WorldWideScience

Sample records for surface water component

  1. Surface Water & Surface Drainage

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This data set contains boundaries for all surface water and surface drainage for the state of New Mexico. It is in a vector digital data structure digitized from a...

  2. Study of the pyritized surfaces of the carbon steel components in heavy water production facilities

    International Nuclear Information System (INIS)

    Radulescu, Maria; Parvan, Ioana; Lucan, Dumitra; Fulger, Manuela; Dinu, Alice; Blanatui, A.

    1998-01-01

    The components used in the Girldler Sulfide (GS) process of heavy water production are made of carbon steel covered by iron sulfide layers of different compositions (mackinawite, troilite, pyrrhotite or pyrite) of variable thicknesses. The most protective layers which provide an acceptable corrosion resistance of the subjacent metal are the mixtures of pyrrhotite and pyrite. In the present work, the corrosion resistance of carbon steel samples covered by different types of sulfides was investigated by the following methods: X ray diffraction, metallography and electrochemical methods (potential-dynamical and electrochemical impedance). In order to carry out the electrochemical measurements in the same conditions as those of the operation of carbon steel components in D 2 O production facilities, the experiments were performed with Na 2 S solutions, at pH=4 - 13 and S 2- concentration value between 1 and 1000 mg/l. The dependence of corrosion rate kinetics on pH and S 2- concentration of the testing solution was investigated for sulfide covered samples comparatively with the uncovered ones. Corrosion rates determined gravimetrically were compared with those determined by electrochemical measurements. The uniformity and thickness of the sulfide layers were checked by metallographic methods. The composition of the sulfides formed in various environment conditions was established by X-ray diffraction. Reaction mechanisms specific for sulfide formation environments have been proposed. (authors)

  3. Mass transfer in fuel cells. [electron microscopy of components, thermal decomposition of Teflon, water transport, and surface tension of KOH solutions

    Science.gov (United States)

    Walker, R. D., Jr.

    1973-01-01

    Results of experiments on electron microscopy of fuel cell components, thermal decomposition of Teflon by thermogravimetry, surface area and pore size distribution measurements, water transport in fuel cells, and surface tension of KOH solutions are described.

  4. Calculation of the surface water pollution index in the evaluation of environmental component of product life cycle

    Directory of Open Access Journals (Sweden)

    Олег Аскольдович Проскурнин

    2015-05-01

    Full Text Available The assessment feasibility of the combined effect of the product life cycle on the environment is grounded. As an example, the pollution of surface waters at the production stage is considered in the article. A mechanism of ranking indicators of surface water pollution according to their importance is proposed. An algorithm for checking the consistency of the statistical expert judgment in determining weight coefficient for the indicators of pollution, based on the use of the concordance coefficient, is given

  5. Near-Surface Profiles of Water Stable Isotope Components and Indicated Transitional History of Ice-Wedge Polygons Near Barrow

    Science.gov (United States)

    Iwahana, G.; Wilson, C.; Newman, B. D.; Heikoop, J. M.; Busey, R.

    2017-12-01

    Wetlands associated with ice-wedge polygons are commonly distributed across the Arctic Coastal Plain of northern Alaska, a region underlain by continuous permafrost. Micro-topography of the ice-wedge polygons controls local hydrology, and the micro-topography could be altered due to factors such like surface vegetation, wetness, freeze-thaw cycles, and permafrost degradation/aggradation under climate change. Understanding status of the wetlands in the near future is important because it determines biogeochemical cycle, which drives release of greenhouse gases from the ground. However, transitional regime of the ice-wedge polygons under the changing climate is not fully understood. In this study, we analyzed geochemistry of water extracted from frozen soil cores sampled down to about 1m depth in 2014 March at NGEE-Arctic sites in the Barrow Environmental Observatory. The cores were sampled from troughs/rims/centers of five different low-centered or flat-centered polygons. The frozen cores are divided into 5-10cm cores for each location, thawed in sealed plastic bags, and then extracted water was stored in vials. Comparison between the profiles of geochemistry indicated connection of soil water in the active layer at different location in a polygon, while it revealed that distinctly different water has been stored in permafrost layer at troughs/rims/centers of some polygons. Profiles of volumetric water content (VWC) showed clear signals of freeze-up desiccation in the middle of saturated active layers as low VWC anomalies at most sampling points. Water in the active layer and near-surface permafrost was classified into four categories: ice wedge / fresh meteoric / transitional / highly fractionated water. The overall results suggested prolonged separation of water in the active layer at the center of low-centered polygons without lateral connection in water path in the past.

  6. Model studies on heterogeneous reactions of organic components within aerosols and their influence on the condensation of water: Surface-analytical investigations on the water up-take of fly-ashes before and after exposition to fluoranthene and toluene

    International Nuclear Information System (INIS)

    Faude, F.; Goschnick, J.

    1993-01-01

    The condensation of water onto four different fly ashes was investigated without any treatment, after annealing and subsequent to exposure with toluene and fluoranthene. It was intented to reveal the influence of organic aerosol components on atmospheric scavenging from particulate pollutants. Because the interaction with the ambient atmosphere is restricted to a very thin surface layer, surface analysis methods were applied to examine directly the adsorption of water or organic compounds at the surface of the fly ashes. Already some of the fly ashes as received contained organic components, which could be desorbed thermally. After their thermal removal the take-up of water improved considerably. Fluoranthene as well as the far more volatile toluene adsorbed at the particle surfaces and both caused strong impediment of the water take-up of originally hydrophilic fly ashes. The results suggest, that for any type of fly ashes the formation of a hydrophobic organic coating can be expected. This may be a result of organic flue gas components such as fluoranthene which condense downstream onto combustion aerosol particles. Or during transport of fly ash particles through organically polluted areas - e.g. with toluene in the air of busy traffic locations - organic coatings may built up. In all cases the hydrophobic coating interferes with the water take-up resulting at least in a considerable delay of the removal of pollutant particulates from the atmosphere. (orig.) [de

  7. Surface freezing of water

    OpenAIRE

    P?rez-D?az, J. L.; ?lvarez-Valenzuela, M. A.; Rodr?guez-Celis, F.

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered?exclusively?by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on ...

  8. Surface freezing of water.

    Science.gov (United States)

    Pérez-Díaz, J L; Álvarez-Valenzuela, M A; Rodríguez-Celis, F

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered-exclusively-by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on humidity, presenting at least three different types of surface crystals. Humidity triggers surface freezing as soon as it overpasses a defined value for a given temperature, generating a plurality of nucleation nodes. An evidence of simultaneous nucleation of surface ice crystals is also provided.

  9. Surface-water surveillance

    Energy Technology Data Exchange (ETDEWEB)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995).

