to the well known scattering law of threedimensionally diffusing particles the scattering law for twodimensional diffusion diverges logarithmically at zero energy transfer. Conclusions relevant to the interpretation of neutron scattering data are discussed. (orig.) [de

  18. Two-dimensional crystallography of amphiphilic molecules at the air-water interface

    DEFF Research Database (Denmark)

    Jacquemain, D.; Grayer Wolf, S.; Leveiller, F.

    1992-01-01

    The advent of well-collimated, high-intensity synchrotron X-ray sources and the consequent development of surface-specific X-ray diffraction and fluorescence techniques have recently revolutionized the study of Langmuir monolayers at the air-liquid interface. These methods allowed for the first......, and review recent results obtained from them for Langmuir films. The methods have been successfully applied in the elucidation of the structure of crystalline aggregates of amphiphilic molecules such as alcohols, carboxylic acids and their salts, alpha-amino acids, and phospholipids at the water surface....... In addition, it became possible to monitor by diffraction the growth and dissolution of the crystalline self-aggregates as well as structural changes occurring by phase transitions. Furthermore, the surface X-ray methods shed new light on the structure of the underlying ionic layer of attached solvent...

  19. Adsorption of simple molecules on clean metal surfaces

    International Nuclear Information System (INIS)

    Na Lamphun, O.-A.

    1980-06-01

    The adsorption of nitric oxide, oxygen, krypton and xenon on evaporated tungsten, nickel and iron films is studied. The theoretical and experimental aspects of adsorption are reviewed, a preliminary study of adsorption by the volumetric method is presented, surface potential and sticking probability studies of adsorption using ion gauges are investigated and an analysis of residual gases, sticking probability and surface potential studies using quadrupole mass spectrometry, given. (author)

  20. Delta self-consistent field method to obtain potential energy surfaces of excited molecules on surfaces

    DEFF Research Database (Denmark)

    Gavnholt, Jeppe; Olsen, Thomas; Engelund, Mads

    2008-01-01

    is a density-functional method closely resembling standard density-functional theory (DFT), the only difference being that in Delta SCF one or more electrons are placed in higher lying Kohn-Sham orbitals instead of placing all electrons in the lowest possible orbitals as one does when calculating the ground......-state energy within standard DFT. We extend the Delta SCF method by allowing excited electrons to occupy orbitals which are linear combinations of Kohn-Sham orbitals. With this extra freedom it is possible to place charge locally on adsorbed molecules in the calculations, such that resonance energies can...... be estimated, which is not possible in traditional Delta SCF because of very delocalized Kohn-Sham orbitals. The method is applied to N2, CO, and NO adsorbed on different metallic surfaces and compared to ordinary Delta SCF without our modification, spatially constrained DFT, and inverse...

  1. Structural and electronic properties of single molecules and organic layers on surfaces

    NARCIS (Netherlands)

    Sotthewes, Kai

    2016-01-01

    Single molecules and organic layers on well-defined solid surfaces have attracted tremendous attention owing to their interesting physical and chemical properties. The ultimate utility of single molecules or self-assembled monolayers (SAMs) for potential applications is critically dependent on the

  2. Anchoring of organic molecules to a metal surface: HtBDC on Cu(110)

    DEFF Research Database (Denmark)

    Schunack, M.; Petersen, L.; Kuhnle, A.

    2001-01-01

    The interaction of largish molecules with metal surfaces has been studied by combining the imaging and manipulation capabilities of the scanning tunneling microscope (STM). At the atomic scale, the STM results directly reveal that the adsorption of a largish organic molecule can induce...

  3. Insight into Chemistry on Cloud/Aerosol Water Surfaces.

    Science.gov (United States)

    Zhong, Jie; Kumar, Manoj; Francisco, Joseph S; Zeng, Xiao Cheng

    2018-05-15

    Cloud/aerosol water surfaces exert significant influence over atmospheric chemical processes. Atmospheric processes at the water surface are observed to follow mechanisms that are quite different from those in the gas phase. This Account summarizes our recent findings of new reaction pathways on the water surface. We have studied these surface reactions using Born-Oppenheimer molecular dynamics simulations. These studies provide useful information on the reaction time scale, the underlying mechanism of surface reactions, and the dynamic behavior of the product formed on the aqueous surface. According to these studies, the aerosol water surfaces confine the atmospheric species into a specific orientation depending on the hydrophilicity of atmospheric species or the hydrogen-bonding interactions between atmospheric species and interfacial water. As a result, atmospheric species are activated toward a particular reaction on the aerosol water surface. For example, the simplest Criegee intermediate (CH 2 OO) exhibits high reactivity toward the interfacial water and hydrogen sulfide, with the reaction times being a few picoseconds, 2-3 orders of magnitude faster than that in the gas phase. The presence of interfacial water molecules induces proton-transfer-based stepwise pathways for these reactions, which are not possible in the gas phase. The strong hydrophobicity of methyl substituents in larger Criegee intermediates (>C1), such as CH 3 CHOO and (CH 3 ) 2 COO, blocks the formation of the necessary prereaction complexes for the Criegee-water reaction to occur at the water droplet surface, which lowers their proton-transfer ability and hampers the reaction. The aerosol water surface provides a solvent medium for acids (e.g., HNO 3 and HCOOH) to participate in reactions via mechanisms that are different from those in the gas and bulk aqueous phases. For example, the anti-CH 3 CHOO-HNO 3 reaction in the gas phase follows a direct reaction between anti-CH 3 CHOO and HNO 3

  4. Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures

    Science.gov (United States)

    Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.

    2018-05-01

    Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.

  5. Renormalization of Optical Excitations in Molecules near a Metal Surface

    DEFF Research Database (Denmark)

    García Lastra, Juan Maria; Thygesen, Kristian Sommer

    2011-01-01

    consequence we find that close to the metal surface the optical gap of benzene can exceed its quasiparticle gap. A classical image charge model for the screened Coulomb interaction can account for all these effects which, on the other hand, are completely missed by standard time-dependent density functional...

  6. Desorption dynamics of deuterium molecules from the Si(100)-(3x1) dideuteride surface.

    Science.gov (United States)

    Niida, T; Tsurumaki, H; Namiki, A

    2006-01-14

    We measured polar angle (theta)-resolved time-of-flight spectra of D2 molecules desorbing from the Si(100)-(3x1) dideuteride surface. The desorbing D2 molecules exhibit a considerable translational heating with mean desorption kinetic energies of approximately 0.25 eV, which is mostly independent of the desorption angles for 0 degreesdynamics of deuterium was discussed along the principle of detailed balance to predict their adsorption dynamics onto the monohydride Si surface.

  7. Water surface coverage effects on reactivity of plasma oxidized Ti films

    International Nuclear Information System (INIS)

    Pranevicius, L.; Pranevicius, L.L.; Vilkinis, P.; Baltaragis, S.; Gedvilas, K.

    2014-01-01

    Highlights: • The reactivity of Ti films immersed in water vapor plasma depends on the surface water coverage. • The adsorbed water monolayers are disintegrated into atomic constituents on the hydrophilic TiO 2 under plasma radiation. • The TiO 2 surface covered by water multilayer loses its ability to split adsorbed water molecules under plasma radiation. - Abstract: The behavior of the adsorbed water on the surface of thin sputter deposited Ti films maintained at room temperature was investigated in dependence on the thickness of the resulting adsorbed water layer, controllably injecting water vapor into plasma. The surface morphology and microstructure were used to characterize the surfaces of plasma treated titanium films. Presented experimental results showed that titanium films immersed in water vapor plasma at pressure of 10–100 Pa promoted the photocatalytic activity of overall water splitting. The surfaces of plasma oxidized titanium covered by an adsorbed hydroxyl-rich island structure water layer and activated by plasma radiation became highly chemically reactive. As water vapor pressure increased up to 300–500 Pa, the formed water multilayer diminished the water oxidation and, consequently, water splitting efficiency decreased. Analysis of the experimental results gave important insights into the role an adsorbed water layer on surface of titanium exposed to water vapor plasma on its chemical activity and plasma activated electrochemical processes, and elucidated the surface reactions that could lead to the split of water molecules

  8. In Situ Detection of Organic Molecules on the Martian Surface With the Mars Organic Molecule Analyzer (MOMA) on Exomars 2018

    Science.gov (United States)

    Li, Xiang; Brinckerhoff, William B.; Pinnick, Veronica T; van Amerom, Friso H. W.; Danell, Ryan M.; Arevalo, Ricardo D., Jr.; Getty, Stephanie; Mahaffy, Paul R.

    2015-01-01

    The Mars Organic Molecule Analyzer (MOMA) investigation on the 2018 ExoMars rover will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from radiative and oxidative degradation. The MOMA instrument is centered around a miniaturized linear ion trap (LIT) that facilitates two modes of operation: i) pyrolysisgas chromatography mass spectrometry (pyrGC-MS); and, ii) laser desorptionionization mass spectrometry (LDI-MS) at ambient Mars pressures. The LIT also enables the structural characterization of complex molecules via complementary analytical capabilities, such as multi-frequency waveforms (i.e., SWIFT) and tandem mass spectrometry (MSMS). When combined with the complement of instruments in the rovers Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds.

  9. Magnetic memory of a single-molecule quantum magnet wired to a gold surface.

    Science.gov (United States)

    Mannini, Matteo; Pineider, Francesco; Sainctavit, Philippe; Danieli, Chiara; Otero, Edwige; Sciancalepore, Corrado; Talarico, Anna Maria; Arrio, Marie-Anne; Cornia, Andrea; Gatteschi, Dante; Sessoli, Roberta

    2009-03-01

    In the field of molecular spintronics, the use of magnetic molecules for information technology is a main target and the observation of magnetic hysteresis on individual molecules organized on surfaces is a necessary step to develop molecular memory arrays. Although simple paramagnetic molecules can show surface-induced magnetic ordering and hysteresis when deposited on ferromagnetic surfaces, information storage at the molecular level requires molecules exhibiting an intrinsic remnant magnetization, like the so-called single-molecule magnets (SMMs). These have been intensively investigated for their rich quantum behaviour but no magnetic hysteresis has been so far reported for monolayers of SMMs on various non-magnetic substrates, most probably owing to the chemical instability of clusters on surfaces. Using X-ray absorption spectroscopy and X-ray magnetic circular dichroism synchrotron-based techniques, pushed to the limits in sensitivity and operated at sub-kelvin temperatures, we have now found that robust, tailor-made Fe(4) complexes retain magnetic hysteresis at gold surfaces. Our results demonstrate that isolated SMMs can be used for storing information. The road is now open to address individual molecules wired to a conducting surface in their blocked magnetization state, thereby enabling investigation of the elementary interactions between electron transport and magnetism degrees of freedom at the molecular scale.

  10. Interactions between nitrogen molecules and barium atoms on Ru (0001) surface

    International Nuclear Information System (INIS)

    Zhao Xinxin; Mi Yiming; Xu Hongxia; Wang Lili; Ren Li; Tao Xiangming; Tan Mingqiu

    2011-01-01

    We had performed first principles calculations on interactions between nitrogen molecules and barium atoms on Ru (0001) surface using density function theory methods. It was shown that effects of barium atoms weakened the bond strength of nitrogen molecules. The bond length of nitrogen molecule increases from 0.113 nm on Ru (001)-N 2 to 0.120 nm on Ru (001)-N 2 /Ba surface. While stretch vibrational frequency of nitrogen molecule decreased from 2222 cm -1 and charge transfer toward nitrogen molecule increased from 0.3 e to 1.1 e. Charge was mainly translated from 6 s orbitals of barium atoms to 4 d orbitals of substrate, which enhanced the hybridization between 4 d and 2 π orbitals and increased the dipole moment of 5 σ and d π orbitals of nitrogen molecule. The molecular dipole moment of nitrogen molecule was increased by -0.136 e Anstrom. It was suggested that barium had some characters to be an electronic promoter on the process of activating nitrogen molecules on Ru (0001) surface. (authors)

  11. Manipulating individual dichlorotin phthalocyanine molecules on Cu(100) surface at room temperature by scanning tunneling microscopy

    International Nuclear Information System (INIS)

    Li, Chao; Xiang, Feifei; Wang, Zhongping; Liu, Xiaoqing; Jiang, Danfeng; Wang, Li; Wang, Guang; Zhang, Xueao; Chen, Wei

    2014-01-01

    Single molecule manipulations have been achieved on dichlorotin phthalocyanine(SnCl 2 Pc) molecules adsorbed on Cu (100) at room temperature. Scanning tunneling microscopy observations directly demonstrate that the individual SnCl 2 Pc molecules can be moved along the [100] direction on Cu(100) surface by employing a scanning tunneling microscope tip fixed at the special position of the molecules. The orientation of the molecule can be switched between two angles of ±28° with respect to the [011] surface direction in the same way. Dependences of the probability of molecular motion on the distances between the tip and the molecules reveal that the mechanism for such manipulation of a SnCl 2 Pc molecule is dominated by the repulsive interactions between the tip and the molecules. With the assistance of this manipulation process, a prototype molecular storage array with molecular orientation as information carrier and an artificial hydrogen bonded supramolecular structure have been constructed on the surface. (paper)

  12. Anchoring of alkyl chain molecules on oxide surface using silicon alkoxide

    Energy Technology Data Exchange (ETDEWEB)

    Narita, Ayumi, E-mail: narita.ayumi@jaea.go.jp [Quantum Beam Science Directorate, Japan Atomic Energy Agency, Tokai-mura, Naka-gun, Ibaraki-ken 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, Bunnkyo, Mito-shi, Ibaraki-ken 310-8512 (Japan); Baba, Yuji; Sekiguchi, Tetsuhiro; Shimoyama, Iwao; Hirao, Norie [Quantum Beam Science Directorate, Japan Atomic Energy Agency, Tokai-mura, Naka-gun, Ibaraki-ken 319-1195 (Japan); Yaita, Tsuyoshi [Quantum Beam Science Directorate, Japan Atomic Energy Agency, Tokai-mura, Naka-gun, Ibaraki-ken 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, Bunnkyo, Mito-shi, Ibaraki-ken 310-8512 (Japan)

    2012-01-01

    Chemical states of the interfaces between octadecyl-triethoxy-silane (ODTS) molecules and sapphire surface were measured by X-ray photoelectron spectroscopy (XPS) and near edge X-ray absorption fine structure (NEXAFS) using synchrotron soft X-rays. The nearly self-assembled monolayer of ODTS was formed on the sapphire surface. For XPS and NEXAFS measurements, it was elucidated that the chemical bond between silicon alkoxide in ODTS and the surface was formed, and the alkane chain of ODTS locates upper side on the surface. As a result, it was elucidated that the silicon alkoxide is a good anchor for the immobilization of organic molecules on oxides.

  13. Observation of the adsorption and desorption of vibrationally excited molecules on a metal surface

    Science.gov (United States)

    Shirhatti, Pranav R.; Rahinov, Igor; Golibrzuch, Kai; Werdecker, Jörn; Geweke, Jan; Altschäffel, Jan; Kumar, Sumit; Auerbach, Daniel J.; Bartels, Christof; Wodtke, Alec M.

    2018-06-01

    The most common mechanism of catalytic surface chemistry is that of Langmuir and Hinshelwood (LH). In the LH mechanism, reactants adsorb, become thermalized with the surface, and subsequently react. The measured vibrational (relaxation) lifetimes of molecules adsorbed at metal surfaces are in the range of a few picoseconds. As a consequence, vibrational promotion of LH chemistry is rarely observed, with the exception of LH reactions occurring via a molecular physisorbed intermediate. Here, we directly detect adsorption and subsequent desorption of vibrationally excited CO molecules from a Au(111) surface. Our results show that CO (v = 1) survives on a Au(111) surface for 1 × 10-10 s. Such long vibrational lifetimes for adsorbates on metal surfaces are unexpected and pose an interesting challenge to the current understanding of vibrational energy dissipation on metal surfaces. They also suggest that vibrational promotion of surface chemistry might be more common than is generally believed.

  14. Structural analysis on mutation residues and interfacial water molecules for human TIM disease understanding

    Science.gov (United States)

    2013-01-01

    Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study

  15. Current-induced switching of magnetic molecules on topological insulator surfaces

    Science.gov (United States)

    Locane, Elina; Brouwer, Piet W.

    2017-03-01

    Electrical currents at the surface or edge of a topological insulator are intrinsically spin polarized. We show that such surface or edge currents can be used to switch the orientation of a molecular magnet weakly coupled to the surface or edge of a topological insulator. For the edge of a two-dimensional topological insulator as well as for the surface of a three-dimensional topological insulator the application of a well-chosen surface or edge current can lead to a complete polarization of the molecule if the molecule's magnetic anisotropy axis is appropriately aligned with the current direction. For a generic orientation of the molecule a nonzero but incomplete polarization is obtained. We calculate the probability distribution of the magnetic states and the switching rates as a function of the applied current.

  16. Anomalous water dynamics at surfaces and interfaces: synergistic effects of confinement and surface interactions

    Science.gov (United States)

    Biswas, Rajib; Bagchi, Biman

    2018-01-01

    In nature, water is often found in contact with surfaces that are extended on the scale of molecule size but small on a macroscopic scale. Examples include lipid bilayers and reverse micelles as well as biomolecules like proteins, DNA and zeolites, to name a few. While the presence of surfaces and interfaces interrupts the continuous hydrogen bond network of liquid water, confinement on a mesoscopic scale introduces new features. Even when extended on a molecular scale, natural and biological surfaces often have features (like charge, hydrophobicity) that vary on the scale of the molecular diameter of water. As a result, many new and exotic features, which are not seen in the bulk, appear in the dynamics of water close to the surface. These different behaviors bear the signature of both water-surface interactions and of confinement. In other words, the altered properties are the result of the synergistic effects of surface-water interactions and confinement. Ultrafast spectroscopy, theoretical modeling and computer simulations together form powerful synergistic approaches towards an understanding of the properties of confined water in such systems as nanocavities, reverse micelles (RMs), water inside and outside biomolecules like proteins and DNA, and also between two hydrophobic walls. We shall review the experimental results and place them in the context of theory and simulations. For water confined within RMs, we discuss the possible interference effects propagating from opposite surfaces. Similar interference is found to give rise to an effective attractive force between two hydrophobic surfaces immersed and kept fixed at a separation of d, with the force showing an exponential dependence on this distance. For protein and DNA hydration, we shall examine a multitude of timescales that arise from frustration effects due to the inherent heterogeneity of these surfaces. We pay particular attention to the role of orientational correlations and modification of the

  17. Multipole moments of water molecules in clusters and ice Ih from first principles calculations

    International Nuclear Information System (INIS)

    Batista, E.R.; Xantheas, S.S.; Jonsson, H.

    1999-01-01

    We have calculated molecular multipole moments for water molecules in clusters and in ice Ih by partitioning the charge density obtained from first principles calculations. Various schemes for dividing the electronic charge density among the water molecules were used. They include Bader close-quote s zero flux surfaces and Voronoi partitioning schemes. A comparison was also made with an induction model including dipole, dipole-quadrupole, quadrupole-quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments. We have found that the different density partitioning schemes lead to widely different values for the molecular multipoles, illustrating how poorly defined molecular multipoles are in clusters and condensed environments. For instance, the magnitude of the molecular dipole moment in ice Ih ranges between 2.3 D and 3.1 D depending on the partitioning scheme used. Within each scheme, though, the value for the molecular dipole moment in ice is larger than in the hexamer. The magnitude of the molecular dipole moment in the clusters shows a monotonic increase from the gas phase value to the one in ice Ih, with the molecular dipole moment in the water ring hexamer being smaller than the one in ice Ih for all the partitioning schemes used. copyright 1999 American Institute of Physics

  18. Experimental and Molecular Dynamics Simulation Study of Specific Ion Effect on the Graphene Oxide Surface and Investigation of the Influence on Reactive Extraction of Model Dye Molecule at Water-Organic Interface

    Czech Academy of Sciences Publication Activity Database

    Borthakur, P.; Boruah, P.K.; Hussain, N.; Sharma, B.; Das, M. R.; Matić, S.; Řeha, David; Minofar, Babak

    2016-01-01

    Roč. 120, č. 26 (2016), s. 14088-14100 ISSN 1932-7447 R&D Projects: GA ČR GA13-21053S; GA MŠk(CZ) LM2015055 Institutional support: RVO:61388971 Keywords : AIR/WATER INTERFACE * AQUEOUS-SOLUTIONS * INITIAL CONFIGURATIONS Subject RIV: EE - Microbiology, Virology Impact factor: 4.536, year: 2016

  19. Effect of nontronite smectite clay on the chemical evolution of several organic molecules under simulated Mars surface UV radiation conditions

    Science.gov (United States)

    Poch, Olivier; Dequaire, Tristan; Stalport, Fabien; Jaber, Maguy; Lambert, Jean-François; Szopa, Cyril; Coll, Patrice

    2015-04-01

    The search for organic carbon-containing molecules at the surface of Mars, as clues of past habitability or remnants of life, is a major scientific goal for Mars exploration. Several lines of evidence, including the detection of phyllosilicates, suggest that early Mars offered favorable conditions for long-term sustaining of water. As a consequence, we can assume that in those days, endogenous chemical processes, or even primitive life, may have produced organic matter on Mars. Moreover, exogenous delivery from small bodies or dust particles is likely to have brought fresh organic molecules to the surface of Mars up today. Organic matter is therefore expected to be present at the surface/subsurface of the planet. But the current environmental conditions at the surface - UV radiation, oxidants and energetic particles - generate physico-chemical processes that may affect organic molecules. On the other hand, on Earth, phyllosilicates are known to accumulate and preserve organic matter. But are phyllosilicates efficient at preserving organic molecules under the current environmental conditions at the surface of Mars? We have monitored the qualitative and quantitative evolutions of glycine, urea and adenine interacting with the Fe3+-smectite clay nontronite, one of the most abundant phyllosilicates present at the surface of Mars, under simulated Martian surface ultraviolet light (190-400 nm), mean temperature (218 ± 2 K) and pressure (6 ± 1 mbar) in a laboratory simulation setup. We have tested organic-rich samples which may be representative of the evaporation of a warm little pond of liquid water having concentrated organics on Mars. For each molecule, we have observed how the nontronite influences the quantum efficiency of its photodecomposition and the nature of its solid evolution products. The results reveal a pronounced photoprotective effect of nontronite on the evolution of glycine and adenine: their efficiencies of photodecomposition are reduced by a factor

  20. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  1. Oxide/water interfaces: how the surface chemistry modifies interfacial water properties

    International Nuclear Information System (INIS)

    Gaigeot, Marie-Pierre; Sprik, Michiel; Sulpizi, Marialore

    2012-01-01

    The organization of water at the interface with silica and alumina oxides is analysed using density functional theory-based molecular dynamics simulation (DFT-MD). The interfacial hydrogen bonding is investigated in detail and related to the chemistry of the oxide surfaces by computing the surface charge density and acidity. We find that water molecules hydrogen-bonded to the surface have different orientations depending on the strength of the hydrogen bonds and use this observation to explain the features in the surface vibrational spectra measured by sum frequency generation spectroscopy. In particular, ‘ice-like’ and ‘liquid-like’ features in these spectra are interpreted as the result of hydrogen bonds of different strengths between surface silanols/aluminols and water. (paper)

  2. Switching behavior of double-decker single molecule magnets on a metal surface

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Yingshuang; Schwoebel, Joerg; Hoffmann, Germar; Brede, Jens; Wiesendanger, Roland [University of Hamburg, Hamburg (Germany); Dillulo, Andrew [Ohio University, Athens (United States); Klyatskaya, Svetlana [Karlsruhe Institute of Technology, Karlsruhe (Germany); Ruben, Mario [Karlsruhe Institute of Technology, Karlsruhe (Germany); Universite de Strasbourg, Strasbourg (France)

    2011-07-01

    Single molecule magnets (SMM) are most promising materials for spin based molecular electronics. Due to their large magnetic anisotropy stabilized by inside chemical bonds, SMM can potentially be used for information storage at the single molecule level. For applications, it is of importance to adsorb the SMM onto surfaces and to study their subsequent conformational, electronic and magnetic properties. We have investigated the adsorption behavior of Tb and Dy based double-decker SMM on an Ir(111) surface with low temperature scanning tunneling microscopy and spectroscopy. It is found that Tb double-decker molecules bind tightly to the Ir(111) surface. By resonantly injecting tunneling electrons into its LUMO or HOMO state, the Tb double-decker molecule can be switched from a four-lobed structure to an eight-lobed structure. After switching, energy positions of the HOMO and LUMO states both shift closer to the Fermi level. Dy double-decker molecules also exhibit the same switching properties on the Ir(111) surface. The switching behavior of the molecules is tentatively attributed to a conformational change of the double-decker molecular frame.

  3. Influence of orientation averaging on the anisotropy of thermal neutrons scattering on water molecules

    International Nuclear Information System (INIS)

    Markovic, M. I.; Radunovic, J. B.

    1976-01-01

    Determination of spatial distribution of neutron flux in water, most frequently used moderator in thermal reactors, demands microscopic scattering kernels dependence on cosine of thermal neutrons scattering angle when solving the Boltzmann equation. Since spatial orientation of water molecules influences this dependence it is necessary to perform orientation averaging or rotation-vibrational intermediate scattering function for water molecules. The calculations described in this paper and the obtained results showed that methods of orientation averaging do not influence the anisotropy of thermal neutrons scattering on water molecules, but do influence the inelastic scattering

  4. Stable perovskite solar cells by surface modification with surfactant molecules

    Energy Technology Data Exchange (ETDEWEB)

    Holanda, Matheus Serra de; Nogueira, Ana Flavia, E-mail: mholandabsb@outlook.com [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Instituto de Quimica

    2016-07-01

    Full text: Surface modification on organic-inorganic perovskite films using dodecylammonium chloride was done to improve the stability of the material over the air moisture, which is considered extremely harmful to these materials and complicates their application on solar cell technology. Perovskite CH{sub 3}NH{sub 3}PbI{sub 3} was prepared by single step method using a solution containing PbI{sub 2} and CH{sub 3}NH{sub 3}I on DMF:DMSO (2:1) on a concentration of 0.88 mol L{sup -1}. The film was deposited over a planar film of TiO{sub 2}, previously deposited over FTO glass, by using spin-casting method. 25 μL of the solution was spread over the substrate which was turned at 4000 RPM for 45 s. In the last 10 s, 800 μL of monochlorobenzene was dropped. The film was submitted to a thermal treatment so the conversion of the perovskite could be completed. After the thermal treatment, the modifier was spin coated over the perovskite film from 5 and 10 mg mL{sup -1} solutions of the dodecylammonium chloride in chloroform. The perovskite films were characterized by SEM, XRD and UV-Vis spectroscopy. SEM images have shown that the modifiers agglomerate and they cover the perovskite film, forming a protection layer. XRD and UV-Vis carried out after the film preparation, 7 and 15 days after the deposition. The first results show that the protection layer is able to avoid degradation of the perovskite film. Photovoltaic devices were prepared by depositing Spiro-OMeTAD as HTM layer and gold as electrode. It was observed that the increase on the thickness of the surfactant layer causes a decrease on the short-circuit current density (JSC), which is expected since is starts to act like an insulating layer. This effect is also the cause of the reduction of the fill factor (FF). More experiments need to be carried out to improve the solar cells devices, but the present data has shown the potential of the method developed, which uses easy access surfactants and a simple

  5. Stable perovskite solar cells by surface modification with surfactant molecules

    International Nuclear Information System (INIS)

    Holanda, Matheus Serra de; Nogueira, Ana Flavia

    2016-01-01

    Full text: Surface modification on organic-inorganic perovskite films using dodecylammonium chloride was done to improve the stability of the material over the air moisture, which is considered extremely harmful to these materials and complicates their application on solar cell technology. Perovskite CH 3 NH 3 PbI 3 was prepared by single step method using a solution containing PbI 2 and CH 3 NH 3 I on DMF:DMSO (2:1) on a concentration of 0.88 mol L -1 . The film was deposited over a planar film of TiO 2 , previously deposited over FTO glass, by using spin-casting method. 25 μL of the solution was spread over the substrate which was turned at 4000 RPM for 45 s. In the last 10 s, 800 μL of monochlorobenzene was dropped. The film was submitted to a thermal treatment so the conversion of the perovskite could be completed. After the thermal treatment, the modifier was spin coated over the perovskite film from 5 and 10 mg mL -1 solutions of the dodecylammonium chloride in chloroform. The perovskite films were characterized by SEM, XRD and UV-Vis spectroscopy. SEM images have shown that the modifiers agglomerate and they cover the perovskite film, forming a protection layer. XRD and UV-Vis carried out after the film preparation, 7 and 15 days after the deposition. The first results show that the protection layer is able to avoid degradation of the perovskite film. Photovoltaic devices were prepared by depositing Spiro-OMeTAD as HTM layer and gold as electrode. It was observed that the increase on the thickness of the surfactant layer causes a decrease on the short-circuit current density (JSC), which is expected since is starts to act like an insulating layer. This effect is also the cause of the reduction of the fill factor (FF). More experiments need to be carried out to improve the solar cells devices, but the present data has shown the potential of the method developed, which uses easy access surfactants and a simple preparation method to improve the stability of

  6. Surface single-molecule dynamics controlled by entropy at low temperatures

    Science.gov (United States)

    Gehrig, J. C.; Penedo, M.; Parschau, M.; Schwenk, J.; Marioni, M. A.; Hudson, E. W.; Hug, H. J.

    2017-02-01

    Configuration transitions of individual molecules and atoms on surfaces are traditionally described using an Arrhenius equation with energy barrier and pre-exponential factor (attempt rate) parameters. Characteristic parameters can vary even for identical systems, and pre-exponential factors sometimes differ by orders of magnitude. Using low-temperature scanning tunnelling microscopy (STM) to measure an individual dibutyl sulfide molecule on Au(111), we show that the differences arise when the relative position of tip apex and molecule changes by a fraction of the molecule size. Altering the tip position on that scale modifies the transition's barrier and attempt rate in a highly correlated fashion, which results in a single-molecular enthalpy-entropy compensation. Conversely, appropriately positioning the STM tip allows selecting the operating point on the compensation line and modifying the transition rates. The results highlight the need to consider entropy in transition rates of single molecules, even at low temperatures.

  7. Nanocoating of titanium implant surfaces with organic molecules. Polysaccharides including glycosaminoglycans

    DEFF Research Database (Denmark)

    Gurzawska, Katarzyna Aleksandra; Svava, Rikke; Jørgensen, Niklas Rye

    2012-01-01

    Long-term stability of titanium implants are dependent on a variety of factors. Nanocoating with organic molecules is one of the method used to improve osseointegration. Nanoscale modification of titanium implants affects surface properties, such as hydrophilicity, biochemical bonding capacity...... and roughness. This influences cell behaviour on the surface such as adhesion, proliferation and differentiation of cells as well as the mineralization of the extracellular matrix at the implant surfaces. The aim of the present systematic review was to describe organic molecules used for surface nanocoating...... nanocoatings. The included in vivo studies, showed improvement of bone interface reactions measured as increased Bone-to-Implant Contact length and Bone Mineral Density adjacent to the polysaccharide coated surfaces. Based on existing literature, surface modification with polysaccharide and glycosaminoglycans...

  8. Probing Enzyme-Surface Interactions via Protein Engineering and Single-Molecule Techniques

    Science.gov (United States)

    2017-06-26

    SECURITY CLASSIFICATION OF: The overall objective of this research was to exploit protein engineering and fluorescence single-molecule methods to...enhance our understanding of the interaction of proteins and surfaces. Given this objective, the specific aims of this research were to: 1) exploit the...incorporation of unnatural amino acids in proteins to introduce single-molecule probes (i.e., fluorophores for fluorescence resonance energy transfer

  9. Water in contact with extended hydrophobic surfaces: Direct evidence of weak dewetting

    International Nuclear Information System (INIS)

    Jensen, Torben R.; Kjaer, Kristian; Oestergaard Jensen, Morten; Peters, Guenther H.; Reitzel, Niels; Balashev, Konstantin; Bjoernholm, Thomas

    2003-01-01

    X-ray reflectivity measurements reveal a significant dewetting of a large hydrophobic paraffin surface floating on water. The dewetting phenomenon extends less than 15 A into the bulk water phase and results in an integrated density deficit of about one water molecule per 25-30 A 2 of water in contact with the paraffin surface. The results are supported by molecular dynamics simulations and related to the hydrophobic effect

  10. Liquid Water may Stick on Hydrophobic Surfaces

    Indian Academy of Sciences (India)

    IAS Admin

    Common Perception. A surface can be classified as. > Wetting. > Non-wetting. Depending on the spreading characteristics of a droplet of water that splashes on the surface. The behavior of fluid on a solid surface under static and dynamic ..... color of the number density profile. Ions at the interface tend to form pinning zones ...

  11. Molecular dynamics study of room temperature ionic liquids with water at mica surface

    Directory of Open Access Journals (Sweden)

    Huanhuan Zhang

    2018-04-01

    Full Text Available Water in room temperature ionic liquids (RTILs could impose significant effects on their interfacial properties at a charged surface. Although the interfaces between RTILs and mica surfaces exhibit rich microstructure, the influence of water content on such interfaces is little understood, in particular, considering the fact that RTILs are always associated with water due to their hygroscopicity. In this work, we studied how different types of RTILs and different amounts of water molecules affect the RTIL-mica interfaces, especially the water distribution at mica surfaces, using molecular dynamics (MD simulation. MD results showed that (1 there is more water and a thicker water layer adsorbed on the mica surface as the water content increases, and correspondingly the average location of K+ ions is farther from mica surface; (2 more water accumulated at the interface with the hydrophobic [Emim][TFSI] than in case of the hydrophilic [Emim][BF4] due to the respective RTIL hydrophobicity and ion size. A similar trend was also observed in the hydrogen bonds formed between water molecules. Moreover, the 2D number density map of adsorbed water revealed that the high-density areas of water seem to be related to K+ ions and silicon/aluminum atoms on mica surface. These results are of great importance to understand the effects of hydrophobicity/hydrophicility of RTIL and water on the interfacial microstructure at electrified surfaces. Keywords: Room temperature ionic liquids, Hydrophobicity/hydrophicility, Water content, Electrical double layer, Mica surface

  12. Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Al-Hamdani, Yasmine S. [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Chemistry, University College London, 20 Gordon Street, London WC1H 0AJ (United Kingdom); Alfè, Dario [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Earth Sciences, University College London, Gower Street, London WC1E 6BT (United Kingdom); Lilienfeld, O. Anatole von [Institute of Physical Chemistry and National Center for Computational Design and Discovery of Novel Materials (MARVEL), Department of Chemistry, University of Basel, Klingelbergstrasse 80, CH-4056 Basel (Switzerland); Michaelides, Angelos, E-mail: angelos.michaelides@ucl.ac.uk [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

    2016-04-21

    Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN doped graphene and C doped h-BN. We find that doped surfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed.

  13. Water in contact with extended hydrophobic surfaces: Direct evidence of weak dewetting

    DEFF Research Database (Denmark)

    Jensen, Torben René; Jensen, Morten Østergaard; Reitzel, Niels

    2003-01-01

    X-ray reflectivity measurements reveal a significant dewetting of a large hydrophobic paraffin surface floating on water. The dewetting phenomenon extends less than 15 Angstrom into the bulk water phase and results in an integrated density deficit of about one water molecule per 25-30 Angstrom(2...

  14. Surface Water Quality Monitoring Sites

    Data.gov (United States)

    Minnesota Department of Natural Resources — The MN Department of Agriculture (MDA) is charged with periodically collecting and analyzing water samples from selected locations throughout the state to determine...

  15. Structure and optical properties of water covered Cu(110) surfaces

    International Nuclear Information System (INIS)

    Baghbanpourasl, A.

    2014-01-01

    In this thesis structural and optical properties of the water covered Cu(110) surface is studied using density functional theory within independent particle approximation. Several stable adsorption structures are studied such as water clusters (monomer, dimer, trimer, tetramer and pentamer), different hexagonal monolayers, partially dissociated water monolayers and three different types of chains among them a chain that consists of pentagon rings. For a copper surface in contact with water vapor, the energetically stable H 2 O/OH adsorbed structures are compared thermodynamically using adsorption free energy (change of free energy due to adsorption). Several phase diagrams with respect to temperature and pressure are calculated. It is found that among the large number of energetically stable structures (i.e. structures with positive adsorption energy ) only limited number of them are thermodynamically stable. These thermodynamically stable structures are the class of almost energetically degenerate hexagonal overlayers, one type of partially dissociated water structure that contains Bjerrum defect in the hydrogen bond network and pentagon chain. Since hydrogen atoms are light weight their vibrational effects can be considerable. Zero point vibration decreases the adsorption energy up to 0.1 eV and free energy of adsorbed molecules arising from vibrational degree of freedom can go up to -0.2 eV per adsorbed molecule at 500 Kelvin. However zero point energy and vibrational free energy of adsorbed molecules do not alter relative stability of the adsorbed structures. To account for the long range van der Waals interactions, a semi-empirical scheme is applied. Reflectance Anisotropy Spectroscopy (RAS) is a fast and non destructive optical method that can be used to prob the surface in different conditions such as vacuum and electro-chemical environment. Elasto-optic coeficients of bulk are calculated from first principles and the change of the RA spectrum of the bare Cu

  16. Production of molecules on a surface under plasma exposure: example of NO on pyrex

    International Nuclear Information System (INIS)

    Marinov, D; Guaitella, O; Rousseau, A; Ionikh, Y

    2010-01-01

    We propose a new experimental approach to the study of surface-catalysed nitric oxide production under plasma exposure. Stable nitrogen species are grafted to the surface of a pyrex discharge tube during N 2 plasma pretreatment. These species are trapped by surface active sites and on being exposed to O 2 plasma, they initiate the production of NO molecules, which are detected using tunable diode laser absorption spectroscopy. Supposing that nitrogen species are adsorbed N atoms, we estimate the initial surface coverage as [N ads ] = 3 x 10 13 cm -2 . This gives an assessment of the lower boundary of the density of surface active sites.

  17. Surface composition and surface properties of water hyacinth ...

    African Journals Online (AJOL)

    Surface composition and surface properties of water hyacinth ( Eichhornia ... (2/1, v/v) followed by ethanol, using Fourier Transform Infra-red (FT-IR) spectroscopy, ... polar organic solvents and non-polar n-alkane hydrocarbons is discussed.

  18. Implication of Crystal Water Molecules in Inhibitor Binding at ALR2 Active Site

    Directory of Open Access Journals (Sweden)

    Hymavati

    2012-01-01

    Full Text Available Water molecules play a crucial role in mediating the interaction between a ligand and a macromolecule. The solvent environment around such biomolecule controls their structure and plays important role in protein-ligand interactions. An understanding of the nature and role of these water molecules in the active site of a protein could greatly increase the efficiency of rational drug design approaches. We have performed the comparative crystal structure analysis of aldose reductase to understand the role of crystal water in protein-ligand interaction. Molecular dynamics simulation has shown the versatile nature of water molecules in bridge H bonding during interaction. Occupancy and life time of water molecules depend on the type of cocrystallized ligand present in the structure. The information may be useful in rational approach to customize the ligand, and thereby longer occupancy and life time for bridge H-bonding.

  19. Interface properties of organic molecules on metal surfaces; Grenzflaecheneigenschaften organischer Molekuele auf Metalloberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Karacuban, Hatice

    2010-01-28

    In this work, the growth of the archetype molecules CuPc and PTCDA was investigated on Cu(111). PTCDA was also studied on NaCl/Cu(111). The main experiments were carried out with a scanning tunneling microscope. Structural analysis of CuPc on Cu (111) is only possible at low temperatures, since at room temperature the molecules exhibit a high surface mobility. For the investigation of these structures and especially to enable scanning tunneling spectroscopy, a low-temperature scanning tunneling microscope was developed. Using this home built STM the experiments could be carried out at about 10 K. After the adsorption of CuPc on Cu (111) a substrate-induced symmetry reduction of the molecules can be observed in scanning tunneling microscopy. When the occupied states of the molecules are imaged, a switching between two distinct levels is found. These modifications are determined by the adsorption geometry of the molecules. Based on high resolution STM data, an on-top adsorption geometry of the CuPc-molecules on Cu (111)-substrate can be deducted. At low temperatures, two new superstructures of PTCDA on Cu(111) are observed. The molecules within these superstructures are tilted with respect to the substrate. Intermolecular interactions may be the crucial factor for the realignment of the molecules. If PTCDA molecules are adsorbed on a NaCl/Cu (111) substrate, at room temperature, also two new superstructures on the copper substrate were found. They indicate the formation of a metall-organic-complex. On top of the NaCl layer the molecules exclusively grow at polar NaCl step edges. This is an indication for electrostatic interaction between the PTCDA molecules and the NaCl layer. When the molecule density is further increased, a Vollmer-Weber growth sets in. If both molecules PTCDA and CuPc are present on the sample at the same time, local spectroscopy provides information on the metal-organic interface in direct comparison. The STS-results of CuPc/PTCDA on Cu (111

  20. Waste water treatment in surface mines

    Energy Technology Data Exchange (ETDEWEB)

    Navasardyants, M A; Esipov, V Z; Ryzhkov, Yu A

    1981-01-01

    This paper evaluates problems associated with waste water from coal surface mines of the Kemerovougol' association in the Kuzbass. Waste water treatment in the Kuzbass is of major importance as the region is supplied with water from only one river, the Tom river. Water influx to Kemerovougol' surface mines in a year amounts to 136 million m/sup 3/. The water is used during technological processes, for fire fighting, and spraying to prevent dusting; the rest, about 82.1 million m/sup 3/, is discharged into surface waters. Of this amount, 25.1 million m/sup 3/ is heavily polluted water, 46.6 million m3 are polluted but within limits, and 10.4 million m/sup 3/ are characterized as relatively clean. Waste water is polluted with: suspended matters, oils and oil products, nitrates, nitrides and chlorides. Suspended matter content sometimes reaches 4,000 and 5,000 mg/l, and oil product content in water amounts to 2.17 mg/l. Water treatment in surface mines is two-staged: sumps and sedimentation tanks are used. Water with suspended matter content of 50 to 100 mg/l in winter and summer, and 200 to 250 mg/l in spring and autumn is reduced in sumps to 25 to 30 mg/l in summer and winter and to 40 to 50 mg/l in autumn and spring. During the first stage water treatment efficiency ranges from 50 to 80%. During the second stage water is collected in sedimentation tanks. It is noted that so-called secondary pollution is one of the causes of the relatively high level of suspended matter in discharged water. Water discharged from sedimentation tanks carries clay and loam particles from the bottom and walls of water tanks and channels.

  1. Desorption dynamics of deuterium molecules from the Si(100)-(3×1) dideuteride surface

    OpenAIRE

    Niida, T; Tsurumaki, Hiroshi; Namiki, Akira

    2006-01-01

    We measured polar angle ()-resolved time-of-flight spectra of D2 molecules desorbing from the Si(100)-(3×1) dideuteride surface. The desorbing D2 molecules exhibit a considerable translational heating with mean desorption kinetic energies of 0.25 eV, which is mostly independent of the desorption angles for 0°30°. The observed desorption dynamics of deuterium was discussed along the principle of detailed balance to predict their adsorption dynamics onto the monohydride Si surface.

  2. Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.

    Science.gov (United States)

    Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

    2018-04-19

    Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

  3. Effect of nontronite smectite clay on the chemical evolution of several organic molecules under simulated martian surface ultraviolet radiation conditions.

    Science.gov (United States)

    Poch, Olivier; Jaber, Maguy; Stalport, Fabien; Nowak, Sophie; Georgelin, Thomas; Lambert, Jean-François; Szopa, Cyril; Coll, Patrice

    2015-03-01

    Most of the phyllosilicates detected at the surface of Mars today are probably remnants of ancient environments that sustained long-term bodies of liquid water at the surface or subsurface and were possibly favorable for the emergence of life. Consequently, phyllosilicates have become the main mineral target in the search for organics on Mars. But are phyllosilicates efficient at preserving organic molecules under current environmental conditions at the surface of Mars? We monitored the qualitative and quantitative evolutions of glycine, urea, and adenine in interaction with the Fe(3+)-smectite clay nontronite, one of the most abundant phyllosilicates present at the surface of Mars, under simulated martian surface ultraviolet light (190-400 nm), mean temperature (218 ± 2 K), and pressure (6 ± 1 mbar) in a laboratory simulation setup. We tested organic-rich samples that were representative of the evaporation of a small, warm pond of liquid water containing a high concentration of organics. For each molecule, we observed how the nontronite influences its quantum efficiency of photodecomposition and the nature of its solid evolution products. The results reveal a pronounced photoprotective effect of nontronite on the evolution of glycine and adenine; their efficiencies of photodecomposition were reduced by a factor of 5 when mixed at a concentration of 2.6 × 10(-2) mol of molecules per gram of nontronite. Moreover, when the amount of nontronite in the sample of glycine was increased by a factor of 2, the gain of photoprotection was multiplied by a factor of 5. This indicates that the photoprotection provided by the nontronite is not a purely mechanical shielding effect but is also due to stabilizing interactions. No new evolution product was firmly identified, but the results obtained with urea suggest a particular reactivity in the presence of nontronite, leading to an increase of its dissociation rate.

  4. Theoretical investigation of the ultrafast dissociation of core-ionized water and uracil molecules immersed in liquid water

    Energy Technology Data Exchange (ETDEWEB)

    Stia, C.R.; Fojon, O.A. [Instituto de Fisica Rosario - CONICET-Universidad Nacional de Rosario, Rosario (Argentina); Gaigeot, M.P. [Laboratoire Analyse et Modelisation pour la Biologie et l' Environnement, LAMBE, UMR-CNRS 8587, Universite d' Evry-Val-d' Essonne, 91 - Evry (France); Institut Universitaire de France, 75 - Paris (France); Vuilleumier, R. [Departement de chimie, Ecole Normale Superieure, 75 - Paris (France); Herve du Penhoat, M.A.; Politis, M.F. [Institut de Mineralogie et de Physique des Milieux Condenses, IMPMC, UMR-CNRS 7590, Universite Pierre et Marie Curie, 75 - Paris (France)

    2010-10-15

    We present a series of ab initio density functional based calculations of the fragmentation dynamics of core-ionized biomolecules. The computations are performed for pure liquid water, aqueous and isolated Uracil. Core ionization is described by replacing the 1s{sup 2} pseudopotential of one atom of the target molecule (C, N or O) with a pseudopotential for a 1s{sup 1} core-hole state. Our results predict that the dissociation of core-ionized water molecules may be reached during the lifetime of inner-shell vacancy (less than 10 fs), leading to OH bond breakage as a primary outcome. We also observe a second fragmentation channel in which total Coulomb explosion of the ionized water molecule occurs. Fragmentation pathways are found similar for pure water or when the water molecule is in the primary hydration shell of the uracil molecule. In the latter case, the proton may be transferred towards the uracil oxygen atoms. When the core hole is located on the uracil molecule, ultrafast dissociation is only observed in the aqueous environment and for nitrogen-K vacancies, resulting in proton transfers towards the hydrogen-bonded water molecule. (authors)

  5. Water vapor retrieval over many surface types

    Energy Technology Data Exchange (ETDEWEB)

    Borel, C.C.; Clodius, W.C.; Johnson, J.