  10. Surface-water surveillance

    International Nuclear Information System (INIS)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995)

  11. Utilization of satellite remote sensing data on land surface characteristics in water and heat balance component modeling for vegetation covered territories

    Science.gov (United States)

    Muzylev, Eugene; Uspensky, Alexander; Startseva, Zoya; Volkova, Elena; Kukharsky, Alexander; Uspensky, Sergey

    2010-05-01

    The model of vertical water and heat transfer in the "soil-vegetation-atmosphere" system (SVAT) for vegetation covered territory has been developed, allowing assimilating satellite remote sensing data on land surface condition as well as accounting for heterogeneities of vegetation and meteorological characteristics. The model provides the calculation of water and heat balance components (such as evapotranspiration Ev, soil water content W, sensible and latent heat fluxes and others ) as well as vertical soil moisture and temperature distributions, temperatures of soil surface and foliage, land surface brightness temperature for any time interval within vegetation season. To describe the landscape diversity soil constants and leaf area index LAI, vegetation cover fraction B, and other vegetation characteristics are used. All these values are considered to be the model parameters. Territory of Kursk region with square about 15 thousands km2 situated in the Black Earth zone of Central Russia was chosen for investigation. Satellite-derived estimates of land surface characteristics have been constructed under cloud-free condition basing AVHRR/NOAA, MODIS/EOS Terra and EOS Aqua, SEVIRI/Meteosat-8, -9 data. The developed technologies of AVHRR data thematic processing have been refined providing the retrieval of surface skin brightness temperature Tsg, air foliage temperature Ta, efficient surface temperature Ts.eff and emissivity E, as well as derivation of vegetation index NDVI, B, and LAI. The linear regression estimators for Tsg, Ta and LAI have been built using representative training samples for 2003-2009 vegetation seasons. The updated software package has been applied for AVHRR data thematic processing to generate named remote sensing products for various dates of the above vegetation seasons. The error statistics of Ta, Ts.eff and Тsg derivation has been investigated for various samples using comparison with in-situ measurements that has given RMS errors in the

  12. Surface Water in Hawaii

    Science.gov (United States)

    Oki, Delwyn S.

    2003-01-01

    Surface water in Hawaii is a valued resource as well as a potential threat to human lives and property. The surface-water resources of Hawaii are of significant economic, ecologic, cultural, and aesthetic importance. Streams supply more than 50 percent of the irrigation water in Hawaii, and although streams supply only a few percent of the drinking water statewide, surface water is the main source of drinking water in some places. Streams also are a source of hydroelectric power, provide important riparian and instream habitats for many unique native species, support traditional and customary Hawaiian gathering rights and the practice of taro cultivation, and possess valued aesthetic qualities. Streams affect the physical, chemical, and aesthetic quality of receiving waters, such as estuaries, bays, and nearshore waters, which are critical to the tourism-based economy of the islands. Streams in Hawaii pose a danger because of their flashy nature; a stream's stage, or water level, can rise several feet in less than an hour during periods of intense rainfall. Streams in Hawaii are flashy because rainfall is intense, drainage basins are small, basins and streams are steep, and channel storage is limited. Streamflow generated during periods of heavy rainfall has led to loss of property and human lives in Hawaii. Most Hawaiian streams originate in the mountainous interiors of the islands and terminate at the coast. Streams are significant sculptors of the Hawaiian landscape because of the erosive power of the water they convey. In geologically young areas, such as much of the southern part of the island of Hawaii, well-defined stream channels have not developed because the permeability of the surface rocks generally is so high that rainfall infiltrates before flowing for significant distances on the surface. In geologically older areas that have received significant rainfall, streams and mass wasting have carved out large valleys.

  13. Water on graphene surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Gordillo, M C [Departamento de Sistemas Fisicos, Quimicos y Naturales, Facultad de Ciencias Experimentales, Universidad Pablo de Olavide, Carretera de Utrera, km 1, E-41013 Sevilla (Spain); Marti, J, E-mail: cgorbar@upo.e, E-mail: jordi.marti@upc.ed [Departament de Fisica i Enginyeria Nuclear, Universitat Politecnica de Catalunya, B4-B5 Campus Nord, E-08034 Barcelona, Catalonia (Spain)

    2010-07-21

    In this paper, we summarize the main results obtained in our group about the behavior of water confined inside or close to different graphene surfaces by means of molecular dynamics simulations. These include the inside and outside of carbon nanotubes, and the confinement inside a slit pore or a single graphene sheet. We paid special attention to some thermodynamical (binding energies), structural (hydrogen-bond distributions) and dynamic (infrared spectra) properties, and their comparison to their bulk counterparts.

  14. Water at surfaces with tunable surface chemistries

    Science.gov (United States)

    Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

    2018-03-01

    Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

  15. Sustaining dry surfaces under water

    DEFF Research Database (Denmark)

    Jones, Paul R.; Hao, Xiuqing; Cruz-Chu, Eduardo R.

    2015-01-01

    Rough surfaces immersed under water remain practically dry if the liquid-solid contact is on roughness peaks, while the roughness valleys are filled with gas. Mechanisms that prevent water from invading the valleys are well studied. However, to remain practically dry under water, additional...... mechanisms need consideration. This is because trapped gas (e.g. air) in the roughness valleys can dissolve into the water pool, leading to invasion. Additionally, water vapor can also occupy the roughness valleys of immersed surfaces. If water vapor condenses, that too leads to invasion. These effects have...... not been investigated, and are critically important to maintain surfaces dry under water.In this work, we identify the critical roughness scale, below which it is possible to sustain the vapor phase of water and/or trapped gases in roughness valleys – thus keeping the immersed surface dry. Theoretical...

  16. Water on a Hydrophobic surface

    Science.gov (United States)

    Scruggs, Ryan; Zhu, Mengjue; Poynor, Adele

    2012-02-01

    Hydrophobicity, meaning literally fear of water, is exhibited on the surfaces of non-stick cooking pans and water resistant clothing, on the leaves of the lotus plan, or even during the protein folding process in our bodies. Hydrophobicity is directly measured by determining a contact angle between water and an objects surface. Associated with a hydrophobic surface is the depletion layer, a low density region approximately 0.2 nm thick. We study this region by comparing data found in lab using surface plasmon resonance techniques to theoretical calculations. Experiments use gold slides coated in ODT and Mercapto solutions to model both hydrophobic and hydrophilic surfaces respectively.