    1996-04-01

    In this paper we present a study of of the water vapor retrieval for many natural surface types which would be valuable for multi-spectral instruments using the existing Continuum Interpolated Band Ratio (CIBR) for the 940 nm water vapor absorption feature. An atmospheric code (6S) and 562 spectra were used to compute the top of the atmosphere radiance near the 940 nm water vapor absorption feature in steps of 2.5 nm as a function of precipitable water (PW). We derive a novel technique called ``Atmospheric Pre-corrected Differential Absorption`` (APDA) and show that APDA performs better than the CIBR over many surface types.

  6. Femtosecond spectroscopic study of the solvation of amphiphilic molecules by water

    NARCIS (Netherlands)

    Rezus, Y.L.A.; Bakker, H.J.

    2008-01-01

    We use polarization-resolved mid-infrared pump-probe spectroscopy to study the aqueous solvation of proline and N-methylacetamide. These molecules serve as models to study the solvation of proteins. We monitor the orientational dynamics of partly deuterated water molecules (HDO) that are present at

  7. Adsorption behavior of sulfur-containing amino acid molecule on transition metal surface studied by S K-edge NEXAFS

    International Nuclear Information System (INIS)

    Yagi, S.; Matsumura, K.; Nakano, Y.; Ikenaga, E.; Sardar, S.A.; Syed, J.A.; Soda, K.; Hashimoto, E.; Tanaka, K.; Taniguchi, M.

    2003-01-01

    Adsorption behavior of a sulfur-containing amino acid L-cysteine molecule on transition metal surface have been investigated by S K-edge near-edge X-ray absorption fine structure. The L-cysteine molecule for first adsorption layer was found to dissociate on polycrystalline nickel surface, whereas molecularly adsorbed on copper surface at room temperature. Most of the L-cysteine molecules have been dissociated on nickel surface in annealing condition up to 353 K. On the other hand, the L-cysteine molecule did not dissociate on copper surface and the elongation of the S-C bonding occurred at 353 K

  8. Dynamics of water molecules in the active-site cavity of human cytochromes P450

    DEFF Research Database (Denmark)

    Rydberg, Patrik; Rod, Thomas Holm; Olsen, Lars

    2007-01-01

    We have studied the dynamics of water molecules in six crystal structures of four human cytochromes P450, 2A6, 2C8, 2C9, and 3A4, with molecular dynamics simulations. In the crystal structures, only a few water molecules are seen and the reported sizes of the active-site cavity vary a lot....... In the simulations, the cavities are completely filled with water molecules, although with approximately 20% lower density than in bulk water. The 2A6 protein differs from the other three in that it has a very small cavity with only two water molecules and no exchange with the surroundings. The other three proteins...... channels, through which there is a quite frequent exchange of water molecules (one molecule is exchanged every 30-200 ps), except in 2A6. Most of the channels are observed also in the crystal structures, but two to three channels in each protein open only during the simulations. There are no water...

  9. Surface-enhanced resonance Raman scattering spectroscopy of single R6G molecules

    Institute of Scientific and Technical Information of China (English)

    Zhou Zeng-Hui; Liu Li; Wang Gui-Ying; Xu Zhi-Zhan

    2006-01-01

    Surface-enhanced resonance Raman scattering (SERRS) of Rhodamine 6G (R6G) adsorbed on colloidal silver clusters has been studied. Based on the great enhancement of the Raman signal and the quench of the fluorescence, the SERRS spectra of R6G were recorded for the samples of dye colloidal solution with different concentrations. Spectral inhomogeneity behaviours from single molecules in the dried sample films were observed with complementary evidences, such as spectral polarization, spectral diffusion, intensity fluctuation of vibrational lines and even "breathing" of the molecules. Sequential spectra observed from a liquid sample with an average of 0.3 dye molecules in the probed volume exhibited the expected Poisson distribution for actually measuring 0, 1 or 2 molecules. Difference between the SERRS spectra of R6G excited by linearly and circularly polarized light were experimentally measured.

  10. Clean Air Markets - Monitoring Surface Water Chemistry

    Science.gov (United States)

    Learn about how EPA uses Long Term Monitoring (LTM) and Temporily Integrated Monitoring of Ecosystems (TIME) to track the effect of the Clean Air Act Amendments on acidity of surface waters in the eastern U.S.

  11. Surface Waters Information Management System (SWIMS)

    Data.gov (United States)

    Kansas Data Access and Support Center — The Surface Waters Information Management System (SWIMS) has been designed to meet multi-agency hydrologic database needs for Kansas. The SWIMS project was supported...

  12. Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

    International Nuclear Information System (INIS)

    Kim, Eunae; Yeom, Min Sun

    2014-01-01

    Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

  13. Quantum Electric Dipole Lattice - Water Molecules Confined to Nanocavities in Beryl

    Science.gov (United States)

    Dressel, Martin; Zhukova, Elena S.; Thomas, Victor G.; Gorshunov, Boris P.

    2018-02-01

    Water is subject to intense investigations due to its importance in biological matter but keeps many of its secrets. Here, we unveil an even other aspect by confining H2O molecules to nanosize cages. Our THz and infrared spectra of water in the gemstone beryl evidence quantum tunneling of H2O molecules in the crystal lattice. The water molecules are spread out when confined in a nanocage. In combination with low-frequency dielectric measurements, we were also able to show that dipolar coupling among the H2O molecules leads towards a ferroelectric state at low temperatures. Upon cooling, a ferroelectric soft mode shifts through the THz range. Only quantum fluctuations prevent perfect macroscopic order to be fully achieved. Beside the significance to life science and possible application, nanoconfined water may become the prime example of a quantum electric dipolar lattice.

  14. Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

    KAUST Repository

    Shinagawa, Tatsuya; Takanabe, Kazuhiro

    2015-01-01

    Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed

  15. Heat transfer and forces on concave surfaces in free molecule flow.

    Science.gov (United States)

    Fan, C.

    1971-01-01

    A Monte Carlo modeling technique is described for mathematically simulating free molecular flows over a concave spherical surface and a concave cylindrical surface of finite length. The half-angle of the surfaces may vary from 0 to 90 degrees, and the incident flow may have an arbitrary speed ratio and an arbitrary angle of attack. Partial diffuse reflection and imperfect energy accommodation for molecules colliding with the surfaces are also considered. Results of heat transfer, drag and lift coefficients are presented for a variety of flow conditions. The present Monte Carlo results are shown to be in very good agreement with certain available theoretical solutions.

  16. Molecular Dynamics Studies of Overbased Detergents on a Water Surface.

    Science.gov (United States)

    Bodnarchuk, M S; Dini, D; Heyes, D M; Breakspear, A; Chahine, S

    2017-07-25

    Molecular dynamics (MD) simulations are reported of model overbased detergent nanoparticles on a model water surface which mimic their behavior on a Langmuir trough or large water droplet in engine oil. The simulations predict that the structure of the nanoparticle on a water surface is different to when it is immersed in a bulk hydrophobic solvent. The surfactant tails are partly directed out of the water, while the carbonate core maximizes its extent of contact with the water. Umbrella sampling calculations of the potential of mean force between two particles showed that they are associated with varying degrees with a maximum binding free energy of ca. 10 k B T for the salicylate stabilized particle, ca. 8 k B T for a sulfurized alkyl phenate stabilized particle, and ca. 5 k B T for a sulfonate stabilized particle. The differences in the strength of attraction depend on the proximity of nearest approach and the energy penalty associated with the disruption of the hydration shell of water molecules around the calcium carbonate core when the two particles approach. This is greatest for the sulfonate particle, which partially loses the surfactant ions to the solution, and least for the salicylate, which forms the weakest water "cage". The particles are separated by a water hydration layer, even at the point of closest approach.

  17. Single molecule force measurements delineate salt, pH and surface effects on biopolymer adhesion

    International Nuclear Information System (INIS)

    Pirzer, T; Geisler, M; Hugel, T; Scheibel, T

    2009-01-01

    In this paper we probe the influence of surface properties, pH and salt on the adhesion of recombinant spider silk proteins onto solid substrates with single molecule force spectroscopy. A single engineered spider silk protein (monomeric C 16 or dimeric (QAQ) 8 NR3) is covalently bound with one end to an AFM tip, which assures long-time measurements for hours with one and the same protein. The tip with the protein is brought into contact with various substrates at various buffer conditions and then retracted to desorb the protein. We observe a linear dependence of the adhesion force on the concentration of three selected salts (NaCl, NaH 2 PO 4 and NaI) and a Hofmeister series both for anions and cations. As expected, the more hydrophobic C 16 shows a higher adhesion force than (QAQ) 8 NR3, and the adhesion force rises with the hydrophobicity of the substrate. Unexpected is the magnitude of the dependences—we never observe a change of more than 30%, suggesting a surprisingly well-regulated balance between dispersive forces, water-structure-induced forces as well as co-solute-induced forces in biopolymer adhesion

  18. Single molecule force measurements delineate salt, pH and surface effects on biopolymer adhesion

    Science.gov (United States)

    Pirzer, T.; Geisler, M.; Scheibel, T.; Hugel, T.

    2009-06-01

    In this paper we probe the influence of surface properties, pH and salt on the adhesion of recombinant spider silk proteins onto solid substrates with single molecule force spectroscopy. A single engineered spider silk protein (monomeric C16 or dimeric (QAQ)8NR3) is covalently bound with one end to an AFM tip, which assures long-time measurements for hours with one and the same protein. The tip with the protein is brought into contact with various substrates at various buffer conditions and then retracted to desorb the protein. We observe a linear dependence of the adhesion force on the concentration of three selected salts (NaCl, NaH2PO4 and NaI) and a Hofmeister series both for anions and cations. As expected, the more hydrophobic C16 shows a higher adhesion force than (QAQ)8NR3, and the adhesion force rises with the hydrophobicity of the substrate. Unexpected is the magnitude of the dependences—we never observe a change of more than 30%, suggesting a surprisingly well-regulated balance between dispersive forces, water-structure-induced forces as well as co-solute-induced forces in biopolymer adhesion.

  19. Potential energy surface from spectroscopic data in the photodissociation of polyatomic molecules

    International Nuclear Information System (INIS)

    Kim, Hwa Joong; Kim, Young Sik

    2001-01-01

    The time-dependent tracking inversion method is studied to extract the potential energy surface of the electronic excited state in the photodissociation of triatomic molecules. Based on the relay of the regularized inversion procedure and time-dependent wave packet propagation, the algorithm extracts the underlying potential energy surface piece by tracking the time-dependent data, which can be synthesized from Raman excitation profiles. We have demonstrated the algorithm to extract the potential energy surface of electronic excited state for NO 2 molecule where the wave packet split on a saddle-shaped surface. Finally, we describe the merits of the time-dependent tracking inversion method compared with the time-dependent inversion method and discussed several extensions of the algorithm

  20. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  1. Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

    Science.gov (United States)

    Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

    2017-08-02

    The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

  2. Bio-active molecules modified surfaces enhanced mesenchymal stem cell adhesion and proliferation

    International Nuclear Information System (INIS)

    Mobasseri, Rezvan; Tian, Lingling; Soleimani, Masoud; Ramakrishna, Seeram; Naderi-Manesh, Hossein

    2017-01-01

    Surface modification of the substrate as a component of in vitro cell culture and tissue engineering, using bio-active molecules including extracellular matrix (ECM) proteins or peptides derived ECM proteins can modulate the surface properties and thereby induce the desired signaling pathways in cells. The aim of this study was to evaluate the behavior of human bone marrow mesenchymal stem cells (hBM-MSCs) on glass substrates modified with fibronectin (Fn), collagen (Coll), RGD peptides (RGD) and designed peptide (R-pept) as bio-active molecules. The glass coverslips were coated with fibronectin, collagen, RGD peptide and R-peptide. Bone marrow mesenchymal stem cells were cultured on different substrates and the adhesion behavior in early incubation times was investigated using scanning electron microscopy (SEM) and confocal microscopy. The MTT assay was performed to evaluate the effect of different bio-active molecules on MSCs proliferation rate during 24 and 72 h. Formation of filopodia and focal adhesion (FA) complexes, two steps of cell adhesion process, were observed in MSCs cultured on bio-active molecules modified coverslips, specifically in Fn coated and R-pept coated groups. SEM image showed well adhesion pattern for MSCs cultured on Fn and R-pept after 2 h incubation, while the shape of cells cultured on Coll and RGD substrates indicated that they might experience stress condition in early hours of culture. Investigation of adhesion behavior, as well as proliferation pattern, suggests R-peptide as a promising bio-active molecule to be used for surface modification of substrate in supporting and inducing cell adhesion and proliferation. - Highlights: • Bioactive molecules modified surface is a strategy to design biomimicry scaffold. • Bi-functional Tat-derived peptide (R-pept) enhanced MSCs adhesion and proliferation. • R-pept showed similar influences to fibronectin on FA formation and attachment.

  3. Scaling properties of adsorption energies for hydrogen-containing molecules on transition-metal surfaces

    DEFF Research Database (Denmark)

    Abild-Pedersen, Frank; Greeley, Jeffrey Philip; Studt, Felix

    2007-01-01

    Density functional theory calculations are presented for CHx, x=0,1,2,3, NHx, x=0,1,2, OHx, x=0,1, and SHx, x=0,1 adsorption on a range of close-packed and stepped transition-metal surfaces. We find that the adsorption energy of any of the molecules considered scales approximately with the adsorp...

  4. Spontaneous dissociation of a conjugated molecule on the Si(100) surface

    DEFF Research Database (Denmark)

    Lin, Rong; Galili, Michael; Quaade, Ulrich

    2002-01-01

    The adsorption mechanism of alpha-sexithiophene (alpha-6T) on the clean Si(100)-(2x1) surface has been investigated using scanning tunneling microscopy (STM) and first principles electronic structure calculations. We find that at submonolayer coverage, the alpha-6T molecules are not stable and di...

  5. Advances in single-molecule magnet surface patterning through microcontact printing

    NARCIS (Netherlands)

    Mannini, Matteo; Bonacchi, D.; Bonacchi, Daniele; Zobbi, Laura; Piras, Federica M.; Speets, E.A.; Caneschi, Andrea; Cornia, Andrea; Magnani, Agnese; Ravoo, B.J.; Reinhoudt, David; Sessoli, Roberta; Gatteschi, Dante

    2005-01-01

    We present an implementation of strategies to deposit single-molecule magnets (SMMs) using microcontact printing (uCP). We describe different approaches of CP to print stripes of a sulfur-functionalized dodecamanganese(III,IV) cluster on gold surfaces. Comparison by atomic force microscopy profile

  6. A study on the contact angles of a water droplet on smooth and rough solid surfaces

    International Nuclear Information System (INIS)

    Park, Ju Young; Ha, Man Yeong; Choi, Ho Jin; Hong, Seung Do; Yoon, Hyun Sik

    2011-01-01

    We investigated the wetting characteristics such as contact angle, wetting radius and topography of water droplets on smooth and random solid surfaces. Molecular dynamic simulation is employed to analyze the wetting behavior of water droplets on smooth and rough surfaces by considering different potential energy models of bond, angle, Lennard-Jones and Coulomb to calculate the interacting forces between water molecules. The Lennard-Jones potential energy model is adopted as an interaction model between water molecules and solid surface atoms. The randomly rough surface is generated by changing the standard deviation of roughness height from 1 A to 3 A with the fixed autocorrelation length. The size of water droplet considered is in the range from 2,000 to 5,000 molecules. The contact angles increase generally with increasing number of water molecules. For a hydrophobic surface whose characteristic energy is 0.1 kcal/mol, the contact angles depend rarely on the standard deviation of the roughness height. However, when the surface energy is 0.5 and 1.0 kcal/mol, the contact angles depend on both the roughness height of surfaces and droplet size

  7. Surface-enhanced Raman scattering of dipolar molecules by the graphene Fermi surface modulation with different dipole moments

    Science.gov (United States)

    Zhang, Mingjia; Leng, Yandan; Huang, Jing; Yu, JiaoJiao; Lan, Zhenggang; Huang, Changshui

    2017-12-01

    We report the modulation of Raman scattering spectrum of chromophore/graphene hybrids by tunning the molecular polarization with different terminal groups (methyl, methoxy, nitrile, and two nitros). Based on the density functional theory, the specific dipole moment values of the chromophore molecules are calculated. An obvious surface-enhanced Raman scattering (SERS) was observed and the scattering intensity of molecule increases with enlarged dipole moment. According to the analysis of G band Raman shifts of graphene, the enhancement of the Raman signal can be attributed to strong electronic coupling between graphene and chromophore, which is closely related with the modulation of graphene Fermi surface by changing the dipole moment of the molecule. Besides, the optimization of the ground state geometry and the binding energy of the hybrids were also calculated with the Density Functional Based Tight Bonding (DFTB) method, which confirms that the enhanced Raman scattering of molecules on graphene arises from the improved energy level matching between graphene Fermi surface and molecular band, further providing a new way to design novel SERS devices.

  8. Intense Visible Luminescence in CdSe Quantum Dots by Efficiency Surface Passivation with H2O Molecules

    Directory of Open Access Journals (Sweden)

    Hyeoung Woo Park

    2012-01-01

    Full Text Available We have investigated the effect of water (H2O cooling and heat treatment on the luminescence efficiency of core CdSe quantum dots (QDs. The photoluminescence (PL quantum yield of the CdSe QDs was enhanced up to ~85%, and some periodic bright points were observed in wide color ranges during the heat treatment of QDs mixed with H2O. The PL enhancement of QDs could be attributed to the recovery of QDs surface traps by unreacted ligands confined within the hydrophilic H2O molecule containers.

  9. Polyfluorinated chemicals in European surface waters, ground- and drinking waters

    NARCIS (Netherlands)

    Eschauzier, C.; de Voogt, P.; Brauch, H.-J.; Lange, F.T.; Knepper, T.P.; Lange, F.T.

    2012-01-01

    Polyfluorinated chemicals (PFCs), especially short chain fluorinated alkyl sulfonates and carboxylates, are ubiquitously found in the environment. This chapter aims at giving an overview of PFC concentrations found in European surface, ground- and drinking waters and their behavior during

  10. Theory of the reaction dynamics of small molecules on metal surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Bret [Univ. of Massachusetts, Amherst, MA (United States)

    2016-09-09

    The objective of this project has been to develop realistic theoretical models for gas-surface interactions, with a focus on processes important in heterogeneous catalysis. The dissociative chemisorption of a molecule on a metal is a key step in many catalyzed reactions, and is often the rate-limiting step. We have explored the dissociative chemisorption of H2, H2O and CH4 on a variety of metal surfaces. Most recently, our extensive studies of methane dissociation on Ni and Pt surfaces have fully elucidated its dependence on translational energy, vibrational state and surface temperature, providing the first accurate comparisons with experimental data. We have explored Eley-Rideal and hot atom reactions of H atoms with H- and C-covered metal surfaces. H atom interactions with graphite have also been explored, including both sticking and Eley-Rideal recombination processes. Again, our methods made it possible to explain several experiments studying these reactions. The sticking of atoms on metal surfaces has also been studied. To help elucidate the experiments that study these processes, we examine how the reaction dynamics depend upon the nature of the molecule-metal interaction, as well as experimental variables such as substrate temperature, beam energy, angle of impact, and the internal states of the molecules. Electronic structure methods based on Density Functional Theory are used to compute each molecule-metal potential energy surface. Both time-dependent quantum scattering techniques and quasi-classical methods are used to examine the reaction or scattering dynamics. Much of our effort has been directed towards developing improved quantum methods that can accurately describe reactions, as well as include the effects of substrate temperature (lattice vibration).

  11. Roles of water molecules in bacteria and viruses

    Science.gov (United States)

    Cox, C. S.

    1993-02-01

    In addition to water, microbes mainly comprise lipids, carbohydrates, proteins and nucleic acids. Their structure and function singularly and conjointly is affected by water activity. Desiccation leads to dramatic lipid phase changes whereas carbohydrates, proteins and nucleic acids initially suffer spontaneous, reversible low activation energy Maillard reactions forming products that more slowly re-arrange, cross-link etc. to give non-native states. While initial products spontaneously may reverse to native states by raising water activity, later products only do so through energy consumption and enzymatic activity eg. repair. Yet, native states of lipid membranes and associated enzymes are required to generate energy. Consequently, good reserves of high energy compounds (e.g. ATP) and of membrane stabilisers (e.g. trehalose) may be expected to enhance survival following drying and rehydration (e.g. anhydrobiotic organisms).

  12. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  13. Interplay of radiative and nonradiative transitions in surface hopping with radiation-molecule interactions

    Energy Technology Data Exchange (ETDEWEB)

    Bajo, Juan José [Departamento de Química-Física I, Universidad Complutense de Madrid, 28040 Madrid (Spain); Granucci, Giovanni, E-mail: giovanni.granucci@unipi.it; Persico, Maurizio [Università di Pisa, Dipartimento di Chimica e Chimica Industriale, via Risorgimento 35, 56126 Pisa (Italy)

    2014-01-28

    We implemented a method for the treatment of field induced transitions in trajectory surface hopping simulations, in the framework of the local diabatization scheme, especially suited for on-the-fly dynamics. The method is applied to a simple one-dimensional model with an avoided crossing and compared with quantum wavepacket dynamics. The results show the importance of introducing a proper decoherence correction to surface hopping, in order to obtain meaningful results. Also the energy conservation policy of standard surface hopping must be revised: in fact, the quantum wavepacket energetics is well reproduced if energy absorption/emission is allowed for in the hops determined by radiation-molecule coupling. To our knowledge, this is the first time the issues of decoherence and energy conservation have been analyzed in depth to devise a mixed quantum-classical method for dynamics with molecule-field interactions.

  14. Contamination of boreholes water by 76 pesticides molecules in the ...

    African Journals Online (AJOL)

    user2

    to be the cause of the degradation of the quality of sur- face and ground waters ... network and the nature of the soil generally clay lateritic with high permeability. .... 0.006 0.008 0.004 0.004 0.004 0.007 0.008 0.004 0.004 0.004 Malathion.

  15. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  16. Adsorption and dissociation of oxygen molecules on Si(111)-(7×7) surface

    International Nuclear Information System (INIS)

    Niu, Chun-Yao; Wang, Jian-Tao

    2013-01-01

    The adsorption and dissociation of O 2 molecules on Si(111)-(7×7) surface have been studied by first-principles calculations. Our results show that all the O 2 molecular species adsorbed on Si(111)-(7×7) surface are unstable and dissociate into atomic species with a small energy barrier about 0.1 eV. The single O 2 molecule adsorption tends to form an ins×2 or a new metastable ins×2* structure on the Si adatom sites and the further coming O 2 molecules adsorb on those structures to produce an ad-ins×3 structure. The ad-ins×3 structure is indeed highly stable and kinetically limited for diving into the subsurface layer to form the ins×3-tri structure by a large barrier of 1.3 eV. Unlike the previous views, we find that all the ad-ins, ins×2, and ad-ins×3 structures show bright images, while the ins×2*, ins×3, and ins×3-tri structures show dark images. The proposed oxidation pathways and simulated scanning tunneling microscope images account well for the experimental results and resolve the long-standing confusion and issue about the adsorption and reaction of O 2 molecules on Si(111) surface

  17. Molecule-surface interaction processes of relevance to gas blanket type fusion device divertor design

    Energy Technology Data Exchange (ETDEWEB)

    Snowdon, K.J. [Newcastle Univ. (United Kingdom). Dept. of Physics; Tawara, H.

    1997-01-01

    The mechanisms which may lead to the departure of molecular species from surfaces exposed to low energy (0.1-100 eV) particle or photon and electron irradiation are reviewed. Where possible, the charge and electronic state, angular, translational and internal energy distributions of the departing molecules are described and the physical origin of the nature of those distributions identified. The consequences, for the departing molecules, of certain material choices become apparent from such an analysis. Such information may help guide the choice of appropriate materials for plasma facing components of gas-blanket type divertors such as that recently proposed for the International Thermonuclear Experimental Reactor (ITER). (author). 71 refs.

  18. A fitting program for potential energy surfaces of bent triatomic molecules

    International Nuclear Information System (INIS)

    Searles, D.J.; Nagy-Felsobuki, E.I. von

    1992-01-01

    A program has been developed in order to fit analytical power series expansions (Dunham, Simon-Parr-Finlan, Ogilvie and their exponential variants) and Pade approximants to discrete ab initio potential energy surfaces of non-linear triatomic molecules. The program employs standard least-squares fitting techniques using the singular decomposition method in order to dampen the higher-order coefficients (if deemed necessary) without significantly degrading the fit. The program makes full use of the symmetry of a triatomic molecule and so addresses the D 3h , C 2v and C S cases. (orig.)

  19. Adsorption of organic molecules on mineral surfaces studied by first-principle calculations: A review.

    Science.gov (United States)

    Zhao, Hongxia; Yang, Yong; Shu, Xin; Wang, Yanwei; Ran, Qianping

    2018-04-09

    First-principle calculations, especially by the density functional theory (DFT) methods, are becoming a power technique to study molecular structure and properties of organic/inorganic interfaces. This review introduces some recent examples on the study of adsorption models of organic molecules or oligomers on mineral surfaces and interfacial properties obtained from first-principles calculations. The aim of this contribution is to inspire scientists to benefit from first-principle calculations and to apply the similar strategies when studying and tailoring interfacial properties at the atomistic scale, especially for those interested in the design and development of new molecules and new products. Copyright © 2017. Published by Elsevier B.V.

  20. Multiple atomic scale solid surface interconnects for atom circuits and molecule logic gates

    International Nuclear Information System (INIS)

    Joachim, C; Martrou, D; Gauthier, S; Rezeq, M; Troadec, C; Jie Deng; Chandrasekhar, N

    2010-01-01

    The scientific and technical challenges involved in building the planar electrical connection of an atomic scale circuit to N electrodes (N > 2) are discussed. The practical, laboratory scale approach explored today to assemble a multi-access atomic scale precision interconnection machine is presented. Depending on the surface electronic properties of the targeted substrates, two types of machines are considered: on moderate surface band gap materials, scanning tunneling microscopy can be combined with scanning electron microscopy to provide an efficient navigation system, while on wide surface band gap materials, atomic force microscopy can be used in conjunction with optical microscopy. The size of the planar part of the circuit should be minimized on moderate band gap surfaces to avoid current leakage, while this requirement does not apply to wide band gap surfaces. These constraints impose different methods of connection, which are thoroughly discussed, in particular regarding the recent progress in single atom and molecule manipulations on a surface.

  1. Radionuclide transfer onto ground surface in surface water flow, 1

    International Nuclear Information System (INIS)

    Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

    1991-07-01

    Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

  2. Manufacturing and characterisation of water repellent surfaces

    DEFF Research Database (Denmark)

    De Grave, Arnaud; Botija, Pablo; Hansen, Hans Nørgaard

    2006-01-01

    design criteria for such surfaces. The problem of adapting this behaviour to artificially roughened surfaces is addressed by providing design criteria for superhydrophobic, water-repellent and self-cleaning surfaces according to the concrete performance desired for them. Different kind of manufacturing...... techniques are investigated and the production of patterned micro structured surfaces following two different manufacturing techniques is reported. The first is a combination of laser manufacturing and hot embossing on polystyrene. To compare geometry and functionality a non-silicon based lithography...

  3. First principles study of dissolved oxygen water adsorption on Fe (001 surfaces

    Directory of Open Access Journals (Sweden)

    Dong ZHANG

    2018-02-01

    Full Text Available In order to study the mechanism of dissolved oxygen content on the surface corrosion behavior of Fe-based heat transfer, the first principle is used to study the adsorption of O2 monomolecular, H2O monolayer and dissolved oxygen system on Fe-based heat transfer surface. The GGA/PBE approximation is used to calculate the adsorption energy, state density and population change during the adsorption process. Calculations prove that when the dissolved oxygen is adsorbed on the Fe-based surface, the water molecule tends to adsorb at the top sites, and the oxygen molecule tends to adsorb at Griffiths. When the H2O molecule adsorbs and interacts on the Fe (001 surface, the charge distribution of the interfacial double electric layer changes to cause the Fe atoms to lose electrons, resulting in the change of the surface potential. When the O2 molecule adsorbs on the Fe (001 crystal surfaces, the electrons on the Fe (001 surface are lost and the surface potential increases. O2 molecule and the surface of the Fe atoms are prone to electron transfer, in which O atom's 2p orbit for the adsorption of O2 molecule on Fe (001 crystal surface play a major role. With the increase of the proportion of O2 molecule in the dissolved oxygen water, the absolute value of the adsorption energy increases, and the interaction of the Fe-based heat transfer surface is stronger. This study explores the influence law of different dissolved oxygen on the Fe base heat exchange surface corrosion, and the base metal corrosion mechanism for experimental study provides a theoretical reference.

  4. Interaction of ethanol and water with the {1014} surface of calcite

    DEFF Research Database (Denmark)

    Cooke, David; Gray, R J; Sand, K K

    2010-01-01

    Molecular dynamics simulations have been used to model the interaction between ethanol, water, and the {1014} surface of calcite. Our results demonstrate that a single ethanol molecule is able to form two interactions with the mineral surface (both Ca-O and O-H), resulting in a highly ordered, st...

  5. Radioactivity in surface waters and its effects

    International Nuclear Information System (INIS)

    Stoeber, I.

    1987-01-01

    In consequence of the reactor accident in Chernobyl, the State Office for Water and Waste Disposal of North-Rhine Westphalia implemented immediate programmes for monitoring radioactivity in surface waters, including their sediments and organisms. Of the initially-measured radionuclides, only cesium-137, with its long half-life of 30 years, is of interest. Only trace amounts of the almost equally long-lived strontium 90 (half-life 28 years) were present in rainfall. Cs-137 is a non-natural-radionuclide, occurring solely as a by-product of nuclear installations and atomic bomb tests. Following the ban on surface testing of nuclear weapons, the Cs-137 content of surface waters had fallen significantly up to April 1986. The load due to the reactor disaster is of the same order of magnitude as that produced by atomic testing at the end of the nineteen-sixties. The paper surveys radioactive pollution of surface waters in North-Rhine Westphalia and its effects on water use, especially in regard to potable water supplies and the fish population. (orig./HSCH) [de

  6. Bonding and vibrational dynamics of a large π-conjugated molecule on a metal surface

    International Nuclear Information System (INIS)

    Temirov, R; Soubatch, S; Lassise, A; Tautz, F S

    2008-01-01

    The interplay between the substrate bonding of a large π-conjugated semiconductor molecule and the dynamical properties of the metal-organic interface is studied, employing the prototypical PTCDA/Ag(111) monolayer as an example. Both the coupling of molecular vibrations to the electron-hole-pair continuum of the metal surface and the inelastic scattering of tunnelling electrons by the molecular vibrations on their passage through the molecule are considered. The results of both types of experiment are consistent with the findings of measurements which probe the geometric and electronic structure of the adsorbate-substrate complex directly; generally speaking, they can be understood in the framework of standard theories for the electron-vibron coupling. While the experiments reported here in fact provide additional qualitative insights into the substrate bonding of our π-conjugated model molecule, their detailed quantitative understanding would require a full calculation of the dynamical interface properties, which is currently not available

  7. Single-Molecule Tribology: Force Microscopy Manipulation of a Porphyrin Derivative on a Copper Surface.

    Science.gov (United States)

    Pawlak, Rémy; Ouyang, Wengen; Filippov, Alexander E; Kalikhman-Razvozov, Lena; Kawai, Shigeki; Glatzel, Thilo; Gnecco, Enrico; Baratoff, Alexis; Zheng, Quanshui; Hod, Oded; Urbakh, Michael; Meyer, Ernst

    2016-01-26

    The low-temperature mechanical response of a single porphyrin molecule attached to the apex of an atomic force microscope (AFM) tip during vertical and lateral manipulations is studied. We find that approach-retraction cycles as well as surface scanning with the terminated tip result in atomic-scale friction patterns induced by the internal reorientations of the molecule. With a joint experimental and computational effort, we identify the dicyanophenyl side groups of the molecule interacting with the surface as the dominant factor determining the observed frictional behavior. To this end, we developed a generalized Prandtl-Tomlinson model parametrized using density functional theory calculations that includes the internal degrees of freedom of the side group with respect to the core and its interactions with the underlying surface. We demonstrate that the friction pattern results from the variations of the bond length and bond angles between the dicyanophenyl side group and the porphyrin backbone as well as those of the CN group facing the surface during the lateral and vertical motion of the AFM tip.

  8. Surface tension of normal and heavy water

    International Nuclear Information System (INIS)

    Straub, J.; Rosner, N.; Grigull, V.

    1980-01-01

    A Skeleton Table and simple interpolation equation for the surface tension of light water was developed by the Working Group III of the International Association for the Properties of Steam and is recommended as an International Standard. The Skeleton Table is based on all known measurements of the surface tension and individual data were weighted corresponding to the accuracy of the measurements. The form of the interpolation equation is based on a physical concept. It represents an extension of van der Waals-equation, where the exponent conforms to the 'Scaling Laws'. In addition for application purposes simple relations for the Laplace-coefficient and for the density difference between the liquid and gaseous phases of light water are given. The same form of interpolation equation for the surface tension can be used for heavy water, for which the coefficients are given. However, this equation is based only on a single set of data. (orig.) [de

  9. Direct numerical solution of the Ornstein-Zernike integral equation and spatial distribution of water around hydrophobic molecules

    Science.gov (United States)

    Ikeguchi, Mitsunori; Doi, Junta

    1995-09-01

    The Ornstein-Zernike integral equation (OZ equation) has been used to evaluate the distribution function of solvents around solutes, but its numerical solution is difficult for molecules with a complicated shape. This paper proposes a numerical method to directly solve the OZ equation by introducing the 3D lattice. The method employs no approximation the reference interaction site model (RISM) equation employed. The method enables one to obtain the spatial distribution of spherical solvents around solutes with an arbitrary shape. Numerical accuracy is sufficient when the grid-spacing is less than 0.5 Å for solvent water. The spatial water distribution around a propane molecule is demonstrated as an example of a nonspherical hydrophobic molecule using iso-value surfaces. The water model proposed by Pratt and Chandler is used. The distribution agrees with the molecular dynamics simulation. The distribution increases offshore molecular concavities. The spatial distribution of water around 5α-cholest-2-ene (C27H46) is visualized using computer graphics techniques and a similar trend is observed.

  10. Determination of surface concentrations of individual molecule-layers used in nanoscale biosensors by in situ ATR-FTIR spectroscopy

    KAUST Repository

    Punzet, Manuel; Baurecht, Dieter; Varga, Franz; Karlic, Heidrun; Heitzinger, Clemens

    2012-01-01

    formation of typical functionalization protocols and to determine the respective molecule surface concentrations. BSA, anti-TNF-α and anti-PSA antibodies were bound via 3-(trimethoxy)butylsilyl aldehyde linkers to silicon-oxide surfaces in order

  11. Hydroxyl and water molecule orientations in trypsin: Comparison to molecular dynamics structures

    Energy Technology Data Exchange (ETDEWEB)

    McDowell, R.S.; Kossiakoff, A.A. [Genentech, Inc., South San Francisco, CA (United States)

    1994-12-31

    A comparison is presented of experimentally observed hydroxyl and water hydrogens in trypsin determined from neutron density maps with the results of a 140ps molecular dynamics (MD) simulation. Experimental determination of hydrogen and deuterium atom positions in molecules as large as proteins is a unique capability of neutron diffraction. The comparison addresses the degree to which a standard force-field approach can adequately describe the local electrostatic and van der Waals forces that determine the orientations of these hydrogens. Neutron densities, derived from 2.1{Angstrom} D{sub 2}O-H{sub 2}O difference Fourier maps, provide a database of 27 well-ordered hydroxyl hydrogens. Most of the simulated hydroxyl orientations are within a standard deviation of the experimentally-observed positions, including several examples in which both the simulation and the neutron density indicate that a hydroxyl group is shifted from a {open_quote}standard{close_quote} rotamer. For the most highly ordered water molecules, the hydrogen distributions calculated from the trajectory were in good agreement with neutron density; simulated water molecules that displayed multiple hydrogen bonding networks had correspondingly broadened neutron density profiles. This comparison was facilitated by development of a method to construct a pseudo 2{Angstrom} density map based on the hydrogen atom distributions from the simulation. The degree of disorder of internal water molecules is shown to result primarily from the electrostatic environment surrounding that water molecule as opposed to the cavity size available to the molecule. A method is presented for comparing the discrete observations sampled in a dynamics trajectory with the time- averaged data obtained from X-ray or neutron diffraction studies. This method is particularly useful for statically-disordered water molecules, in which the average location assigned from a trajectory may represent a site of relatively low occupancy.

  12. Occurrence of Surface Water Contaminations: An Overview

    Science.gov (United States)

    Shahabudin, M. M.; Musa, S.

    2018-04-01

    Water is a part of our life and needed by all organisms. As time goes by, the needs by human increased transforming water quality into bad conditions. Surface water contaminated in various ways which is pointed sources and non-pointed sources. Pointed sources means the source are distinguished from the source such from drains or factory but the non-pointed always occurred in mixed of elements of pollutants. This paper is reviewing the occurrence of the contaminations with effects that occurred around us. Pollutant factors from natural or anthropology factors such nutrients, pathogens, and chemical elements contributed to contaminations. Most of the effects from contaminated surface water contributed to the public health effects also to the environments.

  13. The effect of oxygen molecule adsorption on lead iodide perovskite surface by first-principles calculation

    Science.gov (United States)

    Ma, Xia-Xia; Li, Ze-Sheng

    2018-01-01

    Oxygen molecule has a negative effect on perovskite solar cells, which has been investigated experimentally. However, detailed theoretical research is still rare. This study presents a microscopic view to reveal the interaction mechanism between O2 and perovskite based on the first-principles calculation. The results show that O2 is adsorbed on the (100) surface of MAPbI3 perovskite mainly by Van der Waals force. O2 adsorption makes the MAPbI3 surface generate a small number of positive charges, which leads to the increase of the work function of the MAPbI3 surface. This is in agreement with the experimental measurement. And increased work function of MAPbI3 surface is not beneficial to electron transfer from perovskite to electronic extraction layer (such as TiO2). Comparison of the density of states (DOS) of the clean (100) surface and the adsorbed system shows that an in-gap state belonging to O2 appears, which can explain the phenomenon observed from experiments that electron transfers from the surface of perovskite to O2 to form superoxide. The theoretical power conversion efficiency of the system with and without O2 adsorption is evaluated, and it turns out that the power conversion efficiency of the system with O2 adsorption is slightly lower than that of the system without O2 adsorption. This result indicates that avoiding the introduction of O2 molecules between perovskite and electronic extraction layer is beneficial to the perovskite solar cell.

  14. Interface formation between hydrocarbon ring molecules and III-V semiconductor surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Passmann, Regina

    2008-08-15

    In this work a systematical study to investigate the adsorption structures of small hydrocarbon ring shaped molecules on III-V semiconductor surfaces with Photo-Emission Spectroscopy (PES), Reflectance Anisotropy Spectroscopy (RAS), Scanning Tunneling Microscopy (STM) as well as Low Electron Energy Diffraction (LEED) was performed. To investigate the influence of the surface structure in detail the surface dimer configuration to the adsorption process of organic molecules GaAs(001) surfaces, the c(4 x 4), the (2 x 4) and the (4 x 2) have been investigated as well as the adsorption of cyclopentene on the InP(001)(2 x 4) reconstructed surface. In the direct comparison it is shown that cyclopentene bonds to the InP(001)(2 x 4) surface via a cycloaddition like reaction. During this adsorption the double bond splits which is in contrast to the adsorption of cyclopentene on the GaAs(001) surfaces. Therefrom it is concluded that the surface geometry has an influence on the resulting adsorption structure. In order to investigate the influence of the intra-molecular double bonds, cyclopentene (one double bond), 1,4-cyclohexadiene (two double bonds) and benzene (three double bonds) were used for the characterization of the interface formation. With the investigations on the GaAs(001) reconstructed surfaces it was shown that a dependency of the bonding configuration on the intra-molecular double bonds exists. During the adsorption of cyclopentene no evidence was found that the double bond has to be involved in the interface formation while during the adsorption of 1,4-cyclohexadiene and benzene the double bonds are involved. Furthermore it was found that a bonding to As atoms of the surface is more likely than a bonding to Ga atoms. (orig.)

  15. Interface formation between hydrocarbon ring molecules and III-V semiconductor surfaces

    International Nuclear Information System (INIS)

    Passmann, Regina

    2008-01-01

    In this work a systematical study to investigate the adsorption structures of small hydrocarbon ring shaped molecules on III-V semiconductor surfaces with Photo-Emission Spectroscopy (PES), Reflectance Anisotropy Spectroscopy (RAS), Scanning Tunneling Microscopy (STM) as well as Low Electron Energy Diffraction (LEED) was performed. To investigate the influence of the surface structure in detail the surface dimer configuration to the adsorption process of organic molecules GaAs(001) surfaces, the c(4 x 4), the (2 x 4) and the (4 x 2) have been investigated as well as the adsorption of cyclopentene on the InP(001)(2 x 4) reconstructed surface. In the direct comparison it is shown that cyclopentene bonds to the InP(001)(2 x 4) surface via a cycloaddition like reaction. During this adsorption the double bond splits which is in contrast to the adsorption of cyclopentene on the GaAs(001) surfaces. Therefrom it is concluded that the surface geometry has an influence on the resulting adsorption structure. In order to investigate the influence of the intra-molecular double bonds, cyclopentene (one double bond), 1,4-cyclohexadiene (two double bonds) and benzene (three double bonds) were used for the characterization of the interface formation. With the investigations on the GaAs(001) reconstructed surfaces it was shown that a dependency of the bonding configuration on the intra-molecular double bonds exists. During the adsorption of cyclopentene no evidence was found that the double bond has to be involved in the interface formation while during the adsorption of 1,4-cyclohexadiene and benzene the double bonds are involved. Furthermore it was found that a bonding to As atoms of the surface is more likely than a bonding to Ga atoms. (orig.)

  16. Surface Water Protection by Productive Buffers

    DEFF Research Database (Denmark)

    Christen, Benjamin

    Vegetated riparian buffer zones are a widely recommended best management practice in agriculture for protecting surface and coastal waters from diffuse nutrient pollution. On the background of the EU funded research project NitroEurope (NEU; www.NitroEurope.eu), this study concentrates...... on the mitigation of nitrogen pollution in surface and groundwater, using riparian buffer zones for biomass production. The objectives are to map suitable areas for buffer implementation across the six NEU study landscapes, model tentative N-loss mitigation, calculate biomass production potential and economic...... designed for local conditions could be a way of protecting water quality attractive to many stakeholders....

  17. Single NdPc{sub 2} molecules on surfaces. Adsorption, interaction, and molecular magnetism

    Energy Technology Data Exchange (ETDEWEB)

    Fahrendorf, Sarah

    2013-01-24

    They have huge potential for application in molecular-spin-transistors, molecular-spinvalves, and molecular quantum computing. SMMs are characterized by high spin ground states with zero-field splitting leading to high relaxation barriers and long relaxation times. A relevant class of molecules are the lanthanide double-decker phthalocyanines (LaPc{sub 2}) with only one metal atom sandwiched between two organic phthalocyanine (Pc) ligands. For envisaged spintronic applications it is important to understand the interaction between the molecules and the substrate and its influence on the electronic and magnetic properties. The subject of this thesis is the investigation of the adsorbed neodymium double-decker phthalocyanine (NdPc{sub 2}) by means of low temperature scanning tunneling microscopy and spectroscopy (STM and STS). The molecules are deposited by sublimation onto different substrates. It is observed that a large fraction of the double-decker molecules decomposes during deposition. The decomposition probability strongly depends on the chosen substrate. Therefore it is concluded that the substrate modifies the electronic structure of the molecule leading to a stabilization or destabilization of the molecular entity. Charge transfer from the surface to the molecule is identified as a potential stabilizing mechanism. The electronic and magnetic properties are investigated in detail for adsorbed NdPc{sub 2} molecules on Cu(100). The results of the experimental study are compared to state-of-the-art density functional theory calculations performed by our colleagues from the Peter Gruenberg Institute (PGI-1) at the Forschungszentrum Juelich. Interestingly, the lower Pc ring of the molecule hybridizes intensely with the substrate leading to strong chemisorption of the molecule, while the upper Pc ring keeps its molecular type electronic states, which can be energetically shifted by an external electric field. Importantly, it is possible to get direct access to the

  18. Single NdPc2 molecules on surfaces. Adsorption, interaction, and molecular magnetism

    International Nuclear Information System (INIS)

    Fahrendorf, Sarah

    2013-01-01

    They have huge potential for application in molecular-spin-transistors, molecular-spinvalves, and molecular quantum computing. SMMs are characterized by high spin ground states with zero-field splitting leading to high relaxation barriers and long relaxation times. A relevant class of molecules are the lanthanide double-decker phthalocyanines (LaPc 2 ) with only one metal atom sandwiched between two organic phthalocyanine (Pc) ligands. For envisaged spintronic applications it is important to understand the interaction between the molecules and the substrate and its influence on the electronic and magnetic properties. The subject of this thesis is the investigation of the adsorbed neodymium double-decker phthalocyanine (NdPc 2 ) by means of low temperature scanning tunneling microscopy and spectroscopy (STM and STS). The molecules are deposited by sublimation onto different substrates. It is observed that a large fraction of the double-decker molecules decomposes during deposition. The decomposition probability strongly depends on the chosen substrate. Therefore it is concluded that the substrate modifies the electronic structure of the molecule leading to a stabilization or destabilization of the molecular entity. Charge transfer from the surface to the molecule is identified as a potential stabilizing mechanism. The electronic and magnetic properties are investigated in detail for adsorbed NdPc 2 molecules on Cu(100). The results of the experimental study are compared to state-of-the-art density functional theory calculations performed by our colleagues from the Peter Gruenberg Institute (PGI-1) at the Forschungszentrum Juelich. Interestingly, the lower Pc ring of the molecule hybridizes intensely with the substrate leading to strong chemisorption of the molecule, while the upper Pc ring keeps its molecular type electronic states, which can be energetically shifted by an external electric field. Importantly, it is possible to get direct access to the spin

  19. Collisions of ideal gas molecules with a rough/fractal surface. A computational study.

    Science.gov (United States)

    Panczyk, Tomasz

    2007-02-01

    The frequency of collisions of ideal gas molecules (argon) with a rough surface has been studied. The rough/fractal surface was created using random deposition technique. By applying various depositions, the roughness of the surface was controlled and, as a measure of the irregularity, the fractal dimensions of the surfaces were determined. The surfaces were next immersed in argon (under pressures 2 x 10(3) to 2 x 10(5) Pa) and the numbers of collisions with these surfaces were counted. The calculations were carried out using a simplified molecular dynamics simulation technique (only hard core repulsions were assumed). As a result, it was stated that the frequency of collisions is a linear function of pressure for all fractal dimensions studied (D = 2, ..., 2.5). The frequency per unit pressure is quite complex function of the fractal dimension; however, the changes of that frequency with the fractal dimension are not strong. It was found that the frequency of collisions is controlled by the number of weakly folded sites on the surfaces and there is some mapping between the shape of adsorption energy distribution functions and this number of weakly folded sites. The results for the rough/fractal surfaces were compared with the prediction given by the Langmuir-Hertz equation (valid for smooth surface), generally the departure from the Langmuir-Hertz equation is not higher than 48% for the studied systems (i.e. for the surfaces created using the random deposition technique).

  20. The hydrophobic effect: Molecular dynamics simulations of water confined between extended hydrophobic and hydrophilic surfaces

    DEFF Research Database (Denmark)

    Jensen, Morten Østergaard; Mouritsen, Ole G.; Peters, Günther H.J.

    2004-01-01

    Structural and dynamic properties of water confined between two parallel, extended, either hydrophobic or hydrophilic crystalline surfaces of n-alkane C36H74 or n-alcohol C35H71OH, are studied by molecular dynamics simulations. Electron density profiles, directly compared with corresponding......-correlation functions reveal that water molecules have characteristic diffusive behavior and orientational ordering due to the lack of hydrogen bonding interactions with the surface. These observations suggest that the altered dynamical properties of water in contact with extended hydrophobic surfaces together...... at both surfaces. The ordering is characteristically different between the surfaces and of longer range at the hydrophilic surface. Furthermore, the dynamic properties of water are different at the two surfaces and different from the bulk behavior. In particular, at the hydrophobic surface, time...

  1. Structural and dynamical properties of water confined between two hydrophilic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)

    2009-10-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  2. Structural and dynamical properties of water confined between two hydrophilic surfaces

    International Nuclear Information System (INIS)

    Di Napoli, Solange; Gamba, Zulema

    2009-01-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  3. Advances in single-molecule magnet surface patterning through microcontact printing.

    Science.gov (United States)

    Mannini, Matteo; Bonacchi, Daniele; Zobbi, Laura; Piras, Federica M; Speets, Emiel A; Caneschi, Andrea; Cornia, Andrea; Magnani, Agnese; Ravoo, Bart Jan; Reinhoudt, David N; Sessoli, Roberta; Gatteschi, Dante

    2005-07-01

    We present an implementation of strategies to deposit single-molecule magnets (SMMs) using microcontact printing microCP). We describe different approaches of microCP to print stripes of a sulfur-functionalized dodecamanganese (III, IV) cluster on gold surfaces. Comparison by atomic force microscopy profile analysis of the patterned structures confirms the formation of a chemically stable single layer of SMMs. Images based on chemical contrast, obtained by time-of-flight secondary ion mass spectrometry, confirm the patterned structure.

  4. Toward single-molecule detection with sensors based on propagating surface plasmons

    Czech Academy of Sciences Publication Activity Database

    Kvasnička, Pavel; Chadt, Karel; Vala, Milan; Bocková, Markéta; Homola, Jiří

    2012-01-01

    Roč. 37, č. 2 (2012), s. 163-165 ISSN 0146-9592 R&D Projects: GA AV ČR KAN200670701; GA MŠk OC09058; GA MŠk(CZ) LH11102 Institutional research plan: CEZ:AV0Z20670512 Keywords : optical biosenzor * single molecule * surface plasmon microscopy Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 3.385, year: 2012

  5. SEM visualization of glycosylated surface molecules using lectin-coated microspheres

    Science.gov (United States)

    Duke, J.; Janer, L.; Campbell, M.

    1985-01-01

    There are several techniques currently used to localize glycosylated surface molecules by scanning electron microscopy (Grinnell, 1980; Molday, 1976; Linthicum and Sell, 1975; Nicolson, 1974; Lo Buglio, et al, 1972). A simple and rapid method, using a modification of Grinnell's technique is reported here. Essentially, microspheres coated with Concavalin A are used to bind to glycosylated regions of the palatal shelf epithelium and are visualized in the scanning electron microscope (SEM).

  6. FORMATION OF ORGANIC MOLECULES AND WATER IN WARM DISK ATMOSPHERES

    Energy Technology Data Exchange (ETDEWEB)

    Najita, Joan R. [National Optical Astronomy Observatory, 950 N. Cherry Avenue, Tucson, AZ 85719 (United States); Adamkovics, Mate; Glassgold, Alfred E. [Astronomy Department, University of California, Berkeley, CA 94720 (United States)

    2011-12-20

    Observations from Spitzer and ground-based infrared spectroscopy reveal significant diversity in the molecular emission from the inner few AU of T Tauri disks. We explore theoretically the possible origin of this diversity by expanding on our earlier thermal-chemical model of disk atmospheres. We consider how variations in grain settling, X-ray irradiation, accretion-related mechanical heating, and the oxygen-to-carbon ratio can affect the thermal and chemical properties of the atmosphere at 0.25-40 AU. We find that these model parameters can account for many properties of the detected molecular emission. The column density of the warm (200-2000 K) molecular atmosphere is sensitive to grain settling and the efficiency of accretion-related heating, which may account, at least in part, for the large range in molecular emission fluxes that have been observed. The dependence of the atmospheric properties on the model parameters may also help to explain trends that have been reported in the literature between molecular emission strength and mid-infrared color, stellar accretion rate, and disk mass. We discuss whether some of the differences between our model results and the observations (e.g., for water) indicate a role for vertical transport and freezeout in the disk midplane. We also discuss how planetesimal formation in the outer disk (beyond the snowline) may imprint a chemical signature on the inner few AU of the disk and speculate on possible observational tracers of this process.

  7. FORMATION OF ORGANIC MOLECULES AND WATER IN WARM DISK ATMOSPHERES

    International Nuclear Information System (INIS)

    Najita, Joan R.; Ádámkovics, Máté; Glassgold, Alfred E.

    2011-01-01

    Observations from Spitzer and ground-based infrared spectroscopy reveal significant diversity in the molecular emission from the inner few AU of T Tauri disks. We explore theoretically the possible origin of this diversity by expanding on our earlier thermal-chemical model of disk atmospheres. We consider how variations in grain settling, X-ray irradiation, accretion-related mechanical heating, and the oxygen-to-carbon ratio can affect the thermal and chemical properties of the atmosphere at 0.25-40 AU. We find that these model parameters can account for many properties of the detected molecular emission. The column density of the warm (200-2000 K) molecular atmosphere is sensitive to grain settling and the efficiency of accretion-related heating, which may account, at least in part, for the large range in molecular emission fluxes that have been observed. The dependence of the atmospheric properties on the model parameters may also help to explain trends that have been reported in the literature between molecular emission strength and mid-infrared color, stellar accretion rate, and disk mass. We discuss whether some of the differences between our model results and the observations (e.g., for water) indicate a role for vertical transport and freezeout in the disk midplane. We also discuss how planetesimal formation in the outer disk (beyond the snowline) may imprint a chemical signature on the inner few AU of the disk and speculate on possible observational tracers of this process.

  8. Measuring the force of single protein molecule detachment from surfaces with AFM.

    Science.gov (United States)

    Tsapikouni, Theodora S; Missirlis, Yannis F

    2010-01-01

    Atomic force microscopy (AFM) was used to measure the non-specific detachment force of single fibrinogen molecules from glass surfaces. The identification of single unbinding events was based on the characteristics of the parabolic curves, recorded during the stretching of protein molecules. Fibrinogen molecules were covalently bound to Si(3)N(4) AFM tips, previously modified with 3-aminopropyl-dimethyl-ethoxysilane, through a homobifunctional poly(ethylene glycol) linker bearing two hydroxysulfosuccinimide esters. The most probable detachment force was found to be 210 pN, when the tip was retracting with a velocity of 1400 nm/s, while the distribution of the detachment distances indicated that the fibrinogen chain can be elongated beyond the length of the physical conformation before detachment. The dependence of the most probable detachment force on the loading rate was examined and the dynamics of fibrinogen binding to the surface were found amenable to the simple expression of the Bell-Evans theory. The theory's expansion, however, by incorporating the concept of the rupture of parallel residue-surface bonds could only describe the detachment of fibrinogen for a small number of such bonds. Finally, the mathematical expression of the Worm-Like Chain model was used to fit the stretching curves before rupture and two interpretations are suggested for the description of the AFM curves with multiple detachment events.

  9. A theoretical and experimental investigation of the interaction between gas molecules and cryogenic surfaces

    International Nuclear Information System (INIS)

    Varlam, M.; Steflea, D.; Chiriloaie, N.

    1992-01-01

    The cryo-pumping performance of a cryo-surface subjected to the impingement of low-pressure, thermal-velocity air flow is experimentally and theoretically investigated. Our purpose is to determine the angular dependence of capture coefficients for gas molecules incident on a cryogenic surface under conditions closely approximating those prevailing in cryo-pumped high vacuum chambers. The classical model for the interaction of gas atoms and the solid surface - the 'soft-tube' model - is developed and the basic assumption are examined. Starting from this theory we have calculated the capture coefficient of the Ag - N system and these values are discussed in terms of principal parameters considered. Despite the many simplifying assumptions, this model has the important attribute that it yields closed-form expressions for the capture coefficient of gas molecules. The molecular beam technique offers a direct experimental method for determining the capture coefficient for molecules with given angles of incidence by measuring the incident and reflected molecular fluxes. An experimental setup is also designed and the method for determining these coefficients is proposed. (Author)

  10. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  11. Surface-Water Conditions in Georgia, Water Year 2005

    Science.gov (United States)

    Painter, Jaime A.; Landers, Mark N.

    2007-01-01

    INTRODUCTION The U.S. Geological Survey (USGS) Georgia Water Science Center-in cooperation with Federal, State, and local agencies-collected surface-water streamflow, water-quality, and ecological data during the 2005 Water Year (October 1, 2004-September 30, 2005). These data were compiled into layers of an interactive ArcReaderTM published map document (pmf). ArcReaderTM is a product of Environmental Systems Research Institute, Inc (ESRI?). Datasets represented on the interactive map are * continuous daily mean streamflow * continuous daily mean water levels * continuous daily total precipitation * continuous daily water quality (water temperature, specific conductance dissolved oxygen, pH, and turbidity) * noncontinuous peak streamflow * miscellaneous streamflow measurements * lake or reservoir elevation * periodic surface-water quality * periodic ecological data * historical continuous daily mean streamflow discontinued prior to the 2005 water year The map interface provides the ability to identify a station in spatial reference to the political boundaries of the State of Georgia and other features-such as major streams, major roads, and other collection stations. Each station is hyperlinked to a station summary showing seasonal and annual stream characteristics for the current year and for the period of record. For continuous discharge stations, the station summary includes a one page graphical summary page containing five graphs, a station map, and a photograph of the station. The graphs provide a quick overview of the current and period-of-record hydrologic conditions of the station by providing a daily mean discharge graph for the water year, monthly statistics graph for the water year and period of record, an annual mean streamflow graph for the period of record, an annual minimum 7-day average streamflow graph for the period of record, and an annual peak streamflow graph for the period of record. Additionally, data can be accessed through the layer's link

  12. Global modelling of Cryptosporidium in surface water

    Science.gov (United States)

    Vermeulen, Lucie; Hofstra, Nynke

    2016-04-01

    Introduction Waterborne pathogens that cause diarrhoea, such as Cryptosporidium, pose a health risk all over the world. In many regions quantitative information on pathogens in surface water is unavailable. Our main objective is to model Cryptosporidium concentrations in surface waters worldwide. We present the GloWPa-Crypto model and use the model in a scenario analysis. A first exploration of global Cryptosporidium emissions to surface waters has been published by Hofstra et al. (2013). Further work has focused on modelling emissions of Cryptosporidium and Rotavirus to surface waters from human sources (Vermeulen et al 2015, Kiulia et al 2015). A global waterborne pathogen model can provide valuable insights by (1) providing quantitative information on pathogen levels in data-sparse regions, (2) identifying pathogen hotspots, (3) enabling future projections under global change scenarios and (4) supporting decision making. Material and Methods GloWPa-Crypto runs on a monthly time step and represents conditions for approximately the year 2010. The spatial resolution is a 0.5 x 0.5 degree latitude x longitude grid for the world. We use livestock maps (http://livestock.geo-wiki.org/) combined with literature estimates to calculate spatially explicit livestock Cryptosporidium emissions. For human Cryptosporidium emissions, we use UN population estimates, the WHO/UNICEF JMP sanitation country data and literature estimates of wastewater treatment. We combine our emissions model with a river routing model and data from the VIC hydrological model (http://vic.readthedocs.org/en/master/) to calculate concentrations in surface water. Cryptosporidium survival during transport depends on UV radiation and water temperature. We explore pathogen emissions and concentrations in 2050 with the new Shared Socio-economic Pathways (SSPs) 1 and 3. These scenarios describe plausible future trends in demographics, economic development and the degree of global integration. Results and

  13. Ions, metabolites, and cells: Water as a reporter of surface conditions during bacterial growth

    Science.gov (United States)

    Jarisz, Tasha A.; Lane, Sarah; Gozdzialski, Lea; Hore, Dennis K.

    2018-06-01

    Surface-specific nonlinear vibrational spectroscopy, combined with bulk solution measurements and imaging, is used to study the surface conditions during the growth of E. coli. As a result of the silica high surface charge density, the water structure at the silica-aqueous interface is known to be especially sensitive to pH and ionic strength, and surface concentration profiles develop that can be appreciably different from the bulk solution conditions. We illustrate that, in the presence of growing cells, a unique surface micro-environment is established as a result of metabolites accumulating on the silica surface. Even in the subsequent absence of the cells, this surface layer works to reduce the interfacial ionic strength as revealed by the enhanced signal from surface water molecules. In the presence of growing cells, an additional boost in surface water signal is attributed to a local pH that is higher than that of the bulk solution.

  14. Impinging Water Droplets on Inclined Glass Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Armijo, Kenneth Miguel [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lance, Blake [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ho, Clifford K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-09-01

    Multiphase computational models and tests of falling water droplets on inclined glass surfaces were developed to investigate the physics of impingement and potential of these droplets to self-clean glass surfaces for photovoltaic modules and heliostats. A multiphase volume-of-fluid model was developed in ANSYS Fluent to simulate the impinging droplets. The simulations considered different droplet sizes (1 mm and 3 mm), tilt angles (0°, 10°, and 45°), droplet velocities (1 m/s and 3 m/s), and wetting characteristics (wetting=47° contact angle and non-wetting = 93° contact angle). Results showed that the spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) decreased with increasing inclination angle due to the reduced normal force on the surface. The hydrophilic surface yielded greater spread factors than the hydrophobic surface in all cases. With regard to impact forces, the greater surface tilt angles yielded lower normal forces, but higher shear forces. Experiments showed that the experimentally observed spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) was significantly larger than the simulated spread factor. Observed spread factors were on the order of 5 - 6 for droplet velocities of ~3 m/s, whereas the simulated spread factors were on the order of 2. Droplets were observed to be mobile following impact only for the cases with 45° tilt angle, which matched the simulations. An interesting phenomenon that was observed was that shortly after being released from the nozzle, the water droplet oscillated (like a trampoline) due to the "snapback" caused by the surface tension of the water droplet being released from the nozzle. This oscillation impacted the velocity immediately after the release. Future work should evaluate the impact of parameters such as tilt angle and surface wettability on the impact of particle/soiling uptake and removal to investigate ways that

  15. Surface-Water Data, Georgia, Water Year 1999

    Science.gov (United States)

    Alhadeff, S. Jack; Landers, Mark N.; McCallum, Brian E.

    1999-01-01

    Water resources data for the 1999 water year for Georgia consists of records of stage, discharge, and water quality of streams; and the stage and contents of lakes and reservoirs published in one volume in a digital format on a CD-ROM. This volume contains discharge records of 121 gaging stations; stage for 13 gaging stations; stage and contents for 18 lakes and reservoirs; continuous water quality records for 10 stations; and the annual peak stage and annual peak discharge for 75 crest-stage partial-record stations. These data represent that part of the National Water Data System collected by the U.S. Geological Survey and cooperating State and Federal agencies in Georgia. Records of discharge and stage of streams, and contents or stage of lakes and reservoirs were first published in a series of U.S. Geological water-supply papers entitled, 'Surface-Water Supply of the United States.' Through September 30, 1960, these water-supply papers were in an annual series and then in a 5-year series for 1961-65 and 1966-70. Records of chemical quality, water temperature, and suspended sediment were published from 1941 to 1970 in an annual series of water-supply papers entitled, 'Quality of Surface Waters of the United States.' Records of ground-water levels were published from 1935 to 1974 in a series of water-supply papers entitled, 'Ground-Water Levels in the United States.' Water-supply papers may be consulted in the libraries of the principal cities in the United States or may be purchased from the U.S. Geological Survey, Branch of Information Services, Federal Center, Box 25286, Denver, CO 80225. For water years 1961 through 1970, streamflow data were released by the U.S. Geological Survey in annual reports on a State-boundary basis prior to the two 5-year series water-supply papers, which cover this period. The data contained in the water-supply papers are considered the official record. Water-quality records for water years 1964 through 1970 were similarly released

  16. Influence of the effective mass of water molecule on thermal neutron scattering

    International Nuclear Information System (INIS)

    Markovic, M.

    1981-01-01

    The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E o = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)

  17. Surface water, particulate matter, and sediments of inland waters

    International Nuclear Information System (INIS)

    Mundschenk, H.

    1985-01-01

    The Bundesanstalt fuer Gewaesserkunde (BfG) since 1958 runs a system for monitoring the surface water and sediments of Federal German waterways in its capacity as a directing water monitoring centre. The data recorded over the years show that the radioactivity released by the various emission sources leads to radionuclide concentrations in water, particulate matter, or sediments that generally are below the detection limits defined in the relevant legal provisions governing monitoring and surveillance of nuclear facilities effluents. Representative examples of measuring methods and results (as for e.g. for H-3) are given. (DG) [de

  18. Single-Molecule Chemistry with Surface- and Tip-Enhanced Raman Spectroscopy.

    Science.gov (United States)

    Zrimsek, Alyssa B; Chiang, Naihao; Mattei, Michael; Zaleski, Stephanie; McAnally, Michael O; Chapman, Craig T; Henry, Anne-Isabelle; Schatz, George C; Van Duyne, Richard P

    2017-06-14

    Single-molecule (SM) surface-enhanced Raman spectroscopy (SERS) and tip-enhanced Raman spectroscopy (TERS) have emerged as analytical techniques for characterizing molecular systems in nanoscale environments. SERS and TERS use plasmonically enhanced Raman scattering to characterize the chemical information on single molecules. Additionally, TERS can image single molecules with subnanometer spatial resolution. In this review, we cover the development and history of SERS and TERS, including the concept of SERS hot spots and the plasmonic nanostructures necessary for SM detection, the past and current methodologies for verifying SMSERS, and investigations into understanding the signal heterogeneities observed with SMSERS. Moving on to TERS, we cover tip fabrication and the physical origins of the subnanometer spatial resolution. Then, we highlight recent advances of SMSERS and TERS in fields such as electrochemistry, catalysis, and SM electronics, which all benefit from the vibrational characterization of single molecules. SMSERS and TERS provide new insights on molecular behavior that would otherwise be obscured in an ensemble-averaged measurement.

  19. Shear-stress-induced structural arrangement of water molecules in nanoscale Couette flow with slipping at wall boundary

    International Nuclear Information System (INIS)

    Lin, Jau-Wen

    2014-01-01

    This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied

  20. Effect of water molecule distribution on the quantitative XRD analysis in the case of Na-montmorillonite exchanged Cu2+

    International Nuclear Information System (INIS)

    Oueslati, W.; Meftah, M.; Ben Rhaiem, H.; Ben Haj Amara, A.

    2010-01-01

    Document available in extended abstract form only. Several theoretical models are proposed to describe hydration process for Wyoming-montmorillonite clay exchanged Na + or Cu 2+ . They propose some theoretical distribution and disposition for water molecule in the inter-lamellar space in the case of homogeneous and inter-stratified hydration states. For example, Ben Brahim et al. (1983a) studied the interlayer structure (atomic positions of interlayer cations) and associated H 2 O molecules of Na-saturated montmorillonite and beidellite samples. Moore and Hower (1986) studied ordered structures composed of mono-hydrated and collapsed interlayers in montmorillonite, and Cuadros (1996) estimated the H 2 O content of smectite as a function of the interlayer cation. Using similar approach, Ferrage et al (2005b) proposed a discreet distribution of water molecule layer in the same z coordinate of the exchangeable cation with inhomogeneous distribution. This heterogeneity was attributed to the surface charge. The main objective of this study is to characterize the structural changes in the theoretical XRD profile, induced by different water molecule distribution, used to simulate experimental XRD patterns in the case of Na-montmorillonite exchanged Cu 2+ . This problem was achieved by quantitative XRD analysis using an indirect method based on the comparison of the experimental 001 reflections obtained from oriented films patterns with those calculated from structural models. The starting materials were Ca-montmorillonite originated from bentonites of Wyoming (USA). The XRD patterns were obtained by reflection setting with a D8 ADVANCE Bruker installation using Cu-Kα radiation and equipped with solid state detector. Intensities were measured at an interval of 2Θ 0.04 deg. and 40-50 s counting time per step. The diffracted intensity was calculated according to the matrix formalism detailed by Drits and Tchoubar, (1990). The fitting strategies was detailed by Ferrage et

  1. The specificity of targeted vaccines for APC surface molecules influences the immune response phenotype.

    Directory of Open Access Journals (Sweden)

    Gunnveig Grødeland

    Full Text Available Different diseases require different immune responses for efficient protection. Thus, prophylactic vaccines should prime the immune system for the particular type of response needed for protection against a given infectious agent. We have here tested fusion DNA vaccines which encode proteins that bivalently target influenza hemagglutinins (HA to different surface molecules on antigen presenting cells (APC. We demonstrate that targeting to MHC class II molecules predominantly induced an antibody/Th2 response, whereas targeting to CCR1/3/5 predominantly induced a CD8(+/Th1 T cell response. With respect to antibodies, the polarizing effect was even more pronounced upon intramuscular (i.m delivery as compared to intradermal (i.d. vaccination. Despite these differences in induced immune responses, both vaccines protected against a viral challenge with influenza H1N1. Substitution of HA with ovalbumin (OVA demonstrated that polarization of immune responses, as a consequence of APC targeting specificity, could be extended to other antigens. Taken together, the results demonstrate that vaccination can be tailor-made to induce a particular phenotype of adaptive immune responses by specifically targeting different surface molecules on APCs.

  2. Analysis of functional organic molecules at noble metal surfaces by means of vibrational spectroscopies

    Energy Technology Data Exchange (ETDEWEB)

    Leyssner, Felix

    2011-10-24

    The goal of this work is to optimize the efficiency of photoinduced molecular switching processes on surfaces via controlled variations of the adsorption and electronic properties of the switch. We investigated the influence of external stimuli, i.e. photons and thermal activation, on surface bound molecular switches undergoing trans/cis-isomerizations and ring-opening/closing-reactions, respectively. High resolution electron energy loss spectroscopy (HREELS) and sum-frequency generation (SFG) spectroscopy have been used as the main tools to investigate the adsorption behavior and the molecular switching properties. Two basic concepts of coupling the molecular switch to the surface have been studied: (i) physisorbed or weakly chemisorbed systems deposited on noble metal surfaces under UHV conditions and (ii) molecular switches bound covalently via anchor groups. In the HREELS study following concept (i), we investigated the adsorption geometry and isomerization behavior of various molecular switches on metal substrates which are able to undergo a photoinduced trans/cis-isomerization in solution. We investigated three isoelectronic molecules on Au where we systematically changed the photochemically active group from the diazo-group in an azobenzene-derivative (on Cu(111)) to the imine-group, and the vinylene-group, respectively. Finding the photoisomerization quenched for all systems we observed considerable differences in their thermal isomerization behavior. Comparable we find the photoinduced ring-opening/closing-reaction of spiropyran quenched on Au(111) but a thermally induced ring-opening reaction resulting in the open form being strongly stabilized by the metal. SFG spectroscopy is employed to investigate the reversible, photoinduced trans/cis-isomerization of an azobenzene-functionalized self-assembled monolayer (SAM) on gold using a tripodal linker system. In consequence of the decoupling provided by the tripodal linker, the switching behavior of the

  3. Lithium content in potable water, surface water, ground water, and mineral water on the territory of Republic of Macedonia

    OpenAIRE

    Kostik, Vesna; Bauer, Biljana; Kavrakovski, Zoran

    2014-01-01

    The aim of this study was to determine lithium concentration in potable water, surface water, ground, and mineral water on the territory of the Republic of Macedonia. Water samples were collected from water bodies such as multiple public water supply systems located in 13 cities, wells boreholes located in 12 areas, lakes and rivers located in three different areas. Determination of lithium concentration in potable water, surface water was performed by the technique of inductively coupl...

  4. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  5. Surface chemical reactions induced by molecules electronically-excited in the gas

    DEFF Research Database (Denmark)

    Petrunin, Victor V.

    2011-01-01

    and alignment are taking place, guiding all the molecules towards the intersections with the ground state PES, where transitions to the ground state PES will occur with minimum energy dissipation. The accumulated kinetic energy may be used to overcome the chemical reaction barrier. While recombination chemical...... be readily produced. Products of chemical adsorption and/or chemical reactions induced within adsorbates are aggregated on the surface and observed by light scattering. We will demonstrate how pressure and spectral dependencies of the chemical outcomes, polarization of the light and interference of two laser...... beams inducing the reaction can be used to distinguish the new process we try to investigate from chemical reactions induced by photoexcitation within adsorbed molecules and/or gas phase photolysis....

  6. Epitaxially Grown Films of Standing and Lying Pentacene Molecules on Cu(110) Surfaces

    Science.gov (United States)

    2011-01-01

    Here, it is shown that pentacene thin films (30 nm) with distinctively different crystallographic structures and molecular orientations can be grown under essentially identical growth conditions in UHV on clean Cu(110) surfaces. By X-ray diffraction, we show that the epitaxially oriented pentacene films crystallize either in the “thin film” phase with standing molecules or in the “single crystal” structure with molecules lying with their long axes parallel to the substrate. The morphology of the samples observed by atomic force microscopy shows an epitaxial alignment of pentacene crystallites, which corroborates the molecular orientation observed by X-ray diffraction pole figures. Low energy electron diffraction measurements reveal that these dissimilar growth behaviors are induced by subtle differences in the monolayer structures formed by slightly different preparation procedures. PMID:21479111

  7. Nucleolytic degradation of homologous and heterologous deoxyribonucleic acid molecules at the surface of competent pneumococci

    International Nuclear Information System (INIS)

    Seto, H.; Lopez, R.; Garrigan, O.; Tomasz, A.

    1975-01-01

    Competent pneumococci can catalyze the rapid and quantitative degradation of extracellular deoxyribonucleic acid (DNA) molecules through the activity of surface-located nucleases (endo- and, possibly, exonucleases as well). Both homologous and heterologous DNAs are degraded by a mechanism that seems to involve a cyclic process: (i) attachment of DNA to the cell surface followed by (ii) nucleolytic attack, and (iii) release to the medium. Processes (ii) and (iii) are both inhibited by ethylenediaminetetraacetate. Whereas surface nuclease activity is specific for competent cells, the bulk of this activity is not coupled to irreversible DNA uptake (deoxyribonuclease-resistant binding). Pneumococcal DNA treated with ultraviolet irradiation or nitrous acid (cross-linking) is selectively impaired in the ability to irreversibly bind to competent cells, whereas reversible binding is normal. (U.S.)

  8. Strategies For Immobilization Of Bioactive Organic Molecules On Titanium Implant Surfaces – A Review

    Directory of Open Access Journals (Sweden)

    Panayotov Ivan V.

    2015-03-01

    Full Text Available Numerous approaches have been used to improve the tissue-implant interface of titanium (Ti and titanium alloy (Ti6Al4V. They all aim at increasing cell migration and attachment to the metal, preventing unspecific protein adsorption and improving post-implantation healing process. Promising methods for titanium and titanium alloy surface modification are based on the immobilization of biologically active organic molecules. New and interesting biochemical approaches to such surface modification include layer-by-layer deposition of polyelectrolyte films, phage display-selected surface binding peptides and self-assembled DNA monolayer systems. The present review summarizes the scientific information about these methods, which are at in vitro or in vivo development stages, and hopes to promote their future application in dental implantology and in oral and maxillofacial surgery.

  9. Line printing solution-processable small molecules with uniform surface profile via ink-jet printer.

    Science.gov (United States)

    Liu, Huimin; Xu, Wei; Tan, Wanyi; Zhu, Xuhui; Wang, Jian; Peng, Junbiao; Cao, Yong

    2016-03-01

    Line printing offers a feasible approach to remove the pixel well structure which is widely used to confine the ink-jet printed solution. In the study, a uniform line is printed by an ink-jet printer. To achieve a uniform surface profile of the printed line, 10vol% low-volatile solvent DMA (3,4-Dimethylanisole) is mixed with high-volatile solvent Pxy (p-xylene) as the solvent. After a solution-processable small molecule is dissolved, the surface tension of DMA solution becomes lower than that of Pxy solution, which creates an inward Marangoni flow during the solvent evaporation. The inward Marangoni flow balances out the outward capillary flow, thereby forming a flat film surface. The line width of the printed line depends on the contact angle of the solution on the hole injection layer. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Transport of water molecules through noncylindrical pores in multilayer nanoporous graphene.

    Science.gov (United States)

    Shahbabaei, Majid; Kim, Daejoong

    2017-08-09

    In this study, molecular dynamics (MD) simulations are used to examine the water transport properties through asymmetric hourglass-shaped pores in multilayer nanoporous graphene with a constant interlayer separation of 6 Å. The properties of the tested asymmetric hourglass-shaped pores [with the models having long cone (l 1 , -P) and short cone (l 2 , +P) entrances] are compared to a symmetric pore model. The study findings indicate that the water occupancy increases across the asymmetric pore (l 1 , -P) compared to (l 2 , +P), because of the length effect. The asymmetric pore, (l 1 , -P), yields higher flux compared to (l 2 , +P) and even the symmetric model, which can be attributed to the increase in the hydrogen bonds. In addition, the single-file water molecules across the narrowest pore diameter inside the (l 2 , +P) pore exhibit higher viscosity compared to those in the (l 1 , -P) pore because of the increase in the water layering effect. Moreover, it is found that the permeability inside the multilayer hourglass-shaped pore depends on the length of the flow path of the water molecules before approaching the layer with the smallest pore diameter. The probability of dipole orientation exhibits wider distribution inside the (l 1 , -P) system compared to (l 2 , +P), implying an enhanced formation of hydrogen bonding of water molecules. This results in the fast flow of water molecules. The MD trajectory shows that the dipole orientation across the single-layer graphene has frequently flipped compared to the dipole orientation across the pores in multilayer graphene, which is maintained during the whole simulation time (although the dipole orientation has flipped for a few picoseconds at the beginning of the simulation). This can be attributed to the energy barrier induced by the individual layer. The diffusion coefficient of water molecules inside the (l 2 , +P) system increases with pressure difference, however, it decreases inside the (l 1 , -P) system because

  11. Surface-water investigations at Barrow, Alaska

    Science.gov (United States)

    Jones, Stanley H.

    1972-01-01

    The U.S. Public Health Service is currently developing plans for a long-term water supply and sewage treatment system for the village of Barrow, Alaska. To assist in planning, the U.S. Geological Survey was requested to initiate a cooperative streamflow data-collection program with the U.S. Public Health Service in June 1972 to determine the availability of surface water and the areal distribution of runoff in the Barrow area. This basic-data report summarizes the streamflow data collected from June 1 through July 10, 1972, at three gaging stations in the Barrow area (fig. 1) and discusses the future data-collection program.

  12. Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

    KAUST Repository

    Shinagawa, Tatsuya

    2015-01-01

    Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed constant current behaviors at near neutral pH reflect the intrinsic electrocatalytic reactivity of the metal electrodes for water reduction. This journal is © the Owner Societies.

  13. Transport and transformation of surface water masses across the ...

    African Journals Online (AJOL)

    Transport and transformation of surface water masses across the Mascarene Plateau during the Northeast Monsoon season. ... Mixing occurs in the central gap between intermediate water masses (Red Sea Water [RSW] and Antarctic Intermediate Water [AAIW]) as well as in the upper waters (Subtropical Surface Water ...

  14. STABILIZATION OF THE NEUTRAL PROTEASE OF BACILLUS-STEAROTHERMOPHILUS BY REMOVAL OF A BURIED WATER MOLECULE

    NARCIS (Netherlands)

    VRIEND, G; BERENDSEN, HJC; VANDERZEE, [No Value; VANDENBURG, B; VENEMA, G; EIJSINK, VGH

    1991-01-01

    Using site-directed mutagenesis, Ala166 in the neutral protease of Bacillus stearothermophilus was changed into Ser. Model building and molecular dynamics simulations of the mutant enzyme indicated that the Ser hydroxyl group fits well in a cavity which contains a water molecule in the wild-type

  15. Effects of Water Molecule on CO Oxidation by OH: Reaction Pathways, Kinetic Barriers, and Rate Constants.

    Science.gov (United States)

    Zhang, Linyao; Yang, Li; Zhao, Yijun; Zhang, Jiaxu; Feng, Dongdong; Sun, Shaozeng

    2017-07-06

    The water dilute oxy-fuel combustion is a clean combustion technology for near-zero emission power; and the presence of water molecule could have both kinetic and dynamic effects on combustion reactions. The reaction OH + CO → CO 2 + H, one of the most important elementary reactions, has been investigated by extensive electronic structure calculations. And the effects of a single water molecule on CO oxidation have been studied by considering the preformed OH(H 2 O) complex reacts with CO. The results show little change in the reaction pathways, but the additional water molecule actually increases the vibrationally adiabatic energy barriers (V a G ). Further thermal rate constant calculations in the temperature range of 200 to 2000 K demonstrate that the total low-pressure limit rate constant for the water assisted OH(H 2 O) + CO → CO 2 + H 2 O + H reaction is 1-2 orders lower than that of the water unassisted one, which is consistent with the change of V a G . Therefore, the hydrated radical OH(H 2 O) would actually slow down the oxidation of CO. Meanwhile, comparisons show that the M06-2X/aug-cc-pVDZ method gives a much better estimation in energy and thus is recommended to be employed for direct dynamics simulations.

  16. Molecular Structure and Dynamics in Thin Water Films at the Silica and Graphite Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Argyris, Dr. Dimitrios [University of Oklahoma; Tummala, Dr. Naga Rajesh [University of Oklahoma; StrioloDr., A [Vanderbilt University; Cole, David R [ORNL

    2008-01-01

    The structure and dynamic properties of interfacial water at the graphite and silica solid surfaces were investigated using molecular dynamics simulations. The effect of surface properties on the characteristics of interfacial water was quantified by computing density profiles, radial distribution functions, surface density distributions, orientation order parameters, and residence and reorientation correlation functions. In brief, our results show that the surface roughness, chemical heterogeneity, and surface heterogeneous charge distribution affect the structural and dynamic properties of the interfacial water molecules, as well as their rate of exchange with bulk water. Most importantly, our results indicate the formation of two distinct water layers at the SiO2 surface covered by a large density of hydroxyl groups. Further analysis of the data suggests a highly confined first layer where the water molecules assume preferential hydrogen-down orientation and a second layer whose behavior and characteristics are highly dependent on those of the first layer through a well-organized hydrogen bond network. The results suggest that water-water interactions, in particular hydrogen bonds, may be largely responsible for macroscopic interfacial properties such as adsorption and contact angle.

  17. Radiological monitoring. Controlling surface water pollution

    International Nuclear Information System (INIS)

    Morin, Maxime

    2018-01-01

    Throughout France, surface waters (from rivers to brooks) located at the vicinity of nuclear or industrial sites, are subject to regular radiological monitoring. An example is given with the radiological monitoring of a small river near La Hague Areva's plant, where contaminations have been detected with the help of the French IRSN nuclear safety research organization. The sampling method and various measurement types are described

  18. An immersion calorimetric study of the interactions between some organic molecules and functionalized carbon nanotube surfaces

    International Nuclear Information System (INIS)

    Castillejos-López, E.; Bachiller-Baeza, B.; Guerrero-Ruiz, A.; Rodriguez-Ramos, I.

    2013-01-01

    Highlights: ► The interaction of organic chemicals with the surface of modified CNTs was studied. ► Specific π–π interactions between graphitic CNTs and toluene have been considered. ► Confinement effects in CNTs increase the adsorption strength of aromatic compounds. ► Methanol molecules form H-bonds with the oxygen functional groups on CNT surfaces. - Abstract: The interaction of organic chemicals with the surface of carbon nanotubes has been studied by immersion calorimetry revealing significant differences in the properties when these materials are modified thermally or chemically. Therefore, multiwall carbon nanotubes have been synthesized using a chemical vapour deposition procedure and subsequently aliquots were treated with HNO 3 at reflux, maintaining the reaction during different times, in order to incorporate oxygen surface groups, or were treated at 2873 K under inert atmosphere. The aim of this thermal treatment is to eliminate structural defects of the carbon nanostructures and to graphitize the amorphous carbon phases. These features were confirmed by high-resolution transmission electron microscopy. The immersion in organic compounds, including toluene, methanol and methylcyclohexane, of all these carbon nanotubes samples reveals that the surface properties are remarkably modified. Thus, the formation of different types of interaction, depending on the surface, gives place to changes in the immersion enthalpies

  19. Bulk water freezing dynamics on superhydrophobic surfaces

    Science.gov (United States)

    Chavan, S.; Carpenter, J.; Nallapaneni, M.; Chen, J. Y.; Miljkovic, N.

    2017-01-01

    In this study, we elucidate the mechanisms governing the heat-transfer mediated, non-thermodynamic limited, freezing delay on non-wetting surfaces for a variety of characteristic length scales, Lc (volume/surface area, 3 mm commercial superhydrophobic spray coatings, showing a monotonic increase in freezing time with coating thickness. The added thermal resistance of thicker coatings was much larger than that of the nanoscale superhydrophobic features, which reduced the droplet heat transfer and increased the total freezing time. Transient finite element method heat transfer simulations of the water slab freezing process were performed to calculate the overall heat transfer coefficient at the substrate-water/ice interface during freezing, and shown to be in the range of 1-2.5 kW/m2K for these experiments. The results shown here suggest that in order to exploit the heat-transfer mediated freezing delay, thicker superhydrophobic coatings must be deposited on the surface, where the coating resistance is comparable to the bulk water/ice conduction resistance.

  20. Source Water Assessment for the Las Vegas Valley Surface Waters

    Science.gov (United States)

    Albuquerque, S. P.; Piechota, T. C.

    2003-12-01

    The 1996 amendment to the Safe Drinking Water Act of 1974 created the Source Water Assessment Program (SWAP) with an objective to evaluate potential sources of contamination to drinking water intakes. The development of a Source Water Assessment Plan for Las Vegas Valley surface water runoff into Lake Mead is important since it will guide future work on source water protection of the main source of water. The first step was the identification of the watershed boundary and source water protection area. Two protection zones were delineated. Zone A extends 500 ft around water bodies, and Zone B extends 3000 ft from the boundaries of Zone A. These Zones extend upstream to the limits of dry weather flows in the storm channels within the Las Vegas Valley. After the protection areas were identified, the potential sources of contamination in the protection area were inventoried. Field work was conducted to identify possible sources of contamination. A GIS coverage obtained from local data sources was used to identify the septic tank locations. Finally, the National Pollutant Discharge Elimination System (NPDES) Permits were obtained from the State of Nevada, and included in the inventory. After the inventory was completed, a level of risk was assigned to each potential contaminating activity (PCA). The contaminants of concern were grouped into five categories: volatile organic compounds (VOCs), synthetic organic compounds (SOCs), inorganic compounds (IOCs), microbiological, and radionuclides. The vulnerability of the water intake to each of the PCAs was assigned based on these five categories, and also on three other factors: the physical barrier effectiveness, the risk potential, and the time of travel. The vulnerability analysis shows that the PCAs with the highest vulnerability rating include septic systems, golf courses/parks, storm channels, gas stations, auto repair shops, construction, and the wastewater treatment plant discharges. Based on the current water quality

  1. Quantum Chemical Study of Water Adsorption on the Surfaces of SrTiO3 Nanotubes.

    Science.gov (United States)

    Bandura, Andrei V; Kuruch, Dmitry D; Evarestov, Robert A

    2015-07-20

    We have studied the adsorption of water molecules on the inner and outer surfaces of nanotubes generated by rolling (001) layers of SrTiO3 cubic crystals. The stability and the atomic and electronic structures of the adsorbed layers are determined by using hybrid density functional theory. The absorption energy and the preferred adsorbate structure are essentially governed by the nature of the surface of the nanotube. Dissociative adsorption prevails on the outer nanotube surfaces. The stability of the adsorbed layers on the inner surfaces is related to the possibility of the formation of hydrogen bonds between water molecules and surface oxygen atoms, and depends on the surface curvature. The presence of water molecules on the inner surface of the nanotubes leads to an increase of the electronic band gap. Externally TiO2 -terminated nanotubes could be used for the photocatalytic decomposition of water by ultraviolet radiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Fractionation of hydrogen and oxygen isotopes between hydrated and free water molecules in aqueous urea solution

    International Nuclear Information System (INIS)

    Kakiuchi, M.; Matsuo, S.

    1985-01-01

    Ratios of D/H and 18 O/ 16 O in the vapor phase in equilibrium with aqueous urea solution with different urea molalities were measured at 15 and 25 0 C. Under the assumption that urea solutions consist of two species, i.e., the urea-water cluster and free water, the results are interpreted to give the average hydration number, i.e., the number of water molecules per urea molecule in the urea-water cluster. Good agreement was obtained for the hydration number estimated independently from hydrogen and oxygen isotopic fractions. On the basis of hydrogen isotopic data at 25 0 C, the average hydration number of urea in the cluster is 6.3 +/- 0.8 at 2.1 m and 2.75 +/- 0.08 at saturation (20.15 m). The corresponding average hydration numbers based on oxygen isotopic data were calculated to be 6.7 +/- 2.4 at 2.1 m and 2.75 +/- 0.25 at urea saturation. HD 16 O is enriched in the urea-water cluster and H 2 18 O is enriched in free water. Isotopic partitioning between the cluster and free water is markedly different from those between hydration spheres and free water in aqueous electrolyte solutions. 29 references, 6 figures, 5 tables

  3. Convergent surface water distributions in U.S. cities

    Science.gov (United States)

    M.K. Steele; J.B. Heffernan; N. Bettez; J. Cavender-Bares; P.M. Groffman; J.M. Grove; S. Hall; S.E. Hobbie; K. Larson; J.L. Morse; C. Neill; K.C. Nelson; J. O' Neil-Dunne; L. Ogden; D.E. Pataki; C. Polsky; R. Roy Chowdhury

    2014-01-01

    Earth's surface is rapidly urbanizing, resulting in dramatic changes in the abundance, distribution and character of surface water features in urban landscapes. However, the scope and consequences of surface water redistribution at broad spatial scales are not well understood. We hypothesized that urbanization would lead to convergent surface water abundance and...

  4. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    DEFF Research Database (Denmark)

    Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

  5. Partition Coefficients of Organic Molecules in Squalane and Water/Ethanol Mixtures by Molecular Dynamics Simulations

    DEFF Research Database (Denmark)

    Lundsgaard, Rasmus; Kontogeorgis, Georgios; Economou, Ioannis G.

    2011-01-01

    coefficient can be estimated for both a small hydrophilic and a hydrophobic organic molecules between squalane (used here to mimic low density poly ethylene) and water/ethanol solutes using thermodynamic integration to calculate the free energy of solvation. Molecular dynamics simulations are performed, using...... the GROMACS software, by slowly decoupling of firstly the electrostatic and then the Lennard–Jones interactions between molecules in the simulation box. These calculations depend very much on the choice of force field. Two force fields have been tested in this work, the TraPPE-UA (united-atom) and the OPLS...

  6. Thermal desorption of formamide and methylamine from graphite and amorphous water ice surfaces

    Science.gov (United States)

    Chaabouni, H.; Diana, S.; Nguyen, T.; Dulieu, F.

    2018-04-01

    Context. Formamide (NH2CHO) and methylamine (CH3NH2) are known to be the most abundant amine-containing molecules in many astrophysical environments. The presence of these molecules in the gas phase may result from thermal desorption of interstellar ices. Aims: The aim of this work is to determine the values of the desorption energies of formamide and methylamine from analogues of interstellar dust grain surfaces and to understand their interaction with water ice. Methods: Temperature programmed desorption (TPD) experiments of formamide and methylamine ices were performed in the sub-monolayer and monolayer regimes on graphite (HOPG) and non-porous amorphous solid water (np-ASW) ice surfaces at temperatures 40-240 K. The desorption energy distributions of these two molecules were calculated from TPD measurements using a set of independent Polanyi-Wigner equations. Results: The maximum of the desorption of formamide from both graphite and ASW ice surfaces occurs at 176 K after the desorption of H2O molecules, whereas the desorption profile of methylamine depends strongly on the substrate. Solid methylamine starts to desorb below 100 K from the graphite surface. Its desorption from the water ice surface occurs after 120 K and stops during the water ice sublimation around 150 K. It continues to desorb from the graphite surface at temperatures higher than160 K. Conclusions: More than 95% of solid NH2CHO diffuses through the np-ASW ice surface towards the graphitic substrate and is released into the gas phase with a desorption energy distribution Edes = 7460-9380 K, which is measured with the best-fit pre-exponential factor A = 1018 s-1. However, the desorption energy distribution of methylamine from the np-ASW ice surface (Edes = 3850-8420 K) is measured with the best-fit pre-exponential factor A = 1012 s-1. A fraction of solid methylamine monolayer of roughly 0.15 diffuses through the water ice surface towards the HOPG substrate. This small amount of methylamine

  7. A Monte Carlo simulation of the exchange reaction between gaseous molecules and the atoms on a heterogeneous solid surface

    International Nuclear Information System (INIS)

    Imai, Hisao

    1980-01-01

    A method of the Monte Carlo simulation of the isotopic exchange reaction between gaseous molecules and the atoms on an arbitrarily heterogeneous solid surface is described by employing hydrogen as an example. (author)

  8. Interactions of molecules with surfaces. Progress report, 1 February 1985-31 January 1986

    International Nuclear Information System (INIS)

    Greene, E.F.