  17. Surfaces: processing, coating, decontamination, pollution, etc. Surface mastering to prevent component corrosion; Surfaces: traitement, revetements, decontamination, pollution, etc. Maitrise de la surface pour prevenir la corrosion des composants

    Energy Technology Data Exchange (ETDEWEB)

    Foucault, M. [Departement Corrosion Chimie, AREVA Centre Technique, BP 181, 71205 Le Creusot (France)

    2012-07-01

    In the primary and secondary circuits of nuclear Pressurized Water Reactors, AREVA uses several nickel-based alloys or austenitic stainless steels for the manufacture of safety components. The experience feedback of the last twenty years allows us to point out the major role hold by the component surface state in their life duration. In this paper, we present four examples of problem encountered and solved by a surface study and the definition and implementation of processes for the surface control of the repaired components. Then, we propose some ideas about the present needs in term of analysis means to improve the surface knowledge and control of the manufactured components. (author)

  18. Wetland Surface Water Processes

    National Research Council Canada - National Science Library

    1993-01-01

    .... Temporary storage includes channel, overbank, basin, and groundwater storage. Water is removed from the wetland through evaporation, plant transpiration, channel, overland and tidal flow, and groundwater recharge...

  19. Total Nitrogen in Surface Water

    Data.gov (United States)

    U.S. Environmental Protection Agency — Excess nitrogen in surface water can result in eutrophication. TOTALN is reported in kilograms/hectare/year. More information about these resources, including the...

  20. Total Phosphorus in Surface Water

    Data.gov (United States)

    U.S. Environmental Protection Agency — Excess phosphorus in surface water can result in eutrophication. TOTALP is reported in kilograms/hectare/year. More information about these resources, including the...

  1. Free Surface Water Tunnel (FSWT)

    Data.gov (United States)

    Federal Laboratory Consortium — Description: The Free Surface Water Tunnel consists of the intake plenum, the test section and the exit plenum. The intake plenum starts with a perforated pipe that...

  2. Surface roughness considerations for atmospheric correction of ocean color sensors. I - The Rayleigh-scattering component. II - Error in the retrieved water-leaving radiance

    Science.gov (United States)

    Gordon, Howard R.; Wang, Menghua

    1992-01-01

    The first step in the Coastal Zone Color Scanner (CZCS) atmospheric-correction algorithm is the computation of the Rayleigh-scattering (RS) contribution, L sub r, to the radiance leaving the top of the atmosphere over the ocean. In the present algorithm, L sub r is computed by assuming that the ocean surface is flat. Calculations of the radiance leaving an RS atmosphere overlying a rough Fresnel-reflecting ocean are presented to evaluate the radiance error caused by the flat-ocean assumption. Simulations are carried out to evaluate the error incurred when the CZCS-type algorithm is applied to a realistic ocean in which the surface is roughened by the wind. In situations where there is no direct sun glitter, it is concluded that the error induced by ignoring the Rayleigh-aerosol interaction is usually larger than that caused by ignoring the surface roughness. This suggests that, in refining algorithms for future sensors, more effort should be focused on dealing with the Rayleigh-aerosol interaction than on the roughness of the sea surface.

  3. Dependence of partial molecules surface area on the third component in lyotropic liquid crystals

    International Nuclear Information System (INIS)

    Badalyan, H.G.; Ghazaryan, Kh.M.; Yayloyan, S.M.

    2015-01-01

    Free surface of one amphiphilic molecule head of a lyotropic liquid crystal has been investigated by X-Ray diffraction method, at small and large angles, in the presence of the third component. The pentadecilsulphonat-water system in the presence of cholesterol as well as the lecithin-water system in the presence of decanol were investigated. It is shown that the above mentioned free surface decreases if the cholesterol concentration increases, while this surface increases in the case of water concentration increase. However, it increases slower than in the case of the two-component system. The same is observed for the lecithin-water-decanol system

  4. Controllability of Surface Water Networks

    Science.gov (United States)

    Riasi, M. Sadegh; Yeghiazarian, Lilit

    2017-12-01

    To sustainably manage water resources, we must understand how to control complex networked systems. In this paper, we study surface water networks from the perspective of structural controllability, a concept that integrates classical control theory with graph-theoretic formalism. We present structural controllability theory and compute four metrics: full and target controllability, control centrality and control profile (FTCP) that collectively determine the structural boundaries of the system's control space. We use these metrics to answer the following questions: How does the structure of a surface water network affect its controllability? How to efficiently control a preselected subset of the network? Which nodes have the highest control power? What types of topological structures dominate controllability? Finally, we demonstrate the structural controllability theory in the analysis of a wide range of surface water networks, such as tributary, deltaic, and braided river systems.

  5. Groundwater–Surface Water Exchange

    DEFF Research Database (Denmark)

    Karan, Sachin

    The exchange of groundwater-surface water has been invetigated in the western part of Denmark. Holtum AA provides the framework for all the performed investigations. Several methods are used, primarily eld based measurements ombined with numerical models to achieve insight to the governing...... processes of interaction between groundwater and surface water. By using heat as a tracer it has been possible to use temperature directly as calibrationtargets in a groundwater and heat transport model. Thus, it is possible to use heat investigate the change in groundwater discharge in dynamic conditions...... by using simple temperature devices along a stream to delineate the areas of interest in regard to GW{SW exchange. Thus, at several locations in a stream a temperature data logger was placed in the water column and right at the streambed-water interface. By looking at the correlation of streambed...

  6. Groundwater and surface water pollution

    Energy Technology Data Exchange (ETDEWEB)

    Chae, Y.S.; Hamidi, A. [eds.

    2000-07-01

    This book contains almost all the technical know-how that is required to clean up the water supply. It provides a survey of up-to-date technologies for remediation, as well as a step-by-step guide to pollution assessment for both ground and surface waters. In addition to focusing on causes, effects, and remedies, the book stresses reuse, recycling, and recovery of resources. The authors suggest that through total recycling wastes can become resources.

  7. Surface water quality assessment using factor analysis

    African Journals Online (AJOL)

    2006-01-16

    Jan 16, 2006 ... Surface water, groundwater quality assessment and environ- .... Urbanisation influences the water cycle through changes in flow and water ..... tion of aquatic life, CCME water quality Index 1, 0. User`s ... Water, Air Soil Pollut.

  8. Part 2: Surface water quality

    International Nuclear Information System (INIS)

    1997-01-01

    In 1996 the surface water quality measurements were performed, according to the Agreement, at 8 profiles on the Hungarian territory and at 15 profiles on the Slovak territory. Basic physical and chemical parameters (as water temperature, pH values, conductivity, suspended solids, cations and anions (nitrates, ammonium ion, nitrites, total nitrogen, phosphates, total phosphorus, oxygen and organic carbon regime parameters), metals (iron, manganese and heavy metals), biological and microbiological parameters (coliform bacteria, chlorophyll-a, saprobity index and other biological parameters) and quality of sediment were measured

  9. Assessment of drinking water quality using principal component ...

    African Journals Online (AJOL)

    Assessment of drinking water quality using principal component analysis and partial least square discriminant analysis: a case study at water treatment plants, ... water and to detect the source of pollution for the most revealing parameters.