    1986-01-01

    The angular distributions of beams of Ne and Ar atoms scattered nearly elastically from LiF (100) at 294 K show structure that is obscured by inelastic scattering when the whole range of velocities leaving the crystal is recorded. Increased fluxes of neutral species in beams from an effusive source of alkali halide vapor observed when a beam of electrons is coaxial with the neutral beam are shown to be well accounted for by a model involving electron stimulated desorption of alkali atoms. A simple model is proposed for the compensation observed for changes of the preexponential factor and activation energy in rate coefficients for the desorption of molecules from surfaces undergoing surface phase transitions. The isomerization of perfluoroDewarbenzene to perfluorobenzene can be produced in yields of 10% after single energetic collisions with a surface of polytetrafluoroethylene. The yield of ions produced when a beam of Na atoms strikes a Si(111) surface is increased over the equilibrium value observed for thermal beams by a factor of 10 or more when the kinetic energy of the incoming atoms is increased to 14 eV. The yield is sensitive to the dynamics of electron exchange between the surface and the ion. 12 refs., 1 fig

  9. Measurements of water molecule density by tunable diode laser absorption spectroscopy in dielectric barrier discharges with gas-water interface

    Science.gov (United States)

    Tachibana, Kunihide; Nakamura, Toshihiro; Kawasaki, Mitsuo; Morita, Tatsuo; Umekawa, Toyofumi; Kawasaki, Masahiro

    2018-01-01

    We measured water molecule (H2O) density by tunable diode-laser absorption spectroscopy (TDLAS) for applications in dielectric barrier discharges (DBDs) with a gas-water interface. First, the effects of water temperature and presence of gas flow were tested using a Petri dish filled with water and a gas injection nozzle. Second, the TDLAS system was applied to the measurements of H2O density in two types of DBDs; one was a normal (non-inverted) type with a dielectric-covered electrode above a water-filled counter electrode and the other was an inverted type with a water-suspending mesh electrode above a dielectric-covered counter electrode. The H2O density in the normal DBD was close to the density estimated from the saturated vapor pressure, whereas the density in the inverted DBD was about half of that in the former type. The difference is attributed to the upward gas flow in the latter type, that pushes the water molecules up towards the gas-water interface.

  10. Nanometer-scale discernment of field emission from tungsten surface with single carbon monoxide molecule

    Science.gov (United States)

    Matsunaga, Soichiro; Suwa, Yuji; Katagiri, Souichi

    2017-12-01

    Unusual quantized beam fluctuations were found in the emission current from a cold-field emitter (CFE) operating in an extremely high vacuum of 10-10 Pa. To clarify the microscopic mechanism behind these fluctuations, we developed a new calculation method to evaluate the field emission from a heterogeneous surface under a strong electric field of 4 × 109 V/m by using the local potential distribution obtained by a first-principles calculation, instead of by using the work function. As a result of the first-principles calculations of a single molecule adsorbed on a tungsten surface, we found that dissociative adsorption of a carbon monoxide (CO) molecule enhances the emission current by changing the potential barrier in the area surrounding the C and O adatoms when these two atoms are placed at their most stable positions. It is also found that the migration of the O atom from the most stable position reduces the emission current. These types of enhancement and reduction of the emission current quantitatively explain the observed quantized fluctuations of the CFE emission current.

  11. Effects of Surface Dipole Lengths on Evaporation of Tiny Water Aggregation

    International Nuclear Information System (INIS)

    Wang Shen; Wan Rongzheng; Fang Haiping; Tu Yusong

    2013-01-01

    Using molecular dynamics simulation, we compared evaporation behavior of a tiny amount of water molecules adsorbed on solid surfaces with different dipole lengths, including surface dipole lengths of 1 fold, 2 folds, 4 folds, 6 folds and 8 folds of 0.14 nm and different charges from 0.1e to 0.9e. Surfaces with short dipole lengths (1-fold system) can always maintain hydrophobic character and the evaporation speeds are not influenced, whether the surface charges are enhanced or weakened; but when surface dipole lengths get to 8 folds, surfaces become more hydrophilic as the surface charge increases, and the evaporation speeds increase gradually and monotonically. By tuning dipole lengths from 1-fold to 8-fold systems, we confirmed non-monotonic variation of the evaporation flux (first increases, then decreases) in 4 fold system with charges (0.1e–0.7e), reported in our previous paper [S. Wang, et al., J. Phys. Chem. B 116 (2012) 13863], and also show the process from the enhancement of this unexpected non-monotonic variation to its vanishment with surface dipole lengths increasing. Herein, we demonstrated two key factors to influence the evaporation flux of a tiny amount of water molecules adsorbed on solid surfaces: the exposed surficial area of water aggregation from where the water molecules can evaporate directly and the attraction potential from the substrate hindering the evaporation. In addition, more interestingly, we showed extra steric effect of surface dipoles on further increase of evaporation flux for 2-folds, 4-folds, 6-folds and 8-folds systems with charges around larger than 0.7e. (The steric effect is first reported by parts of our authors [C. Wang, et al., Sci. Rep. 2 (2012) 358]). This study presents a complete physical picture of the influence of surface dipole lengths on the evaporation behavior of the adsorbed tiny amount of water. (condensed matter: structural, mechanical, and thermal properties)

  12. Characterizing water-metal interfaces and machine learning potential energy surfaces

    Science.gov (United States)

    Ryczko, Kevin

    In this thesis, we first discuss the fundamentals of ab initio electronic structure theory and density functional theory (DFT). We also discuss statistics related to computing thermodynamic averages of molecular dynamics (MD). We then use this theory to analyze and compare the structural, dynamical, and electronic properties of liquid water next to prototypical metals including platinum, graphite, and graphene. Our results are built on Born-Oppenheimer molecular dynamics (BOMD) generated using density functional theory (DFT) which explicitly include van der Waals (vdW) interactions within a first principles approach. All calculations reported use large simulation cells, allowing for an accurate treatment of the water-electrode interfaces. We have included vdW interactions through the use of the optB86b-vdW exchange correlation functional. Comparisons with the Perdew-Burke-Ernzerhof (PBE) exchange correlation functional are also shown. We find an initial peak, due to chemisorption, in the density profile of the liquid water-Pt interface not seen in the liquid water-graphite interface, liquid watergraphene interface, nor interfaces studied previously. To further investigate this chemisorption peak, we also report differences in the electronic structure of single water molecules on both Pt and graphite surfaces. We find that a covalent bond forms between the single water molecule and the platinum surface, but not between the single water molecule and the graphite surface. We also discuss the effects that defects and dopants in the graphite and graphene surfaces have on the structure and dynamics of liquid water. Lastly, we introduce artificial neural networks (ANNs), and demonstrate how they can be used to machine learn electronic structure calculations. As a proof of principle, we show the success of an ANN potential energy surfaces for a dimer molecule with a Lennard-Jones potential.

  13. Water droplet evaporation from sticky superhydrophobic surfaces

    Science.gov (United States)

    Lee, Moonchan; Kim, Wuseok; Lee, Sanghee; Baek, Seunghyeon; Yong, Kijung; Jeon, Sangmin

    2017-07-01

    The evaporation dynamics of water from sticky superhydrophobic surfaces was investigated using a quartz crystal microresonator and an optical microscope. Anodic aluminum oxide (AAO) layers with different pore sizes were directly fabricated onto quartz crystal substrates and hydrophobized via chemical modification. The resulting AAO layers exhibited hydrophobic or superhydrophobic characteristics with strong adhesion to water due to the presence of sealed air pockets inside the nanopores. After placing a water droplet on the AAO membranes, variations in the resonance frequency and Q-factor were measured throughout the evaporation process, which were related to changes in mass and viscous damping, respectively. It was found that droplet evaporation from a sticky superhydrophobic surface followed a constant contact radius (CCR) mode in the early stage of evaporation and a combination of CCR and constant contact angle modes without a Cassie-Wenzel transition in the final stage. Furthermore, AAO membranes with larger pore sizes exhibited longer evaporation times, which were attributed to evaporative cooling at the droplet interface.

  14. Differential Expression of Osteo-Modulatory Molecules in Periodontal Ligament Stem Cells in Response to Modified Titanium Surfaces

    Directory of Open Access Journals (Sweden)

    So Yeon Kim

    2014-01-01

    Full Text Available This study assessed differential gene expression of signaling molecules involved in osteogenic differentiation of periodontal ligament stem cells (PDLSCs subjected to different titanium (Ti surface types. PDLSCs were cultured on tissue culture polystyrene (TCPS, and four types of Ti discs (PT, SLA, hydrophilic PT (pmodPT, and hydrophilic SLA (modSLA with no osteoinductive factor and then osteogenic activity, including alkaline phosphatase (ALP activity, mRNA expression of runt-related gene 2, osterix, FOSB, FRA1, and protein levels of osteopontin and collagen type IA, were examined. The highest osteogenic activity appeared in PDLSCs cultured on SLA, compared with the TCPS and other Ti surfaces. The role of surface properties in affecting signaling molecules to modulate PDLSC behavior was determined by examining the regulation of Wnt pathways. mRNA expression of the canonical Wnt signaling molecules, Wnt3a and β-catenin, was higher on SLA and modSLA than on smooth surfaces, but gene expression of the calcium-dependent Wnt signaling molecules Wnt5a, calmodulin, and NFATc1 was increased significantly on PT and pmodPT. Moreover, integrin α2/β1, sonic hedgehog, and Notch signaling molecules were affected differently by each surface modification. In conclusion, surface roughness and hydrophilicity can affect differential Wnt pathways and signaling molecules, targeting the osteogenic differentiation of PDLSCs.

  15. QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods

    Directory of Open Access Journals (Sweden)

    Assia Belhassan

    2017-10-01

    Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978 

  16. Studies of the viscoelastic properties of water confined between surfaces of specified chemical nature.

    Energy Technology Data Exchange (ETDEWEB)

    Houston, Jack E.; Grest, Gary Stephen; Moore, Nathan W.; Feibelman, Peter J.

    2010-09-01

    This report summarizes the work completed under the Laboratory Directed Research and Development (LDRD) project 10-0973 of the same title. Understanding the molecular origin of the no-slip boundary condition remains vitally important for understanding molecular transport in biological, environmental and energy-related processes, with broad technological implications. Moreover, the viscoelastic properties of fluids in nanoconfinement or near surfaces are not well-understood. We have critically reviewed progress in this area, evaluated key experimental and theoretical methods, and made unique and important discoveries addressing these and related scientific questions. Thematically, the discoveries include insight into the orientation of water molecules on metal surfaces, the premelting of ice, the nucleation of water and alcohol vapors between surface asperities and the lubricity of these molecules when confined inside nanopores, the influence of water nucleation on adhesion to salts and silicates, and the growth and superplasticity of NaCl nanowires.

  17. Water evaporation on highly viscoelastic polymer surfaces.

    Science.gov (United States)

    Pu, Gang; Severtson, Steven J

    2012-07-03

    Results are reported for a study on the evaporation of water droplets from a highly viscoelastic acrylic polymer surface. These are contrasted with those collected for the same measurements carried out on polydimethylsiloxane (PDMS). For PDMS, the evaporation process involves the expected multistep process including constant drop area, constant contact angle, and finally a combination of these steps until the liquid is gone. In contrast, water evaporation from the acrylic polymer shows a constant drop area mode throughout. Furthermore, during the evaporation process, the drop area actually expands on the acrylic polymer. The single mode evaporation process is consistent with formation of wetting structures, which cannot be propagated by the capillary forces. Expansion of the drop area is attributed to the influence of the drop capillary pressure. Furthermore, the rate of drop area expansion is shown to be dependent on the thickness of the polymer film.

  18. Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite

    KAUST Repository

    Yoon, Seyoon

    2013-01-01

    The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current knowledge of the refined structure. The MD simulations provide detailed information on the position and mobility of the hydrogen and oxygen of interlayer water, as well as its self-diffusion coefficient, through the interlayer of 14 Å tobermorite. Comparison of the MD simulation results at 100 and 300 K demonstrates that water molecules in the interlayer maintain their structure but change their mobility. The dominant configuration and self-diffusion coefficient of interlayer water are obtained in this study. Copyright © 2013 Japan Concrete Institute.

  19. Decoration of carbon nano surfaces with hydrogen and hydrogen rich molecules

    International Nuclear Information System (INIS)

    Zöttl, S.

    2013-01-01

    The use of helium nano droplets as a matrix to investigate different atomic and molecular samples is a well established experimental technique. The unique properties of helium allow for different analytical methods and at the same time provide a stable ambient temperature. Cluster growth inside helium nano droplets can be accomplished by repeatedly doping the droplets with sample particles in a controlled environment. The experimental work represented in this thesis was performed using helium nano droplets to create clusters of fullerenes like C 60 and C 70 . The adsorption properties of these fullerene clusters regarding hydrogen and hydrogen rich molecules have been subject to investigation. The observed results suggest that curved carbon nano surfaces offer higher storage densities than planar graphite surfaces. The use of C 60 as a model carbon nano structure provides a well understood molecule for testing and evaluating computational methods to calculate surface properties of various carbon nano materials. The cost effective storage of hydrogen for mobile applications plays a key role in the development of alternatives to fossil fuels. For that reason, the application of carbon nano materials to store hydrogen by adsorption has attracted much scientific attention lately. The insights gained in the presented thesis contribute to the collective efforts and deliver more refined tools to estimate the adsorption properties of future carbon nano materials. In addition to the aforementioned, a time-of-flight mass spectrometer for educational purpose has been designed and constructed in the framework of my PhD thesis. The instrument is successfully used in various lab courses and information on the setup can be found in the Appendix of this work. (author) [de

  20. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    International Nuclear Information System (INIS)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

  1. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Energy Technology Data Exchange (ETDEWEB)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

  2. On the influence of the intermolecular potential on the wetting properties of water on silica surfaces

    Science.gov (United States)

    Pafong, E.; Geske, J.; Drossel, B.

    2016-09-01

    We study the wetting properties of water on silica surfaces using molecular dynamics (MD) simulations. To describe the intermolecular interaction between water and silica atoms, two types of interaction potential models are used: the standard BródkA and Zerda (BZ) model and the Gulmen and Thompson (GT) model. We perform an in-depth analysis of the influence of the choice of the potential on the arrangement of the water molecules in partially filled pores and on top of silica slabs. We find that at moderate pore filling ratios, the GT silica surface is completely wetted by water molecules, which agrees well with experimental findings, while the commonly used BZ surface is less hydrophilic and is only partially wetted. We interpret our simulation results using an analytical calculation of the phase diagram of water in partially filled pores. Moreover, an evaluation of the contact angle of the water droplet on top of the silica slab reveals that the interaction becomes more hydrophilic with increasing slab thickness and saturates around 2.5-3 nm, in agreement with the experimentally found value. Our analysis also shows that the hydroaffinity of the surface is mainly determined by the electrostatic interaction, but the van der Waals interaction nevertheless is strong enough that it can turn a hydrophobic surface into a hydrophilic surface.

  3. Effect of solid waste landfill on underground and surface water ...

    African Journals Online (AJOL)

    Effect of solid waste landfill on underground and surface water quality at ring road, Ibadan, Nigeria. ... parameters showed increased concentrations over those from control sites. ... Keywords: Landfill, groundwater, surface-water, pollution.

  4. chemical and microbiological assessment of surface water samples

    African Journals Online (AJOL)

    PROF EKWUEME

    concentrations and bacteriological content. Evaluation of the results ... and Aninri local government areas of Enugu state. Surface water ... surface water bodies are prone to impacts from ... Coal Measures (Akamigbo, 1987). The geologic map ...

  5. Water molecule-enhanced CO2 insertion in lanthanide coordination polymers

    International Nuclear Information System (INIS)

    Luo Liushan; Huang Xiaoyuan; Wang Ning; Wu Hongyan; Chen Wenbin; Feng Zihao; Zhu Huiping; Peng Xiaoling; Li Yongxian; Huang Ling; Yue Shantang; Liu Yingliang

    2009-01-01

    Two new lanthanide coordination polymers H 2 N(CH 3 ) 2 .[Eu III 2 (L 1 ) 3 (L 2 )] (1, L 1 =isophthalic acid dianion, L 2 =formic acid anion) and [La III (2,5-PDC)(L 2 )](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L 2 ) is not contained in the stating materials, but arises from the water molecule-enhanced CO 2 insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO 2 insertion resulting in the formation of formic anion and dimethylammonium cation were synthesized under solvothermal conditions.

  6. Water adsorption on amorphous silica surfaces: a Car-Parrinello simulation study

    International Nuclear Information System (INIS)

    Mischler, Claus; Horbach, Juergen; Kob, Walter; Binder, Kurt

    2005-01-01

    A combination of classical molecular dynamics (MD) and ab initio Car-Parrinello molecular dynamics (CPMD) simulations is used to investigate the adsorption of water on a free amorphous silica surface. From the classical MD, SiO 2 configurations with a free surface are generated which are then used as starting configurations for the CPMD. We study the reaction of a water molecule with a two-membered ring at the temperature T = 300 K. We show that the result of this reaction is the formation of two silanol groups on the surface. The activation energy of the reaction is estimated and it is shown that the reaction is exothermic

  7. Mathematical aspects of surface water waves

    International Nuclear Information System (INIS)

    Craig, Walter; Wayne, Clarence E

    2007-01-01

    The theory of the motion of a free surface over a body of water is a fascinating subject, with a long history in both applied and pure mathematical research, and with a continuing relevance to the enterprises of mankind having to do with the sea. Despite the recent advances in the field (some of which we will hear about during this Workshop on Mathematical Hydrodynamics at the Steklov Institute), and the current focus of the mathematical community on the topic, many fundamental mathematical questions remain. These have to do with the evolution of surface water waves, their approximation by model equations and by computer simulations, the detailed dynamics of wave interactions, such as would produce rogue waves in an open ocean, and the theory (partially probabilistic) of approximating wave fields over large regions by averaged 'macroscopic' quantities which satisfy essentially kinetic equations of motion. In this note we would like to point out open problems and some of the directions of current research in the field. We believe that the introduction of new analytical techniques and novel points of view will play an important role in the future development of the area.

  8. Water infiltration into exposed fractured rock surfaces

    International Nuclear Information System (INIS)

    Rasmussen, T.C.; Evans, D.D.

    1993-01-01

    Fractured rock media are present at many existing and potential waste disposal sites, yet characterization data and physical relationships are not well developed for such media. This study focused on water infiltration characteristics of an exposed fractured rock as an approach for defining the upper boundary condition for unsaturated-zone water percolation and contaminant transport modeling. Two adjacent watersheds of 0.24 and 1.73 ha with slopes up to 45% were instrumented for measuring rainfall and runoff. Fracture density was measured from readily observable fracture traces on the surface. Three methods were employed to evaluate the rainfall-runoff relationship. The first method used the annual totals and indicated that only 22.5% of rainfall occurred as runoff for the 1990-1991 water year, which demonstrates a high water intake rate by the exposed fracture system. The second method employed total rainfall and runoff for individual storms in conjunction with the commonly used USDA Soil Conservation Service curve number method developed for wide ranges of soils and vegetation. Curve numbers between 75 and 85 were observed for summer and winter storms with dry antecedent runoff conditions, while values exceeded 90 for wet conditions. The third method used a mass-balance approach for four major storms, which indicated that water intake rates ranged from 2.0 to 7.3 mm h -1 , yielding fracture intake velocities ranging from 122 to 293 m h -1 . The three analyses show the complexity of the infiltration process for fractured rock. However, they contribute to a better understanding of the upper boundary condition for predicting contaminant transport through an unsaturated fractured rock medium. 17 refs., 4 figs., 1 tab

  9. Investigation of the Hydantoin Monomer and its Interaction with Water Molecules

    Science.gov (United States)

    Gruet, Sébastien; Perez, Cristobal; Schnell, Melanie

    2017-06-01

    Hydantoin (Imidazolidine-2,4-dione, C_3H_4N_2O_2) is a five-membered heterocyclic compound of astrobiological interest. This molecule has been detected in carbonaceous chondrites [1], and its formation can rise from the presence of glycolic acid and urea, two prebiotic molecules [2]. The hydrolysis of hydantoin under acidic conditions can also produce glycine [3], an amino acid actively searched for in the interstellar medium. Spectroscopic data of hydantoin is very limited and mostly dedicated to the solid phase. The high resolution study in gas phase is restricted to the work recently published by Ozeki et al. reporting the pure rotational spectra of the ground state and two vibrational states of the molecule in the millimeter-wave region (90-370 GHz)[4]. Using chirped-pulse Fourier-transform microwave (CP-FTMW) spectroscopy, we recorded the jet-cooled rotational spectra of hydantoin with water between 2 to 8 GHz. We observed the ground state of hydantoin monomer and several water complexes with one or two water molecules. All the observed species exhibit a hyperfine structure due to the two nitrogen atoms present in the molecule, which were fully resolved and analyzed. Additional experiments with a ^{18}O enriched water sample were realized to determine the oxygen-atom positions of the water monomers. These experiments yielded accurate structural information on the preferred water binding sites. The observed complexes and the interactions that hold them together, mainly strong directional hydrogen bonds, will be presented and discussed. [1] Shimoyama, A. and Ogasawara, R., Orig. Life Evol. Biosph., 32, 165-179, 2002. DOI:10.1023/A:1016015319112. [2] Menor-Salván, C. and Marín-Yaseli, M.R., Chem. Soc. Rev., 41(16), 5404-5415, 2012. DOI:10.1039/c2cs35060b. [3] De Marcellus P., Bertrand M., Nuevo M., Westall F. and Le Sergeant d'Hendecourt L., Astrobiology. 11(9), 847-854, 2011. DOI:10.1089/ast.2011.0677. [4] Ozeki, H., Miyahara R., Ihara H., Todaka S., Kobayashi

  10. Liquefaction of H2 molecules upon exterior surfaces of carbon nanotube bundles

    International Nuclear Information System (INIS)

    Han, Sang Soo; Kang, Jeung Ku; Lee, Hyuck Mo; Duin, Adri C.T. van; Goddard, William A. III

    2005-01-01

    We have used molecular dynamics simulations to investigate interaction of H 2 molecules on the exterior surfaces of carbon nanotubes (CNTs): single and bundle types. At 80 K and 10 MPa, it is found that charge transfer occurs from a low curvature region to a high curvature region of the deformed CNT bundle, which develops charge polarization only on the deformed structure. The long-range electrostatic interactions of polarized charges on the deformed CNT bundle with hydrogen molecules are observed to induce a high local-ordering of H 2 gas that results in hydrogen liquefaction. Our predicted heat of hydrogen liquefaction on the CNT bundle is 97.6 kcal kg -1 . On the other hand, hydrogen liquefaction is not observed in the CNT of a single type. This is because charge polarization is not developed on the single CNT as it is symmetrically deformed under the same pressure. Consequently, the hydrogen storage capacity on the CNT bundle is much higher due to liquefaction than that on the single CNT. Additionally, our results indicate that it would also be possible to liquefy H 2 gas on a more strongly polarized CNT bundle at temperatures higher than 80 K

  11. On-Demand Final State Control of a Surface-Bound Bistable Single Molecule Switch.

    Science.gov (United States)

    Garrido Torres, José A; Simpson, Grant J; Adams, Christopher J; Früchtl, Herbert A; Schaub, Renald

    2018-04-12

    Modern electronic devices perform their defined action because of the complete reliability of their individual active components (transistors, switches, diodes, and so forth). For instance, to encode basic computer units (bits) an electrical switch can be used. The reliability of the switch ensures that the desired outcome (the component's final state, 0 or 1) can be selected with certainty. No practical data storage device would otherwise exist. This reliability criterion will necessarily need to hold true for future molecular electronics to have the opportunity to emerge as a viable miniaturization alternative to our current silicon-based technology. Molecular electronics target the use of single-molecules to perform the actions of individual electronic components. On-demand final state control over a bistable unimolecular component has therefore been one of the main challenges in the past decade (1-5) but has yet to be achieved. In this Letter, we demonstrate how control of the final state of a surface-supported bistable single molecule switch can be realized. On the basis of the observations and deductions presented here, we further suggest an alternative strategy to achieve final state control in unimolecular bistable switches.

  12. The extraction of liquid, protein molecules and yeast cells from paper through surface acoustic wave atomization.

    Science.gov (United States)

    Qi, Aisha; Yeo, Leslie; Friend, James; Ho, Jenny

    2010-02-21

    Paper has been proposed as an inexpensive and versatile carrier for microfluidics devices with abilities well beyond simple capillary action for pregnancy tests and the like. Unlike standard microfluidics devices, extracting a fluid from the paper is a challenge and a drawback to its broader use. Here, we extract fluid from narrow paper strips using surface acoustic wave (SAW) irradiation that subsequently atomizes the extracted fluid into a monodisperse aerosol for use in mass spectroscopy, medical diagnostics, and drug delivery applications. Two protein molecules, ovalbumin and bovine serum albumin (BSA), have been preserved in paper and then extracted using atomized mist through SAW excitation; protein electrophoresis shows there is less than 1% degradation of either protein molecule in this process. Finally, a solution of live yeast cells was infused into paper, which was subsequently dried for preservation then remoistened to extract the cells via SAW atomization, yielding live cells at the completion of the process. The successful preservation and extraction of fluids, proteins and yeast cells significantly expands the usefulness of paper in microfluidics.

  13. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  14. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  15. Organic acids in naturally colored surface waters

    Science.gov (United States)

    Lamar, William L.; Goerlitz, D.F.

    1966-01-01

    Most of the organic matter in naturally colored surface waters consists of a mixture of carboxylic acids or salts of these acids. Many of the acids color the water yellow to brown; however, not all of the acids are colored. These acids range from simple to complex, but predominantly they are nonvolatile polymeric carboxylic acids. The organic acids were recovered from the water by two techniques: continuous liquid-liquid extraction with n-butanol and vacuum evaporation at 50?C (centigrade). The isolated acids were studied by techniques of gas, paper, and column chromatography and infrared spectroscopy. About 10 percent of the acids recovered were volatile or could be made volatile for gas chromatographic analysis. Approximately 30 of these carboxylic acids were isolated, and 13 of them were individually identified. The predominant part of the total acids could not be made volatile for gas chromatographic analysis. Infrared examination of many column chromatographic fractions indicated that these nonvolatile substances are primarily polymeric hydroxy carboxylic acids having aromatic and olefinic unsaturation. The evidence suggests that some of these acids result from polymerization in aqueous solution. Elemental analysis of the sodium fusion products disclosed the absence of nitrogen, sulfur, and halogens.

  16. PREFACE: International Conference on Many Particle Spectroscopy of Atoms, Molecules, Clusters and Surfaces (MPS2014)

    Science.gov (United States)

    Ancarani, Lorenzo Ugo

    2015-04-01

    This volume contains a collection of contributions from the invited speakers at the 2014 edition of the International Conference on Many Particle Spectroscopy of Atoms, Molecules, Clusters and Surfaces held in Metz, France, from 15th to 18th July 2014. This biennial conference alternates with the ICPEAC satellite International Symposium on (e,2e), Double Photoionization and Related Topics, and is concerned with experimental and theoretical studies of radiation interactions with matter. These include many-body and electron-electron correlation effects in excitation, and in single and multiple ionization of atoms, molecules, clusters and surfaces with various projectiles: electrons, photons and ions. More than 80 scientists, from 19 different countries around the world, came together to discuss the most recent progress on these topics. The scientific programme included 28 invited talks and a poster session extending over the three days of the meeting. Amongst the 51 posters, 11 have been selected and were advertised through short talks. Besides, Professor Nora Berrah gave a talk in memory of Professor Uwe Becker who sadly passed away shortly after co-chairing the previous edition of this conference. Financial support from the Institut Jean Barriol, Laboratoire SRSMC, Groupement de Recherche THEMS (CNRS), Ville de Metz, Metz Métropole, Conseil Général de la Moselle and Région Lorraine is gratefully acknowledged. Finally, I would like to thank the members of the local committee and the staff of the Université de Lorraine for making the conference run smoothly, the International Advisory Board for building up the scientific programme, the sessions chairpersons, those who gave their valuable time in carefully refereeing the articles of this volume and last, but not least, all participants for contributing to lively and fruitful discussions throughout the meeting.

  17. Quantification of the Intracellular Life Time of Water Molecules to Measure Transport Rates of Human Aquaglyceroporins.

    Science.gov (United States)

    Palmgren, Madelene; Hernebring, Malin; Eriksson, Stefanie; Elbing, Karin; Geijer, Cecilia; Lasič, Samo; Dahl, Peter; Hansen, Jesper S; Topgaard, Daniel; Lindkvist-Petersson, Karin

    2017-12-01

    Orthodox aquaporins are transmembrane channel proteins that facilitate rapid diffusion of water, while aquaglyceroporins facilitate the diffusion of small uncharged molecules such as glycerol and arsenic trioxide. Aquaglyceroporins play important roles in human physiology, in particular for glycerol metabolism and arsenic detoxification. We have developed a unique system applying the strain of the yeast Pichia pastoris, where the endogenous aquaporins/aquaglyceroporins have been removed and human aquaglyceroporins AQP3, AQP7, and AQP9 are recombinantly expressed enabling comparative permeability measurements between the expressed proteins. Using a newly established Nuclear Magnetic Resonance approach based on measurement of the intracellular life time of water, we propose that human aquaglyceroporins are poor facilitators of water and that the water transport efficiency is similar to that of passive diffusion across native cell membranes. This is distinctly different from glycerol and arsenic trioxide, where high glycerol transport efficiency was recorded.

  18. The interaction between surface water and groundwater and its ...

    Indian Academy of Sciences (India)

    Surface water; groundwater; stable isotopes; water quality; Second Songhua River basin. .... The total dissolved solid (TDS) was calculated by the con- centrations of major ions in ...... evaluating water quality management effectiveness; J.

  19. Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

    KAUST Repository

    Jin, Yong; Zhang, Lianbin; Wang, Peng

    2017-01-01

    Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH

  20. Impact of Water Withdrawals from Groundwater and Surface Water on Continental Water Storage Variations

    Science.gov (United States)

    Doell, Petra; Hoffmann-Dobrev, Heike; Portmann, Felix T.; Siebert, Stefan; Eicker, Annette; Rodell, Matthew; Strassberg, Gil

    2011-01-01

    Humans have strongly impacted the global water cycle, not only water flows but also water storage. We have performed a first global-scale analysis of the impact of water withdrawals on water storage variations, using the global water resources and use model WaterGAP. This required estimation of fractions of total water withdrawals from groundwater, considering five water use sectors. According to our assessment, the source of 35% of the water withdrawn worldwide (4300 cubic km/yr during 1998-2002) is groundwater. Groundwater contributes 42%, 36% and 27% of water used for irrigation, households and manufacturing, respectively, while we assume that only surface water is used for livestock and for cooling of thermal power plants. Consumptive water use was 1400 cubic km/yr during 1998-2002. It is the sum of the net abstraction of 250 cubic km/yr of groundwater (taking into account evapotranspiration and return flows of withdrawn surface water and groundwater) and the net abstraction of 1150 km3/yr of surface water. Computed net abstractions indicate, for the first time at the global scale, where and when human water withdrawals decrease or increase groundwater or surface water storage. In regions with extensive surface water irrigation, such as Southern China, net abstractions from groundwater are negative, i.e. groundwater is recharged by irrigation. The opposite is true for areas dominated by groundwater irrigation, such as in the High Plains aquifer of the central USA, where net abstraction of surface water is negative because return flow of withdrawn groundwater recharges the surface water compartments. In intensively irrigated areas, the amplitude of seasonal total water storage variations is generally increased due to human water use; however, in some areas, it is decreased. For the High Plains aquifer and the whole Mississippi basin, modeled groundwater and total water storage variations were compared with estimates of groundwater storage variations based on

  1. Effect of anodizing voltage on the sorption of water molecules on porous alumina

    Energy Technology Data Exchange (ETDEWEB)

    Vrublevsky, I., E-mail: vrublevsky@bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Chernyakova, K. [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Bund, A.; Ispas, A.; Schmidt, U. [Fachgebiet Elektrochemie und Galvanotechnik, Technische Universitaet Ilmenau, 98693 Ilmenau (Germany)

    2012-05-01

    The amount of water adsorbed on different centers on the surface of oxalic acid alumina films is a function of the anodizing voltage. It is decreased with increasing the anodizing voltage from 20 up to 50 V, came up to maximum value at 20-30 V and slightly increased at voltages above 50 V. Water adsorption by oxide films formed at voltages below 50 V can be due to the negative surface charge that is present on the alumina surface. The negative surface charge disappears in the films formed at voltages higher than 50 V, and thus, the water is adsorbed on aluminum ions in a tetrahedral and octahedral environment. The correlation between anodizing conditions of aluminum in oxalic acid and the structure and composition of anodic alumina was established by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), thermogravimetric and differential thermal analyses (TG/DTA).

  2. Enhancement of Water Evaporation on Solid Surfaces with Nanoscale Hydrophobic-Hydrophilic Patterns.

    Science.gov (United States)

    Wan, Rongzheng; Wang, Chunlei; Lei, Xiaoling; Zhou, Guoquan; Fang, Haiping

    2015-11-06

    Using molecular dynamics simulations, we show that the evaporation of nanoscale water on hydrophobic-hydrophilic patterned surfaces is unexpectedly faster than that on any surfaces with uniform wettability. The key to this phenomenon is that, on the patterned surface, the evaporation rate from the hydrophilic region only slightly decreases due to the correspondingly increased water thickness; meanwhile, a considerable number of water molecules evaporate from the hydrophobic region despite the lack of water film. Most of the evaporated water from the hydrophobic region originates from the hydrophilic region by diffusing across the contact lines. Further analysis shows that the evaporation rate from the hydrophobic region is approximately proportional to the total length of the contact lines.

  3. Modeling the Release Kinetics of Poorly Water-Soluble Drug Molecules from Liposomal Nanocarriers

    Directory of Open Access Journals (Sweden)

    Stephan Loew

    2011-01-01

    Full Text Available Liposomes are frequently used as pharmaceutical nanocarriers to deliver poorly water-soluble drugs such as temoporfin, cyclosporine A, amphotericin B, and paclitaxel to their target site. Optimal drug delivery depends on understanding the release kinetics of the drug molecules from the host liposomes during the journey to the target site and at the target site. Transfer of drugs in model systems consisting of donor liposomes and acceptor liposomes is known from experimental work to typically exhibit a first-order kinetics with a simple exponential behavior. In some cases, a fast component in the initial transfer is present, in other cases the transfer is sigmoidal. We present and analyze a theoretical model for the transfer that accounts for two physical mechanisms, collisions between liposomes and diffusion of the drug molecules through the aqueous phase. Starting with the detailed distribution of drug molecules among the individual liposomes, we specify the conditions that lead to an apparent first-order kinetic behavior. We also discuss possible implications on the transfer kinetics of (1 high drug loading of donor liposomes, (2 attractive interactions between drug molecules within the liposomes, and (3 slow transfer of drugs between the inner and outer leaflets of the liposomes.

  4. Potentially hazardous substances in surface waters. II. Cholinesterase inhibitors in Dutch surface waters

    NARCIS (Netherlands)

    Greve, P.A.; Freudenthal, J.; Wit, S.L.

    1972-01-01

    Several analytical methods were employed to determine the concentrations of cholinesterase inhibitors in several Dutch surface waters. An Auto-Analyzer method was used for screening purposes; thin-layer chromatography and gas-liquid chromatography-mass spectrometry were used for identification and

  5. Heterogeneous Ice Nucleation: Interplay of Surface Properties and Their Impact on Water Orientations.

    Science.gov (United States)

    Glatz, Brittany; Sarupria, Sapna

    2018-01-23

    Ice is ubiquitous in nature, and heterogeneous ice nucleation is the most common pathway of ice formation. How surface properties affect the propensity to observe ice nucleation on that surface remains an open question. We present results of molecular dynamics studies of heterogeneous ice nucleation on model surfaces. The models surfaces considered emulate the chemistry of kaolinite, an abundant component of mineral dust. We investigate the interplay of surface lattice and hydrogen bonding properties in affecting ice nucleation. We find that lattice matching and hydrogen bonding are necessary but not sufficient conditions for observing ice nucleation at these surfaces. We correlate this behavior to the orientations sampled by the metastable supercooled water in contact with the surfaces. We find that ice is observed in cases where water molecules not only sample orientations favorable for bilayer formation but also do not sample unfavorable orientations. This distribution depends on both surface-water and water-water interactions and can change with subtle modifications to the surface properties. Our results provide insights into the diverse behavior of ice nucleation observed at different surfaces and highlight the complexity in elucidating heterogeneous ice nucleation.

  6. Post-Spaceflight (STS-135 Mouse Splenocytes Demonstrate Altered Activation Properties and Surface Molecule Expression.

    Directory of Open Access Journals (Sweden)

    Shen-An Hwang

    Full Text Available Alterations in immune function have been documented during or post-spaceflight and in ground based models of microgravity. Identification of immune parameters that are dysregulated during spaceflight is an important step in mitigating crew health risks during deep space missions. The in vitro analysis of leukocyte activity post-spaceflight in both human and animal species is primarily focused on lymphocytic function. This report completes a broader spectrum analysis of mouse lymphocyte and monocyte changes post 13 days orbital flight (mission STS-135. Analysis includes an examination in surface markers for cell activation, and antigen presentation and co-stimulatory molecules. Cytokine production was measured after stimulation with T-cell mitogen or TLR-2, TLR-4, or TLR-5 agonists. Splenocyte surface marker analysis immediate post-spaceflight and after in vitro culture demonstrated unique changes in phenotypic populations between the flight mice and matched treatment ground controls. Post-spaceflight splenocytes (flight splenocytes had lower expression intensity of CD4+CD25+ and CD8+CD25+ cells, lower percentage of CD11c+MHC II+ cells, and higher percentage of CD11c+MHC I+ populations compared to ground controls. The flight splenocytes demonstrated an increase in phagocytic activity. Stimulation with ConA led to decrease in CD4+ population but increased CD4+CD25+ cells compared to ground controls. Culturing with TLR agonists led to a decrease in CD11c+ population in splenocytes isolated from flight mice compared to ground controls. Consequently, flight splenocytes with or without TLR-agonist stimulation showed a decrease in CD11c+MHC I+, CD11c+MHC II+, and CD11c+CD86+ cells compared to ground controls. Production of IFN-γ was decreased and IL-2 was increased from ConA stimulated flight splenocytes. This study demonstrated that expression of surface molecules can be affected by conditions of spaceflight and impaired responsiveness persists under

  7. Photoionization of environmentally polluting aromatic chlorides and nitrides on the water surface by laser and synchrotron radiations.

    Science.gov (United States)

    Sato, Miki; Maeda, Yuki; Ishioka, Toshio; Harata, Akira

    2017-11-20

    The detection limits and photoionization thresholds of polycyclic aromatic hydrocarbons and their chlorides and nitrides on the water surface are examined using laser two-photon ionization and single-photon ionization, respectively. The laser two-photon ionization methods are highly surface-selective, with a high sensitivity for aromatic hydrocarbons tending to accumulate on the water surface in the natural environment due to their highly hydrophobic nature. The dependence of the detection limits of target aromatic molecules on their physicochemical properties (photoionization thresholds relating to excess energy, molar absorptivity, and the octanol-water partition coefficient) is discussed. The detection limit clearly depends on the product of the octanol-water partition coefficient and molar absorptivity, and no clear dependence was found on excess energy. The detection limits of laser two-photon ionization for these types of molecules on the water surface are formulated.

  8. Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics

    International Nuclear Information System (INIS)

    Yoshida, Koji

    2001-01-01

    Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)

  9. In situ biodenitrification of nitrate surface water

    International Nuclear Information System (INIS)

    Schmidt, G.C.; Ballew, M.B.

    1995-01-01

    The US Department of Energy's Weldon Spring Site Remedial Action Project has successfully operated a full-scale in situ biodenitrification system to treat water with elevated nitrate levels in abandoned raffinate pits. Bench- and pilot-scale studies were conducted to evaluate the feasibility of the process and to support its full-scale design and application. Bench testing evaluated variables that would influence development of an active denitrifying biological culture. The variables were carbon source, phosphate source, presence and absence of raffinate sludge, addition of a commercially available denitrifying microbial culture, and the use of a microbial growth medium. Nitrate levels were reduced from 750 mg/L NO 3 -N to below 10 mg/L NO 3 -N within 17 days. Pilot testing simulated the full-scale process to determine if nitrate levels could be reduced to less than 10 mg/L NO 3 -N when high levels are present below the sludge surface. Four separate test systems were examined along with two control systems. Nitrates were reduced from 1,200 mg/L NO 3 -N to below 2 mg/L NO 3 -N within 21 days. Full-scale operation has been initiated to denitrify 900,000-gal batches alternating between two 1-acre ponds. The process used commercially available calcium acetate solution and monosodium/disodium phosphate solution as a nutrient source for indigenous microorganisms to convert nitrates to molecular nitrogen and water

  10. Molecular Dynamics Simulation and Analysis of Interfacial Water at Selected Sulfide Mineral Surfaces under Anaerobic Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Jiaqi; Miller, Jan D.; Dang, Liem X.

    2014-04-10

    In this paper, we report on a molecular dynamics simulation (MDS) study of the behavior of interfacial water at selected sulfide mineral surfaces under anaerobic conditions. The study revealed the interfacial water structure and wetting characteristics of the pyrite (100) surface, galena (100) surface, chalcopyrite (012) surface, sphalerite (110) surface, and molybdenite surfaces (i.e., the face, armchair-edge, and zigzag-edge surfaces), including simulated contact angles, relative number density profiles, water dipole orientations, hydrogen-bonding, and residence times. For force fields of the metal and sulfur atoms in selected sulfide minerals used in the MDS, we used the universal force field (UFF) and another set of force fields optimized by quantum chemical calculations for interactions with interfacial water molecules at selected sulfide mineral surfaces. Simulation results for the structural and dynamic properties of interfacial water molecules indicate the natural hydrophobic character for the selected sulfide mineral surfaces under anaerobic conditions as well as the relatively weak hydrophobicity for the sphalerite (110) surface and two molybdenite edge surfaces. Part of the financial support for this study was provided by the U.S. Department of Energy (DOE) under Basic Science Grant No. DE-FG-03-93ER14315. The Division of Chemical Sciences, Geosciences, and Biosciences, Office of Basic Energy Sciences (BES), of the DOE, funded work performed by Liem X. Dang. Battelle operates Pacific Northwest National Laboratory for DOE. The calculations were carried out using computer resources provided by BES. The authors are grateful to Professor Tsun-Mei Chang for valuable discussions.

  11. Dissolved organic matter in sea spray: a transfer study from marine surface water to aerosols

    Science.gov (United States)

    Schmitt-Kopplin, P.; Liger-Belair, G.; Koch, B. P.; Flerus, R.; Kattner, G.; Harir, M.; Kanawati, B.; Lucio, M.; Tziotis, D.; Hertkorn, N.; Gebefügi, I.

    2012-04-01

    Atmospheric aerosols impose direct and indirect effects on the climate system, for example, by absorption of radiation in relation to cloud droplets size, on chemical and organic composition and cloud dynamics. The first step in the formation of Organic primary aerosols, i.e. the transfer of dissolved organic matter from the marine surface into the atmosphere, was studied. We present a molecular level description of this phenomenon using the high resolution analytical tools of Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) and nuclear magnetic resonance spectroscopy (NMR). Our experiments confirm the chemoselective transfer of natural organic molecules, especially of aliphatic compounds from the surface water into the atmosphere via bubble bursting processes. Transfer from marine surface water to the atmosphere involves a chemical gradient governed by the physicochemical properties of the involved molecules when comparing elemental compositions and differentiating CHO, CHNO, CHOS and CHNOS bearing compounds. Typical chemical fingerprints of compounds enriched in the aerosol phase were CHO and CHOS molecular series, smaller molecules of higher aliphaticity and lower oxygen content, and typical surfactants. A non-targeted metabolomics analysis demonstrated that many of these molecules corresponded to homologous series of oxo-, hydroxy-, methoxy-, branched fatty acids and mono-, di- and tricarboxylic acids as well as monoterpenes and sugars. These surface active biomolecules were preferentially transferred from surface water into the atmosphere via bubble bursting processes to form a significant fraction of primary organic aerosols. This way of sea spray production leaves a selective biological signature of the surface water in the corresponding aerosol that may be transported into higher altitudes up to the lower atmosphere, thus contributing to the formation of secondary organic aerosol on a global scale or transported laterally with

  12. Imbalanced expression of functional surface molecules in regulatory and effector T cells in systemic lupus erythematosus

    Energy Technology Data Exchange (ETDEWEB)

    Mesquita Júnior, D. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil); Cruvinel, W.M. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil); Departamento de Biomedicina, Universidade Católica de Goiás, Goiânia, GO (Brazil); Araujo, J.A.P. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil); Salmazi, K.C.; Kallas, E.G. [Disciplina de Imunologia Clínica e Alergia, Departamento de Clínica Médica, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); Andrade, L.E.C. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil)

    2014-08-22

    Regulatory T (TREG) cells play an important role in maintaining immune tolerance and avoiding autoimmunity. We analyzed the expression of membrane molecules in TREG and effector T cells in systemic lupus erythematosus (SLE). TREG and effector T cells were analyzed for the expression of CTLA-4, PD1, CD28, CD95, GITR, HLA-DR, OX40, CD40L, and CD45RO in 26 patients with active disease, 31 with inactive disease, and 26 healthy controls. TREG cells were defined as CD25{sup +/high}CD127{sup Ø/low}FoxP3{sup +}, and effector T cells were defined as CD25{sup +}CD127{sup +}FoxP3{sup Ø}. The ratio of TREG to effector T cells expressing GITR, PD1, HLA-DR, OX40, CD40L, and CD45RO was determined in the three groups. The frequency of TREG cells was similar in patients with SLE and controls. However, SLE patients had a decreased frequency of CTLA-4{sup +}TREG and CD28{sup +}TREG cells and an increased frequency of CD40L{sup +}TREG cells. There was a decrease in the TREG/effector-T ratio for GITR{sup +}, HLA-DR{sup +}, OX40{sup +}, and CD45RO{sup +} cells, and an increased ratio of TREG/effector-T CD40L{sup +} cells in patients with SLE. In addition, CD40L{sup +}TREG cell frequency correlated with the SLE disease activity index (P=0.0163). In conclusion, our findings showed several abnormalities in the expression of functionally critical surface molecules in TREG and effector T cells in SLE that may be relevant to the pathogenesis of this disease.

  13. Imbalanced expression of functional surface molecules in regulatory and effector T cells in systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Mesquita Júnior, D.; Cruvinel, W.M.; Araujo, J.A.P.; Salmazi, K.C.; Kallas, E.G.; Andrade, L.E.C.

    2014-01-01

    Regulatory T (TREG) cells play an important role in maintaining immune tolerance and avoiding autoimmunity. We analyzed the expression of membrane molecules in TREG and effector T cells in systemic lupus erythematosus (SLE). TREG and effector T cells were analyzed for the expression of CTLA-4, PD1, CD28, CD95, GITR, HLA-DR, OX40, CD40L, and CD45RO in 26 patients with active disease, 31 with inactive disease, and 26 healthy controls. TREG cells were defined as CD25 +/high CD127 Ø/low FoxP3 + , and effector T cells were defined as CD25 + CD127 + FoxP3 Ø . The ratio of TREG to effector T cells expressing GITR, PD1, HLA-DR, OX40, CD40L, and CD45RO was determined in the three groups. The frequency of TREG cells was similar in patients with SLE and controls. However, SLE patients had a decreased frequency of CTLA-4 + TREG and CD28 + TREG cells and an increased frequency of CD40L + TREG cells. There was a decrease in the TREG/effector-T ratio for GITR + , HLA-DR + , OX40 + , and CD45RO + cells, and an increased ratio of TREG/effector-T CD40L + cells in patients with SLE. In addition, CD40L + TREG cell frequency correlated with the SLE disease activity index (P=0.0163). In conclusion, our findings showed several abnormalities in the expression of functionally critical surface molecules in TREG and effector T cells in SLE that may be relevant to the pathogenesis of this disease

  14. Control of magnetism in dilute magnetic semiconductor (Ga,Mn)As films by surface decoration of molecules

    Science.gov (United States)

    Wang, Hailong; Wang, Xiaolei; Xiong, Peng; Zhao, Jianhua

    2016-03-01

    The responses of magnetic moments to external stimuli such as magnetic-field, heat, light and electric-field have been utilized to manipulate the magnetism in magnetic semiconductors, with many of the novel ideas applied even to ferromagnetic metals. Here, we review a new experimental development on the control of magnetism in (Ga,Mn)As thin films by surface decoration of organic molecules: Molecules deposited on the surface of (Ga,Mn)As thin films are shown to be capable of significantly modulating their saturation magnetization and Curie temperature. These phenomena are shown to originate from the carrier-mediated ferromagnetism in (Ga,Mn)As and the surface molecules acting as acceptors or donors depending on their highest occupied molecular orbitals, resembling the charge transfer mechanism in a pn junction in which the equilibrium state is reached on the alignment of Fermi levels.

  15. Control of magnetism in dilute magnetic semiconductor (Ga,MnAs films by surface decoration of molecules

    Directory of Open Access Journals (Sweden)

    Hailong eWang

    2016-03-01

    Full Text Available The responses of magnetic moments to external stimuli such as magnetic-field, heat, light and electric-field have been utilized to manipulate the magnetism in magnetic semiconductors, with many of the novel ideas applied even to ferromagnetic metals. Here, we review a new experimental development on the control of magnetism in (Ga,MnAs thin films by surface decoration of organic molecules: Molecules deposited on the surface of (Ga,MnAs thin films are shown to be capable of significantly modulating their saturation magnetization and Curie temperature. These phenomena are shown to originate from the carrier-mediated ferromagnetism in (Ga,MnAs and the surface molecules acting as acceptors or donors depending on their highest occupied molecular orbitals, resembling the charge transfer mechanism in a pn junction in which the equilibrium state is reached on the alignment of Fermi levels.

  16. High resolution spectroscopy on adsorbed molecules on a Ni (110)-surface: vibrational states and electronic levels

    International Nuclear Information System (INIS)

    Kardinal, I.

    1998-01-01

    The complementary techniques of HR-XPS and HREELS have been applied to two distinct problems. The first studies adsorption and dissociation of C 2 N 2 on Ni (110) at room temperature (RT) and at 90 K and its co-adsorption with CO. At RT C 2 N 2 dissociates and forms a c(2x2)-CN structure. The resulting CN is found to be bound in the grooves of the (110) surface yielding the lowest C-N vibrational energy yet observed. C 2 N 2 was found to dissociate even at 90 K however the resulting CN overlayer after warming to RT showed remarkable differences to that of the RT adsorption. As well as the in-groove species a number of adsorption sites on the ridges with a bond order higher have been identified. Preadsorbed CO is completely driven of the Ni (110) surface by co-adsorption of CN at RT. HREELS indicates that first CO is desorbed from the on-top-sites and then from the bridge-sites of the (110)-ridges involving a considerable increase of the HREELS cross section for the CO on the bridge-sites. Also the signal intensity of the coadsorbed CN is suppressed by the CO present on the surface. The second study investigated the adsorption of bithiophene (BiT) on clean Ni (110) and the S-modified c(2x2)-S-Ni (110) and p(4x1)-S-Ni (110). The latter provided a strongly structured substrate which forced the assembly of the adsorbed BiT-molecules. The high degree of order of this adsorbate/substrate system was obvious in both the HR-XPS results and the BREELS results with strong azimuthal anisotropy. This system was used to asses the ability to use the HREELS impact selection rules to determine molecular orientation of a reasonably complex adsorbate overlayer. (author)

  17. Ab Initio Density Functional Theory Investigation of the Interaction between Carbon Nanotubes and Water Molecules during Water Desalination Process

    Directory of Open Access Journals (Sweden)

    Loay A. Elalfy

    2013-01-01

    Full Text Available Density functional theory calculations using B3LYP/3-21G level of theory have been implemented on 6 carbon nanotubes (CNTs structures (3 zigzag and 3 armchair CNTs to study the energetics of the reverse osmosis during water desalination process. Calculations of the band gap, interaction energy, highest occupied molecular orbital, lowest unoccupied molecular orbital, electronegativity, hardness, and pressure of the system are discussed. The calculations showed that the water molecule that exists inside the CNT is about 2-3 Å away from its wall. The calculations have proven that the zigzag CNTs are more efficient for reverse osmosis water desalination process than armchair CNTs as the reverse osmosis process requires pressure of approximately 200 MPa for armchair CNTs, which is consistent with the values used in molecular dynamics simulations, while that needed when using zigzag CNTs was in the order of 60 MPa.

  18. Liquid Water may Stick on Hydrophobic Surfaces

    Indian Academy of Sciences (India)

    IAS Admin

    Department of Mechanical Engineering, IIT Kharagpur, India. July, 2016 ... sufficient enough in moving the fluid molecules adhering to the solid by overcoming ... sheets, as well as the rapid diffusion of hydrocarbons are qualitatively attributed ...

  19. Transfer of glyphosate and its degradate AMPA to surface waters through urban sewerage systems.

    Science.gov (United States)

    Botta, Fabrizio; Lavison, Gwenaëlle; Couturier, Guillaume; Alliot, Fabrice; Moreau-Guigon, Elodie; Fauchon, Nils; Guery, Bénédicte; Chevreuil, Marc; Blanchoud, Hélène

    2009-09-01

    A study of glyphosate and aminomethyl phosphonic acid (AMPA) transfer in the Orge watershed (France) was carried out during 2007 and 2008. Water samples were collected in surface water, wastewater sewer, storm sewer and wastewater treatment plant (WWTP). These two molecules appeared to be the most frequently detected ones in the rivers and usually exceeded the European quality standard concentrations of 0.1microg L(-1) for drinking water. The annual glyphosate estimated load was 1.9 kg year(-1) upstream (agricultural zone) and 179.5 kg year(-1) at the catchment outlet (urban zone). This result suggests that the contamination of this basin by glyphosate is essentially from urban origin (road and railway applications). Glyphosate reached surface water prevalently through storm sewer during rainfall event. Maximum concentrations were detected in storm sewer just after a rainfall event (75-90 microg L(-1)). High concentrations of glyphosate in surface water during rainfall events reflected urban runoff impact. AMPA was always detected in the sewerage system. This molecule reached surface water mainly via WWTP effluent and also through storm sewer. Variations in concentrations of AMPA during hydrological episodes were minor compared to glyphosate variations. Our study highlights that AMPA and glyphosate origins in urban area are different. During dry period, detergent degradation seemed to be the major AMPA source in wastewater.

  20. Water Induced Surface Reconstruction of the Oxygen (2x1) covered Ru(0001)

    Energy Technology Data Exchange (ETDEWEB)

    Maier, Sabine; Cabrera-Sanfelix, Pepa; Stass, Ingeborg; Sanchez-Portal, Daniel; Arnau, Andres; Salmeron, Miquel

    2010-08-06

    Low temperature scanning tunneling microscopy (STM) and density functional theory (DFT) were used to study the adsorption of water on a Ru(0001) surface covered with half monolayer of oxygen. The oxygen atoms occupy hcp sites in an ordered structure with (2x1) periodicity. DFT predicts that water is weakly bound to the unmodified surface, 86 meV compared to the ~;;200 meV water-water H-bond. Instead, we found that water adsorption causes a shift of half of the oxygen atoms from hcp sites to fcc sites, creating a honeycomb structure where water molecules bind strongly to the exposed Ru atoms. The energy cost of reconstructing the oxygen overlayer, around 230 meV per displaced oxygen atom, is more than compensated by the larger adsorption energy of water on the newly exposed Ru atoms. Water forms hydrogen bonds with the fcc O atoms in a (4x2) superstructure due to alternating orientations of the molecules. Heating to 185 K results in the complete desorption of the water layer, leaving behind the oxygen honeycomb structure, which is metastable relative to the original (2x1). This stable structure is not recovered until after heating to temperatures close to 260K.

  1. Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

    KAUST Repository

    Jin, Yong

    2017-06-23

    Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH) to elucidate their roles on water mass collection efficiency. The experimental results indicate that a hydrophilic surface promotes nucleation and individual droplets growth, and a surface with a low CAH tends to let a smaller droplet to slide down, but the overall water mass collection efficiency is independent of both surface contact angle and CAH. The experimental results agree well with our theoretical calculations. During water condensation, a balance has to be struck between single droplet growth and droplet density on a surface so as to maintain a constant water droplet surface coverage ratio, which renders the role of both surface wettability and hysteresis insignificant to the ultimate water mass collection. Moreover, water droplets on the edges of a surface grow much faster than those on the non-edge areas and thus dominate the contribution to the water mass collection by the entire surface, directly pointing out the very important role of edge effect on water condensation and collection.

  2. Continuum Navier-Stokes modelling of water ow past fullerene molecules

    DEFF Research Database (Denmark)

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  3. Continuum Navier-Stokes modelling of water flow past fullerene molecules

    DEFF Research Database (Denmark)

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  4. Characterisation of the inorganic chemistry of surface waters in ...

    African Journals Online (AJOL)

    The main purpose of this study was to determine a simple inorganic chemistry index that can be used for all surface waters in South Africa, in order to characterise the inorganic chemistry of surface waters. Water quality data collected up until 1999 from all sample monitoring stations (2 068 monitoring stations, 364 659 ...

  5. Thermophoretically driven water droplets on graphene and boron nitride surfaces

    Science.gov (United States)

    Rajegowda, Rakesh; Kannam, Sridhar Kumar; Hartkamp, Remco; Sathian, Sarith P.

    2018-05-01

    We investigate thermally driven water droplet transport on graphene and hexagonal boron nitride (h-BN) surfaces using molecular dynamics simulations. The two surfaces considered here have different wettabilities with a significant difference in the mode of droplet transport. The water droplet travels along a straighter path on the h-BN sheet than on graphene. The h-BN surface produced a higher driving force on the droplet than the graphene surface. The water droplet is found to move faster on h-BN surface compared to graphene surface. The instantaneous contact angle was monitored as a measure of droplet deformation during thermal transport. The characteristics of the droplet motion on both surfaces is determined through the moment scaling spectrum. The water droplet on h-BN surface showed the attributes of the super-diffusive process, whereas it was sub-diffusive on the graphene surface.

  6. Explicit Consideration of Water Molecules to Study Vibrational Circular DICHROÎSM of Monosaccharide's

    Science.gov (United States)

    Moussi, Sofiane; Ouamerali, Ourida

    2014-06-01

    Carbohydrates have multiples roles in biological systems. It has been found that the glycoside bond is fundamentally important in many aspects of chemistry and biology and forms the basis of carbohydrate chemistry. That means the stereochemical information, namely, glycosidic linkages α or β, gives an significant features of the carbohydrate glycosidation position of the glycosylic acceptor. For these reasons, much effort was made for the synthesis and analysis of the glycoside bond. Vibrational circular dichroism VCD has some advantages over conventional electronic circular dichroism (ECD) due to the applicability to all organic molecules and the reliability of ab initio quantum calculation. However, for a molecule with many chiral centers such as carbohydrates, determination of the absolute configuration tends to be difficult because the information from each stereochemical center is mixed and averaged over the spectrum. In the CH stretching region, only two VCD studies on carbohydrates have been reported and spectra--structure correlation, as determined for the glycoside band, remains to be investigated. T. Taniguchi and collaborators report that methyl glycosides exhibit a characteristic VCD peak, the sign of which solely reflects the C-1 absolute configuration. This work is a theoretical contribution to study the behaviour of VCD spectrum's of the monosaccharides when the water molecules are taken explicitly. This study is focused on six different monosaccharides in theirs absolute configuration R and S. We used the method of density functional theory DFT by means of the B3LYP hybrid functional and 6-31G * basis set.

  7. Protocol for quantitative tracing of surface water with synthetic DNA

    Science.gov (United States)

    Foppen, J. W.; Bogaard, T. A.

    2012-04-01

    Based on experiments we carried out in 2010 with various synthetic single stranded DNA markers with a size of 80 nucleotides (ssDNA; Foppen et al., 2011), we concluded that ssDNA can be used to carry out spatially distributed multi-tracer experiments in the environment. Main advantages are in principle unlimited amount of tracers, environmental friendly and tracer recovery at very high dilution rates (detection limit is very low). However, when ssDNA was injected in headwater streams, we found that at selected downstream locations, the total mass recovery was less than 100%. The exact reason for low mass recovery was unknown. In order to start identifying the cause of the loss of mass in these surface waters, and to increase our knowledge of the behaviour of synthetic ssDNA in the environment, we examined the effect of laboratory and field protocols working with artificial DNA by performing numerous batch experiments. Then, we carried out several field tests in different headwater streams in the Netherlands and in Luxembourg. The laboratory experiments consisted of a batch of water in a vessel with in the order of 10^10 ssDNA molecules injected into the batch. The total duration of each experiment was 10 hour, and, at regular time intervals, 100 µl samples were collected in a 1.5 ml Eppendorf vial for qPCR analyses. The waters we used ranged from milliQ water to river water with an Electrical Conductivity of around 400 μS/cm. The batch experiments were performed in different vessel types: polyethylene bottles, polypropylene copolymer bottles , and glass bottles. In addition, two filter types were tested: 1 µm pore size glass fibre filters and 0.2 µm pore size cellulose acetate filters. Lastly, stream bed sediment was added to the batch experiments to quantify interaction of the DNA with sediment. For each field experiment around 10^15 ssDNA molecules were injected, and water samples were collected 100 - 600 m downstream of the point of injection. Additionally

  8. Photochemical Transformation Processes in Sunlit Surface Waters

    Science.gov (United States)

    Vione, D.

    2012-12-01

    Photochemical reactions are major processes in the transformation of hardly biodegradable xenobiotics in surface waters. They are usually classified into direct photolysis and indirect or sensitised degradation. Direct photolysis requires xenobiotic compounds to absorb sunlight, and to get transformed as a consequence. Sensitised transformation involves reaction with transient species (e.g. °OH, CO3-°, 1O2 and triplet states of chromophoric dissolved organic matter, 3CDOM*), photogenerated by so-called photosensitisers (nitrate, nitrite and CDOM). CDOM is a major photosensitiser: is it on average the main source of °OH (and of CO3-° as a consequence, which is mainly produced upon oxidation by °OH of carbonate and bicarbonate) and the only important source of 1O2 and 3CDOM* [1, 2]. CDOM origin plays a key role in sensitised processes: allochthonous CDOM derived from soil runoff and rich in fulvic and humic substances is usually more photoactive than autochthonous CDOM (produced by in-water biological processes and mainly consisting of protein-like material) or of CDOM derived from atmospheric deposition. An interesting gradual evolution of CDOM origin and photochemistry can be found in mountain lakes across the treeline, which afford a gradual transition of allochthonous- autochtonous - atmopheric CDOM when passing from trees to alpine meadows to exposed rocks [3]. Another important issue is the sites of reactive species photoproduction in CDOM. While there is evidence that smaller molecular weight fractions are more photoactive, some studies have reported considerable 1O2 reactivity in CDOM hydrophobic sites and inside particles [4]. We have recently addressed the problem and found that dissolved species in standard humic acids (hydrodynamic diameter pollutants to be assessed and modelled. For instance, it is possible to predict pollutant half-life times by knowing absorption spectrum, direct photolysis quantum yield and reaction rate constants with °OH, CO3

  9. Electronic coupling effects and charge transfer between organic molecules and metal surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Forker, Roman

    2010-07-01

    We employ a variant of optical absorption spectroscopy, namely in situ differential reflectance spectroscopy (DRS), for an analysis of the structure-properties relations of thin epitaxial organic films. Clear correlations between the spectra and the differently intense coupling to the respective substrates are found. While rather broad and almost structureless spectra are obtained for a quaterrylene (QT) monolayer on Au(111), the spectral shape resembles that of isolated molecules when QT is grown on graphite. We even achieve an efficient electronic decoupling from the subjacent Au(111) by inserting an atomically thin organic spacer layer consisting of hexa-peri-hexabenzocoronene (HBC) with a noticeably dissimilar electronic behavior. These observations are further consolidated by a systematic variation of the metal substrate (Au, Ag, and Al), ranging from inert to rather reactive. For this purpose, 3,4,9,10-perylenetetracarboxylic dianhydride (PTCDA) is chosen to ensure comparability of the molecular film structures on the different metals, and also because its electronic alignment on various metal surfaces has previously been studied with great intensity. We present evidence for ionized PTCDA at several interfaces and propose the charge transfer to be related to the electronic level alignment governed by interface dipole formation on the respective metals. (orig.)

  10. Ozone kinetics in low-pressure discharges: vibrationally excited ozone and molecule formation on surfaces

    Science.gov (United States)

    Marinov, Daniil; Guerra, Vasco; Guaitella, Olivier; Booth, Jean-Paul; Rousseau, Antoine

    2013-10-01

    A combined experimental and modeling investigation of the ozone kinetics in the afterglow of pulsed direct current discharges in oxygen is carried out. The discharge is generated in a cylindrical silica tube of radius 1 cm, with short pulse durations between 0.5 and 2 ms, pressures in the range 1-5 Torr and discharge currents ˜40-120 mA. Time-resolved absolute concentrations of ground-state atoms and ozone molecules were measured simultaneously in situ, by two-photon absorption laser-induced fluorescence and ultraviolet absorption, respectively. The experiments were complemented by a self-consistent model developed to interpret the results and, in particular, to evaluate the roles of vibrationally excited ozone and of ozone formation on surfaces. It is found that vibrationally excited ozone, O_3^{*} , plays an important role in the ozone kinetics, leading to a decrease in the ozone concentration and an increase in its formation time. In turn, the kinetics of O_3^{*} is strongly coupled with those of atomic oxygen and O2(a 1Δg) metastables. Ozone formation at the wall does not contribute significantly to the total ozone production under the present conditions. Upper limits for the effective heterogeneous recombination probability of O atoms into ozone are established.

  11. Ozone kinetics in low-pressure discharges: vibrationally excited ozone and molecule formation on surfaces

    International Nuclear Information System (INIS)

    Marinov, Daniil; Guaitella, Olivier; Booth, Jean-Paul; Rousseau, Antoine; Guerra, Vasco

    2013-01-01

    A combined experimental and modeling investigation of the ozone kinetics in the afterglow of pulsed direct current discharges in oxygen is carried out. The discharge is generated in a cylindrical silica tube of radius 1 cm, with short pulse durations between 0.5 and 2 ms, pressures in the range 1–5 Torr and discharge currents ∼40–120 mA. Time-resolved absolute concentrations of ground-state atoms and ozone molecules were measured simultaneously in situ, by two-photon absorption laser-induced fluorescence and ultraviolet absorption, respectively. The experiments were complemented by a self-consistent model developed to interpret the results and, in particular, to evaluate the roles of vibrationally excited ozone and of ozone formation on surfaces. It is found that vibrationally excited ozone, O 3 * , plays an important role in the ozone kinetics, leading to a decrease in the ozone concentration and an increase in its formation time. In turn, the kinetics of O 3 * is strongly coupled with those of atomic oxygen and O 2 (a 1 Δ g ) metastables. Ozone formation at the wall does not contribute significantly to the total ozone production under the present conditions. Upper limits for the effective heterogeneous recombination probability of O atoms into ozone are established. (paper)

  12. Monocyte and lymphocyte surface molecules in severe sepsis and non-septic critically ill Patients.

    Science.gov (United States)

    Jämsä, Joel; Syrjälä, Hannu; Huotari, Virva; Savolainen, Eeva-Riitta; Ala-Kokko, Tero

    2017-06-01

    The aim of the present study was to investigate whether expression of monocyte and lymphocyte surface molecules differs between patients with severe sepsis and non-septic patients treated in the intensive care unit (ICU). The expression of monocyte CD14, CD40, CD80 and HLA-DR, and lymphocyte CD69 were analyzed using quantitative flow cytometry on three consecutive days in 27 patients with severe sepsis and in 15 non-septic patients. Receiver operating characteristic analyses were performed and each corresponding area under the curve (AUC) was determined. The results showed that the expression levels of CD40 on monocytes and CD69 on CD4+ T cells and on natural killer (NK) cells were highest in patients with severe sepsis (p sepsis and positive blood culture compared with those with negative blood culture (p sepsis detection were 0.836 for CD40, 0.872 for CD69 on NK cells, and 0.795 for CD69 on CD4+ T cells. These findings suggest that monocyte CD40 and CD69 on NK cells and CD4+ T cells could prove useful for new approaches in the identification of severe sepsis in the ICU. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  13. Distribution of {sup 129}I in terrestrial surface water environments

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xuegao [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Gong, Meng [College of Hydrology and Water Resources, Hohai University, Nanjing (China); Yi, Peng, E-mail: pengyi1915@163.com [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Aldahan, Ala [Department of Earth Sciences, Uppsala University, Uppsala (Sweden); Department of Geology, United Arab Emirates University, Al Ain (United Arab Emirates); Yu, Zhongbo [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Possnert, Göran [Tandem Laboratory, Uppsala University, Uppsala (Sweden); Chen, Li [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China)

    2015-10-15

    The global distribution of the radioactive isotope iodine-129 in surface waters (lakes and rivers) is presented here and compared with the atmospheric deposition and distribution in surface marine waters. The results indicate relatively high concentrations in surface water systems in close vicinity of the anthropogenic release sources as well as in parts of Western Europe, North America and Central Asia. {sup 129}I level is generally higher in the terrestrial surface water of the Northern hemisphere compared to the southern hemisphere. The highest values of {sup 129}I appear around 50°N and 40°S in the northern and southern hemisphere, separately. Direct gaseous and marine atmospheric emissions are the most likely avenues for the transport of {sup 129}I from the sources to the terrestrial surface waters. To apply iodine-129 as process tracer in terrestrial surface water environment, more data are needed on {sup 129}I distribution patterns both locally and globally.

  14. Water and oxygen induced degradation of small molecule organic solar cells

    DEFF Research Database (Denmark)

    Hermenau, Martin; Riede, Moritz; Leo, Karl

    2011-01-01

    Small molecule organic solar cells were studied with respect to water and oxygen induced degradation by mapping the spatial distribution of reaction products in order to elucidate the degradation patterns and failure mechanisms. The active layers consist of a 30 nm bulk heterojunction formed......,4′-diamine p-doped with C60F36 (MeO-TPD:C60F36), which acted as hole transporting layer. Indium-tin-oxide (ITO) and aluminum served as hole and electron collecting electrode, respectively. Time-of-flight secondary ion mass spectrometry (TOF-SIMS) and X-ray photoelectron spectroscopy (XPS) in conjunction...... of aluminum oxide at the BPhen/Al interface, and diffusion of water into the ZnPc:C60 layer where ZnPc becomes oxidized. Finally, diffusion from the electrodes was found to have no or a negligible effect on the device lifetime....

  15. Possibility of 1-nm level localization of a single molecule with gap-mode surface-enhanced Raman scattering

    International Nuclear Information System (INIS)

    Choi, Han Kyu; Kim, Zee Hwan

    2015-01-01

    The electromagnetic (EM) enhancement mechanism of surface-enhanced Raman scattering (SERS) has been well established through 30 years of extensive investigation: molecules adsorbed on resonantly driven silver or gold nanoparticles (NPs) experience strongly enhanced field and thus show enhanced Raman scattering. Even stronger SERS enhancement is possible with a gap structure in which two or more NPs form assemblies with gap sizes of 1 nm or less. We have theoretically shown that the measurement of SERS angular distribution can reveal the position of a single molecule near the gap with 1-nm accuracy, even though the spatial extent of the enhanced field is ~10 nm. Real implementation of such experiment requires extremely well-defined (preferably a single crystal) dimeric junctions. Nevertheless, the experiment will provide spatial as well as frequency domain information on single-molecule dynamics at metallic surfaces

  16. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  17. Study of the Adsorption of Atoms and Molecules on Silicon Surfaces: Crystallographics and Electronic Structure

    International Nuclear Information System (INIS)

    Bengio, Silvina

    2003-01-01

    This thesis work has been concerned with adsorption properties of silicon surfaces.The atomic and electronic structure of molecules and atoms adsorbed on Si has been investigated by means of photoemission experiments combined with synchrotron radiation.The quantitative atomic structure determination was held applying the photoelectron diffraction technique.This technique is sensible to the local structure of a reference atomic specie and has elemental and chemical-state specificity.This approach has been applied to three quite different systems with different degrees of complexity, Sb/Si(111) √3x √3R30 0 , H 2 O/Si(100)2x1 and NH 3 /Si(111)7x7.Our results show that Sb which forms a ( √3√3)R30 0 phase produces a bulklike-terminated Si(111)1x1 substrate free of stacking faults.Regarding the atomic structure of its interface, this study strongly favours the T4-site milkstool model over the H3 one.An important aspect regarding the H 2 O/Si(100)(2x1) system was establishing the limits of precision with which one can determine not only the location of the adsorbed hydroxyl (OH) species, but also the extent to which this adsorption modifes the asymmetric dimers of the clean surface to which it is bonded.On the Si(111)(7x7) surface the problem is particularly complex because there are several different potentially active sites for NH3 adsorption and fragmentation.The application of the PhD method, however, has shown that the majority of the N atoms are on so-called 'rest atom' sites when deposited at RT.This is consistent with the N in the NH2 chemical state.This investigation represents the first quantitative structural study of any molecular adsorbate on the complex Si(111)(7x7) surface.This atomic structures determination shows the PhD is a powerful tool for the atomic structure determination.The molecular systems interacting with the active sites of the substrate fragments producing a short-range order surface.This long-range disorder is produced by the

  18. Identification of Carboxylate, Phosphate, and Phenoxide Functionalities in Deprotonated Molecules Related to Drug Metabolites via Ion-Molecule Reactions with water and Diethylhydroxyborane

    Science.gov (United States)

    Zhu, Hanyu; Ma, Xin; Kong, John Y.; Zhang, Minli; Kenttämaa, Hilkka I.

    2017-10-01

    Tandem mass spectrometry based on ion-molecule reactions has emerged as a powerful tool for structural elucidation of ionized analytes. However, most currently used reagents were designed to react with protonated analytes, making them suboptimal for acidic analytes that are preferentially detected in negative ion mode. In this work we demonstrate that the phenoxide, carboxylate, and phosphate functionalities can be identified in deprotonated molecules by use of a combination of two reagents, diethylmethoxyborane (DEMB) and water. A novel reagent introduction setup that allowed DEMB and water to be separately introduced into the ion trap region of the mass spectrometer was developed to facilitate fundamental studies of this reaction. A new reagent, diethylhydroxyborane (DEHB), was generated inside the ion trap by hydrolysis of DEMB on introduction of water. Most carboxylates and phenoxides formed a DEHB adduct, followed by addition of one water molecule and subsequent ethane elimination (DEHB adduct +H2O - CH3CH3) as the major product ion. Phenoxides with a hydroxy group adjacent to the deprotonation site and phosphates formed a DEHB adduct, followed by ethane elimination (DEHB adduct - CH3CH3). Deprotonated molecules with strong intramolecular hydrogen bonds or without the aforementioned functionalities, including sulfates, were unreactive toward DEHB/H2O. Reaction mechanisms were explored via isotope labeling experiments and quantum chemical calculations. The mass spectrometry method allowed the differentiation of phenoxide-, carboxylate-, phosphate-, and sulfate-containing analytes. Finally, it was successfully coupled with high-performance liquid chromatography for the analysis of a mixture containing hymecromone, a biliary spasm drug, and its three possible metabolites. [Figure not available: see fulltext.

  19. Surface Chemistry Dependence of Mechanochemical Reaction of Adsorbed Molecules-An Experimental Study on Tribopolymerization of α-Pinene on Metal, Metal Oxide, and Carbon Surfaces.

    Science.gov (United States)

    He, Xin; Kim, Seong H

    2018-02-20

    Mechanochemical reactions between adsorbate molecules sheared at tribological interfaces can induce association of adsorbed molecules, forming oligomeric and polymeric products often called tribopolymers). This study revealed the role or effect of surface chemistry of the solid substrate in mechanochemical polymerization reactions. As a model reactant, α-pinene was chosen because it was known to readily form tribopolymers at the sliding interface of stainless steel under vapor-phase lubrication conditions. Eight different substrate materials were tested-palladium, nickel, copper, stainless steel, gold, silicon oxide, aluminum oxide, and diamond-like carbon (DLC). All metal substrates and DLC were initially covered with surface oxide species formed naturally in air or during the oxidative sample cleaning. It was found that the tribopolymerization yield of α-pinene is much higher on the substrates that can chemisorb α-pinene, compared to the ones on which only physisorption occurs. From the load dependence of the tribopolymerization yield, it was found that the surfaces capable of chemisorption give a smaller critical activation volume for the mechanochemical reaction, compared to the ones capable of physisorption only. On the basis of these observations and infrared spectroscopy analyses of the adsorbed molecules and the produced polymers, it was concluded that the mechanochemical reaction mechanisms might be different between chemically reactive and inert surfaces and that the chemical reactivity of the substrate surface greatly influences the tribochemical polymerization reactions of adsorbed molecules.

  20. Adsorption of metal-phthalocyanine molecules onto the Si(111) surface passivated by δ doping: Ab initio calculations

    Science.gov (United States)

    Veiga, R. G. A.; Miwa, R. H.; McLean, A. B.

    2016-03-01

    We report first-principles calculations of the energetic stability and electronic properties of metal-phthalocyanine (MPc) molecules (M = Cr, Mn, Fe, Co, Ni, Cu, and Zn) adsorbed on the δ -doped Si(111)-B (√{3 }×√{3 }) reconstructed surface. (i) It can be seen that CrPc, MnPc, FePc, and CoPc are chemically anchored to the topmost Si atom. (ii) Contrastingly, the binding of the NiPc, CuPc, and ZnPc molecules to the Si (111 ) -B (√{3 }×√{3 }) surface is exclusively ruled by van der Waals interactions, the main implication being that these molecules may diffuse and rearrange to form clusters and/or self-organized structures on this surface. The electronic structure calculations reveal that in point (i), owing to the formation of the metal-Si covalent bond, the net magnetic moment of the molecule is quenched by 1 μB , remaining unchanged in point (ii). In particular, the magnetic moment of CuPc (1 μB ) is preserved after adsorption. Finally, we verify that the formation of ZnPc, CuPc, and NiPc molecular (self-assembled) arrangements on the Si(111)-B (√{3 }×√{3 } ) surface is energetically favorable, in good agreement with recent experimental findings.

  1. Self-consistent meta-generalized gradient approximation study of adsorption of aromatic molecules on noble metal surfaces

    DEFF Research Database (Denmark)

    Ferrighi, Lara; Madsen, Georg Kent Hellerup; Hammer, Bjørk

    2011-01-01

    aromatic molecules considered. The adsorption of pentacene is studied on Au, Ag, and Cu surfaces. In agreement with experiment, the adsorption energies are found to increase with decreasing nobleness, but the dependency is underestimated. We point out how the kinetic energy density can discriminate between...

  2. Variability in chemistry of surface and soil waters of an ...

    African Journals Online (AJOL)

    Water chemistry is important for the maintenance of wetland structure and function. Interpreting ecological patterns in a wetland system therefore requires an in-depth understanding of the water chemistry of that system. We investigated the spatial distribution of chemical solutes both in soil pore water and surface water, ...

  3. Short Communication: Conductivity as an indicator of surface water ...

    African Journals Online (AJOL)

    Various water- soluble species are present in FeCr waste materials and in process water. Considering the size of the South African FeCr industry and its global importance, it is essential to assess the extent of potential surface water pollution in the proximity of FeCr smelters by such watersoluble species. In this study water ...

  4. Control of unidirectional transport of single-file water molecules through carbon nanotubes in an electric field.

    Science.gov (United States)

    Su, Jiaye; Guo, Hongxia

    2011-01-25

    The transport of water molecules through nanopores is not only crucial to biological activities but also useful for designing novel nanofluidic devices. Despite considerable effort and progress that has been made, a controllable and unidirectional water flow is still difficult to achieve and the underlying mechanism is far from being understood. In this paper, using molecular dynamics simulations, we systematically investigate the effects of an external electric field on the transport of single-file water molecules through a carbon nanotube (CNT). We find that the orientation of water molecules inside the CNT can be well-tuned by the electric field and is strongly coupled to the water flux. This orientation-induced water flux is energetically due to the asymmetrical water-water interaction along the CNT axis. The wavelike water density profiles are disturbed under strong field strengths. The frequency of flipping for the water dipoles will decrease as the field strength is increased, and the flipping events vanish completely for the relatively large field strengths. Most importantly, a critical field strength E(c) related to the water flux is found. The water flux is increased as E is increased for E ≤ E(c), while it is almost unchanged for E > E(c). Thus, the electric field offers a level of governing for unidirectional water flow, which may have some biological applications and provides a route for designing efficient nanopumps.

  5. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  6. TURBIDITY REMOVAL FROM SURFACE WATER USING ...

    African Journals Online (AJOL)

    User

    2016-06-01

    Jun 1, 2016 ... Plant-based coagulants are potential alternatives to chemical coagulants used in drinking water treatment. ... Conventional water treatment systems involve the use of synthetic ..... Thesis, Royal Institute of Technology (KTH),.

  7. Finite-bias electronic transport of molecules in a water solution

    KAUST Repository

    Rungger, Ivan; Chen, X.; Sanvito, Stefano; Schwingenschlö gl, Udo

    2010-01-01

    The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

  8. Finite-bias electronic transport of molecules in a water solution

    KAUST Repository

    Rungger, Ivan

    2010-06-04

    The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

  9. Indices of quality surface water bodies in the planning of water resources

    Directory of Open Access Journals (Sweden)

    Rodríguez-Miranda, Juan Pablo

    2016-12-01

    Full Text Available This paper considers a review of the literature major and significant methods of quality indices of water applied in surface water bodies, used and proposed for assessing the significance of parameters of water quality in the assessment of surface water currents and they are usually used in making decisions for intervention and strategic prevention measures for those responsible for the conservation and preservation of watersheds where these water bodies belong. An exploratory methodology was applied to realize the conceptualization of each water quality index. As a result, it is observed that there are several important methods for determining the water quality index applied in surface water bodies.

  10. An ontology design pattern for surface water features

    Science.gov (United States)

    Sinha, Gaurav; Mark, David; Kolas, Dave; Varanka, Dalia; Romero, Boleslo E.; Feng, Chen-Chieh; Usery, E. Lynn; Liebermann, Joshua; Sorokine, Alexandre

    2014-01-01

    Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities exist due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology for other more context-dependent ontologies. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex or specialized surface water ontologies. A fundamental distinction is made in this ontology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is implemented in OWL, but Description Logic axioms and a detailed explanation is provided in this paper. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. Also provided is a discussion of why there is a need to complement the pattern with other ontologies, especially the previously developed Surface Network pattern. Finally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through an annotated geospatial dataset and sample queries using the classes of the Surface Water pattern.

  11. Orbiting Water Molecules Dance to Tune Of Galaxy's "Central Engine," Astronomers Say

    Science.gov (United States)

    2000-01-01

    A disk of water molecules orbiting a supermassive black hole at the core of a galaxy 60 million light-years away is "reverberating" in response to variations in the energy output from the galaxy's powerful "central engine" close to the black hole, astronomers say. The team of astronomers used the National Science Foundation's (NSF) Very Large Array (VLA) radio telescope in New Mexico and the 100-meter-diameter radio telescope of the Max Planck Institute for Radio Astronomy at Effelsberg, Germany, to observe the galaxy NGC 1068 in the constellation Cetus. They announced their findings today at the American Astronomical Society's meeting in Atlanta. The water molecules, in a disk some 5 light-years in diameter, are acting as a set of giant cosmic radio-wave amplifiers, called masers. Using energy radiated by the galaxy's "central engine," the molecules strengthen, or brighten, radio emission at a particular frequency as seen from Earth. "We have seen variations in the radio 'brightness' of these cosmic amplifiers that we believe were caused by variations in the energy output of the central engine," said Jack Gallimore, an astronomer at the National Radio Astronomy Observatory (NRAO) in Charlottesville, VA. "This could provide us with a valuable new tool for learning about the central engine itself," he added. Gallimore worked with Stefi Baum of the Space Telescope Science Institute in Baltimore, MD; Christian Henkel of the Max Planck Institute for Radio Astronomy in Bonn, Germany; Ian Glass of the South African Astronomical Observatory; Mark Claussen of the NRAO in Socorro, NM; and Almudena Prieto of the European Southern Observatory in Munich, Germany. "Our observations show that NGC 1068 is the second-known case of a giant disk of water molecules orbiting a supermassive black hole at a galaxy's core," Gallimore said. The first case was the galaxy NGC 4258 (Messier 106), whose disk of radio-amplifying water molecules was measured by the NSF's Very Long Baseline

  12. Selective scanning tunnelling microscope electron-induced reactions of single biphenyl molecules on a Si(100) surface.

    Science.gov (United States)

    Riedel, Damien; Bocquet, Marie-Laure; Lesnard, Hervé; Lastapis, Mathieu; Lorente, Nicolas; Sonnet, Philippe; Dujardin, Gérald

    2009-06-03

    Selective electron-induced reactions of individual biphenyl molecules adsorbed in their weakly chemisorbed configuration on a Si(100) surface are investigated by using the tip of a low-temperature (5 K) scanning tunnelling microscope (STM) as an atomic size source of electrons. Selected types of molecular reactions are produced, depending on the polarity of the surface voltage during STM excitation. At negative surface voltages, the biphenyl molecule diffuses across the surface in its weakly chemisorbed configuration. At positive surface voltages, different types of molecular reactions are activated, which involve the change of adsorption configuration from the weakly chemisorbed to the strongly chemisorbed bistable and quadristable configurations. Calculated reaction pathways of the molecular reactions on the silicon surface, using the nudge elastic band method, provide evidence that the observed selectivity as a function of the surface voltage polarity cannot be ascribed to different activation energies. These results, together with the measured threshold surface voltages and the calculated molecular electronic structures via density functional theory, suggest that the electron-induced molecular reactions are driven by selective electron detachment (oxidation) or attachment (reduction) processes.

  13. Using Force to Probe Single-Molecule Receptor-Cytoskeletal Anchoring Beneath the Surface of a Living Cell

    DEFF Research Database (Denmark)

    Evans, Evan; Kinoshita, Koji

    2007-01-01

    -cytoskeletal unbinding increased exponentially with the level of force, suggesting disruption at a site of single-molecule interaction. Since many important enzymes and signaling molecules are closely associated with a membrane receptor-cytoskeletal linkage, pulling on a receptor could alter interactions among its......The ligation of cell surface receptors often communicates a signal that initiates a cytoplasmic chemical cascade to implement an important cell function. Less well understood is how physical stress applied to a cell surface adhesive bond propagates throughout the cytostructure to catalyze...... or trigger important steps in these chemical processes. Probing the nanoscale impact of pulling on cell surface bonds, we discovered that receptors frequently detach prematurely from the interior cytostructure prior to failure of the exterior adhesive bond [Evans, E., Heinrich, V., Leung, A., and Kinoshita...

  14. Relationship between diffusivity of water molecules inside hydrating tablets and their drug release behavior elucidated by magnetic resonance imaging.

    Science.gov (United States)

    Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo

    2012-01-01

    We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.

  15. The neural cell adhesion molecule L1 is distinct from the N-CAM related group of surface antigens BSP-2 and D2

    DEFF Research Database (Denmark)

    Faissner, A; Kruse, J; Goridis, C

    1984-01-01

    The neural cell adhesion molecule L1 and the group of N-CAM related molecules, BSP-2 and D2 antigen, are immunochemically distinct molecular species. The two groups of surface molecules are also functionally distinct entities, since inhibition of Ca2+-independent adhesion among early post-natal m...

  16. water quality assessment of underground and surface water ...

    African Journals Online (AJOL)

    Dr Osondu

    Water quality assessment in the Ethiopian highlands is crucial owing to increasing ... and provide information for formulating appropriate framework for an integrated ... with four seasons (rainy, dry period, small rains ..... treatment. Annual conference proceedings, American Water Works ... Towns' water supply and sanitation.

  17. Infiltration of pesticides in surface water into nearby drinking water supply wells

    DEFF Research Database (Denmark)

    Malaguerra, Flavio; Albrechtsen, Hans-Jørgen; Binning, Philip John

    Drinking water wells are often placed near streams because streams often overly permeable sediments and the water table is near the surface in valleys, and so pumping costs are reduced. The lowering of the water table by pumping wells can reverse the natural flow from the groundwater to the stream......, inducing infiltration of surface water to groundwater and consequently to the drinking water well. Many attenuation processes can take place in the riparian zone, mainly due to mixing, biodegradation and sorption. However, if the water travel time from the surface water to the pumping well is too short......, or if the compounds are poorly degradable, contaminants can reach the drinking water well at high concentrations, jeopardizing drinking water quality. Here we developed a reactive transport model to evaluate the risk of contamination of drinking water wells by surface water pollution. The model was validated using...

  18. Instability of confined water films between elastic surfaces

    NARCIS (Netherlands)

    de Beer, Sissi; 't Mannetje, Dieter; Zantema, Sietske; Mugele, Friedrich

    2010-01-01

    We investigated the dynamics of nanometer thin water films at controlled ambient humidity adsorbed onto two atomically smooth mica sheets upon rapidly bringing the surfaces into contact. Using a surface forces apparatus (SFA) in imaging mode, we found that the water films break up into a

  19. Models of Fate and Transport of Pollutants in Surface Waters

    Science.gov (United States)

    Okome, Gloria Eloho

    2013-01-01

    There is the need to answer very crucial questions of "what happens to pollutants in surface waters?" This question must be answered to determine the factors controlling fate and transport of chemicals and their evolutionary state in surface waters. Monitoring and experimental methods are used in establishing the environmental states.…

  20. Economic Impacts of Surface Mining on Household Drinking Water Supplies

    Science.gov (United States)

    This report provides information on the economic and social impacts of contaminated surface and ground water supplies on residents and households near surface mining operations. The focus is on coal slurry contamination of water supplies in Mingo County, West Virginia, and descr...

  1. The impact of uncontrolled waste disposal on surface water quality ...

    African Journals Online (AJOL)

    The main threat to the surface water quality in Addis Ababa is environmental pollution derived from domestic and industrial activities. Due to the inadequacy of controlled waste management strategies and waste treatment plants, people are forced to discharge wastes both on open surface and within water bodies.

  2. Sampling procedure for lake or stream surface water chemistry

    Science.gov (United States)

    Robert Musselman

    2012-01-01

    Surface waters collected in the field for chemical analyses are easily contaminated. This research note presents a step-by-step detailed description of how to avoid sample contamination when field collecting, processing, and transporting surface water samples for laboratory analysis.

  3. Boltzmann equation analysis of electron-molecule collision cross sections in water vapor and ammonia

    International Nuclear Information System (INIS)

    Yousfi, M.; Benabdessadok, M.D.

    1996-01-01

    Sets of electron-molecule collision cross sections for H 2 O and NH 3 have been determined from a classical technique of electron swarm parameter unfolding. This deconvolution method is based on a simplex algorithm using a powerful multiterm Boltzmann equation analysis established in the framework of the classical hydrodynamic approximation. It is well adapted for the simulation of the different classes of swarm experiments (i.e., time resolved, time of flight, and steady state experiments). The sets of collision cross sections that exist in the literature are reviewed and analyzed. Fitted sets of cross sections are determined for H 2 O and NH 3 which exhibit features characteristic of polar molecules such as high rotational excitation collision cross sections. The hydrodynamic swarm parameters (i.e., drift velocity, longitudinal and transverse diffusion coefficients, ionization and attachment coefficients) calculated from the fitted sets are in excellent agreement with the measured ones. These sets are finally used to calculate the transport and reaction coefficients needed for discharge modeling in two cases of typical gas mixtures for which experimental swarm data are very sparse or nonexistent (i.e., flue gas mixtures and gas mixtures for rf plasma surface treatment). copyright 1996 American Institute of Physics

  4. Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

    International Nuclear Information System (INIS)

    Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

    2014-01-01

    Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

  5. Bond rearrangement caused by sudden single and multiple ionization of water molecules

    International Nuclear Information System (INIS)

    Ben-Itzhak, I.; Sayler, A. Max; Leonard, M.; Maseberg, J.W.; Hathiramani, D.; Wells, E.; Smith, M.A.; Xia, Jiangfan; Wang, Pengqian; Carnes, K.D.; Esry, B.D.

    2005-01-01

    Bond rearrangement, namely the dissociation of water into H 2 + +O q+ following ionization by fast proton and highly charged ion impact, was investigated. Single ionization by fast proton impact exhibits a strong isotopic effect, the dissociation of H 2 O + ->H 2 + +O being about twice as likely as D 2 O + ->D 2 + +O, with HDO + ->HD + +O in between. This suggests that the bond rearrangement does not happen during the slow dissociation, but rather during the very fast ionization, and thus H 2 + should also be produced when the water molecule is multiply ionized. We observed that the H 2 + +O + and H 2 + +O 2+ production in 1MeV/amu F 7+ +H 2 O collisions are 0.209+/-0.006% and 0.0665+/-0.003%, respectively, of the main double-ionization dissociation product, H 2 O 2+ ->H + +OH + . This ratio is similar to the triple to double ionization ratio in similar collisions with atomic targets thus suggesting that the bond-rearrangement fraction out of each ionization level is approximately constant. Similar dissociation channels in the heavier water isotopes, which are expected to be smaller, are under study. Finally, the fragmentation of HDO exhibits very strong isotopic preference for breaking the OH bond over the OD bond

  6. Theoretical studies of molecule surface scattering: Rotationally inelastic diffraction and dissociative dynamics of H2 on metals

    International Nuclear Information System (INIS)

    Cruz Pol, A.J.