  10. Water quality of the Chhoti Gandak River using principal component ...

    Indian Academy of Sciences (India)

    ; therefore water samples were collected to analyse its quality along the entire length of Chhoti Gandak. River. The principal components of water quality are controlled by lithology, gentle slope gradient, poor drainage, long residence of water, ...

  11. Surface modification method for reactor incore structural component

    International Nuclear Information System (INIS)

    Obata, Minoru; Sudo, Akira.

    1996-01-01

    A large number of metal or ceramic small spheres accelerated by pressurized air are collided against a surface of a reactor incore structures or a welded surface of the structural components, and then finishing is applied by polishing to form compression stresses on the surface. This can change residual stresses into compressive stress without increasing the strength of the surface. Accordingly, stress corrosion crackings of the incore structural components or welded portions thereof can be prevented thereby enabling to extend the working life of equipments. (T.M.)

  12. Impact of climate forcing uncertainty and human water use on global and continental water balance components

    Directory of Open Access Journals (Sweden)

    H. Müller Schmied

    2016-10-01

    Full Text Available The assessment of water balance components using global hydrological models is subject to climate forcing uncertainty as well as to an increasing intensity of human water use within the 20th century. The uncertainty of five state-of-the-art climate forcings and the resulting range of cell runoff that is simulated by the global hydrological model WaterGAP is presented. On the global land surface, about 62 % of precipitation evapotranspires, whereas 38 % discharges into oceans and inland sinks. During 1971–2000, evapotranspiration due to human water use amounted to almost 1 % of precipitation, while this anthropogenic water flow increased by a factor of approximately 5 between 1901 and 2010. Deviation of estimated global discharge from the ensemble mean due to climate forcing uncertainty is approximately 4 %. Precipitation uncertainty is the most important reason for the uncertainty of discharge and evapotranspiration, followed by shortwave downward radiation. At continental levels, deviations of water balance components due to uncertain climate forcing are higher, with the highest discharge deviations occurring for river discharge in Africa (−6 to 11 % from the ensemble mean. Uncertain climate forcings also affect the estimation of irrigation water use and thus the estimated human impact of river discharge. The uncertainty range of global irrigation water consumption amounts to approximately 50 % of the global sum of water consumption in the other water use sector.

  13. Water's Interfacial Hydrogen Bonding Structure Reveals the Effective Strength of Surface-Water Interactions.

    Science.gov (United States)

    Shin, Sucheol; Willard, Adam P

    2018-06-05

    We combine all-atom molecular dynamics simulations with a mean field model of interfacial hydrogen bonding to analyze the effect of surface-water interactions on the structural and energetic properties of the liquid water interface. We show that the molecular structure of water at a weakly interacting ( i.e., hydrophobic) surface is resistant to change unless the strength of surface-water interactions are above a certain threshold. We find that below this threshold water's interfacial structure is homogeneous and insensitive to the details of the disordered surface, however, above this threshold water's interfacial structure is heterogeneous. Despite this heterogeneity, we demonstrate that the equilibrium distribution of molecular orientations can be used to quantify the energetic component of the surface-water interactions that contribute specifically to modifying the interfacial hydrogen bonding network. We identify this specific energetic component as a new measure of hydrophilicity, which we refer to as the intrinsic hydropathy.

  14. Biological control component [Management of water hyacinth

    International Nuclear Information System (INIS)

    Harley, K.L.S.

    1981-01-01

    Both chemical and biological control have been used with limited success for the management of water hyacinth in Fiji. In some cases heavy application of chemicals have been successful in completely killing limited areas of water hyacinth, but have resulted in the destruction of biological agents introduced to control the water hyacinth and high contamination of natural water supplies. It is proposed that under the direction of Mr S R Singh, the Senior Research Scientist (Entomology) of the Koronivia Research Station, Suva, Fiji, a collaborative programme with Dr Harley of Australia on chemical and biological control of water hyacinth be initiated. This programme would be fundamentally short-term with the prime objective being an investigation of levels of insect population following varying levels of application of chemical sprays. By comparison with control areas, observations would be made of both chemical damage and insect damage within the limited time span of the period

  15. Modelling global fresh surface water temperature

    NARCIS (Netherlands)

    Beek, L.P.H. van; Eikelboom, T.; Vliet, M.T.H. van; Bierkens, M.F.P.

    2011-01-01

    Temperature directly determines a range of water physical properties including vapour pressure, surface tension, density and viscosity, and the solubility of oxygen and other gases. Indirectly water temperature acts as a strong control on fresh water biogeochemistry, influencing sediment

  16. Groundwater-surface water interaction

    International Nuclear Information System (INIS)

    White, P.A.; Clausen, B.; Hunt, B.; Cameron, S.; Weir, J.J.

    2001-01-01

    This chapter discusses natural and modified interactions between groundwater and surface water. Theory on recharge to groundwater from rivers is introduced, and the relative importance of groundwater recharge from rivers is illustrated with an example from the Ngaruroro River, Hawke's Bay. Some of the techniques used to identify and measure recharge to groundwater from gravel-bed rivers will be outlined, with examples from the Ngaruroro River, where the recharge reach is relatively well defined, and from the Rakaia River, where it is poorly defined. Groundwater recharged from rivers can have characteristic chemical and isotopic signatures, as shown by Waimakariri River water in the Christchurch-West Melton groundwater system. The incorporation of groundwater-river interaction in a regional groundwater flow model is outlined for the Waimea Plains, and relationships between river scour and groundwater recharge are examined for the Waimakariri River. Springs are the result of natural discharge from groundwater systems and are important water sources. The interactions between groundwater systems, springs, and river flow for the Avon River in New Zealand will be outlined. The theory of depletion of stream flow by groundwater pumpage will be introduced with a case study from Canterbury, and salt-water intrusion into groundwater systems with examples from Nelson and Christchurch. The theory of artificial recharge to groundwater systems is introduced with a case study from Hawke's Bay. Wetlands are important to flora, and the relationship of the wetland environment to groundwater hydrology will be discussed, with an example from the South Taupo wetland. (author). 56 refs., 25 figs., 3 tabs

  17. Analytical characterization of selective benthic flux components in estuarine and coastal waters

    Science.gov (United States)

    King, Jeffrey N.