    1993-01-01

    The interaction of H 2 and its isotopes with metal surfaces has been the subject of many investigations. The scattering experiments provide data such as the final rotational state distribution, sticking coefficients, kinetic energy distribution, and diffraction data. In the first study of this thesis the author implemented a model for looking at the rotationally inelastic diffraction probabilities for H 2 , HD, and D 2 , as a function of surface temperature. The surface is treated in a quantum mechanical fashion using a recently developed formalism. The center of mass translational motion is treated semiclassically using Gaussian wave packets, and the rotations are described quantum mechanically. The phonon summed rotation-diffraction probabilities as well as the probability distribution for a scattering molecule exchanging an amount of energy ΔE with the surface were computed. In the second and third study of this thesis the author implemented a mixed quantum-classical model to compute the probability for dissociation and rotational excitation for H 2 , HD, and D 2 scattered from Ni(100) dimensionally in dynamics simulations. Of the six degrees of freedom for the dissociative adsorption of a diatomic molecule on a static surface, the author treats Z,d the center of mass distance above the surface plan, r, the internuclear separation, θ, the polar orientation angle, quantum mechanically. The remaining three degrees of freedom, X and Y, the center of mass position on the surface plane, and oe, the azimuthal orientation angle, are treated classically. Probabilities for dissociation and ro-vibrational excitation are computed as a function of incident translational energy. Two sudden approximations are tested, in which either the center of mass translation parallel to the surface or the azimuthal orientation of the molecule are frozen. Comparisons are made between low and high dimensionality results and with fully classical results

  7. Adsorption of methanol, ethanol and water on well-characterized PtSn surface alloys

    Science.gov (United States)

    Panja, Chameli; Saliba, Najat; Koel, Bruce E.

    1998-01-01

    Adsorption and desorption of methanol (CH 3OH), ethanol (C 2H 5OH) and water on Pt(111) and two, ordered, PtSn alloys has been studied primarily using temperature-programmed desorption (TPD) mass spectroscopy. The two alloys studied were the {p(2 × 2) Sn}/{Pt(111) } and (√3 × √3) R30° {Sn}/{Pt(111) } surface alloys prepared by vapor deposition of Sn on Pt(111), with θSn = 0.25 and 0.33, respectively. All three molecules are weakly bonded and reversibly adsorbed under UHV conditions on all three surfaces, molecularly desorbing during TPD without any decomposition. The two PtSn surface alloys were found to chemisorb both methanol and ethanol slightly more weakly than on the Pt(111) surface. The desorption activation energies measured by TPD, and hence the adsorption energies, of both methanol and ethanol progressively decrease as the surface concentration of Sn increases, compared with Pt(111). The decreased binding energy leads one to expect a lower reactivity for these alcohols on the two alloys. The sticking coefficients and the monolayer coverages of these alcohols on the two alloys were identical to that on Pt(111) at 100 K, independent of the amount of Sn present in the surface layer. Alloying Sn in Pt(111) also slightly weakens the adsorption energy of water. Water clusters are formed even at low coverages on all three surfaces, eventually forming a water bilayer prior to the formation of a condensed ice phase. These results are relevant to a molecular-level explanation for the reactivity of Sn-promoted Pt surfaces that have been used in the electro-oxidation of simple organic molecules.

  8. Plasmonic nanoantenna arrays for surface-enhanced Raman spectroscopy of lipid molecules embedded in a bilayer membrane.

    Science.gov (United States)

    Kühler, Paul; Weber, Max; Lohmüller, Theobald

    2014-06-25

    We demonstrate a strategy for surface-enhanced Raman spectroscopy (SERS) of supported lipid membranes with arrays of plasmonic nanoantennas. Colloidal lithography refined with plasma etching is used to synthesize arrays of triangular shaped gold nanoparticles. Reducing the separation distance between the triangle tips leads to plasmonic coupling and to a strong enhancement of the electromagnetic field in the nanotriangle gap. As a result, the Raman scattering intensity of molecules that are located at this plasmonic "hot-spot" can be increased by several orders of magnitude. The nanoantenna array is then embedded with a supported phospholipid membrane which is fluid at room temperature and spans the antenna gap. This configuration offers the advantage that molecules that are mobile within the bilayer membrane can enter the "hot-spot" region via diffusion and can therefore be measured by SERS without static entrapment or adsorption of the molecules to the antenna itself.

  9. Monitoring of Water and Contaminant Migration at the Groundwater-Surface Water Interface

    Science.gov (United States)

    2008-08-01

    seepage is occurring in a freshwater lake environment and to map the lateral extent of any subsurface contamination at the groundwater –surface water ...and Contaminant Migration at the Groundwater -Surface Water Interface August 2008 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public...4. TITLE AND SUBTITLE Monitoring of Water and Contaminant Migration at the Groundwater -Surface Water Interface 5a. CONTRACT NUMBER 5b. GRANT NUMBER

  10. Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations; Aproksimativno Krieger-Nelkinovo orijentacijsko usrednjenje i anozotropija vibracija molekula lake vode

    Energy Technology Data Exchange (ETDEWEB)

    Markovic, M I [Elektrothenicki fakultet, Belgrade (Yugoslavia)

    1974-07-01

    Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy.

  11. Ureaplasma diversum Genome Provides New Insights about the Interaction of the Surface Molecules of This Bacterium with the Host.

    Directory of Open Access Journals (Sweden)

    Lucas M Marques

    Full Text Available Whole genome sequencing and analyses of Ureaplasma diversum ATCC 49782 was undertaken as a step towards understanding U. diversum biology and pathogenicity. The complete genome showed 973,501 bp in a single circular chromosome, with 28.2% of G+C content. A total of 782 coding DNA sequences (CDSs, and 6 rRNA and 32 tRNA genes were predicted and annotated. The metabolic pathways are identical to other human ureaplasmas, including the production of ATP via hydrolysis of the urea. Genes related to pathogenicity, such as urease, phospholipase, hemolysin, and a Mycoplasma Ig binding protein (MIB-Mycoplasma Ig protease (MIP system were identified. More interestingly, a large number of genes (n = 40 encoding surface molecules were annotated in the genome (lipoproteins, multiple-banded antigen like protein, membrane nuclease lipoprotein and variable surface antigens lipoprotein. In addition, a gene encoding glycosyltransferase was also found. This enzyme has been associated with the production of capsule in mycoplasmas and ureaplasma. We then sought to detect the presence of a capsule in this organism. A polysaccharide capsule from 11 to 17 nm of U. diversum was observed trough electron microscopy and using specific dyes. This structure contained arabinose, xylose, mannose, galactose and glucose. In order to understand the inflammatory response against these surface molecules, we evaluated the response of murine macrophages J774 against viable and non-viable U. diversum. As with viable bacteria, non-viable bacteria were capable of promoting a significant inflammatory response by activation of Toll like receptor 2 (TLR2, indicating that surface molecules are important for the activation of inflammatory response. Furthermore, a cascade of genes related to the inflammasome pathway of macrophages was also up-regulated during infection with viable organisms when compared to non-infected cells. In conclusion, U. diversum has a typical ureaplasma genome and

  12. Ureaplasma diversum Genome Provides New Insights about the Interaction of the Surface Molecules of This Bacterium with the Host.

    Science.gov (United States)

    Marques, Lucas M; Rezende, Izadora S; Barbosa, Maysa S; Guimarães, Ana M S; Martins, Hellen B; Campos, Guilherme B; do Nascimento, Naíla C; Dos Santos, Andrea P; Amorim, Aline T; Santos, Verena M; Farias, Sávio T; Barrence, Fernanda  C; de Souza, Lauro M; Buzinhani, Melissa; Arana-Chavez, Victor E; Zenteno, Maria E; Amarante-Mendes, Gustavo P; Messick, Joanne B; Timenetsky, Jorge

    2016-01-01

    Whole genome sequencing and analyses of Ureaplasma diversum ATCC 49782 was undertaken as a step towards understanding U. diversum biology and pathogenicity. The complete genome showed 973,501 bp in a single circular chromosome, with 28.2% of G+C content. A total of 782 coding DNA sequences (CDSs), and 6 rRNA and 32 tRNA genes were predicted and annotated. The metabolic pathways are identical to other human ureaplasmas, including the production of ATP via hydrolysis of the urea. Genes related to pathogenicity, such as urease, phospholipase, hemolysin, and a Mycoplasma Ig binding protein (MIB)-Mycoplasma Ig protease (MIP) system were identified. More interestingly, a large number of genes (n = 40) encoding surface molecules were annotated in the genome (lipoproteins, multiple-banded antigen like protein, membrane nuclease lipoprotein and variable surface antigens lipoprotein). In addition, a gene encoding glycosyltransferase was also found. This enzyme has been associated with the production of capsule in mycoplasmas and ureaplasma. We then sought to detect the presence of a capsule in this organism. A polysaccharide capsule from 11 to 17 nm of U. diversum was observed trough electron microscopy and using specific dyes. This structure contained arabinose, xylose, mannose, galactose and glucose. In order to understand the inflammatory response against these surface molecules, we evaluated the response of murine macrophages J774 against viable and non-viable U. diversum. As with viable bacteria, non-viable bacteria were capable of promoting a significant inflammatory response by activation of Toll like receptor 2 (TLR2), indicating that surface molecules are important for the activation of inflammatory response. Furthermore, a cascade of genes related to the inflammasome pathway of macrophages was also up-regulated during infection with viable organisms when compared to non-infected cells. In conclusion, U. diversum has a typical ureaplasma genome and metabolism, and

  13. Issues of the presence of parasitic protozoa in surface waters

    Directory of Open Access Journals (Sweden)

    Hawrylik Eliza

    2018-01-01

    This paper focuses on the problem of the presence of parasitic protozoa in surface waters. Characteristics of the most frequently recognized pathogens responsible for water-borne outbreaks were described, as well as sources of contamination and surface waters contamination due to protozoa of the genus Cryptosporidium and Giardia were presented. The methods of destroying the cysts and oocysts of parasitic protozoa used nowadays in the world were also presented in a review.

  14. 40 CFR 257.3-3 - Surface water.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Surface water. 257.3-3 Section 257.3-3... and Practices § 257.3-3 Surface water. (a) For purposes of section 4004(a) of the Act, a facility... Water Act, as amended. (b) For purposes of section 4004(a) of the Act, a facility shall not cause a...

  15. Adsorption of egg phosphatidylcholine to an air/water and triolein/water bubble interface: use of the 2-dimensional phase rule to estimate the surface composition of a phospholipid/triolein/water surface as a function of surface pressure.

    Science.gov (United States)

    Mitsche, Matthew A; Wang, Libo; Small, Donald M

    2010-03-11

    Phospholipid monolayers play a critical role in the structure and stabilization of biological interfaces, including all membranes, the alveoli of the lungs, fat droplets in adipose tissue, and lipoproteins. The behavior of phospholipids in bilayers and at an air-water interface is well understood. However, the study of phospholipids at oil-water interfaces is limited due to technical challenges. In this study, egg phosphatidylcholine (EPC) was deposited from small unilamellar vesicles onto a bubble of either air or triolein (TO) formed in a low-salt buffer. The surface tension (gamma) was measured using a drop tensiometer. We observed that EPC binds irreversibly to both interfaces and at equilibrium exerts approximately 12 and 15 mN/m of pressure (Pi) at an air and TO interface, respectively. After EPC was bound to the interface, the unbound EPC was washed out of the cuvette, and the surface was compressed to study the Pi/area relationship. To determine the surface concentration (Gamma), which cannot be measured directly, compression isotherms from a Langmuir trough and drop tensiometer were compared. The air-water interfaces had identical characteristics using both techniques; thus, Gamma on the bubble can be determined by overlaying the two isotherms. Both TO and EPC are surface-active, so in a mixed TO/EPC monolayer, both molecules will be exposed to water. Since TO is less surface-active than EPC, as Pi increases, the TO is progressively ejected. To understand the Pi/area isotherm of EPC on a TO bubble, a variety of TO-EPC mixtures were spread at the air-water interface. The isotherms show an abrupt break in the curve caused by the ejection of TO from the monolayer into a new bulk phase. By overlaying the compression isotherm above the ejection point with a TO bubble compression isotherm, Gamma can be estimated. This allows determination of Gamma of EPC on a TO bubble as a function of Pi.

  16. 77 FR 12227 - Long Term 2 Enhanced Surface Water Treatment Rule: Uncovered Finished Water Reservoirs; Public...

    Science.gov (United States)

    2012-02-29

    ... Water Treatment Rule: Uncovered Finished Water Reservoirs; Public Meeting AGENCY: Environmental... review of the uncovered finished water reservoir requirement in the Long Term 2 Enhanced Surface Water... uncovered finished water reservoir requirement and the agency's Six Year Review process. EPA also plans to...

  17. Treatability of South African surface waters by enhanced coagulation

    African Journals Online (AJOL)

    The majority of South African inland surface water sources are compromised due to a long-standing national policy of mandatory return flows. With renewed emphasis on the removal of organic carbon in the latest SANS 241 water quality standard, many South African water treatment managers may need to consider ...

  18. Environmental impact of by pass channel of surface waters

    International Nuclear Information System (INIS)

    Vismara, R.; Renoldi, M.; Torretta, V.

    1996-01-01

    In this paper are analyzed the impacts generated by surface waters drawing on river course. This impacts are generated also by reduction of water flow. This effect is most important for the presence of biological community: algae, fiches, micro invertebrates. Are also reported regional laws, water master plan of Lombardia region

  19. Molecular insight into nanoscale water films dewetting on modified silica surfaces.

    Science.gov (United States)

    Zhang, Jun; Li, Wen; Yan, Youguo; Wang, Yefei; Liu, Bing; Shen, Yue; Chen, Haixiang; Liu, Liang

    2015-01-07

    In this work, molecular dynamics simulations are adopted to investigate the microscopic dewetting mechanism of nanoscale water films on methylated silica surfaces. The simulation results show that the dewetting process is divided into two stages: the appearance of dry patches and the quick contraction of the water film. First, the appearance of dry patches is due to the fluctuation in the film thickness originating from capillary wave instability. Second, for the fast contraction of water film, the unsaturated electrostatic and hydrogen bond interactions among water molecules are the driving forces, which induce the quick contraction of the water film. Finally, the effect of film thickness on water films dewetting is studied. Research results suggest that upon increasing the water film thickness from 6 to 8 Å, the final dewetting patterns experience separate droplets and striation-shaped structures, respectively. But upon further increasing the water film thickness, the water film is stable and there are no dry patches. The microscopic dewetting behaviors of water films on methylated silica surfaces discussed here are helpful in understanding many phenomena in scientific and industrial processes better.

  20. Photo-stimulated desorption from water and methane clusters on the surface of solid neon

    International Nuclear Information System (INIS)

    Arakawa Ichiri; Matsumoto Dairo; Takekuma Shinichi; Tamura Reimi; Miura Takashi

    2012-01-01

    Photo-stimulated desorption of ions from methane and water heterocluster on the surface of solid neon was studied. The desorption yields of the variety of photo-desorbed species showed strong dependence on the composition and the size of the mother cluster. It was found that the presence of a water molecule in the cluster significantly enhanced, or was almost essential for, the desorption of any species observed. Systematic investigation of the correlation between the cluster size and the desorption yield of each ion has revealed the mother cluster which yields the each desorbed ion.

  1. Underground coal mine subsidence impacts on surface water

    International Nuclear Information System (INIS)

    Stump, D.E. Jr.

    1992-01-01

    This paper reports that subsidence from underground coal mining alters surface water discharge and availability. The magnitude and areal extent of these impacts are dependent on many factors, including the amount of subsidence, topography, geology, climate, surface water - ground water interactions, and fractures in the overburden. There alterations may have positive and/or negative impacts. One of the most significant surface water impacts occurred in July 1957 near West Pittston, Pennsylvania. Subsidence in the Knox Mine under the Coxton Yards of the Lehigh Valley Railroad allowed part of the discharge in the Susquehanna River to flow into the mine and create a crater 200 feet in diameter and 300 feet deep. Fourteen railroad gondola cars fell into the hole which was eventually filled with rock, sand, and gravel. Other surface water impacts from subsidence may include the loss of water to the ground water system, the gaining of water from the ground water system, the creation of flooded subsidence troughs, the increasing of impoundment storage capacity, the relocation of water sources (springs), and the alteration of surface drainage patterns

  2. OCCURRENCE OF ENTERIC VIRUSES IN SURFACE WATERS

    Science.gov (United States)

    Human enteric viruses cause a number of diseases when individuals are exposed to contaminated drinking & recreational waters. Vaccination against poliovirus has virtually eliminated poliomyelitis from the planet. Other members of enterovirus group cause numerous diseases. Hepatit...

  3. Wind effect on water surface of water reservoirs

    Directory of Open Access Journals (Sweden)

    Petr Pelikán

    2013-01-01

    Full Text Available The primary research of wind-water interactions was focused on coastal areas along the shores of world oceans and seas because a basic understanding of coastal meteorology is an important component in coastal and offshore design and planning. Over time the research showed the most important meteorological consideration relates to the dominant role of winds in wave generation. The rapid growth of building-up of dams in 20th century caused spreading of the water wave mechanics research to the inland water bodies. The attention was paid to the influence of waterwork on its vicinity, wave regime respectively, due to the shoreline deterioration, predominantly caused by wind waves. Consequently the similar principles of water wave mechanics are considered in conditions of water reservoirs. The paper deals with the fundamental factors associated with initial wind-water interactions resulting in the wave origination and growth. The aim of the paper is thepresentation of utilization of piece of knowledge from a part of sea hydrodynamics and new approach in its application in the conditions of inland water bodies with respect to actual state of the art. The authors compared foreign and national approach to the solved problems and worked out graphical interpretation and overview of related wind-water interaction factors.

  4. Presence and risk assessment of pharmaceuticals in surface water and drinking water

    DEFF Research Database (Denmark)

    Sanderson, Hans

    2011-01-01

    Trace amounts of pharmaceuticals have been detected in surface waters in the nano- to microgram per liter range, and in drinking water in the nanogram/L range. The environmental risks of pharmaceuticals in surface waters have been evaluated and generally found to be low if the wastewater is treated...

  5. Coastal surface water suitability analysis for irrigation in Bangladesh

    Science.gov (United States)

    Mahtab, Mohammad Hossain; Zahid, Anwar

    2018-03-01

    Water with adequate quality and quantity is very important for irrigation to ensure the crop yields. Salinity is common problem in the coastal waters in Bangladesh. The intensity of salinity in the coastal zone in Bangladesh is not same. It fluctuates over the year. Sodium is another hazard which may hamper permeability and ultimately affects the fertility. It can reduce the crop yields. Although surface water is available in the coastal zone of Bangladesh, but its quality for irrigation needs to be monitored over the year. This paper will investigate the overall quality of coastal surface waters. Thirty-three water samples from different rivers were collected both in wet period (October-December) and in dry period (February-April). Different physical and chemical parameters are considered for investigation of the adequacy of water with respect to international irrigation water quality standards and Bangladesh standards. A comparison between the dry and wet period coastal surface water quality in Bangladesh will also be drawn here. The analysis shows that coastal surface water in Bangladesh is overall suitable for irrigation during wet period, while it needs treatment (which will increase the irrigation cost) for using for irrigation during dry period. Adaptation to this situation can improve the scenario. An integrated plan should be taken to increase the water storing capacity in the coastal area to harvest water during wet period.

  6. Synthesis of ZnO particles using water molecules generated in esterification reaction

    Science.gov (United States)

    Šarić, Ankica; Gotić, Marijan; Štefanić, Goran; Dražić, Goran

    2017-07-01

    Zinc oxide particles were synthesized without the addition of water by autoclaving (anhydrous) zinc acetate/alcohol and zinc acetate/acetic acid/alcohol solutions at 160 °C. The solvothermal synthesis was performed in ethanol or octanol. The structural, optical and morphological characteristics of ZnO particles were investigated by X-ray diffraction (XRD), UV-Vis spectroscopy, FE-SEM and TEM/STEM microscopy. 13C NMR spectroscopy revealed the presence of ester (ethyl- or octyl-acetate) in the supernatants which directly indicate the reaction mechanism. The formation of ester in this esterification reaction generated water molecule in situ, which hydrolyzed anhydrous zinc acetate and initiated nucleation and formation of ZnO. It was found that the size and shape of ZnO particles depend on the type of alcohol used as a solvent and on the presence of acetic acid in solution. The presence of ethanol in the ;pure; system without acetic acid favoured the formation of fine and uniform spherical ZnO nanoparticles (∼20 nm). With the addition of small amount of acetic acid the size of these small nanoparticles increased significantly up to a few hundred nanometers. The addition of small amount of acetic acid in the presence of octanol caused even more radical changes in the shape of ZnO particles, favouring the growth of huge rod-like particles (∼3 μm).

  7. A GPU-based mipmapping method for water surface visualization

    Science.gov (United States)

    Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan

    2018-03-01

    Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

  8. Activation of a water molecule coordinated to manganese: four study cases

    International Nuclear Information System (INIS)

    Lassalle-Kaiser, B.

    2008-10-01

    The daunting energy consumption of western societies calls for the development of renewable energies. Among them, hydrogen stands as a major candidate. The cleanest way of producing hydrogen is water electro- or photolysis. This reaction is carried out in natural photosynthesis by a manganese-oxo cluster, the functioning of which remains unknown. Insight into this mechanism would greatly help the search for low-cost water splitting catalysts. Our contribution to this field is the understanding of the fundamental processes that govern the activation of water by manganese complexes. This manuscript describes our attempts to generate electrochemically mononuclear manganese(IV) complexes bearing a fully deprotonated water molecule (oxo ligand). We have studied four different cases, which reflect different possible coordination spheres capable of stabilizing such species. In the first chapter, we will give a brief overview of the present energetic challenges faced by western societies. In the second chapter, we will present general considerations about manganese chemistry and a description of the structure and functioning of the water oxidizing enzyme. We will also describe the basic requirements for the splitting of water and present the goals of our work. In the third chapter, we will present the synthesis of a new family of tetradentate ligands, together with the synthesis and full characterization of the corresponding nickel(II) complexes. The first results obtained with the manganese analogue will also be shown. Chapter four presents the formation and the full characterization of a mononuclear manganese(IV)-oxo complex, by electrochemical oxidation of a manganese(II)-aqua complex. We will present different pathways to generate this species and show which intermediates are involved in this 2 e - , 2 H + reaction. Chapter five describes the formation of a mononuclear manganese(IV) complex, by electrochemical oxidation of a manganese(III)-hydroxo complex. The

  9. Water resources data, Iowa, water year 2001, Volume 2. surface water--Missouri River basin, and ground water

    Science.gov (United States)

    Nalley, G.M.; Gorman, J.G.; Goodrich, R.D.; Miller, V.E.; Turco, M.J.; Linhart, S.M.

    2002-01-01

    The Water Resources Division of the U.S. Geological Survey, in cooperation with State, county, municipal, and other Federal agencies, obtains a large amount of data pertaining to the water resources of Iowa each water year. These data, accumulated during many water years, constitute a valuable data base for developing an improved understanding of the water resources of the State. To make this data readily available to interested parties outside of the Geological Survey, the data is published annually in this report series entitled “Water Resources Data - Iowa” as part of the National Water Data System. Water resources data for water year 2001 for Iowa consists of records of stage, discharge, and water quality of streams; stage and contents of lakes and reservoirs; and water levels and water quality of ground water. This report, in two volumes, contains stage or discharge records for 132 gaging stations; stage records for 9 lakes and reservoirs; water-quality records for 4 gaging stations; sediment records for 13 gaging stations; and water levels for 163 ground-water observation wells. Also included are peak-flow data for 92 crest-stage partial-record stations, water-quality data from 86 municipal wells, and precipitation data collected at 6 gaging stations and 2 precipitation sites. Additional water data were collected at various sites not included in the systematic data-collection program, and are published here as miscellaneous measurements and analyses. These data represent that part of the National Water Data System operated by the U.S. Geological Survey and cooperating local, State, and Federal agencies in Iowa.Records of discharge or stage of streams, and contents or stage of lakes and reservoirs were first published in a series of U.S. Geological Survey water-supply papers entitled “Surface Water Supply of the United States.” Through September 30, 1960, these water-supply papers were published in an annual series; during 1961-65 and 1966-70, they

  10. Deuterium content on surface waters VI to X Chile regions

    International Nuclear Information System (INIS)

    Aravena C, R; Pollastri J, A.; Suzuki S, O.

    1984-01-01

    One important parameter on any sitting study for a heavy water plant installation is the deuterium content of the feed water. Deuterium data on surface waters from differents areas located in the south of Chile, are presented. These results allow to idently some potential areas for a future heavy water plant. One of these areas, Lago Llanquihue, was sampled more in detail to study the vertical distribution and spatial variations. (Author)

  11. Possibilities of surface waters monitoring at mining areas using UAV

    Science.gov (United States)

    Lisiecka, Ewa; Motyka, Barbara; Motyka, Zbigniew; Pierzchała, Łukasz; Szade, Adam

    2018-04-01

    The selected, remote measurement methods are discussed, useful for determining surface water properties using mobile unmanned aerial platforms (UAV). The possibilities of using this type of solutions in the scope of measuring spatial, physicochemical and biological parameters of both natural and anthropogenic water reservoirs, including flood polders, water-filled pits, settling tanks and mining sinks were analyzed. Methods of remote identification of the process of overgrowing this type of ecosystems with water and coastal plant formations have also been proposed.

  12. Desert Beetle-Inspired Superwettable Patterned Surfaces for Water Harvesting.

    Science.gov (United States)

    Yu, Zhenwei; Yun, Frank F; Wang, Yanqin; Yao, Li; Dou, Shixue; Liu, Kesong; Jiang, Lei; Wang, Xiaolin

    2017-09-01

    With the impacts of climate change and impending crisis of clean drinking water, designing functional materials for water harvesting from fog with large water capacity has received much attention in recent years. Nature has evolved different strategies for surviving dry, arid, and xeric conditions. Nature is a school for human beings. In this contribution, inspired by the Stenocara beetle, superhydrophilic/superhydrophobic patterned surfaces are fabricated on the silica poly(dimethylsiloxane) (PDMS)-coated superhydrophobic surfaces using a pulsed laser deposition approach with masks. The resultant samples with patterned wettability demonstrate water-harvesting efficiency in comparison with the silica PDMS-coated superhydrophobic surface and the Pt nanoparticles-coated superhydrophilic surface. The maximum water-harvesting efficiency can reach about 5.3 g cm -2 h -1 . Both the size and the percentage of the Pt-coated superhydrophilic square regions on the patterned surface affect the condensation and coalescence of the water droplet, as well as the final water-harvesting efficiency. The present water-harvesting strategy should provide an avenue to alleviate the water crisis facing mankind in certain arid regions of the world. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. (e,3e) and (e,3-1e) differential cross sections for the double ionization of water molecule

    International Nuclear Information System (INIS)

    Mansouri, A.; Dal Cappello, C.; Kada, I.; Champion, C.; Roy, A.C.

    2009-01-01

    We report new results for differential cross sections for the double ionization of water molecule by 1 keV electron impact. The present calculation is based on the first Born approximation. We describe the water molecule by a single centre wave function of Moccia. For the final state, an approximation of the well-known 3C wave function is used. An extensive study has been made by varying the angles of detection and the energies of each ejected electron. We have investigated the double ionization of each molecular state (1b 1 , 3a 1 , 1b 2 and 2a 1 ) and identified the mechanisms of this process.

  14. Electrochemistry of Single Metalloprotein and DNA‐Based Molecules at Au(111) Electrode Surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia; Zeng, Dongdong; Karlsen, Kasper Kannegård

    2013-01-01

    We have briefly overviewed recent efforts in the electrochemistry of single transition metal complex, redox metalloprotein, and redox‐marked oligonucleotide (ON) molecules. We have particularly studied self‐assembled molecular monolayers (SAMs) of several 5′‐C6‐SH single‐ (ss) and double‐strand (...

  15. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  16. Expansion Hamiltonian model for a diatomic molecule adsorbed on a surface: Vibrational states of the CO/Cu(100) system including surface vibrations

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Qingyong, E-mail: mengqingyong@dicp.ac.cn [State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Zhongshan Road 457, 116023 Dalian (China); Meyer, Hans-Dieter, E-mail: hans-dieter.meyer@pci.uni-heidelberg.de [Theoretische Chemie, Physikalisch-Chemisches Institut, Ruprecht-Karls Universität Heidelberg, Im Neuenheimer Feld 229, D-69120 Heidelberg (Germany)

    2015-10-28

    Molecular-surface studies are often done by assuming a corrugated, static (i.e., rigid) surface. To be able to investigate the effects that vibrations of surface atoms may have on spectra and cross sections, an expansion Hamiltonian model is proposed on the basis of the recently reported [R. Marquardt et al., J. Chem. Phys. 132, 074108 (2010)] SAP potential energy surface (PES), which was built for the CO/Cu(100) system with a rigid surface. In contrast to other molecule-surface coupling models, such as the modified surface oscillator model, the coupling between the adsorbed molecule and the surface atoms is already included in the present expansion SAP-PES model, in which a Taylor expansion around the equilibrium positions of the surface atoms is performed. To test the quality of the Taylor expansion, a direct model, that is avoiding the expansion, is also studied. The latter, however, requests that there is only one movable surface atom included. On the basis of the present expansion and direct models, the effects of a moving top copper atom (the one to which CO is bound) on the energy levels of a bound CO/Cu(100) system are studied. For this purpose, the multiconfiguration time-dependent Hartree calculations are carried out to obtain the vibrational fundamentals and overtones of the CO/Cu(100) system including a movable top copper atom. In order to interpret the results, a simple model consisting of two coupled harmonic oscillators is introduced. From these calculations, the vibrational levels of the CO/Cu(100) system as function of the frequency of the top copper atom are discussed.

  17. Ionization by a pulsed plasma surface water

    International Nuclear Information System (INIS)

    Bloyet, E.; Leprince, P.; Marec, J.; Llamas Blasco, M.

    1981-01-01

    The ionization mechanism is studied of a pulsed surface wave generating a microwave discharge. When the plasma is dominated by collisions, it is found that the velocity of the ionization front depends on the ponderomotive force due to the field gradient in the front. (orig.)

  18. Nonadiabatic effects on surfaces: Kohn anomaly, electronic damping of adsorbate vibrations, and local heating of single molecules

    International Nuclear Information System (INIS)

    Kroeger, J

    2008-01-01

    Three aspects of electron-phonon coupling at metal surfaces are reviewed. One aspect is the Kohn effect, which describes an anomalous dispersion relation of surface phonons due to quasi-one-dimensional nesting of Fermi surface contours. The combination of electron energy loss spectroscopy and angle-resolved photoelectron spectroscopy allows us to unambiguously characterize Kohn anomaly systems. A second aspect is the nonadiabatic damping of adsorbate vibrations. Characteristic spectroscopic line shapes of vibrational modes allow us to estimate the amount of energy transfer between the vibrational mode and electron-hole pairs. Case studies of a Kohn anomaly and nonadiabatic damping are provided by the hydrogen- and deuterium-covered Mo(110) surface. As a third aspect of interaction between electrons and phonons, local heating of a C 60 molecule adsorbed on Cu(100) and in contact with the tip of a scanning tunnelling microscope is covered

  19. Guidelines for surface water quality, vol. l

    International Nuclear Information System (INIS)

    1983-01-01

    A literature survey was carried out on the chemically toxic effects of uranium and uranium compounds on human health, aquatic life, plants and livestock. All the information collected is summarized in this document and, from it, maximum uranium concentrations in water at which toxic effects will not appear are recommended

  20. Water's Interfacial Hydrogen Bonding Structure Reveals the Effective Strength of Surface-Water Interactions.

    Science.gov (United States)

    Shin, Sucheol; Willard, Adam P

    2018-06-05

    We combine all-atom molecular dynamics simulations with a mean field model of interfacial hydrogen bonding to analyze the effect of surface-water interactions on the structural and energetic properties of the liquid water interface. We show that the molecular structure of water at a weakly interacting ( i.e., hydrophobic) surface is resistant to change unless the strength of surface-water interactions are above a certain threshold. We find that below this threshold water's interfacial structure is homogeneous and insensitive to the details of the disordered surface, however, above this threshold water's interfacial structure is heterogeneous. Despite this heterogeneity, we demonstrate that the equilibrium distribution of molecular orientations can be used to quantify the energetic component of the surface-water interactions that contribute specifically to modifying the interfacial hydrogen bonding network. We identify this specific energetic component as a new measure of hydrophilicity, which we refer to as the intrinsic hydropathy.

  1. Basin scale management of surface and ground water

    International Nuclear Information System (INIS)

    Tracy, J.C.; Al-Sharif, M.

    1993-01-01

    An important element in the economic development of many regions of the Great Plains is the availability of a reliable water supply. Due to the highly variable nature of the climate through out much of the Great Plains region, non-controlled stream flow rates tend to be highly variable from year to year. Thus, the primary water supply has tended towards developing ground water aquifers. However, in regions where shallow ground water is extracted for use, there exists the potential for over drafting aquifers to the point of depleting hydraulically connected stream flows, which could adversely affect the water supply of downstream users. To prevent the potential conflict that can arise when a basin's water supply is being developed or to control the water extractions within a developed basin requires the ability to predict the effect that water extractions in one region will have on water extractions from either surface or ground water supplies else where in the basin. This requires the ability to simulate ground water levels and stream flows on a basin scale as affected by changes in water use, land use practices and climatic changes within the basin. The outline for such a basin scale surface water-ground water model has been presented in Tracy (1991) and Tracy and Koelliker (1992), and the outline for the mathematical programming statement to aid in determining the optimal allocation of water on a basin scale has been presented in Tracy and Al-Sharif (1992). This previous work has been combined into a computer based model with graphical output referred to as the LINOSA model and was developed as a decision support system for basin managers. This paper will present the application of the LINOSA surface-ground water management model to the Rattlesnake watershed basin that resides within Ground Water Management District Number 5 in south central Kansas

  2. Effect of water table dynamics on land surface hydrologic memory

    Science.gov (United States)

    Lo, Min-Hui; Famiglietti, James S.

    2010-11-01

    The representation of groundwater dynamics in land surface models has received considerable attention in recent years. Most studies have found that soil moisture increases after adding a groundwater component because of the additional supply of water to the root zone. However, the effect of groundwater on land surface hydrologic memory (persistence) has not been explored thoroughly. In this study we investigate the effect of water table dynamics on National Center for Atmospheric Research Community Land Model hydrologic simulations in terms of land surface hydrologic memory. Unlike soil water or evapotranspiration, results show that land surface hydrologic memory does not always increase after adding a groundwater component. In regions where the water table level is intermediate, land surface hydrologic memory can even decrease, which occurs when soil moisture and capillary rise from groundwater are not in phase with each other. Further, we explore the hypothesis that in addition to atmospheric forcing, groundwater variations may also play an important role in affecting land surface hydrologic memory. Analyses show that feedbacks of groundwater on land surface hydrologic memory can be positive, negative, or neutral, depending on water table dynamics. In regions where the water table is shallow, the damping process of soil moisture variations by groundwater is not significant, and soil moisture variations are mostly controlled by random noise from atmospheric forcing. In contrast, in regions where the water table is very deep, capillary fluxes from groundwater are small, having limited potential to affect soil moisture variations. Therefore, a positive feedback of groundwater to land surface hydrologic memory is observed in a transition zone between deep and shallow water tables, where capillary fluxes act as a buffer by reducing high-frequency soil moisture variations resulting in longer land surface hydrologic memory.

  3. Turbulent flow over an interactive alternating land-water surface

    Science.gov (United States)

    Van Heerwaarden, C.; Mellado, J. P.

    2014-12-01

    The alternating land-water surface is a challenging surface to represent accurately in weather and climate models, but it is of great importance for the surface energy balance in polar regions. The complexity of this surface lies in the fact that secondary circulations, which form at the boundary of water and land, interact strongly with the surface energy balance. Due to its large heat capacity, the water temperature adapts slowly to the flow, thus the properties of the atmosphere determine the uptake of energy from the water. In order to study this complex system in a simpler way, retaining only the most essential physics, we have simplified the full surface energy balance including radiation. We have derived a boundary condition that mimics the full balance and can be formulated as a so-called Robin boundary condition: a linear combination of Dirichlet (fixed temperature) and Neumann (fixed temperature gradient) ones. By spatially varying the coefficients, we are able to express land and water using this boundary condition. We have done a series of direct numerical simulations in which we generate artificial land-water patterns from noise created from a Gaussian spectrum centered around a dominant wave number. This method creates realistic random patterns, but we are still in control of the length scales. We show that the system can manifest itself in three regimes: micro-, meso- and macro-scale. In the micro-scale, we find perfect mixing of the near-surface atmosphere that results in identical air properties over water and land. In the meso-scale, secondary circulations alter the heat exchange considerably by advecting air between land and water. In addition, they bring the surface temperature of the land closer to that of the air, thereby modulating the energy loss due to outgoing longwave radiation. In the macro-scale regime, the flow over land and water become independent of each other and only the large scale forcings determine the energy balance.

  4. Osmium Atoms and Os2 Molecules Move Faster on Selenium-Doped Compared to Sulfur-Doped Boronic Graphenic Surfaces.

    Science.gov (United States)

    Barry, Nicolas P E; Pitto-Barry, Anaïs; Tran, Johanna; Spencer, Simon E F; Johansen, Adam M; Sanchez, Ana M; Dove, Andrew P; O'Reilly, Rachel K; Deeth, Robert J; Beanland, Richard; Sadler, Peter J

    2015-07-28

    We deposited Os atoms on S- and Se-doped boronic graphenic surfaces by electron bombardment of micelles containing 16e complexes [Os(p-cymene)(1,2-dicarba-closo-dodecarborane-1,2-diselenate/dithiolate)] encapsulated in a triblock copolymer. The surfaces were characterized by energy-dispersive X-ray (EDX) analysis and electron energy loss spectroscopy of energy filtered TEM (EFTEM). Os atoms moved ca. 26× faster on the B/Se surface compared to the B/S surface (233 ± 34 pm·s(-1) versus 8.9 ± 1.9 pm·s(-1)). Os atoms formed dimers with an average Os-Os distance of 0.284 ± 0.077 nm on the B/Se surface and 0.243 ± 0.059 nm on B/S, close to that in metallic Os. The Os2 molecules moved 0.83× and 0.65× more slowly than single Os atoms on B/S and B/Se surfaces, respectively, and again markedly faster (ca. 20×) on the B/Se surface (151 ± 45 pm·s(-1) versus 7.4 ± 2.8 pm·s(-1)). Os atom motion did not follow Brownian motion and appears to involve anchoring sites, probably S and Se atoms. The ability to control the atomic motion of metal atoms and molecules on surfaces has potential for exploitation in nanodevices of the future.

  5. Cavity mutants of Savinase. Crystal structures and differential scanning calorimetry experiments give hints of the function of the buried water molecules in subtilisins.

    Science.gov (United States)

    Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S

    1994-09-23

    The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.

  6. Spinterface between tris(8-hydroxyquinoline)metal(III) molecules and magnetic surfaces: a first-principles study

    Science.gov (United States)

    Jiang, W.; Wang, Jingying; Dougherty, Daniel; Liu, Feng; Feng Liu Team; Daniel Dougherty Team

    Using first-principles calculations, we have systematically investigated the hybridization between tris(8-hydroxyquinoline)metal(III) (Mq3, M = Fe, Cr, Al) molecules and magnetic substrates (Co and Cr). Mq3 with different central metal elements but the same organic framework has dramatically different interaction with different magnetic substrates, which affect the interface state significantly. AFM coupling was observed between magnetic Mq3 molecules and ferromagnetic (Co) as well as antiferromagnetic (Cr) substrate, manifested with a superexchange and direct exchange interaction, respectively. Such strong magnetic interfacial coupling may open a gap around the Fermi level and significantly change interface transport properties. Nonmagnetic Alq3 molecule was found to enhance the interface spin polarization due to hybridization between the lowest unoccupied molecular orbitals (LUMO) of Alq3 and metallic surface state. These findings will help better understand spinterface and shed new light on future application of Mq3 molecules in spintronics devices. This work was support by NSF-MRSEC (DMR-1121252) and DOE-BES (DE-FG02-04ER46148).

  7. Electronic and magnetic properties of Mn{sub 12} single-molecule magnets on the Au(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Voss, Soenke; Burgert, Michael; Fonin, Mikhail; Groth, Ulrich; Ruediger, Ulrich [Universitaet Konstanz (Germany); Michaelis, Christian; Brihuega, Ivan; Kern, Klaus [Max-Planck-Institut fuer Festkoerperforschung, Stuttgart (Germany); Dedkov, Yury S. [Institut fuer Festkoerperphysik, Technische Universitaet Dresden (Germany)

    2008-07-01

    The paramount interest in single-molecule magnets (SMMs) like Mn{sub 12}-acetate and its derivatives was inspired by numerous experimental and theoretical insights indicating the feasibility of addressing quantum effects of magnetism on a molecular scale. Due to its relatively high blocking temperature ({proportional_to}3 K) combined with the ability to identify well-defined spin states, Mn{sub 12} still remains the most favoured SMM possibly allowing the detection of magnetic fingerprints in transport properties of a single molecule. In this work, the electronic properties of Mn{sub 12} molecules chemically grafted on Au(111) surfaces have been studied by means of low temperature as well as room temperature scanning tunneling microscopy and spectroscopy (STS), X-ray absorption spectroscopy and photoelectron spectroscopy. The results revealed signatures from most probably intact Mn{sub 12} molecules while STS measurements in magnetic fields indicate the possibility to identify magnetic fingerprints in scanning tunneling spectra. The results will be discussed with respect to previous attempts to perform transport measurements on Mn{sub 12} SMMs.

  8. chemical and microbiological assessment of surface water samples

    African Journals Online (AJOL)

    PROF EKWUEME

    were investigated in this study: Nine samples from different surface water bodies, two samples from two effluent sources ... Ezeagu, Udi, Nkanu, Oji River and some parts of Awgu and Aninri ..... Study of Stream Output from Small Catchments.

  9. Exciton-Promoted Desorption From Solid Water Surfaces A2

    DEFF Research Database (Denmark)

    McCoustra, M.R.S.; Thrower, J.D.

    2018-01-01

    Abstract Desorption from solid water surfaces resulting from interaction with electromagnetic and particle radiation is reviewed in the context of the role of nonthermal desorption in astrophysical environments. Experimental observations are interpreted in terms of mechanisms sharing a common basis...

  10. Titanium Dioxide-Based Antibacterial Surfaces for Water Treatment

    Science.gov (United States)

    The field of water disinfection is gaining much interest since waterborne diseases caused by pathogenic microorganisms directly endanger human health. Antibacterial surfaces offer a new, ecofriendly technique to reduce the harmful disinfection byproducts that form in medical and ...

  11. Metallic nanocone array photonic substrate for high-uniformity surface deposition and optical detection of small molecules

    International Nuclear Information System (INIS)

    Coppe, Jean-Philippe; Xu Zhida; Chen Yi; Logan Liu, G

    2011-01-01

    Molecular probe arrays printed on solid surfaces such as DNA, peptide, and protein microarrays are widely used in chemical and biomedical applications especially genomic and proteomic studies (Pollack et al 1999 Nat. Genet. 23 41-6, Houseman et al 2002 Nat. Biotechnol. 20 270-4, Sauer et al 2005 Nat. Rev. Genet. 6 465-76) as well as surface imaging and spectroscopy (Mori et al 2008 Anal. Biochem. 375 223-31, Liu et al 2006 Nat. Nanotechnol. 1 47-52, Liu 2010 IEEE J. Sel. Top. Quantum Electron. 16 662-71). Unfortunately the printed molecular spots on solid surfaces often suffer low distribution uniformity due to the lingering 'coffee stain' (Deegan et al 1997 Nature 389 827-9) problem of molecular accumulations and blotches, especially around the edge of deposition spots caused by solvent evaporation and convection processes. Here we present, without any surface chemistry modification, a unique solid surface of high-aspect-ratio silver-coated silicon nanocone arrays that allows highly uniform molecular deposition and thus subsequent uniform optical imaging and spectroscopic molecular detection. Both fluorescent Rhodamine dye molecules and unlabeled oligopeptides are printed on the metallic nanocone photonic substrate surface as circular spot arrays. In comparison with the printed results on ordinary glass slides and silver-coated glass slides, not only high printing density but uniform molecular distribution in every deposited spot is achieved. The high-uniformity and repeatability of molecular depositions on the 'coffee stain'-free nanocone surface is confirmed by laser scanning fluorescence imaging and surface enhanced Raman imaging experiments. The physical mechanism for the uniform molecular deposition is attributed to the superhydrophobicity and localized pinned liquid-solid-air interface on the silver-coated silicon nanocone surface. The unique surface properties of the presented nanocone surface enabled high-density, high-uniformity probe spotting beneficial

  12. Surface Passivation of GaN Nanowires for Enhanced Photoelectrochemical Water-Splitting

    KAUST Repository

    Varadhan, Purushothaman; Fu, Hui-chun; Priante, Davide; Duran Retamal, Jose Ramon; Zhao, Chao; Ebaid, Mohamed; Ng, Tien Khee; Ajia, Idris A.; Mitra, Somak; Roqan, Iman S.; Ooi, Boon S.; He, Jr-Hau

    2017-01-01

    Hydrogen production via photoelectrochemical water-splitting is a key source of clean and sustainable energy. The use of one-dimensional nanostructures as photoelectrodes is desirable for photoelectrochemical water-splitting applications due to the ultralarge surface areas, lateral carrier extraction schemes, and superior light-harvesting capabilities. However, the unavoidable surface states of nanostructured materials create additional charge carrier trapping centers and energy barriers at the semiconductor-electrolyte interface, which severely reduce the solar-to-hydrogen conversion efficiency. In this work, we address the issue of surface states in GaN nanowire photoelectrodes by employing a simple and low-cost surface treatment method, which utilizes an organic thiol compound (i.e., 1,2-ethanedithiol). The surface-treated photocathode showed an enhanced photocurrent density of −31 mA/cm at −0.2 V versus RHE with an incident photon-to-current conversion efficiency of 18.3%, whereas untreated nanowires yielded only 8.1% efficiency. Furthermore, the surface passivation provides enhanced photoelectrochemical stability as surface-treated nanowires retained ∼80% of their initial photocurrent value and produced 8000 μmol of gas molecules over 55 h at acidic conditions (pH ∼ 0), whereas the untreated nanowires demonstrated only <4 h of photoelectrochemical stability. These findings shed new light on the importance of surface passivation of nanostructured photoelectrodes for photoelectrochemical applications.