    2011-01-01

    Benthic flux is the rate of flow across the bed of a water body, per unit area of bed. It is forced by component mechanisms, which interact. For example, pressure gradients across the bed, forced by tide, surface gravity waves, density gradients, bed–current interaction, turbulence, and terrestrial hydraulic gradients, drive an advective benthic flux of water and constituents between estuarine and coastal waters, and surficial aquifers. Other mechanisms also force benthic flux, such as chemical gradients, bioturbation, and dispersion. A suite of component mechanisms force a total benthic flux at any given location, where each member of the suite contributes a component benthic flux. Currently, the types and characteristics of component interactions are not fully understood. For example, components may interact linearly or nonlinearly, and the interaction may be constructive or destructive. Benthic flux is a surface water–groundwater interaction process. Its discharge component to a marine water body is referred to, in some literature, as submarine groundwater discharge. Benthic flux is important in characterizing water and constituent budgets of estuarine and coastal systems. Analytical models to characterize selective benthic flux components are reviewed. Specifically, these mechanisms are for the component associated with the groundwater tidal prism, and forced by surface gravity wave setup, surface gravity waves on a plane bed, and the terrestrial hydraulic gradient. Analytical models are applied to the Indian River Lagoon, Florida; Great South Bay, New York; and the South Atlantic Bight in South Carolina and portions of North Carolina.

  18. Principal Component Surface (2011) for Fish Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Fish Bay, St. John in the U.S. Virgin Islands (USVI). It was...

  19. Principal Component Surface (2011) for Coral Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Coral Bay, St. John in the U.S. Virgin Islands (USVI). It was...

  20. Early micromovement of the Articular Surface Replacement (ASR) femoral component

    DEFF Research Database (Denmark)

    Penny, J O; Ding, M; Varmarken, J E

    2012-01-01

    Radiostereometric analysis (RSA) can detect early micromovement in unstable implant designs which are likely subsequently to have a high failure rate. In 2010, the Articular Surface Replacement (ASR) was withdrawn because of a high failure rate. In 19 ASR femoral components, the mean micromovement...

  1. Adaptive ultrasonic imaging with the total focusing method for inspection of complex components immersed in water

    Science.gov (United States)

    Le Jeune, L.; Robert, S.; Dumas, P.; Membre, A.; Prada, C.

    2015-03-01

    In this paper, we propose an ultrasonic adaptive imaging method based on the phased-array technology and the synthetic focusing algorithm Total Focusing Method (TFM). The general principle is to image the surface by applying the TFM algorithm in a semi-infinite water medium. Then, the reconstructed surface is taken into account to make a second TFM image inside the component. In the surface reconstruction step, the TFM algorithm has been optimized to decrease computation time and to limit noise in water. In the second step, the ultrasonic paths through the reconstructed surface are calculated by the Fermat's principle and an iterative algorithm, and the classical TFM is applied to obtain an image inside the component. This paper presents several results of TFM imaging in components of different geometries, and a result obtained with a new technology of probes equipped with a flexible wedge filled with water (manufactured by Imasonic).

  2. Nonzero Ideal Gas Contribution to the Surface Tension of Water.

    Science.gov (United States)

    Sega, Marcello; Fábián, Balázs; Jedlovszky, Pál

    2017-06-15

    Surface tension, the tendency of fluid interfaces to behave elastically and minimize their surface, is routinely calculated as the difference between the lateral and normal components of the pressure or, invoking isotropy in momentum space, of the virial tensor. Here we show that the anisotropy of the kinetic energy tensor close to a liquid-vapor interface can be responsible for a large part of its surface tension (about 15% for water, independent from temperature).

  3. An ontology for component-based models of water resource systems

    Science.gov (United States)

    Elag, Mostafa; Goodall, Jonathan L.

    2013-08-01

    Component-based modeling is an approach for simulating water resource systems where a model is composed of a set of components, each with a defined modeling objective, interlinked through data exchanges. Component-based modeling frameworks are used within the hydrologic, atmospheric, and earth surface dynamics modeling communities. While these efforts have been advancing, it has become clear that the water resources modeling community in particular, and arguably the larger earth science modeling community as well, faces a challenge of fully and precisely defining the metadata for model components. The lack of a unified framework for model component metadata limits interoperability between modeling communities and the reuse of models across modeling frameworks due to ambiguity about the model and its capabilities. To address this need, we propose an ontology for water resources model components that describes core concepts and relationships using the Web Ontology Language (OWL). The ontology that we present, which is termed the Water Resources Component (WRC) ontology, is meant to serve as a starting point that can be refined over time through engagement by the larger community until a robust knowledge framework for water resource model components is achieved. This paper presents the methodology used to arrive at the WRC ontology, the WRC ontology itself, and examples of how the ontology can aid in component-based water resources modeling by (i) assisting in identifying relevant models, (ii) encouraging proper model coupling, and (iii) facilitating interoperability across earth science modeling frameworks.

  4. Evaluating the hydrological consistency of satellite based water cycle components

    KAUST Repository

    Lopez Valencia, Oliver Miguel

    2016-06-15

    Advances in multi-satellite based observations of the earth system have provided the capacity to retrieve information across a wide-range of land surface hydrological components and provided an opportunity to characterize terrestrial processes from a completely new perspective. Given the spatial advantage that space-based observations offer, several regional-to-global scale products have been developed, offering insights into the multi-scale behaviour and variability of hydrological states and fluxes. However, one of the key challenges in the use of satellite-based products is characterizing the degree to which they provide realistic and representative estimates of the underlying retrieval: that is, how accurate are the hydrological components derived from satellite observations? The challenge is intrinsically linked to issues of scale, since the availability of high-quality in-situ data is limited, and even where it does exist, is generally not commensurate to the resolution of the satellite observation. Basin-scale studies have shown considerable variability in achieving water budget closure with any degree of accuracy using satellite estimates of the water cycle. In order to assess the suitability of this type of approach for evaluating hydrological observations, it makes sense to first test it over environments with restricted hydrological inputs, before applying it to more hydrological complex basins. Here we explore the concept of hydrological consistency, i.e. the physical considerations that the water budget impose on the hydrologic fluxes and states to be temporally and spatially linked, to evaluate the reproduction of a set of large-scale evaporation (E) products by using a combination of satellite rainfall (P) and Gravity Recovery and Climate Experiment (GRACE) observations of storage change, focusing on arid and semi-arid environments, where the hydrological flows can be more realistically described. Our results indicate no persistent hydrological

  5. Effect of water table dynamics on land surface hydrologic memory

    Science.gov (United States)

    Lo, Min-Hui; Famiglietti, James S.

    2010-11-01

    The representation of groundwater dynamics in land surface models has received considerable attention in recent years. Most studies have found that soil moisture increases after adding a groundwater component because of the additional supply of water to the root zone. However, the effect of groundwater on land surface hydrologic memory (persistence) has not been explored thoroughly. In this study we investigate the effect of water table dynamics on National Center for Atmospheric Research Community Land Model hydrologic simulations in terms of land surface hydrologic memory. Unlike soil water or evapotranspiration, results show that land surface hydrologic memory does not always increase after adding a groundwater component. In regions where the water table level is intermediate, land surface hydrologic memory can even decrease, which occurs when soil moisture and capillary rise from groundwater are not in phase with each other. Further, we explore the hypothesis that in addition to atmospheric forcing, groundwater variations may also play an important role in affecting land surface hydrologic memory. Analyses show that feedbacks of groundwater on land surface hydrologic memory can be positive, negative, or neutral, depending on water table dynamics. In regions where the water table is shallow, the damping process of soil moisture variations by groundwater is not significant, and soil moisture variations are mostly controlled by random noise from atmospheric forcing. In contrast, in regions where the water table is very deep, capillary fluxes from groundwater are small, having limited potential to affect soil moisture variations. Therefore, a positive feedback of groundwater to land surface hydrologic memory is observed in a transition zone between deep and shallow water tables, where capillary fluxes act as a buffer by reducing high-frequency soil moisture variations resulting in longer land surface hydrologic memory.

  6. Microclimatic models. Estimation of components of the energy balance over land surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Heikinheimo, M.; Venaelaeinen, A.; Tourula, T. [Finnish Meteorological Inst., Helsinki (Finland). Air Quality Dept.

    1996-12-31

    Climates at regional scale are strongly dependent on the interaction between atmosphere and its lower boundary, the oceans and the land surface mosaic. Land surfaces influence climate through their albedo, and the aerodynamic roughness, the processes of the biosphere and many soil hydrological properties; all these factors vary considerably geographically. Land surfaces receive a certain portion of the solar irradiance depending on the cloudiness, atmospheric transparency and surface albedo. Short-wave solar irradiance is the source of the heat energy exchange at the earth`s surface and also regulates many biological processes, e.g. photosynthesis. Methods for estimating solar irradiance, atmospheric transparency and surface albedo were reviewed during the course of this project. The solar energy at earth`s surface is consumed for heating the soil and the lower atmosphere. Where moisture is available, evaporation is one of the key components of the surface energy balance, because the conversion of liquid water into water vapour consumes heat. The evaporation process was studied by carrying out field experiments and testing parameterisation for a cultivated agricultural surface and for lakes. The micrometeorological study over lakes was carried out as part of the international `Northern Hemisphere Climatic Processes Experiment` (NOPEX/BAHC) in Sweden. These studies have been aimed at a better understanding of the energy exchange processes of the earth`s surface-atmosphere boundary for a more accurate and realistic parameterisation of the land surface in atmospheric models

  7. Microclimatic models. Estimation of components of the energy balance over land surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Heikinheimo, M; Venaelaeinen, A; Tourula, T [Finnish Meteorological Inst., Helsinki (Finland). Air Quality Dept.

    1997-12-31

    Climates at regional scale are strongly dependent on the interaction between atmosphere and its lower boundary, the oceans and the land surface mosaic. Land surfaces influence climate through their albedo, and the aerodynamic roughness, the processes of the biosphere and many soil hydrological properties; all these factors vary considerably geographically. Land surfaces receive a certain portion of the solar irradiance depending on the cloudiness, atmospheric transparency and surface albedo. Short-wave solar irradiance is the source of the heat energy exchange at the earth`s surface and also regulates many biological processes, e.g. photosynthesis. Methods for estimating solar irradiance, atmospheric transparency and surface albedo were reviewed during the course of this project. The solar energy at earth`s surface is consumed for heating the soil and the lower atmosphere. Where moisture is available, evaporation is one of the key components of the surface energy balance, because the conversion of liquid water into water vapour consumes heat. The evaporation process was studied by carrying out field experiments and testing parameterisation for a cultivated agricultural surface and for lakes. The micrometeorological study over lakes was carried out as part of the international `Northern Hemisphere Climatic Processes Experiment` (NOPEX/BAHC) in Sweden. These studies have been aimed at a better understanding of the energy exchange processes of the earth`s surface-atmosphere boundary for a more accurate and realistic parameterisation of the land surface in atmospheric models

  8. Surface temperature measurement of plasma facing components in tokamaks

    International Nuclear Information System (INIS)

    Amiel, Stephane

    2014-01-01

    During this PhD, the challenges on the non-intrusive surface temperature measurements of metallic plasma facing components in tokamaks are reported. Indeed, a precise material emissivity value is needed for classical infrared methods and the environment contribution has to be known particularly for low emissivities materials. Although methods have been developed to overcome these issues, they have been implemented solely for dedicated experiments. In any case, none of these methods are suitable for surface temperature measurement in tokamaks.The active pyrometry introduced in this study allows surface temperature measurements independently of reflected flux and emissivities using pulsed and modulated photothermal effect. This method has been validated in laboratory on metallic materials with reflected fluxes for pulsed and modulated modes. This experimental validation is coupled with a surface temperature variation induced by photothermal effect and temporal signal evolvement modelling in order to optimize both the heating source characteristics and the data acquisition and treatment. The experimental results have been used to determine the application range in temperature and detection wavelengths. In this context, the design of an active pyrometry system on tokamak has been completed, based on a bicolor camera for a thermography application in metallic (or low emissivity) environment.The active pyrometry method introduced in this study is a complementary technique of classical infrared methods used for thermography in tokamak environment which allows performing local and 2D surface temperature measurements independently of reflected fluxes and emissivities. (author) [fr

  9. Surface composition of biomedical components by ion beam analysis

    International Nuclear Information System (INIS)

    Kenny, M.J.; Wielunski, L.S.; Baxter, G.R.

    1991-01-01

    Materials used for replacement body parts must satisfy a number of requirements such as biocompatibility and mechanical ability to handle the task with regard to strength, wear and durability. When using a CVD coated carbon fibre reinforced carbon ball, the surface must be ion implanted with uniform dose of nitrogen ions in order to make it wear resistant. The mechanism by which the wear resistance is improved is one of radiation damage and the required dose of about 10 16 cm -2 can have a tolerance of about 20%. To implant a spherical surface requires manipulation of the sample within the beam and control system (either computer or manually operated) to enable uniform dose all the way from polar to equatorial regions on the surface. A manipulator has been designed and built for this purpose. In order to establish whether the dose is uniform, nuclear reaction analysis using the reaction 14 N(d,α) 12 C is an ideal method of profiling. By taking measurements at a number of points on the surface, the uniformity of nitrogen dose can be ascertained. It is concluded that both Rutherford Backscattering and Nuclear Reaction Analysis can be used for rapid analysis of surface composition of carbon based materials used for replacement body components. 2 refs., 2 figs

  10. Fine and coarse components in surface sediments from Bikini Lagoon

    Energy Technology Data Exchange (ETDEWEB)

    Noshkin, V. E., LLNL

    1997-01-01

    In 1979, 21 years after the moratorium on nuclear testing in the Marshall Islands, surface sediment samples (to depths of 2 and 4 cm) were collected from 87 locations in the lagoon of Bikini Atoll, one of the two sites in the Marshall Islands used by the United States to test nuclear devices from 1946 through 1958. The main purpose for the collections was to map the distribution of long-lived man-made radionuclides associated with the bottom material. In addition the samples were processed to estimate the fraction of fine and coarse components to show, by comparison, what modifications occurred in the composition since the sediments were first described in samples collected before testing in 1946. Nuclear testing produced more finely divided material that is now found in the surface sediment layer over large areas of the lagoon and especially in regions of the lagoon and reef adjacent to test sites. The 5 cratering events alone at Bikini Atoll redistributed sufficient material to account for the higher inventory of fine material found over the surface 4 cm of the sediment of the lagoon. Although the fraction of fine material in the bottom sediments was altered by the nuclear events, the combined processes of formation, transport and deposition were not sufficiently dynamic to greatly change the general geographical features of the major sedimentary components over most of the lagoon floor.