  13. Surface Passivation of GaN Nanowires for Enhanced Photoelectrochemical Water-Splitting

    KAUST Repository

    Varadhan, Purushothaman

    2017-02-08

    Hydrogen production via photoelectrochemical water-splitting is a key source of clean and sustainable energy. The use of one-dimensional nanostructures as photoelectrodes is desirable for photoelectrochemical water-splitting applications due to the ultralarge surface areas, lateral carrier extraction schemes, and superior light-harvesting capabilities. However, the unavoidable surface states of nanostructured materials create additional charge carrier trapping centers and energy barriers at the semiconductor-electrolyte interface, which severely reduce the solar-to-hydrogen conversion efficiency. In this work, we address the issue of surface states in GaN nanowire photoelectrodes by employing a simple and low-cost surface treatment method, which utilizes an organic thiol compound (i.e., 1,2-ethanedithiol). The surface-treated photocathode showed an enhanced photocurrent density of −31 mA/cm at −0.2 V versus RHE with an incident photon-to-current conversion efficiency of 18.3%, whereas untreated nanowires yielded only 8.1% efficiency. Furthermore, the surface passivation provides enhanced photoelectrochemical stability as surface-treated nanowires retained ∼80% of their initial photocurrent value and produced 8000 μmol of gas molecules over 55 h at acidic conditions (pH ∼ 0), whereas the untreated nanowires demonstrated only <4 h of photoelectrochemical stability. These findings shed new light on the importance of surface passivation of nanostructured photoelectrodes for photoelectrochemical applications.

  14. Cell surface and gene expression regulation molecules in dystrophinopathy: mdx vs. Duchenne

    Directory of Open Access Journals (Sweden)

    RICARDO FADIC

    2005-01-01

    Full Text Available Duchenne muscular dystrophy (DMD is secondary to loss-of-function mutations in the dystrophin gene. The causes underlying the progression of DMD, differential muscle involvement, and the discrepancies in phenotypes among species with the same genetic defect are not understood. The mdx mouse, an animal model with dystrophin mutation, has a milder phenotype. This article reviews the available information on expression of signaling-related molecules in DMD and mdx. Extracellular matrix proteoglycans, growth factors, integrins, caveolin-3, and neuronal nitric oxide synthase expression do not show significant differences. Calcineurin is inconsistently activated in mdx, which is associated with lack of cardiomyopathy, compared to the permanent calcineurin activation in mdx/utrophin null mice that have a DMD-like cardiomyopathy. Levels of focal adhesion kinase (FAK and extracellular regulated kinases (ERKs differ among mdx and DMD. Further work is needed to identify the point of discrepancy in these signaling molecules' pathways in dystrophynopathies.

  15. Radiolysis of water in the vicinity of passive surfaces

    International Nuclear Information System (INIS)

    Moreau, S.; Fenart, M.; Renault, J.P.

    2014-01-01

    Highlights: • HO° production through water radiolysis is enhanced near metal surfaces. • Hastelloy and Stainless steel surfaces can also produce HO° radicals through hydrogen peroxide activation. • There is a deficit in solvated electron production compared to hydroxyl radicals near metal surfaces. - Abstract: Porous metals were used to describe the water radiolysis in the vicinity of metal surfaces. The hydroxyl radical production under gamma irradiation was measured by benzoate scavenging in water confined in a 200 nm porous Ni base alloy or in Stainless steel. The presence of the metallic surfaces changed drastically the HO° production level and lifetime. The solvated electron production was measured via glycylglycine scavenging for Stainless steel and was found to be significantly smaller than hydroxyl production. These observations imply that interfacial radiolysis may deeply impact the corrosion behavior of the SS and Ni based alloys

  16. Water evaporation from substrate tooth surface during dentin treatments.

    Science.gov (United States)

    Kusunoki, Mizuho; Itoh, Kazuo; Gokan, Yuka; Nagai, Yoshitaka; Tani, Chihiro; Hisamitsu, Hisashi

    2011-01-01

    The purpose of this study was to evaluate changes in the quantity of water evaporation from tooth surfaces. The amount of water evaporation was measured using Multi probe adapter MPA5 and Tewameter TM300 (Courage+Khazaka Electric GmbH, Köln, Germany) after acid etching and GM priming of enamel; and after EDTA conditioning and GM priming of dentin. The results indicated that the amount of water evaporation from the enamel surface was significantly less than that from the dentin. Acid etching did not affect the water evaporation from enamel, though GM priming significantly decreased the evaporation (83.48 ± 15.14% of that before priming). The evaporation from dentin was significantly increased by EDTA conditioning (131.38 ± 42.08% of that before conditioning) and significantly reduced by GM priming (80.26 ± 7.43% of that before priming). It was concluded that dentin priming reduced water evaporation from the dentin surface.

  17. Unique water-water coordination tailored by a metal surface

    DEFF Research Database (Denmark)

    Schiros, T.; Andersson, Klas Jerker; MacNaughton, J.

    2013-01-01

    (2006)]. Using x-ray absorption spectroscopy we find an anomalous low-energy resonance at ~533.1 eV which, based on density functional theory spectrum simulations, we assign to an unexpected configuration of water units whose uncoordinated O-H bonds directly face those of their neighbors...

  18. Inelastic transitions of atoms and molecules induced by van der Waals interaction with a surface

    International Nuclear Information System (INIS)

    Baudon, J.; Hamamda, M.; Boustimi, M.; Bocvarski, V.; Taillandier-Loize, T.; Dutier, G.; Perales, F.; Ducloy, M.

    2012-01-01

    Inelastic processes occuring in thermal-velocity metastable atoms and molecules passing at a mean distance (1–100 nm) are investigated. These processes are caused by the quadrupolar part of the van der Waals interaction: fine-structure transitions in atoms (Ar ∗ , Kr ∗ ), rovibrational transitions in N 2 ∗ ( 3 Σ u + ), transitions among magnetic sub-levels in the presence of a magnetic field.

  19. Coupling of carbon monoxide molecules over oxygen-defected UO2(111) single crystal and thin film surfaces.

    Science.gov (United States)

    Senanayake, S D; Waterhouse, G I N; Idriss, H; Madey, Theodore E

    2005-11-22

    While coupling reactions of carbon-containing compounds are numerous in organometallic chemistry, they are very rare on well-defined solid surfaces. In this work we show that the reductive coupling of two molecules of carbon monoxide to C2 compounds (acetylene and ethylene) could be achieved on oxygen-defected UO2(111) single crystal and thin film surfaces. This result allows in situ electron spectroscopic investigation of a typical organometallic reaction such as carbon coupling and extends it to heterogeneous catalysis and solids. By using high-resolution photoelectron spectroscopy (HRXPS) it was possible to track the changes in surface states of the U and O atoms as well as identify the intermediate of the reaction. Upon CO adsorption U cations in low oxidation states are oxidized to U4+ ions; this was accompanied by an increase of the O-to-U surface ratios. The HRXPS C 1s lines show the presence of adsorbed species assigned to diolate species (-OCH=CHO-) that are most likely the reaction intermediate in the coupling of two CO molecules to acetylene and ethylene.

  20. Coupling of Carbon Monoxide Molecules over Oxygen Defected UO2 (111) Single Crystal and Thin Film Surfaces

    International Nuclear Information System (INIS)

    Senanayake, S.; Waterhouse, G.; Idriss, H.; Madey, T.

    2005-01-01

    While coupling reactions of carbon-containing compounds are numerous in organometallic chemistry, they are very rare on well-defined solid surfaces. In this work we show that the reductive coupling of two molecules of carbon monoxide to C 2 compounds (acetylene and ethylene) could be achieved on oxygen-defected UO 2 (111) single crystal and thin film surfaces. This result allows in situ electron spectroscopic investigation of a typical organometallic reaction such as carbon coupling and extends it to heterogeneous catalysis and solids. By using high-resolution photoelectron spectroscopy (HRXPS) it was possible to track the changes in surface states of the U and O atoms as well as identify the intermediate of the reaction. Upon CO adsorption U cations in low oxidation states are oxidized to U 4+ ions; this was accompanied by an increase of the O-to-U surface ratios. The HRXPS C 1s lines show the presence of adsorbed species assigned to diolate species (-OCH=CHO-) that are most likely the reaction intermediate in the coupling of two CO molecules to acetylene and ethylene

  1. Tetrahedral cluster and pseudo molecule: New approaches to Calculate Absolute Surface Energy of Zinc Blende (111)/(-1-1-1) Surface

    Science.gov (United States)

    Zhang, Yiou; Zhang, Jingzhao; Tse, Kinfai; Wong, Lun; Chan, Chunkai; Deng, Bei; Zhu, Junyi

    Determining accurate absolute surface energies for polar surfaces of semiconductors has been a great challenge in decades. Here, we propose pseudo-hydrogen passivation to calculate them, using density functional theory approaches. By calculating the energy contribution from pseudo-hydrogen using either a pseudo molecule method or a tetrahedral cluster method, we obtained (111)/(-1-1-1) surfaces energies of Si, GaP, GaAs, and ZnS with high self-consistency. Our findings may greatly enhance the basic understandings of different surfaces and lead to novel strategies in the crystal growth. We would like to thank Su-huai Wei for helpful discussions. Computing resources were provided by the High Performance Cluster Computing Centre, Hong Kong Baptist University. This work was supported by the start-up funding and direct Grant with the Project.

  2. A Probabilistic Analysis of Surface Water Flood Risk in London.

    Science.gov (United States)

    Jenkins, Katie; Hall, Jim; Glenis, Vassilis; Kilsby, Chris

    2017-10-30

    Flooding in urban areas during heavy rainfall, often characterized by short duration and high-intensity events, is known as "surface water flooding." Analyzing surface water flood risk is complex as it requires understanding of biophysical and human factors, such as the localized scale and nature of heavy precipitation events, characteristics of the urban area affected (including detailed topography and drainage networks), and the spatial distribution of economic and social vulnerability. Climate change is recognized as having the potential to enhance the intensity and frequency of heavy rainfall events. This study develops a methodology to link high spatial resolution probabilistic projections of hourly precipitation with detailed surface water flood depth maps and characterization of urban vulnerability to estimate surface water flood risk. It incorporates probabilistic information on the range of uncertainties in future precipitation in a changing climate. The method is applied to a case study of Greater London and highlights that both the frequency and spatial extent of surface water flood events are set to increase under future climate change. The expected annual damage from surface water flooding is estimated to be to be £171 million, £343 million, and £390 million/year under the baseline, 2030 high, and 2050 high climate change scenarios, respectively. © 2017 Society for Risk Analysis.

  3. Chlorine stress mediates microbial surface attachment in drinking water systems.

    Science.gov (United States)

    Liu, Li; Le, Yang; Jin, Juliang; Zhou, Yuliang; Chen, Guowei

    2015-03-01

    Microbial attachment to drinking water pipe surfaces facilitates pathogen survival and deteriorates disinfection performance, directly threatening the safety of drinking water. Notwithstanding that the formation of biofilm has been studied for decades, the underlying mechanisms for the origins of microbial surface attachment in biofilm development in drinking water pipelines remain largely elusive. We combined experimental and mathematical methods to investigate the role of environmental stress-mediated cell motility on microbial surface attachment in chlorination-stressed drinking water distribution systems. Results show that at low levels of disinfectant (0.0-1.0 mg/L), the presence of chlorine promotes initiation of microbial surface attachment, while higher amounts of disinfectant (>1.0 mg/L) inhibit microbial attachment. The proposed mathematical model further demonstrates that chlorination stress (0.0-5.0 mg/L)-mediated microbial cell motility regulates the frequency of cell-wall collision and thereby controls initial microbial surface attachment. The results reveal that transport processes and decay patterns of chlorine in drinking water pipelines regulate microbial cell motility and, thus, control initial surface cell attachment. It provides a mechanistic understanding of microbial attachment shaped by environmental disinfection stress and leads to new insights into microbial safety protocols in water distribution systems.

  4. Single-molecule resolution of protein dynamics on polymeric membrane surfaces: the roles of spatial and population heterogeneity.

    Science.gov (United States)

    Langdon, Blake B; Mirhossaini, Roya B; Mabry, Joshua N; Sriram, Indira; Lajmi, Ajay; Zhang, Yanxia; Rojas, Orlando J; Schwartz, Daniel K

    2015-02-18

    Although polymeric membranes are widely used in the purification of protein pharmaceuticals, interactions between biomolecules and membrane surfaces can lead to reduced membrane performance and damage to the product. In this study, single-molecule fluorescence microscopy provided direct observation of bovine serum albumin (BSA) and human monoclonal antibody (IgG) dynamics at the interface between aqueous buffer and polymeric membrane materials including regenerated cellulose and unmodified poly(ether sulfone) (PES) blended with either polyvinylpyrrolidone (PVP), polyvinyl acetate-co-polyvinylpyrrolidone (PVAc-PVP), or polyethylene glycol methacrylate (PEGM) before casting. These polymer surfaces were compared with model surfaces composed of hydrophilic bare fused silica and hydrophobic trimethylsilane-coated fused silica. At extremely dilute protein concentrations (10(-3)-10(-7) mg/mL), protein surface exchange was highly dynamic with protein monomers desorbing from the surface within ∼1 s after adsorption. Protein oligomers (e.g., nonspecific dimers, trimers, or larger aggregates), although less common, remained on the surface for 5 times longer than monomers. Using newly developed super-resolution methods, we could localize adsorption sites with ∼50 nm resolution and quantify the spatial heterogeneity of the various surfaces. On a small anomalous subset of the adsorption sites, proteins adsorbed preferentially and tended to reside for significantly longer times (i.e., on "strong" sites). Proteins resided for shorter times overall on surfaces that were more homogeneous and exhibited fewer strong sites (e.g., PVAc-PVP/PES). We propose that strong surface sites may nucleate protein aggregation, initiated preferentially by protein oligomers, and accelerate ultrafiltration membrane fouling. At high protein concentrations (0.3-1.0 mg/mL), fewer strong adsorption sites were observed, and surface residence times were reduced. This suggests that at high concentrations

  5. Anomalous diffusion of water molecules at grain boundaries in ice Ih.

    Science.gov (United States)

    Moreira, Pedro Augusto Franco Pinheiro; Veiga, Roberto Gomes de Aguiar; Ribeiro, Ingrid de Almeida; Freitas, Rodrigo; Helfferich, Julian; de Koning, Maurice

    2018-05-23

    Using ab initio and classical molecular dynamics simulations, we study pre-melting phenomena in pristine coincident-site-lattice grain boundaries (GBs) in proton-disordered hexagonal ice Ih at temperatures just below the melting point Tm. Concerning pre-melt-layer thicknesses, the results are consistent with the available experimental estimates for low-disorder impurity-free GBs. With regard to molecular mobility, the simulations provide a key new insight: the translational motion of the water molecules is found to be subdiffusive for time scales from ∼10 ns up to at least 0.1 μs. Moreover, the fact that the anomalous diffusion occurs even at temperatures just below Tm where the bulk supercooled liquid still diffuses normally suggests that it is related to the confinement of the GB pre-melt layers by the surrounding crystalline environment. Furthermore, we show that this behavior can be characterized by continuous-time random walk models in which the waiting-time distributions decay according to power-laws that are very similar to those describing dynamics in glass-forming systems.

  6. Intercalated Water and Organic Molecules for Electrode Materials of Rechargeable Batteries.

    Science.gov (United States)

    Lee, Hyeon Jeong; Shin, Jaeho; Choi, Jang Wook

    2018-03-24

    The intrinsic limitations of lithium-ion batteries (LIBs) with regard to safety, cost, and the availability of raw materials have promoted research on so-called "post-LIBs". The recent intense research of post-LIBs provides an invaluable lesson that existing electrode materials used in LIBs may not perform as well in post-LIBs, calling for new material designs compliant with emerging batteries based on new chemistries. One promising approach in this direction is the development of materials with intercalated water or organic molecules, as these materials demonstrate superior electrochemical performance in emerging battery systems. The enlarged ionic channel dimensions and effective shielding of the electrostatic interaction between carrier ions and the lattice host are the origins of the observed electrochemical performance. Moreover, these intercalants serve as interlayer pillars to sustain the framework for prolonged cycles. Representative examples of such intercalated materials applied to batteries based on Li + , Na + , Mg 2+ , and Zn 2+ ions and supercapacitors are considered, along with their impact in materials research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. NO Exchange for a Water Molecule Favorably Changes Iontophoretic Release of Ruthenium Complexes to the Skin

    Directory of Open Access Journals (Sweden)

    Danielle C. A. S. de Santana

    2017-01-01

    Full Text Available Ruthenium (Ru complexes have been studied as promising anticancer agents. Ru nitrosyl complex (Ru-NO is one which acts as a pro-drug for the release of nitric oxide (NO. The Ru-aqueous complex formed by the exchange of NO for a water molecule after NO release could also possess therapeutic effects. This study evaluates the influence of iontophoresis on enhancing the skin penetration of Ru-NO and Ru-aqueous and assesses its applicability as a tool in treating diverse skin diseases. Passive and iontophoretic (0.5 mA·cm−2 skin permeation of the complexes were performed for 4 h. The amount of Ru and NO in the stratum corneum (SC, viable epidermis (VE, and receptor solution was quantified while the influence of iontophoresis and irradiation on NO release from Ru-NO complex was also evaluated. Iontophoresis increased the amount of Ru-NO and Ru-aqueous recovered from the receptor solution by 15 and 400 times, respectively, as compared to passive permeation. Iontophoresis produced a higher accumulation of Ru-aqueous in the skin layers as compared to Ru-NO. At least 50% of Ru-NO penetrated the SC was stable after 4 h. The presence of Ru-NO in this skin layer suggests that further controlled release of NO can be achieved by photo-stimulation after iontophoresis.

  8. Impact of industrial effluents on surface waters

    International Nuclear Information System (INIS)

    Ahmed, K.

    2000-01-01

    The indiscriminate discharge of untreated municipal and industrial effluents has given rise to serious problems of water pollution and human health in Pakistan. The City of Lahore discharges about 365 mgd of wastewater with a BOD load of 250 tons per day, without treatment, into Ravi river. Because of the untreated industrial discharges, river Ravi is devoid of dissolved oxygen through most of its react between Lahore and Upper Chenab Canal under low flow conditions. Pollution levels can be controlled if each industry treats its own wastewater prior to disposal, in accordance with NEQS (Pakistan). (author)

  9. Recovery from acidification in European surface waters

    Czech Academy of Sciences Publication Activity Database

    Evans, C. D.; Cullen, J. M.; Alewell, C.; Kopáček, Jiří; Marchetto, A.; Moldan, F.; Prechtel, A.; Rogora, M.; Veselý, J.; Wright, R.

    2001-01-01

    Roč. 5, č. 3 (2001), s. 283-297 ISSN 1027-5606 R&D Projects: GA ČR GA206/00/0063 Grant - others:CEC RECOVER(XE) 2010 EVK1-CT-1999-00018; GMER(DE) PT BEO 51-0339476; UKDETR(GB) EPG1/3/92; NNP(NO) SFT2000; CEC(XE) EMERGE EVK1-CT-1999-00032 Keywords : acidification * recovery * sulphate Subject RIV: DJ - Water Pollution ; Quality Impact factor: 1.127, year: 2001

  10. Recovery of acidified European surface waters

    Czech Academy of Sciences Publication Activity Database

    Wright, R. F.; Larssen, T.; Camarero, L.; Cosby, B. J.; Ferrier, R. C.; Helliwell, R.; Forsius, M.; Jenkins, A.; Kopáček, Jiří; Majer, V.; Moldan, F.; Posch, M.; Rogora, M.; Schöpp, W.

    2005-01-01

    Roč. 39, č. 3 (2005), 64A-72A ISSN 0013-936X. [ Acid Rain 2005. International Conference on Acid Deposition /7./. Prague, 12.06.2005-17.06.2005] Grant - others:EC(XE) EMERGE EVK1-CT-1999-00032; EC(XE) RECOVER:2010 EVK1-CT-1999-00018; DEFRA(GB) EPG 1/3/194; ICST(ES) REN2000-0889/GLO Institutional research plan: CEZ:AV0Z60170517 Keywords : acid ification * recovery * European lake districts Subject RIV: DJ - Water Pollution ; Quality Impact factor: 4.054, year: 2005

  11. Adsorption of surface functionalized silica nanoparticles onto mineral surfaces and decane/water interface

    International Nuclear Information System (INIS)

    Metin, Cigdem O.; Baran, Jimmie R.; Nguyen, Quoc P.

    2012-01-01

    The adsorption of silica nanoparticles onto representative mineral surfaces and at the decane/water interface was studied. The effects of particle size (the mean diameters from 5 to 75 nm), concentration and surface type on the adsorption were studied in detail. Silica nanoparticles with four different surfaces [unmodified, surface modified with anionic (sulfonate), cationic (quaternary ammonium (quat)) or nonionic (polyethylene glycol (PEG)) surfactant] were used. The zeta potential of these silica nanoparticles ranges from −79.8 to 15.3 mV. The shape of silica particles examined by a Hitachi-S5500 scanning transmission electron microscope (STEM) is quite spherical. The adsorption of all the nanoparticles (unmodified or surface modified) on quartz and calcite surfaces was found to be insignificant. We used interfacial tension (IFT) measurements to investigate the adsorption of silica nanoparticles at the decane/water interface. Unmodified nanoparticles or surface modified ones with sulfonate or quat do not significantly affect the IFT of the decane/water interface. It also does not appear that the particle size or concentration influences the IFT. However, the presence of PEG as a surface modifying material significantly reduces the IFT. The PEG surface modifier alone in an aqueous solution, without the nanoparticles, yields the same IFT reduction for an equivalent PEG concentration as that used for modifying the surface of nanoparticles. Contact angle measurements of a decane droplet on quartz or calcite plate immersed in water (or aqueous nanoparticle dispersion) showed a slight change in the contact angle in the presence of the studied nanoparticles. The results of contact angle measurements are in good agreement with experiments of adsorption of nanoparticles on mineral surfaces or decane/water interface. This study brings new insights into the understanding and modeling of the adsorption of surface-modified silica nanoparticles onto mineral surfaces and

  12. Investigating the Interaction of Water Vapour with Aminopropyl Groups on the Surface of Mesoporous Silica Nanoparticles.

    Science.gov (United States)

    Paul, Geo; Musso, Giorgia Elena; Bottinelli, Emanuela; Cossi, Maurizio; Marchese, Leonardo; Berlier, Gloria

    2017-04-05

    The interaction of water molecules with the surface of hybrid silica-based mesoporous materials is studied by 29 Si, 1 H and 13 C solid-state NMR and IR spectroscopy, with the support of ab initio calculations. The surface of aminopropyl-grafted mesoporous silica nanoparticles is studied in the dehydrated state and upon interaction with controlled doses of water vapour. Former investigations described the interactions between aminopropyl and residual SiOH groups; the present study shows the presence of hydrogen-bonded species (SiOH to NH 2 ) and weakly interacting "free" aminopropyl chains with restricted mobility, together with a small amount of protonated NH 3 + groups. The concentration of the last-named species increased upon interaction with water, and this indicates reversible and fast proton exchange from water molecules to a fraction of the amino groups. Herein, this is discussed and explained for the first time, by a combination of experimental and theoretical approaches. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. In-Situ Measurement of Chirality of Molecules and Molecular Assemblies with Surface Nonlinear Spectroscopy

    International Nuclear Information System (INIS)

    Wang, Hongfei

    2012-01-01

    Developments in quantitative measurement and analysis in nonlinear surface spectroscopy, namely, second harmonic generation linear dichroism (SHG-LD) and sum frequency generation vibrational spectroscopy linear dichroism (SFG-VS-LD), provide new opportunities for probing the surface chirality of monolayers and thin films. In this book chapter, the up-to-date theoretical background and experimental methodology, as well as examples and future perspectives on the developments with surface nonlinear spectroscopy in surface chirality studies are to be summarized and outlined for general readers.

  14. High Surface Area of Porous Silicon Drives Desorption of Intact Molecules

    Science.gov (United States)

    Northen, Trent R.; Woo, Hin-Koon; Northen, Michael T.; Nordström, Anders; Uritboonthail, Winnie; Turner, Kimberly L.; Siuzdak, Gary

    2007-01-01

    The surface structure of porous silicon used in desorption/ionization on porous silicon (DIOS) mass analysis is known to play a primary role in the desorption/ionization (D/I) process. In this study, mass spectrometry and scanning electron microscopy (SEM) are used to examine the correlation between intact ion generation with surface ablation, and surface morphology. The DIOS process is found to be highly laser energy dependent and correlates directly with the appearance of surface ions (Sin+ and OSiH+). A threshold laser energy for DIOS is observed (10 mJ/cm2), which supports that DIOS is driven by surface restructuring and is not a strictly thermal process. In addition, three DIOS regimes are observed which correspond to surface restructuring and melting. These results suggest that higher surface area silicon substrates may enhance DIOS performance. A recent example which fits into this mechanism is silicon nanowires surface which have a high surface energy and concomitantly requires lower laser energy for analyte desorpton. PMID:17881245

  15. Methods on estimation of the evaporation from water surface

    International Nuclear Information System (INIS)

    Trajanovska, Lidija; Tanushevska, Dushanka; Aleksovska, Nina

    2001-01-01

    The whole world water supply on the Earth is in close dependence on hydrological cycle connected with water circulation at Earth-Atmosphere route through evaporation, precipitation and water runoff. Evaporation exists worldwide where the atmosphere is unsatiated of water steam (when there is humidity in short supply) and it depends on climatic conditions in some regions. The purpose of this paper is to determine a method for estimation of evaporation of natural water surface in our areas, that means its determination as exact as possible. (Original)

  16. Dynamics of ice nucleation on water repellent surfaces.

    Science.gov (United States)

    Alizadeh, Azar; Yamada, Masako; Li, Ri; Shang, Wen; Otta, Shourya; Zhong, Sheng; Ge, Liehui; Dhinojwala, Ali; Conway, Ken R; Bahadur, Vaibhav; Vinciquerra, A Joseph; Stephens, Brian; Blohm, Margaret L

    2012-02-14

    Prevention of ice accretion and adhesion on surfaces is relevant to many applications, leading to improved operation safety, increased energy efficiency, and cost reduction. Development of passive nonicing coatings is highly desirable, since current antiicing strategies are energy and cost intensive. Superhydrophobicity has been proposed as a lead passive nonicing strategy, yet the exact mechanism of delayed icing on these surfaces is not clearly understood. In this work, we present an in-depth analysis of ice formation dynamics upon water droplet impact on surfaces with different wettabilities. We experimentally demonstrate that ice nucleation under low-humidity conditions can be delayed through control of surface chemistry and texture. Combining infrared (IR) thermometry and high-speed photography, we observe that the reduction of water-surface contact area on superhydrophobic surfaces plays a dual role in delaying nucleation: first by reducing heat transfer and second by reducing the probability of heterogeneous nucleation at the water-substrate interface. This work also includes an analysis (based on classical nucleation theory) to estimate various homogeneous and heterogeneous nucleation rates in icing situations. The key finding is that ice nucleation delay on superhydrophobic surfaces is more prominent at moderate degrees of supercooling, while closer to the homogeneous nucleation temperature, bulk and air-water interface nucleation effects become equally important. The study presented here offers a comprehensive perspective on the efficacy of textured surfaces for nonicing applications.

  17. Bayesian optimization for constructing potential energy surfaces of polyatomic molecules with the smallest number of ab initio calculations

    Science.gov (United States)

    Vargas-Hernandez, Rodrigo A.; v Krems, Roman

    2017-04-01

    We examine the application of kernel methods of machine learning for constructing potential energy surfaces (PES) of polyatomic molecules. In particular, we illustrate the application of Bayesian optimization with Gaussian processes as an efficient method for sampling the configuration space of polyatomic molecules. Bayesian optimization relies on two key components: a prior over an objective function and a mechanism for sampling the configuration space. We use Gaussian processes to model the objective function and various acquisition functions commonly used in computer science to quantify the accuracy of sampling. The PES is obtained through an iterative process of adding ab initio points at the locations maximizing the acquisition function and re-trainig the Gaussian process with new points added. We sample different PESs with one or many acquisition functions and show how the acquisition functions affect the construction of the PESs.

  18. On the widths of Stokes lines in Raman scattering from molecules adsorbed at metal surfaces and in molecular conduction junctions

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yi, E-mail: yig057@ucsd.edu; Galperin, Michael, E-mail: migalperin@ucsd.edu [Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, California 92093 (United States); Nitzan, Abraham, E-mail: nitzan@post.tau.ac.il [Department of Chemistry, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA and School of Chemistry, Tel Aviv University, Tel Aviv 69978 (Israel)

    2016-06-28

    Within a generic model we analyze the Stokes linewidth in surface enhanced Raman scattering (SERS) from molecules embedded as bridges in molecular junctions. We identify four main contributions to the off-resonant Stokes signal and show that under zero voltage bias (a situation pertaining also to standard SERS experiments) and at low bias junctions only one of these contributions is pronounced. The linewidth of this component is determined by the molecular vibrational relaxation rate, which is dominated by interactions with the essentially bosonic thermal environment when the relevant molecular electronic energy is far from the metal(s) Fermi energy(ies). It increases when the molecular electronic level is close to the metal Fermi level so that an additional vibrational relaxation channel due to electron-hole (eh) exciton in the molecule opens. Other contributions to the Raman signal, of considerably broader linewidths, can become important at larger junction bias.

  19. How to repel hot water from a superhydrophobic surface?

    KAUST Repository

    Yu, Zhejun; Yang, Jieyi; Wan, Fang; Ge, Quan; Yang, Longlai; Ding, Zunliang; Yang, Dequan; Sacher, Edward R.; Isimjan, Tayirjan T.

    2014-01-01

    Superhydrophobic surfaces, with water contact angles greater than 150° and slide angles less than 10°, have attracted a great deal of attention due to their self-cleaning ability and excellent water-repellency. It is commonly accepted that a

  20. Heavy Metals Pollution on Surface Water Sources in Kaduna ...

    African Journals Online (AJOL)

    This study examine the effects of heavy metal pollutants to aquatic ecosystems and the environment by considering the role of urban, municipal, agricultural, industrial and other anthropogenic processes as sources of heavy metal pollution in surface water sources of Kaduna metropolis. Samples of the polluted water were ...

  1. Pesticides distribution in surface waters and sediments of lotic and ...

    African Journals Online (AJOL)

    An investigation on the availability and distribution of Lindane (HCHs) and Total organochlorine phosphate (TOCP) in the surface waters and sediments of selected water bodies in Agbede wetlands was carried out from December, 2012 to May, 2014 in order to cover seasonal trends in both matrixes. A Gas Chromatograph ...

  2. Macro-invertebrate decline in surface water polluted with imidacloprid

    NARCIS (Netherlands)

    van Dijk, T.; van Staalduinen, M.A.; van der Sluijs, J.P.|info:eu-repo/dai/nl/073427489

    Imidacloprid is one of the most widely used insecticides in the world. Its concentration in surface water exceeds the water quality norms in many parts of the Netherlands. Several studies have demonstrated harmful effects of this neonicotinoid to a wide range of non-target species. Therefore we

  3. Maleimide-activated aryl diazonium salts for electrode surface functionalization with biological and redox-active molecules.

    Science.gov (United States)

    Harper, Jason C; Polsky, Ronen; Wheeler, David R; Brozik, Susan M

    2008-03-04

    A versatile and simple method is introduced for formation of maleimide-functionalized surfaces using maleimide-activated aryl diazonium salts. We show for the first time electrodeposition of N-(4-diazophenyl)maleimide tetrafluoroborate on gold and carbon electrodes which was characterized via voltammetry, grazing angle FTIR, and ellipsometry. Electrodeposition conditions were used to control film thickness and yielded submonolayer-to-multilayer grafting. The resulting phenylmaleimide surfaces served as effective coupling agents for electrode functionalization with ferrocene and the redox-active protein cytochrome c. The utility of phenylmaleimide diazonium toward formation of a diazonium-activated conjugate, followed by direct electrodeposition of the diazonium-modified DNA onto the electrode surface, was also demonstrated. Effective electron transfer was obtained between immobilized molecules and the electrodes. This novel application of N-phenylmaleimide diazonium may facilitate the development of bioelectronic devices including biofuel cells, biosensors, and DNA and protein microarrays.

  4. Cloning and expression of the receptor for human urokinase plasminogen activator, a central molecule in cell surface, plasmin dependent proteolysis

    DEFF Research Database (Denmark)

    Roldan, A.L.; Cubellis, M.V.; Masucci, M.T.

    1990-01-01

    , and therefore the capacity of cells to migrate and invade neighboring tissues. We have isolated a 1.4 kb cDNA clone coding for the entire human uPAR. An oligonucleotide synthesized on the basis of the N-terminal sequence of the purified protein was used to screen a cDNA library made from SV40 transformed human......, a size very close to that of the cloned cDNA. Expression of the uPAR cDNA in mouse cells confirms that the clone is complete and expresses a functional uPA binding protein, located on the cell surface and with properties similar to the human uPAR. Caseinolytic plaque assay, immunofluorescence analysis......The surface receptor for urokinase plasminogen activator (uPAR) has been recognized in recent years as a key molecule in regulating plasminogen mediated extracellular proteolysis. Surface plasminogen activation controls the connections between cells, basement membrane and extracellular matrix...

  5. Rapid surface-water volume estimations in beaver ponds

    Science.gov (United States)

    Karran, Daniel J.; Westbrook, Cherie J.; Wheaton, Joseph M.; Johnston, Carol A.; Bedard-Haughn, Angela

    2017-02-01

    Beaver ponds are surface-water features that are transient through space and time. Such qualities complicate the inclusion of beaver ponds in local and regional water balances, and in hydrological models, as reliable estimates of surface-water storage are difficult to acquire without time- and labour-intensive topographic surveys. A simpler approach to overcome this challenge is needed, given the abundance of the beaver ponds in North America, Eurasia, and southern South America. We investigated whether simple morphometric characteristics derived from readily available aerial imagery or quickly measured field attributes of beaver ponds can be used to approximate surface-water storage among the range of environmental settings in which beaver ponds are found. Studied were a total of 40 beaver ponds from four different sites in North and South America. The simplified volume-area-depth (V-A-h) approach, originally developed for prairie potholes, was tested. With only two measurements of pond depth and corresponding surface area, this method estimated surface-water storage in beaver ponds within 5 % on average. Beaver pond morphometry was characterized by a median basin coefficient of 0.91, and dam length and pond surface area were strongly correlated with beaver pond storage capacity, regardless of geographic setting. These attributes provide a means for coarsely estimating surface-water storage capacity in beaver ponds. Overall, this research demonstrates that reliable estimates of surface-water storage in beaver ponds only requires simple measurements derived from aerial imagery and/or brief visits to the field. Future research efforts should be directed at incorporating these simple methods into both broader beaver-related tools and catchment-scale hydrological models.

  6. An Ontology Design Pattern for Surface Water Features

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, Gaurav [Ohio University; Mark, David [University at Buffalo (SUNY); Kolas, Dave [Raytheon BBN Technologies; Varanka, Dalia [U.S. Geological Survey, Rolla, MO; Romero, Boleslo E [University of California, Santa Barbara; Feng, Chen-Chieh [National University of Singapore; Usery, Lynn [U.S. Geological Survey, Rolla, MO; Liebermann, Joshua [Tumbling Walls, LLC; Sorokine, Alexandre [ORNL

    2014-01-01

    Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities can be found due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology. It can then be used to systematically incor-porate concepts that are specific to a culture, language, or scientific domain. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex surface water ontologies. A fundamental distinction is made in this on-tology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is imple-mented in OWL, but Description Logic axioms and a detailed explanation is provided. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. A discussion about why there is a need to complement the pattern with other ontologies, es-pecially the previously developed Surface Network pattern is also provided. Fi-nally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through a few queries and annotated geospatial datasets.

  7. Nonzero Ideal Gas Contribution to the Surface Tension of Water.

    Science.gov (United States)

    Sega, Marcello; Fábián, Balázs; Jedlovszky, Pál

    2017-06-15

    Surface tension, the tendency of fluid interfaces to behave elastically and minimize their surface, is routinely calculated as the difference between the lateral and normal components of the pressure or, invoking isotropy in momentum space, of the virial tensor. Here we show that the anisotropy of the kinetic energy tensor close to a liquid-vapor interface can be responsible for a large part of its surface tension (about 15% for water, independent from temperature).

  8. Practical aspects of tritium measurement in ground and surface waters

    Energy Technology Data Exchange (ETDEWEB)

    Nitzsche, O [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Angewandte Physik; Hebert, D [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Angewandte Physik

    1997-03-01

    Tritium measurements are a powerful tool in hydrological and hydrogeological investigations for detecting mean residence times of several water reservoirs. Due to the low tritium activities in precipitation, ground and surface waters a low level measurement is necessary. Therefore often the liquid scintillation counting after an electrolytic enrichment of water is used. In this paper some practical aspects and problems of measurement are discussed and the problem of contamination in low level laboratories is shown. (orig.)

  9. Influence of Road Surface Microtexture on Thin Water Film Traction

    OpenAIRE

    BEAUTRU , Yannick; Kane , Malal; Do , Minh Tan; Cerezo , Véronique

    2012-01-01

    This paper deals with the contribution of road surface microtexture to the relationship between tire/road friction and water depth. The main objectives are the estimation of local water depths trapped at the tire/road interface and the definition of a critical water depth which can be used for driver assistance and information systems. Tests are performed in laboratory. Specimens are slabs made of asphalt concrete and mosaics composed of coarse aggregates. The aggregate mosaics are sandblaste...

  10. Decomposition of SnH{sub 4} molecules on metal and metal–oxide surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Ugur, D. [TNO, Stieltjesweg 1, 2628 CK Delft (Netherlands); Delft University of Technology, Department of Materials Science and Engineering, Mekelweg 2, 2628 CD Delft (Netherlands); Storm, A.J.; Verberk, R. [TNO, Stieltjesweg 1, 2628 CK Delft (Netherlands); Brouwer, J.C. [Delft University of Technology, Department of Materials Science and Engineering, Mekelweg 2, 2628 CD Delft (Netherlands); Sloof, W.G., E-mail: w.g.sloof@tudelft.nl [Delft University of Technology, Department of Materials Science and Engineering, Mekelweg 2, 2628 CD Delft (Netherlands)

    2014-01-01

    Atomic hydrogen cleaning is a promising method for EUV lithography systems, to recover from surface oxidation and to remove carbon and tin contaminants. Earlier studies showed, however, that tin may redeposit on nearby surfaces due to SnH{sub 4} decomposition. This phenomenon of SnH{sub 4} decomposition during tin cleaning has been quantified for various metallic and metal-oxide surfaces using X-ray photoelectron spectroscopy (XPS). It was observed that the metal oxide surfaces (TiO{sub 2} and ZrO{sub 2}) were significantly less contaminated than metallic surfaces. Tin contamination due to SnH{sub 4} decomposition can thus be reduced or even mitigated by application of a suitable metal-oxide coating.

  11. Water slip and friction at a solid surface

    Energy Technology Data Exchange (ETDEWEB)

    Brigo, L; Pierno, M; Mammano, F; Sada, C; Fois, G; Pozzato, A; Zilio, S dal; Mistura, G [Dipartimento di Fisica G Galilei, Universita degli Studi di Padova, via Marzolo 8, 35131 Padova (Italy); Natali, M [Istituto di Chimica Inorganica e delle Superfici (ICIS), CNR, Corso Stati Uniti 4, 35127 Padova (Italy); Tormen, M [TASC-INFM, CNR, S S 14 km 163.5 Area Science Park, 34012 Basovizza, Trieste (Italy)], E-mail: mistura@padova.infm.it

    2008-09-03

    A versatile micro-particle imaging velocimetry ({mu}-PIV) recording system is described, which allows us to make fluid velocity measurements in a wide range of flow conditions both inside microchannels and at liquid-solid interfaces by using epifluorescence and total internal reflection fluorescence excitation. This set-up has been applied to study the slippage of water over flat surfaces characterized by different degrees of hydrophobicity and the effects that a grooved surface has on the fluid flow inside a microchannel. Preliminary measurements of the slip length of water past various flat surfaces show no significant dependence on the contact angle.

  12. Stormwater Priority Pollutants Versus Surface Water Quality Criteria

    DEFF Research Database (Denmark)

    Eriksson, Eva; Ledin, Anna; Baun, Anders

    2011-01-01

    Stormwater in urban areas comprises of a substantial part of the urban water cycle, dominating the flow in many small urban streams, and the pollution levels are sizeable. No stormwater quality criteria were found here and no European or national emission limit values exist. Stormwater pollutants...... however are present in levels exceeding most of the regulated surface water quality criteria and environmental quality standards. Therefore catchment characterisation is needed to chose suitable treatment prior to discharge into receiving surface waters, as the mixing may be insufficient in small streams....

  13. Context of surveillance of underground and surface waters

    International Nuclear Information System (INIS)

    2010-01-01

    This document briefly describes the evolutions of regulations on site liquid effluents and of guideline values concerning radioactive wastes, briefly presents the surveillance of underground and surface waters of CEA sites, comments the guideline values of the radiological quality of waters aimed at human consumption, and gives an overview of information which are brought to public's attention. Then, for different CEA sites (Cadarache, Marcoule, Saclay, Grenoble, Fontenay-aux-Roses, Valduc, DIF), this document proposes a presentation of the hydrological context, regulatory context, the surface and underground water surveillance process and values, the storing zones of old wastes

  14. Surface Passivation of GaN Nanowires for Enhanced Photoelectrochemical Water-Splitting.

    Science.gov (United States)

    Varadhan, Purushothaman; Fu, Hui-Chun; Priante, Davide; Retamal, Jose Ramon Duran; Zhao, Chao; Ebaid, Mohamed; Ng, Tien Khee; Ajia, Idirs; Mitra, Somak; Roqan, Iman S; Ooi, Boon S; He, Jr-Hau

    2017-03-08

    Hydrogen production via photoelectrochemical water-splitting is a key source of clean and sustainable energy. The use of one-dimensional nanostructures as photoelectrodes is desirable for photoelectrochemical water-splitting applications due to the ultralarge surface areas, lateral carrier extraction schemes, and superior light-harvesting capabilities. However, the unavoidable surface states of nanostructured materials create additional charge carrier trapping centers and energy barriers at the semiconductor-electrolyte interface, which severely reduce the solar-to-hydrogen conversion efficiency. In this work, we address the issue of surface states in GaN nanowire photoelectrodes by employing a simple and low-cost surface treatment method, which utilizes an organic thiol compound (i.e., 1,2-ethanedithiol). The surface-treated photocathode showed an enhanced photocurrent density of -31 mA/cm 2 at -0.2 V versus RHE with an incident photon-to-current conversion efficiency of 18.3%, whereas untreated nanowires yielded only 8.1% efficiency. Furthermore, the surface passivation provides enhanced photoelectrochemical stability as surface-treated nanowires retained ∼80% of their initial photocurrent value and produced 8000 μmol of gas molecules over 55 h at acidic conditions (pH ∼ 0), whereas the untreated nanowires demonstrated only passivation of nanostructured photoelectrodes for photoelectrochemical applications.

  15. Robust superhydrophobic surface by nature-inspired polyphenol chemistry for effective oil-water separation

    Science.gov (United States)

    Bu, Yiming; Huang, Jingjing; Zhang, Shiyu; Wang, Yinghua; Gu, Shaojin; Cao, Genyang; Yang, Hongjun; Ye, Dezhan; Zhou, Yingshan; Xu, Weilin

    2018-05-01

    With the ever-increasing oil spillages, oil-water separation has attracted widespread concern in recent years. In this work, a nature-inspired polyphenol method has been developed to fabricate the durable superhydrophobic surfaces for the oil-water separation. Inspiring from the adhesion of polyphenol and reducing capacity of free catechol/pyrogallol groups in polyphenol, firstly, the simple immersion of commercial materials (melamine sponge, PET, and nonwoven cotton fabrics) in tannic acid (TA) solution allows to form a multifunctional coating on the surface of sponge or fabrics, which was used as reducing reagent to generate Ag nanoparticles (NPs). Then, decoration of 1H, 1H, 2H, 2H-perfluorodecanethiol (PFDT) molecules produced superhydrophobic surfaces. The surface topological structure, chemical composition, and superhydrophobic property of the as-prepared surface are characterized by scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), energy dispersive spectroscopy (EDS), and water contact angle (WCA) measurements. The WCAs of as-prepared sponge and fabrics were higher than 150°. The stability, absorption capacity, and recyclability of as-prepared sponge and fabrics were investigated. The as-prepared sponge demonstrates high oil/water selectivity and high absorption capacity (66-150 g/g) for a broad variety of oils and organic solvents, and was chemically resistant, robust against abrasion, and long-term durability in harsh environments. Most important of all, it can continuously separate various kinds of oils or organic pollutants from the surface of water. This study presents a facile strategy to fabricate superhydrophobic materials for continuous oil-water separation, displaying great potential in large-scale practical application.

  16. Interaction of SO2 with the Surface of a Water Nanodroplet.

    Science.gov (United States)

    Zhong, Jie; Zhu, Chongqin; Li, Lei; Richmond, Geraldine L; Francisco, Joseph S; Zeng, Xiao Cheng

    2017-11-29

    We present a comprehensive computational study of interaction of a SO 2 with water molecules in the gas phase and with the surface of various sized water nanodroplets to investigate the solvation behavior of SO 2 in different atmospheric environments. Born-Oppenheimer molecular dynamics (BOMD) simulation shows that, in the gas phase and at a temperature of 300 K, the dominant interaction between SO 2 and H 2 O is (SO 2 ) S···O (H 2 O) , consistent with previous density-functional theory (DFT) computation at 0 K. However, at the surface of a water nanodroplet, BOMD simulation shows that the hydrogen-bonding interaction of (SO 2 ) O···H (H 2 O) becomes increasingly important with the increase of droplet size, reflecting a marked effect of the water surface on the SO 2 solvation. This conclusion is in good accordance with spectroscopy evidence obtained previously (J. Am. Chem. Soc. 2005, 127, 16806; J. Am. Chem. Soc. 2006, 128, 3256). The prevailing interaction (SO 2 ) O···H (H 2 O) on a large droplet is mainly due to favorable exposure of H atoms of H 2 O at the air-water interface. Indeed, the conversion of the dominant interaction in the gas phase (SO 2 ) S···O (H 2 O) to the dominant interaction on the water nanodroplet (SO 2 ) O···H (H 2 O) may incur effects on the SO 2 chemistry in atmospheric aerosols because the solvation of SO 2 at the water surface can affect the reactive sites and electrophilicity of SO 2 . Hence, the solvation of SO 2 on the aerosol surface may have new implications when studying SO 2 chemistry in the aerosol-containing troposphere.