  11. Liquid Water may Stick on Hydrophobic Surfaces

    Indian Academy of Sciences (India)

    IAS Admin

    Common Perception. A surface can be classified as. > Wetting. > Non-wetting. Depending on the spreading characteristics of a droplet of water that splashes on the surface. The behavior of fluid on a solid surface under static and dynamic ..... color of the number density profile. Ions at the interface tend to form pinning zones ...

  12. Design and Application of an Ontology for Component-Based Modeling of Water Systems

    Science.gov (United States)

    Elag, M.; Goodall, J. L.

    2012-12-01

    Many Earth system modeling frameworks have adopted an approach of componentizing models so that a large model can be assembled by linking a set of smaller model components. These model components can then be more easily reused, extended, and maintained by a large group of model developers and end users. While there has been a notable increase in component-based model frameworks in the Earth sciences in recent years, there has been less work on creating framework-agnostic metadata and ontologies for model components. Well defined model component metadata is needed, however, to facilitate sharing, reuse, and interoperability both within and across Earth system modeling frameworks. To address this need, we have designed an ontology for the water resources community named the Water Resources Component (WRC) ontology in order to advance the application of component-based modeling frameworks across water related disciplines. Here we present the design of the WRC ontology and demonstrate its application for integration of model components used in watershed management. First we show how the watershed modeling system Soil and Water Assessment Tool (SWAT) can be decomposed into a set of hydrological and ecological components that adopt the Open Modeling Interface (OpenMI) standard. Then we show how the components can be used to estimate nitrogen losses from land to surface water for the Baltimore Ecosystem study area. Results of this work are (i) a demonstration of how the WRC ontology advances the conceptual integration between components of water related disciplines by handling the semantic and syntactic heterogeneity present when describing components from different disciplines and (ii) an investigation of a methodology by which large models can be decomposed into a set of model components that can be well described by populating metadata according to the WRC ontology.

  13. Pesticide volatilization from small surface waters : rationale of a new parameterization for TOXSWA

    NARCIS (Netherlands)

    Jacobs, C.M.J.; Adriaanse, P.I.

    2012-01-01

    In the TOXSWA (TOXic substances in Surface WAters) model volatilization of pesticides from surface water is computed because it may be an important component of the mass balance of pesticides in water bodies. Here, we briefly review the physics of air-water gas exchange relevant in this context. A

  14. Surface Water Quality Monitoring Sites

    Data.gov (United States)

    Minnesota Department of Natural Resources — The MN Department of Agriculture (MDA) is charged with periodically collecting and analyzing water samples from selected locations throughout the state to determine...

  15. Surface composition and surface properties of water hyacinth ...

    African Journals Online (AJOL)

    Surface composition and surface properties of water hyacinth ( Eichhornia ... (2/1, v/v) followed by ethanol, using Fourier Transform Infra-red (FT-IR) spectroscopy, ... polar organic solvents and non-polar n-alkane hydrocarbons is discussed.

  16. Waste water treatment in surface mines

    Energy Technology Data Exchange (ETDEWEB)

    Navasardyants, M A; Esipov, V Z; Ryzhkov, Yu A

    1981-01-01

    This paper evaluates problems associated with waste water from coal surface mines of the Kemerovougol' association in the Kuzbass. Waste water treatment in the Kuzbass is of major importance as the region is supplied with water from only one river, the Tom river. Water influx to Kemerovougol' surface mines in a year amounts to 136 million m/sup 3/. The water is used during technological processes, for fire fighting, and spraying to prevent dusting; the rest, about 82.1 million m/sup 3/, is discharged into surface waters. Of this amount, 25.1 million m/sup 3/ is heavily polluted water, 46.6 million m3 are polluted but within limits, and 10.4 million m/sup 3/ are characterized as relatively clean. Waste water is polluted with: suspended matters, oils and oil products, nitrates, nitrides and chlorides. Suspended matter content sometimes reaches 4,000 and 5,000 mg/l, and oil product content in water amounts to 2.17 mg/l. Water treatment in surface mines is two-staged: sumps and sedimentation tanks are used. Water with suspended matter content of 50 to 100 mg/l in winter and summer, and 200 to 250 mg/l in spring and autumn is reduced in sumps to 25 to 30 mg/l in summer and winter and to 40 to 50 mg/l in autumn and spring. During the first stage water treatment efficiency ranges from 50 to 80%. During the second stage water is collected in sedimentation tanks. It is noted that so-called secondary pollution is one of the causes of the relatively high level of suspended matter in discharged water. Water discharged from sedimentation tanks carries clay and loam particles from the bottom and walls of water tanks and channels.

  17. Water vapor retrieval over many surface types

    Energy Technology Data Exchange (ETDEWEB)

    Borel, C.C.; Clodius, W.C.; Johnson, J.

    1996-04-01

    In this paper we present a study of of the water vapor retrieval for many natural surface types which would be valuable for multi-spectral instruments using the existing Continuum Interpolated Band Ratio (CIBR) for the 940 nm water vapor absorption feature. An atmospheric code (6S) and 562 spectra were used to compute the top of the atmosphere radiance near the 940 nm water vapor absorption feature in steps of 2.5 nm as a function of precipitable water (PW). We derive a novel technique called ``Atmospheric Pre-corrected Differential Absorption`` (APDA) and show that APDA performs better than the CIBR over many surface types.

  18. Water reuse systems: A review of the principal components

    Science.gov (United States)

    Lucchetti, G.; Gray, G.A.

    1988-01-01

    Principal components of water reuse systems include ammonia removal, disease control, temperature control, aeration, and particulate filtration. Effective ammonia removal techniques include air stripping, ion exchange, and biofiltration. Selection of a particular technique largely depends on site-specific requirements (e.g., space, existing water quality, and fish densities). Disease control, although often overlooked, is a major problem in reuse systems. Pathogens can be controlled most effectively with ultraviolet radiation, ozone, or chlorine. Simple and inexpensive methods are available to increase oxygen concentration and eliminate gas supersaturation, these include commercial aerators, air injectors, and packed columns. Temperature control is a major advantage of reuse systems, but the equipment required can be expensive, particularly if water temperature must be rigidly controlled and ambient air temperature fluctuates. Filtration can be readily accomplished with a hydrocyclone or sand filter that increases overall system efficiency. Based on criteria of adaptability, efficiency, and reasonable cost, we recommend components for a small water reuse system.