  17. The Proposed Surface Water and Ocean Topography (SWOT) Mission

    Science.gov (United States)

    Fu, Lee-Lueng; Alsdorf, Douglas; Rodriguez, Ernesto; Morrow, Rosemary; Mognard, Nelly; Vaze, Parag; Lafon, Thierry

    2012-01-01

    A new space mission concept called Surface Water and Ocean Topography (SWOT) is being developed jointly by a collaborative effort of the international oceanographic and hydrological communities for making high-resolution measurement of the water elevation of both the ocean and land surface water to answer the questions about the oceanic submesoscale processes and the storage and discharge of land surface water. The key instrument payload would be a Ka-band radar interferometer capable of making high-resolution wide-swath altimetry measurement. This paper describes the proposed science objectives and requirements as well as the measurement approach of SWOT, which is baselined to be launched in 2019. SWOT would demonstrate this new approach to advancing both oceanography and land hydrology and set a standard for future altimetry missions.

  18. Polarization Patterns of Transmitted Celestial Light under Wavy Water Surfaces

    Directory of Open Access Journals (Sweden)

    Guanhua Zhou

    2017-03-01

    Full Text Available This paper presents a model to describe the polarization patterns of celestial light, which includes sunlight and skylight, when refracted by wavy water surfaces. The polarization patterns and intensity distribution of refracted light through the wave water surface were calculated. The model was validated by underwater experimental measurements. The experimental and theoretical values agree well qualitatively. This work provides a quantitative description of the repolarization and transmittance of celestial light transmitted through wave water surfaces. The effects of wind speed and incident sources on the underwater refraction polarization patterns are discussed. Scattering skylight dominates the polarization patterns while direct solar light is the dominant source of the intensity of the underwater light field. Wind speed has an influence on disturbing the patterns under water.

  19. The influence of lithology on surface water sources | Science ...

    Science.gov (United States)

    Understanding the temporal and spatial variability of surface water sources within a basin is vital to our ability to manage the impacts of climate variability and land cover change. Water stable isotopes can be used as a tool to determine geographic and seasonal sources of water at the basin scale. Previous studies in the Coastal Range of Oregon reported that the variation in the isotopic signatures of surface water does not conform to the commonly observed “rainout effect”, which exhibits a trend of increasing isotopic depletion with rising elevation. The primary purpose of this research is to investigate the mechanisms governing seasonal and spatial variations in the isotopic signature of surface waters within the Marys River Basin, located in the leeward side of the Oregon Coastal Range. Surface water and precipitation samples were collected every 2-3 weeks for isotopic analysis of δ18O and δ2H for one year. Results indicate a significant difference in isotopic signature between watersheds underlain by basalt and sandstone. The degree of separation was the most distinct during the summer when low flows reflect deeper groundwater sources, whereas isotopic signatures during the rainy season (fall and winter) showed a greater degree of similarity between the two lithologies. This indicates that baseflow within streams drained by sandstone versus basalt is being supplied from two distinctly separate water sources. In addition, Marys River flow at the outle

  20. Generation of murine tumor cell lines deficient in MHC molecule surface expression using the CRISPR/Cas9 system.

    Directory of Open Access Journals (Sweden)

    Krishna Das

    Full Text Available In this study, the CRISPR/Cas9 technology was used to establish murine tumor cell lines, devoid of MHC I or MHC II surface expression, respectively. The melanoma cell line B16F10 and the murine breast cancer cell line EO-771, the latter stably expressing the tumor antigen NY-BR-1 (EO-NY, were transfected with an expression plasmid encoding a β2m-specific single guide (sgRNA and Cas9. The resulting MHC I negative cells were sorted by flow cytometry to obtain single cell clones, and loss of susceptibility of peptide pulsed MHC I negative clones to peptide-specific CTL recognition was determined by IFNγ ELISpot assay. The β2m knockout (KO clones did not give rise to tumors in syngeneic mice (C57BL/6N, unless NK cells were depleted, suggesting that outgrowth of the β2m KO cell lines was controlled by NK cells. Using sgRNAs targeting the β-chain encoding locus of the IAb molecule we also generated several B16F10 MHC II KO clones. Peptide loaded B16F10 MHC II KO cells were insusceptible to recognition by OT-II cells and tumor growth was unaltered compared to parental B16F10 cells. Thus, in our hands the CRISPR/Cas9 system has proven to be an efficient straight forward strategy for the generation of MHC knockout cell lines. Such cell lines could serve as parental cells for co-transfection of compatible HLA alleles together with human tumor antigens of interest, thereby facilitating the generation of HLA matched transplantable tumor models, e.g. in HLAtg mouse strains of the newer generation, lacking cell surface expression of endogenous H2 molecules. In addition, our tumor cell lines established might offer a useful tool to investigate tumor reactive T cell responses that function independently from MHC molecule surface expression by the tumor.

  1. Salinization and arsenic contamination of surface water in southwest Bangladesh.

    Science.gov (United States)

    Ayers, John C; George, Gregory; Fry, David; Benneyworth, Laura; Wilson, Carol; Auerbach, Leslie; Roy, Kushal; Karim, Md Rezaul; Akter, Farjana; Goodbred, Steven

    2017-09-11

    To identify the causes of salinization and arsenic contamination of surface water on an embanked island (i.e., polder) in the tidal delta plain of SW Bangladesh we collected and analyzed water samples in the dry (May) and wet (October) seasons in 2012-2013. Samples were collected from rice paddies (wet season), saltwater ponds used for brine shrimp aquaculture (dry season), freshwater ponds and tidal channels (both wet and dry season), and rainwater collectors. Continuous measurements of salinity from March 2012 to February 2013 show that tidal channel water increases from ~0.15 ppt in the wet season up to ~20 ppt in the dry season. On the polder, surface water exceeds the World Health Organization drinking water guideline of 10 μg As/L in 78% of shrimp ponds and 27% of rice paddies, raising concerns that produced shrimp and rice could have unsafe levels of As. Drinking water sources also often have unsafe As levels, with 83% of tubewell and 43% of freshwater pond samples having >10 μg As/L. Water compositions and field observations are consistent with shrimp pond water being sourced from tidal channels during the dry season, rather than the locally saline groundwater from tubewells. Irrigation water for rice paddies is also obtained from the tidal channels, but during the wet season when surface waters are fresh. Salts become concentrated in irrigation water through evaporation, with average salinity increasing from 0.43 ppt in the tidal channel source to 0.91 ppt in the rice paddies. Our observations suggest that the practice of seasonally alternating rice and shrimp farming in a field has a negligible effect on rice paddy water salinity. Also, shrimp ponds do not significantly affect the salinity of adjacent surface water bodies or subjacent groundwater because impermeable shallow surface deposits of silt and clay mostly isolate surface water bodies from each other and from the shallow groundwater aquifer. Bivariate plots of conservative element

  2. 3D nanostar dimers with a sub-10-nm gap for single-/few-molecule surface-enhanced raman scattering

    KAUST Repository

    Chirumamilla, Manohar

    2014-01-22

    Plasmonic nanostar-dimers, decoupled from the substrate, have been fabricated by combining electron-beam lithography and reactive-ion etching techniques. The 3D architecture, the sharp tips of the nanostars and the sub-10 nm gap size promote the formation of giant electric-field in highly localized hot-spots. The single/few molecule detection capability of the 3D nanostar-dimers has been demonstrated by Surface-Enhanced Raman Scattering. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. 3D nanostar dimers with a sub-10-nm gap for single-/few-molecule surface-enhanced raman scattering

    KAUST Repository

    Chirumamilla, Manohar; Toma, Andrea; Gopalakrishnan, Anisha; Das, Gobind; Proietti Zaccaria, Remo; Krahne, Roman; Rondanina, Eliana; Leoncini, Marco; Liberale, Carlo; De Angelis, Francesco De; Di Fabrizio, Enzo M.

    2014-01-01

    Plasmonic nanostar-dimers, decoupled from the substrate, have been fabricated by combining electron-beam lithography and reactive-ion etching techniques. The 3D architecture, the sharp tips of the nanostars and the sub-10 nm gap size promote the formation of giant electric-field in highly localized hot-spots. The single/few molecule detection capability of the 3D nanostar-dimers has been demonstrated by Surface-Enhanced Raman Scattering. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Nuclear magnetic resonance study of the structure of simple molecules adsorbed on metal surfaces: acetylene on platinum

    International Nuclear Information System (INIS)

    Wang, P.K.

    1984-01-01

    We have used NMR to determine the structure of acetylene (HC - CH) adsorbed at room temperature on small platinum particles by studying the 13 C- 13 C, 13 C- 1 H, and 1 H- 1 H dipolar interactions among the nuclei in the adsorbed molecules. We find a model of 77% CCH 2 and 23% HCCH to be the only one consistent with all of our data. The C-C bond length of the majority species, CCH 2 , is determined as 1.44 +- 0.02 A, midway between a single and double bond, suggesting that both carbon atoms bond to the surface. 36 references, 29 figures, 1 table

  5. Using IR Imaging of Water Surfaces for Estimating Piston Velocities

    Science.gov (United States)

    Gålfalk, M.; Bastviken, D.; Arneborg, L.

    2013-12-01

    The transport of gasses dissolved in surface waters across the water-atmosphere interface is controlled by the piston velocity (k). This coefficient has large implications for, e.g., greenhouse gas fluxes but is challenging to quantify in situ. At present, empirical k-wind speed relationships from a small number of studies and systems are often extrapolated without knowledge of model performance. It is therefore of interest to search for new methods for estimating k, and to compare the pros and cons of existing and new methods. Wind speeds in such models are often measured at a height of 10 meters. In smaller bodies of water such as lakes, wind speeds can vary dramatically across the surface through varying degrees of wind shadow from e.g. trees at the shoreline. More local measurements of the water surface, through wave heights or surface motion mapping, could give improved k-estimates over a surface, also taking into account wind fetch. At thermal infrared (IR) wavelengths water has very low reflectivity (depending on viewing angle) than can go below 1%, meaning that more than 99% is heat radiation giving a direct measurement of surface temperature variations. Using an IR camera at about 100 frames/s one could map surface temperature structures at a fraction of a mm depth even with waves present. In this presentation I will focus on IR imaging as a possible tool for estimating piston velocities. Results will be presented from IR field measurements, relating the motions of surface temperature structures to k calculated from other simultaneous measurements (flux chamber and ADV-Based Dissipation Rate), but also attempting to calculate k directly from the IR surface divergence. A relation between wave height and k will also be presented.

  6. Issues of the presence of parasitic protozoa in surface waters

    Science.gov (United States)

    Hawrylik, Eliza

    2018-02-01

    Parasitic protozoa are very numerous organisms in the environment that play an important role in the spread of water-borne diseases. Water-borne epidemics caused by parasitic protozoa are noted throughout the world. Within these organisms, intestinal protozoa of the genera Cryptosporidium and Giardia are ones of the most serious health hazards for humans. This paper focuses on the problem of the presence of parasitic protozoa in surface waters. Characteristics of the most frequently recognized pathogens responsible for water-borne outbreaks were described, as well as sources of contamination and surface waters contamination due to protozoa of the genus Cryptosporidium and Giardia were presented. The methods of destroying the cysts and oocysts of parasitic protozoa used nowadays in the world were also presented in a review.

  7. Studing electronic structure of water molecules in aquocomplexes by the method of pions minus capture by hydrogen

    International Nuclear Information System (INIS)

    Dezhi, I.; Krumshtejn, Z.V.; Molnar, B.; Petrukhin, V.I.; Rybakov, V.N.; Suvorov, V.M.; Khorvat, D.; Tsisek, Z.; Yutlandov, I.A.

    1980-01-01

    Using the effect of electron shell state on π-meson capture by chemically bound hydrogen studied has been change of electron density in hydrogen atoms of water molecules bound into aquocomplexes. The fact of depression of π-meson capture probability by hydrogen of water in aquocomplexes has been established. The magnitudes of depression indicate essential decrease of electron density in a hydrogen atom of coordinated water. Interaction of ligands with oxygen-containing anions also essentially contributes to a magnitude of depression

  8. Exploring the role of water in molecular recognition: predicting protein ligandability using a combinatorial search of surface hydration sites

    Science.gov (United States)

    Vukovic, Sinisa; Brennan, Paul E.; Huggins, David J.

    2016-09-01

    The interaction between any two biological molecules must compete with their interaction with water molecules. This makes water the most important molecule in medicine, as it controls the interactions of every therapeutic with its target. A small molecule binding to a protein is able to recognize a unique binding site on a protein by displacing bound water molecules from specific hydration sites. Quantifying the interactions of these water molecules allows us to estimate the potential of the protein to bind a small molecule. This is referred to as ligandability. In the study, we describe a method to predict ligandability by performing a search of all possible combinations of hydration sites on protein surfaces. We predict ligandability as the summed binding free energy for each of the constituent hydration sites, computed using inhomogeneous fluid solvation theory. We compared the predicted ligandability with the maximum observed binding affinity for 20 proteins in the human bromodomain family. Based on this comparison, it was determined that effective inhibitors have been developed for the majority of bromodomains, in the range from 10 to 100 nM. However, we predict that more potent inhibitors can be developed for the bromodomains BPTF and BRD7 with relative ease, but that further efforts to develop inhibitors for ATAD2 will be extremely challenging. We have also made predictions for the 14 bromodomains with no reported small molecule K d values by isothermal titration calorimetry. The calculations predict that PBRM1(1) will be a challenging target, while others such as TAF1L(2), PBRM1(4) and TAF1(2), should be highly ligandable. As an outcome of this work, we assembled a database of experimental maximal K d that can serve as a community resource assisting medicinal chemistry efforts focused on BRDs. Effective prediction of ligandability would be a very useful tool in the drug discovery process.

  9. Exploring the role of water in molecular recognition: predicting protein ligandability using a combinatorial search of surface hydration sites.

    Science.gov (United States)

    Vukovic, Sinisa; Brennan, Paul E; Huggins, David J

    2016-09-01

    The interaction between any two biological molecules must compete with their interaction with water molecules. This makes water the most important molecule in medicine, as it controls the interactions of every therapeutic with its target. A small molecule binding to a protein is able to recognize a unique binding site on a protein by displacing bound water molecules from specific hydration sites. Quantifying the interactions of these water molecules allows us to estimate the potential of the protein to bind a small molecule. This is referred to as ligandability. In the study, we describe a method to predict ligandability by performing a search of all possible combinations of hydration sites on protein surfaces. We predict ligandability as the summed binding free energy for each of the constituent hydration sites, computed using inhomogeneous fluid solvation theory. We compared the predicted ligandability with the maximum observed binding affinity for 20 proteins in the human bromodomain family. Based on this comparison, it was determined that effective inhibitors have been developed for the majority of bromodomains, in the range from 10 to 100 nM. However, we predict that more potent inhibitors can be developed for the bromodomains BPTF and BRD7 with relative ease, but that further efforts to develop inhibitors for ATAD2 will be extremely challenging. We have also made predictions for the 14 bromodomains with no reported small molecule K d values by isothermal titration calorimetry. The calculations predict that PBRM1(1) will be a challenging target, while others such as TAF1L(2), PBRM1(4) and TAF1(2), should be highly ligandable. As an outcome of this work, we assembled a database of experimental maximal K d that can serve as a community resource assisting medicinal chemistry efforts focused on BRDs. Effective prediction of ligandability would be a very useful tool in the drug discovery process.

  10. Reaction of water vapor with a clean liquid uranium surface

    International Nuclear Information System (INIS)

    Siekhaus, W.

    1985-01-01

    To study the reaction of water vapor with uranium, we have exposed clean liquid uranium surfaces to H 2 O under UHV conditions. We have measured the surface concentration of oxygen as a function of exposure, and determined the maximum attainable surface oxygen concentration X 0 /sup s/ as a function of temperature. We have used these measurements to estimate, close to the melting point, the solubility of oxygen (X 0 /sup b/, -4 ) and its surface segregation coefficient β/sup s/(> 10 3 ). 8 refs., 5 figs., 1 tab

  11. Molecular Dynamics Simulations of Water Nanodroplets on Silica Surfaces

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Jaffe, Richard L.

    2009-01-01

    and DNA microarrays technologies.4,5,6,7,8 Although extensive experimental, theoretical and computational work has been devoted to study the nature of the interaction between silica and water,2,9-16 at the molecular level a complete understanding of silica-water systems has not been reached. Contact angle...... computations of water droplets on silica surfaces offers a useful fundamental and quantitative measurement in order to study chemical and physical properties of water-silica systems.3,16,17,18 For hydrophobic systems the static and dynamic properties of the fluid-solid interface are influenced by the presence...

  12. Impacts of thermal and chemical discharges to surface water

    International Nuclear Information System (INIS)

    Stober, Q.J.

    1974-01-01

    Various aspects of thermal and chemical discharges to surface water are outlined. The major impacts of nuclear power plants on aquatic resources are disruption during construction, intake of cooling water, discharge problems, and interactions with other water users. The following topics are included under the heading, assessment of aquatic ecology: identification of flora and fauna; abundance of aquatic organisms; species-environment relationships; and identification of pre-existing environmental stress. The following topics are included under the heading, environmental effects of plant operation: entrapment of fish by cooling water; passage of plankton through cooling system; discharge area and thermal plume; chemical effluents; and plant construction. (U.S.)

  13. Possibilities of surface waters monitoring at mining areas using UAV

    Directory of Open Access Journals (Sweden)

    Lisiecka Ewa

    2018-01-01

    Full Text Available The selected, remote measurement methods are discussed, useful for determining surface water properties using mobile unmanned aerial platforms (UAV. The possibilities of using this type of solutions in the scope of measuring spatial, physicochemical and biological parameters of both natural and anthropogenic water reservoirs, including flood polders, water-filled pits, settling tanks and mining sinks were analyzed. Methods of remote identification of the process of overgrowing this type of ecosystems with water and coastal plant formations have also been proposed.

  14. Hydraulics and drones: observations of water level, bathymetry and water surface velocity from Unmanned Aerial Vehicles

    DEFF Research Database (Denmark)

    Bandini, Filippo

    -navigable rivers and overpass obstacles (e.g. river structures). Computer vision, autopilot system and beyond visual line-of-sight (BVLOS) flights will ensure the possibility to retrieve hyper-spatial observations of water depth, without requiring the operator to access the area. Surface water speed can......The planet faces several water-related threats, including water scarcity, floods, and pollution. Satellite and airborne sensing technology is rapidly evolving to improve the observation and prediction of surface water and thus prevent natural disasters. While technological developments require....... Although UAV-borne measurements of surface water speed have already been documented in the literature, a novel approach was developed to avoid GCPs. This research is the first demonstration that orthometric water level can be measured from UAVs with a radar system and a GNSS (Global Navigation Satellite...

  15. Surface water classification and monitoring using polarimetric synthetic aperture radar

    Science.gov (United States)

    Irwin, Katherine Elizabeth

    Surface water classification using synthetic aperture radar (SAR) is an established practice for monitoring flood hazards due to the high temporal and spatial resolution it provides. Surface water change is a dynamic process that varies both spatially and temporally, and can occur on various scales resulting in significant impacts on affected areas. Small-scale flooding hazards, caused by beaver dam failure, is an example of surface water change, which can impact nearby infrastructure and ecosystems. Assessing these hazards is essential to transportation and infrastructure maintenance. With current satellite missions operating in multiple polarizations, spatio-temporal resolutions, and frequencies, a comprehensive comparison between SAR products for surface water monitoring is necessary. In this thesis, surface water extent models derived from high resolution single-polarization TerraSAR-X (TSX) data, medium resolution dual-polarization TSX data and low resolution quad-polarization RADARSAT-2 (RS-2) data are compared. There exists a compromise between acquiring SAR data with a high resolution or high information content. Multi-polarization data provides additional phase and intensity information, which makes it possible to better classify areas of flooded vegetation and wetlands. These locations are often where fluctuations in surface water occur and are essential for understanding dynamic underlying processes. However, often multi-polarized data is acquired at a low resolution, which cannot image these zones effectively. High spatial resolution, single-polarization TSX data provides the best model of open water. However, these single-polarization observations have limited information content and are affected by shadow and layover errors. This often hinders the classification of other land cover types. The dual-polarization TSX data allows for the classification of flooded vegetation, but classification is less accurate compared to the quad-polarization RS-2 data

  16. Lawrence Livermore National Laboratory Surface Water Protection: A Watershed Approach

    Energy Technology Data Exchange (ETDEWEB)

    Coty, J

    2009-03-16

    This surface water protection plan (plan) provides an overview of the management efforts implemented at Lawrence Livermore National Laboratory (LLNL) that support a watershed approach to protect surface water. This plan fulfills a requirement in the Department of Energy (DOE) Order 450.1A to demonstrate a watershed approach for surface water protection that protects the environment and public health. This plan describes the use of a watershed approach within which the Laboratory's current surface water management and protections efforts have been structured and coordinated. With more than 800 million acres of land in the U.S. under federal management and stewardship, a unified approach across agencies provides enhanced resource protection and cost-effectiveness. The DOE adopted, along with other federal agencies, the Unified Federal Policy for a Watershed Approach to Federal Land and Resource Management (UFP) with a goal to protect water quality and aquatic ecosystems on federal lands. This policy intends to prevent and/or reduce water pollution from federal activities while fostering a cost-effective watershed approach to federal land and resource management. The UFP also intends to enhance the implementation of existing laws (e.g., the Clean Water Act [CWA] and National Environmental Policy Act [NEPA]) and regulations. In addition, this provides an opportunity for the federal government to serve as a model for water quality stewardship using a watershed approach for federal land and resource activities that potentially impact surface water and its uses. As a federal land manager, the Laboratory is responsible for a small but important part of those 800 million acres of land. Diverse land uses are required to support the Laboratory's mission and provide an appropriate work environment for its staff. The Laboratory comprises two sites: its main site in Livermore, California, and the Experimental Test Site (Site 300), near Tracy, California. The main site

  17. The significant surface-water connectivity of "geographically isolated wetlands"

    Science.gov (United States)

    Calhoun, Aram J.K.; Mushet, David M.; Alexander, Laurie C.; DeKeyser, Edward S.; Fowler, Laurie; Lane, Charles R.; Lang, Megan W.; Rains, Mark C.; Richter, Stephen; Walls, Susan

    2017-01-01

    We evaluated the current literature, coupled with our collective research expertise, on surface-water connectivity of wetlands considered to be “geographically isolated” (sensu Tiner Wetlands 23:494–516, 2003a) to critically assess the scientific foundation of grouping wetlands based on the singular condition of being surrounded by uplands. The most recent research on wetlands considered to be “geographically isolated” shows the difficulties in grouping an ecological resource that does not reliably indicate lack of surface water connectivity in order to meet legal, regulatory, or scientific needs. Additionally, the practice of identifying “geographically isolated wetlands” based on distance from a stream can result in gross overestimates of the number of wetlands lacking ecologically important surface-water connections. Our findings do not support use of the overly simplistic label of “geographically isolated wetlands”. Wetlands surrounded by uplands vary in function and surface-water connections based on wetland landscape setting, context, climate, and geographic region and should be evaluated as such. We found that the “geographically isolated” grouping does not reflect our understanding of the hydrologic variability of these wetlands and hence does not benefit conservation of the Nation’s diverse wetland resources. Therefore, we strongly discourage use of categorizations that provide overly simplistic views of surface-water connectivity of wetlands fully embedded in upland landscapes.

  18. Properties of water surface discharge at different pulse repetition rates

    International Nuclear Information System (INIS)

    Ruma,; Yoshihara, K.; Hosseini, S. H. R.; Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-01-01

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H 2 O 2 ) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H 2 O 2 and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  19. Strategies for creating antifouling surfaces using selfassembled poly(ethylene glycol) thiol molecules

    DEFF Research Database (Denmark)

    Lokanathan, Arcot R.

    2011-01-01

    of microbial species, but then the environment is also teeming with pathogenic microbes that pose serious threat to human health. Hence the success of human survival not only depends on exploiting the useful microbes but also on our ability to defend ourselves against the pathogenic ones. Microbes...... have substantial impact on human health, as many bacterial infections are caused by or involve biofilms. Biofilm infections are for example often associated with medical implants, as artificial surfaces in the human body provide a safe haven where biofilms can form. The food industry daily combats...... polymers for making non-adhesive coatings. The work presented in this thesis involves grafting PEG chains onto surfaces using different modifications of the ‘grafting to’ technique. The main aim of studies presented in this thesis was to develop surfaces which would prevent bacteria from forming biofilm...

  20. Preparation of theoretical scanning tunneling microscope images of adsorbed molecules: a theoretical study of benzene on the Cu(110) surface

    International Nuclear Information System (INIS)

    Shapter, J.G.; Rogers, B.L.; Ford, M.J.

    2003-01-01

    Full text: Since its development in 1982, the Scanning Tunneling Microscope (STM) has developed into a powerful tool for the study of surfaces and adsorbates. However, the utility of the technique can be further enhanced through the development of techniques for generating theoretical STM images. This is particularly true when studying molecules adsorbed on a substrate, as the results are often interpreted superficially due to an inadequate understanding of the orbital overlap probed in the experiment. A method of preparing theoretical scanning tunneling microscope (STM) images using comparatively inexpensive desktop computers and the commercially available CRYSTAL98 package is presented through a study of benzene adsorbed on the Cu(110) surface. Density Functional Theory (DFT) and Hartree-Fock (HF) methods are used to model clean Cu(110) slabs of various thicknesses and to simulate the adsorption of benzene onto these slabs. Eight possible orientations of benzene on the Cu(110) surface are proposed, and the optimum orientation according to the calculations is presented. Theoretical STM images of the Cu(110) surface and benzene adsorbed on the Cu(110) surface are compared with experimental STM images of the system from a published study. Significant differences are observed and are examined in detail

  1. Determination of surface concentrations of individual molecule-layers used in nanoscale biosensors by in situ ATR-FTIR spectroscopy

    KAUST Repository

    Punzet, Manuel

    2012-01-01

    For the development of nanowire sensors for chemical and medical detection purposes, the optimal functionalization of the surface is a mandatory component. Quantitative ATR-FTIR spectroscopy was used in situ to investigate the step-by-step layer formation of typical functionalization protocols and to determine the respective molecule surface concentrations. BSA, anti-TNF-α and anti-PSA antibodies were bound via 3-(trimethoxy)butylsilyl aldehyde linkers to silicon-oxide surfaces in order to investigate surface functionalization of nanowires. Maximum determined surface concentrations were 7.17 × 10 -13 mol cm -2 for BSA, 1.7 × 10 -13 mol cm -2 for anti-TNF-α antibody, 6.1 × 10 -13 mol cm -2 for anti-PSA antibody, 3.88 × 10 -13 mol cm -2 for TNF-α and 7.0 × 10 -13 mol cm -2 for PSA. Furthermore we performed antibody-antigen binding experiments and determined the specific binding ratios. The maximum possible ratio of 2 was obtained at bulk concentrations of the antigen in the μg ml -1 range for TNF-α and PSA. © 2012 The Royal Society of Chemistry.

  2. Quantum theory of scattering of atoms and diatomic molecules by solid surfaces

    International Nuclear Information System (INIS)

    Liu, W.S.

    1973-01-01

    The unitary treatment, based on standard t-matrix theory, of the quantum theory of scattering of atoms by solid surfaces, is extended to the scattering of particles having internal degrees of freedom by perfect harmonic crystalline surfaces. The diagonal matrix element of the interaction potential which enters into the quantum scattering theory is obtained to represent the potential for the specular beam. From the two-potential formula, the scattering intensities for the diffracted beams and the inelastic beams with or without internal transitions of the particles are obtained by solving the equation for the t-matrix elements. (author)

  3. Organic molecules as tools to control the growth, surface structure, and redox activity of colloidal quantum dots.

    Science.gov (United States)

    Weiss, Emily A

    2013-11-19

    In order to achieve efficient and reliable technology that can harness solar energy, the behavior of electrons and energy at interfaces between different types or phases of materials must be understood. Conversion of light to chemical or electrical potential in condensed phase systems requires gradients in free energy that allow the movement of energy or charge carriers and facilitate redox reactions and dissociation of photoexcited states (excitons) into free charge carriers. Such free energy gradients are present at interfaces between solid and liquid phases or between inorganic and organic materials. Nanostructured materials have a higher density of these interfaces than bulk materials. Nanostructured materials, however, have a structural and chemical complexity that does not exist in bulk materials, which presents a difficult challenge: to lower or eliminate energy barriers to electron and energy flux that inevitably result from forcing different materials to meet in a spatial region of atomic dimensions. Chemical functionalization of nanostructured materials is perhaps the most versatile and powerful strategy for controlling the potential energy landscape of their interfaces and for minimizing losses in energy conversion efficiency due to interfacial structural and electronic defects. Colloidal quantum dots are semiconductor nanocrystals synthesized with wet-chemical methods and coated in organic molecules. Chemists can use these model systems to study the effects of chemical functionalization of nanoscale organic/inorganic interfaces on the optical and electronic properties of a nanostructured material, and the behavior of electrons and energy at interfaces. The optical and electronic properties of colloidal quantum dots have an intense sensitivity to their surface chemistry, and their organic adlayers make them dispersible in solvent. This allows researchers to use high signal-to-noise solution-phase spectroscopy to study processes at interfaces. In this

  4. Water redistribution at the soil surface : ponding and surface runoff in flat areas

    NARCIS (Netherlands)

    Appels, W.M.

    2013-01-01

    In The Netherlands, one of the most important targets for the improvement of surface water quality as aimed for in the European Water Framework Directive, is the reduction of nutrient concentrations (both nitrogen and phosphorus). To identify the most suitable and effective measures for reducing the

  5. Foulant characteristics comparison in recycling cooling water system makeup by municipal reclaimed water and surface water in power plant.

    Science.gov (United States)

    Ping, Xu; Jing, Wang; Yajun, Zhang; Jie, Wang; Shuai, Si

    2015-01-01

    Due to water shortage, municipal reclaimed water rather than surface water was replenished into recycling cooling water system in power plants in some cities in China. In order to understand the effects of the measure on carbon steel corrosion, characteristics of two kinds of foulant produced in different systems were studied in the paper. Differences between municipal reclaimed water and surface water were analyzed firstly. Then, the weight and the morphology of two kinds of foulant were compared. Moreover, other characteristics including the total number of bacteria, sulfate reducing bacteria, iron bacteria, extracellular polymeric substance (EPS), protein (PN), and polysaccharide (PS) in foulant were analyzed. Based on results, it could be concluded that microbial and corrosive risk would be increased when the system replenished by municipal reclaimed water instead of surface water.

  6. Hydrologic Science and Satellite Measurements of Surface Water (Invited)

    Science.gov (United States)

    Alsdorf, D. E.; Mognard, N. M.; Lettenmaier, D. P.

    2010-12-01

    While significant advances continue to be made for satellite measurements of surface waters, important science and application opportunities remain. Examples include the following: (1) Our current methods of measuring floodwater dynamics are either sparsely distributed or temporally inadequate. As an example, flood depths are measured by using high water marks, which capture only the peak of the flood wave, not its temporal variability. (2) Discharge is well measured at individual points along stream networks using in-situ gauges, but these do not capture within-reach hydraulic variability such as the water surface slope changes on the rising and falling limbs of flood waves. (3) Just a 1.0 mm/day error in ET over the Congo Basin translates to a 35,000 m3/s discharge error. Knowing the discharge of the Congo River and its many tributaries should significantly improve our understanding of the water balance throughout the basin. The Congo is exemplary of many other basins around the globe. (4) Arctic hydrology is punctuated by millions of unmeasured lakes. Globally, there might be as many as 30 million lakes larger than a hectare. Storage changes in these lakes are nearly unknown, but in the Arctic such changes are likely an indication of global warming. (5) Well over 100 rivers cross international boundaries, yet the sharing of water data is poor. Overcoming this helps to better manage the entire river basin while also providing a better assessment of potential water related disasters. The Surface Water and Ocean Topography (SWOT, http://swot.jpl.nasa.gov/) mission is designed to meet these needs by providing global measurements of surface water hydrodynamics. SWOT will allow estimates of discharge in rivers wider than 100m (50m goal) and storage changes in water bodies larger than 250m by 250m (and likely as small as one hectare).

  7. Sorption Characteristics of Mixed Molecules of Glutaraldehyde from Water on Mesoporous Acid-Amine Modified Low-Cost Activated Carbon: Mechanism, Isotherm, and Kinetics

    Directory of Open Access Journals (Sweden)

    Mukosha Lloyd

    2015-01-01

    Full Text Available The environmental discharge of inefficiently treated waste solutions of the strong biocide glutaraldehyde (GA from hospitals has potential toxic impact on aquatic organisms. The adsorption characteristics of mixed polarized monomeric and polymeric molecules of GA from water on mesoporous acid-amine modified low-cost activated carbon (AC were investigated. It was found that the adsorption strongly depended on pH and surface chemistry. In acidic pH, the adsorption mechanism was elaborated to involve chemical sorption of mainly hydroxyl GA monomeric molecules on acidic surface groups, while in alkaline pH, the adsorption was elaborated to involve both chemical and physical sorption of GA polymeric forms having mixed functional groups (aldehyde, carboxyl, and hydroxyl on acidic and amine surface groups. The optimum pH of adsorption was about 12 with significant contribution by cooperative adsorption, elucidated in terms of hydrogen bonding and aldol condensation. Freundlich and Dubinin-Radushkevich models were fitted to isotherm data. The adsorption kinetics was dependent on initial concentration and temperature and described by the Elovich model. The adsorption was endothermic, while the intraparticle diffusion model suggested significant contribution by film diffusion. The developed low-cost AC could be used to supplement the GA alkaline deactivation process for efficient removal of residual GA aquatic toxicity.

  8. Impact of Water Recovery from Wastes on the Lunar Surface Mission Water Balance

    Science.gov (United States)

    Fisher, John W.; Hogan, John Andrew; Wignarajah, Kanapathipi; Pace, Gregory S.

    2010-01-01

    Future extended lunar surface missions will require extensive recovery of resources to reduce mission costs and enable self-sufficiency. Water is of particular importance due to its potential use for human consumption and hygiene, general cleaning, clothes washing, radiation shielding, cooling for extravehicular activity suits, and oxygen and hydrogen production. Various water sources are inherently present or are generated in lunar surface missions, and subject to recovery. They include: initial water stores, water contained in food, human and other solid wastes, wastewaters and associated brines, ISRU water, and scavenging from residual propellant in landers. This paper presents the results of an analysis of the contribution of water recovery from life support wastes on the overall water balance for lunar surface missions. Water in human wastes, metabolic activity and survival needs are well characterized and dependable figures are available. A detailed life support waste model was developed that summarizes the composition of life support wastes and their water content. Waste processing technologies were reviewed for their potential to recover that water. The recoverable water in waste is a significant contribution to the overall water balance. The value of this contribution is discussed in the context of the other major sources and loses of water. Combined with other analyses these results provide guidance for research and technology development and down-selection.

  9. Miniaturized Quantum Semiconductor Surface Plasmon Resonance Platform for Detection of Biological Molecules

    Directory of Open Access Journals (Sweden)

    Jan J. Dubowski

    2013-06-01

    Full Text Available The concept of a portable, inexpensive and semi-automated biosensing platform, or lab-on-a-chip, is a vision shared by many researchers and venture industries. Under this scope, we have investigated the application of optical emission from quantum well (QW microstructures for monitoring surface phenomena on gold layers remaining in proximity (<300 nm with QW microstructures. The uncollimated QW radiation excites surface plasmons (SP and through the surface plasmon resonance (SPR effect allows for detection of small perturbation in the density surface adsorbates. The SPR technology is already commonly used for biochemical characterization in pharmaceutical industries, but the reduction of the distance between the SP exciting source and the biosensing platform to a few hundreds of nanometers is an innovative approach enabling us to achieve an ultimate miniaturization of the device. We evaluate the signal quality of this nanophotonic QW-SPR device using hyperspectral-imaging technology, and we compare its performance with that of a standard prism-based commercial system. Two standard biochemical agents are employed for this characterization study: bovine serum albumin and inactivated influenza A virus. With an innovative conical method of SPR data collection, we demonstrate that individually collected SPR scan, each in less than 2.2 s, yield a resolution of the detection at 1.5 × 10−6 RIU.

  10. Identification of a regulatory T cell specific cell surface molecule that mediates suppressive signals and induces Foxp3 expression.

    Science.gov (United States)

    Wang, Rui; Wan, Qi; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya

    2008-07-16

    Regulatory T (T(reg)) cells control immune activation and maintain tolerance. How T(regs) mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32), which within T cells is specifically expressed in T(regs) activated through the T cell receptor (TCR). Ectopic expression of GARP in human naïve T (T(N)) cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N) cells induced expression of T(reg) master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg) cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.

  11. Identification of a regulatory T cell specific cell surface molecule that mediates suppressive signals and induces Foxp3 expression.

    Directory of Open Access Journals (Sweden)

    Rui Wang

    2008-07-01

    Full Text Available Regulatory T (T(reg cells control immune activation and maintain tolerance. How T(regs mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32, which within T cells is specifically expressed in T(regs activated through the T cell receptor (TCR. Ectopic expression of GARP in human naïve T (T(N cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N cells induced expression of T(reg master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.

  12. MRD-CI potential surfaces using balanced basis sets. IV. The H2 molecule and the H3 surface

    International Nuclear Information System (INIS)

    Wright, J.S.; Kruus, E.

    1986-01-01

    The utility of midbond functions in molecular calculations was tested in two cases where the correct results are known: the H 2 potential curve and the collinear H 3 potential surface. For H 2 , a variety of basis sets both with and without bond functions was compared to the exact nonrelativistic potential curve of Kolos and Wolniewicz [J. Chem. Phys. 43, 2429 (1965)]. It was found that optimally balanced basis sets at two levels of quality were the double zeta single polarization plus sp bond function basis (BF1) and the triple zeta double polarization plus two sets of sp bond function basis (BF2). These gave bond dissociation energies D/sub e/ = 4.7341 and 4.7368 eV, respectively (expt. 4.7477 eV). Four basis sets were tested for basis set superposition errors, which were found to be small relative to basis set incompleteness and therefore did not affect any conclusions regarding basis set balance. Basis sets BF1 and BF2 were used to construct potential surfaces for collinear H 3 , along with the corresponding basis sets DZ*P and TZ*PP which contain no bond functions. Barrier heights of 12.52, 10.37, 10.06, and 9.96 kcal/mol were obtained for basis sets DZ*P, TZ*PP, BF1, and BF2, respectively, compared to an estimated limiting value of 9.60 kcal/mol. Difference maps, force constants, and relative rms deviations show that the bond functions improve the surface shape as well as the barrier height

  13. Macroelements in the surface microlayer of water of urban ponds

    Directory of Open Access Journals (Sweden)

    Antonowicz Józef Piotr

    2016-03-01

    Full Text Available Analyses were conducted concerning the accumulation of four metals representing the group of macroelements, i.e. sodium, potassium, calcium and magnesium in two ponds located in the city of Słupsk. Water samples for chemical analyses were collected from the surface microlayer using a Garrett net. At the same time subsurface water samples were collected. Concentrations of metals were determined using a mass spectrometer. Generally, amounts of sodium, potassium, calcium and magnesium were similar in surface microlayer and subsurface water. Only in the case of potassium and calcium was low enrichment observed in the surface microlayer in one pond, while the greatest extent for magnesium enrichment was observed in the spring period.

  14. Wavefront modulation of water surface wave by a metasurface

    International Nuclear Information System (INIS)

    Sun Hai-Tao; Cheng Ying; Liu Xiao-Jun; Wang Jing-Shi

    2015-01-01

    We design a planar metasurface to modulate the wavefront of a water surface wave (WSW) on a deep sub-wavelength scale. The metasurface is composed of an array of coiling-up-space units with specially designed parameters, and can take on the work of steering the wavefront when it is pierced into water. Like their acoustic counterparts, the modulation of WSW is ascribed to the gradient phase shift of the coiling-up-space units, which can be perfectly tuned by changing the coiling plate length and channel number inside the units. According to the generalized Snell’s law, negative refraction and ‘driven’ surface mode of WSW are also demonstrated at certain incidences. Specially, the transmitted WSW could be efficiently guided out by linking a symmetrically-corrugated channel in ‘driven’ surface mode. This work may have potential applications in water wave energy extraction and coastal protection. (paper)

  15. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  16. Modeling decadal timescale interactions between surface water and ground water in the central Everglades, Florida, USA

    Science.gov (United States)

    Harvey, Judson W.; Newlin, Jessica T.; Krupa, Steven L.

    2006-04-01

    Surface-water and ground-water flow are coupled in the central Everglades, although the remoteness of this system has hindered many previous attempts to quantify interactions between surface water and ground water. We modeled flow through a 43,000 ha basin in the central Everglades called Water Conservation Area 2A. The purpose of the model was to quantify recharge and discharge in the basin's vast interior areas. The presence and distribution of tritium in ground water was the principal constraint on the modeling, based on measurements in 25 research wells ranging in depth from 2 to 37 m. In addition to average characteristics of surface-water flow, the model parameters included depth of the layer of 'interactive' ground water that is actively exchanged with surface water, average residence time of interactive ground water, and the associated recharge and discharge fluxes across the wetland ground surface. Results indicated that only a relatively thin (8 m) layer of the 60 m deep surfical aquifer actively exchanges surface water and ground water on a decadal timescale. The calculated storage depth of interactive ground water was 3.1 m after adjustment for the porosity of peat and sandy limestone. Modeling of the tritium data yielded an average residence time of 90 years in interactive ground water, with associated recharge and discharge fluxes equal to 0.01 cm d -1. 3H/ 3He isotopic ratio measurements (which correct for effects of vertical mixing in the aquifer with deeper, tritium-dead water) were available from several wells, and these indicated an average residence time of 25 years, suggesting that residence time was overestimated using tritium measurements alone. Indeed, both residence time and storage depth would be expected to be overestimated due to vertical mixing. The estimate of recharge and discharge (0.01 cm d -1) that resulted from tritium modeling therefore is still considered reliable, because the ratio of residence time and storage depth (used to

  17. Particle dry deposition to water surfaces: Processes and consequences

    DEFF Research Database (Denmark)

    Pryor, S.C.; Barthelmie, R.J.

    2000-01-01

    flux to coastal waters, atmosphere-surface exchange represents a significant component of the total flux and may be particularly critical during the summertime when both the riverine input and ambient nutrient concentrations are often at a minimum. In this chapter, we present an overview...... of the physical and chemical processes which dictate the quantity (and direction) of atmosphere-surface fluxes of trace chemicals to (and above) water surfaces with particular emphasis on the role of particles. Dry deposition (transfer to the surface in the absence of precipitation) of particles is determined...... efforts to simulate and measure fluxes close to the coastline. These arise in part from the complexity of atmospheric flow in this region where energy and chemical fluxes are highly inhomogeneous in space and time and thermally generated atmospheric circulations are commonplace. (C) 2000 Elsevier Science...

  18. A procedure to analyze surface profiles of the protein molecules visualized by quick-freeze deep-etch replica electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Kimori, Yoshitaka [Division of Biomolecular Imaging, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 108-8639 (Japan); Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka 820-8502 (Japan); Oguchi, Yosuke [Department of Electric Engineering, Kogakuin University, Hachioji, Tokyo 192-0015 (Japan); Ichise, Norihiko [Department of Visual Communication, Komazawa Women' s University, Inagi, Tokyo 206-8511 (Japan); Baba, Norio [Department of Electric Engineering, Kogakuin University, Hachioji, Tokyo 192-0015 (Japan); Katayama, Eisaku [Division of Biomolecular Imaging, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 108-8639 (Japan)]. E-mail: ekatayam@ims.u-tokyo.ac.jp

    2007-01-15

    Quick-freeze deep-etch replica electron microscopy gives high contrast snapshots of individual protein molecules under physiological conditions in vitro or in situ. The images show delicate internal pattern, possibly reflecting the rotary-shadowed surface profile of the molecule. As a step to build the new system for the 'Structural analysis of single molecules', we propose a procedure to quantitatively characterize the structural property of individual molecules; e.g. conformational type and precise view-angle of the molecules, if the crystallographic structure of the target molecule is available. This paper presents a framework to determine the observed face of the protein molecule by analyzing the surface profile of individual molecules visualized in freeze-replica specimens. A comprehensive set of rotary-shadowed views of the protein molecule was artificially generated from the available atomic coordinates using light-rendering software. Exploiting new mathematical morphology-based image filter, characteristic features were extracted from each image and stored as template. Similar features were extracted from the true replica image and the most likely projection angle and the conformation of the observed particle were determined by quantitative comparison with a set of archived images. The performance and the robustness of the procedure were examined with myosin head structure in defined configuration for actual application.

  19. A procedure to analyze surface profiles of the protein molecules visualized by quick-freeze deep-etch replica electron microscopy

    International Nuclear Information System (INIS)

    Kimori, Yoshitaka; Oguchi, Yosuke; Ichise, Norihiko; Baba, Norio; Katayama, Eisaku

    2007-01-01

    Quick-freeze deep-etch replica electron microscopy gives high contrast snapshots of individual protein molecules under physiological conditions in vitro or in situ. The images show delicate internal pattern, possibly reflecting the rotary-shadowed surface profile of the molecule. As a step to build the new system for the 'Structural analysis of single molecules', we propose a procedure to quantitatively characterize the structural property of individual molecules; e.g. conformational type and precise view-angle of the molecules, if the crystallographic structure of the target molecule is available. This paper presents a framework to determine the observed face of the protein molecule by analyzing the surface profile of individual molecules visualized in freeze-replica specimens. A comprehensive set of rotary-shadowed views of the protein molecule was artificially generated from the available atomic coordinates using light-rendering software. Exploiting new mathematical morphology-based image filter, characteristic features were extracted from each image and stored as template. Similar features were extracted from the true replica image and the most likely projection angle and the conformation of the observed particle were determined by quantitative comparison with a set of archived images. The performance and the robustness of the procedure were examined with myosin head structure in defined configuration for actual application

  20. Design and fabrication of structural color by local surface plasmonic meta-molecules

    International Nuclear Information System (INIS)

    Ma Ya-Qi; Shao Jin-Hai; Lu Bing-Rui; Zhang Si-Chao; Chen Yi-Fang; Zhang Ya-Feng; Sun Yan; Qu Xin-Ping

    2015-01-01

    In this paper, we propose a new form of nanostructures with Al film deposited on a patterned dielectric material for generating structural color, which is induced by local