  19. Clean Air Markets - Monitoring Surface Water Chemistry

    Science.gov (United States)

    Learn about how EPA uses Long Term Monitoring (LTM) and Temporily Integrated Monitoring of Ecosystems (TIME) to track the effect of the Clean Air Act Amendments on acidity of surface waters in the eastern U.S.

  20. Surface Waters Information Management System (SWIMS)

    Data.gov (United States)

    Kansas Data Access and Support Center — The Surface Waters Information Management System (SWIMS) has been designed to meet multi-agency hydrologic database needs for Kansas. The SWIMS project was supported...

  1. Soil Structure - A Neglected Component of Land-Surface Models

    Science.gov (United States)

    Fatichi, S.; Or, D.; Walko, R. L.; Vereecken, H.; Kollet, S. J.; Young, M.; Ghezzehei, T. A.; Hengl, T.; Agam, N.; Avissar, R.

    2017-12-01

    Soil structure is largely absent in most standard sampling and measurements and in the subsequent parameterization of soil hydraulic properties deduced from soil maps and used in Earth System Models. The apparent omission propagates into the pedotransfer functions that deduce parameters of soil hydraulic properties primarily from soil textural information. Such simple parameterization is an essential ingredient in the practical application of any land surface model. Despite the critical role of soil structure (biopores formed by decaying roots, aggregates, etc.) in defining soil hydraulic functions, only a few studies have attempted to incorporate soil structure into models. They mostly looked at the effects on preferential flow and solute transport pathways at the soil profile scale; yet, the role of soil structure in mediating large-scale fluxes remains understudied. Here, we focus on rectifying this gap and demonstrating potential impacts on surface and subsurface fluxes and system wide eco-hydrologic responses. The study proposes a systematic way for correcting the soil water retention and hydraulic conductivity functions—accounting for soil-structure—with major implications for near saturated hydraulic conductivity. Modification to the basic soil hydraulic parameterization is assumed as a function of biological activity summarized by Gross Primary Production. A land-surface model with dynamic vegetation is used to carry out numerical simulations with and without the role of soil-structure for 20 locations characterized by different climates and biomes across the globe. Including soil structure affects considerably the partition between infiltration and runoff and consequently leakage at the base of the soil profile (recharge). In several locations characterized by wet climates, a few hundreds of mm per year of surface runoff become deep-recharge accounting for soil-structure. Changes in energy fluxes, total evapotranspiration and vegetation productivity

  2. Ranking of risk significant components for the Davis-Besse Component Cooling Water System

    International Nuclear Information System (INIS)

    Seniuk, P.J.

    1994-01-01

    Utilities that run nuclear power plants are responsible for testing pumps and valves, as specified by the American Society of Mechanical Engineers (ASME) that are required for safe shutdown, mitigating the consequences of an accident, and maintaining the plant in a safe condition. These inservice components are tested according to ASME Codes, either the earlier requirements of the ASME Boiler and Pressure Vessel Code, Section XI, or the more recent requirements of the ASME Operation and Maintenance Code, Section IST. These codes dictate test techniques and frequencies regardless of the component failure rate or significance of failure consequences. A probabilistic risk assessment or probabilistic safety assessment may be used to evaluate the component importance for inservice test (IST) risk ranking, which is a combination of failure rate and failure consequences. Resources for component testing during the normal quarterly verification test or postmaintenance test are expensive. Normal quarterly testing may cause component unavailability. Outage testing may increase outage cost with no real benefit. This paper identifies the importance ranking of risk significant components in the Davis-Besse component cooling water system. Identifying the ranking of these risk significant IST components adds technical insight for developing the appropriate test technique and test frequency

  3. Water-cooled beam line components at LAMPF

    International Nuclear Information System (INIS)

    Grisham, D.L.; Lambert, J.E.

    1981-01-01

    The beam line components that comprise the main experimental beam at the Clinton P. Anderson Meson Physics Facility (LAMPF) have been operating since February 1976. This paper will define the functions of the primary water-cooled elements, their design evolution, and our operating experience to the present time

  4. Polyfluorinated chemicals in European surface waters, ground- and drinking waters

    NARCIS (Netherlands)

    Eschauzier, C.; de Voogt, P.; Brauch, H.-J.; Lange, F.T.; Knepper, T.P.; Lange, F.T.

    2012-01-01

    Polyfluorinated chemicals (PFCs), especially short chain fluorinated alkyl sulfonates and carboxylates, are ubiquitously found in the environment. This chapter aims at giving an overview of PFC concentrations found in European surface, ground- and drinking waters and their behavior during

  5. Surface water management at a mixed waste remediation site

    International Nuclear Information System (INIS)

    Schlotzhauer, D.S.; Warbritton, K.R.

    1991-01-01

    The Weldon Spring Remedial Action Project (WSSRAP) deals with chemical and radiological contaminants. MK-Ferguson Company is managing the project under contract with the US Department of Energy. Remedial activities include demolishing buildings, constructing material storage and staging areas, excavating and consolidating waste materials, and treating and disposing of the materials in a land disposal facility. Due to the excavation and construction required during remediation, a well-planned surface water management system is essential. Planning involves characterization of source areas and surface water transport mechanisms and identification of applicable regulations. System components include: erosion control sediment control, flow attenuation, and management of contaminated water. Combinations of these components may be utilized during actual construction and remediation to obtain optimum control. Monitoring is performed during implementation in order to assess the effectiveness of control measures. This management scheme provides for comprehensive management of surface water at this site by providing control and/or treatment to appropriate standards. Although some treatment methodologies for contaminated water are specific to site contaminants, this comprehensive program provides a management approach which is applicable to many remedial projects in order to minimize contaminant release and meet Clean Water Act requirements

  6. Radionuclide transfer onto ground surface in surface water flow, 1

    International Nuclear Information System (INIS)

    Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

    1991-07-01

    Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

  7. Manufacturing and characterisation of water repellent surfaces

    DEFF Research Database (Denmark)

    De Grave, Arnaud; Botija, Pablo; Hansen, Hans Nørgaard

    2006-01-01

    design criteria for such surfaces. The problem of adapting this behaviour to artificially roughened surfaces is addressed by providing design criteria for superhydrophobic, water-repellent and self-cleaning surfaces according to the concrete performance desired for them. Different kind of manufacturing...... techniques are investigated and the production of patterned micro structured surfaces following two different manufacturing techniques is reported. The first is a combination of laser manufacturing and hot embossing on polystyrene. To compare geometry and functionality a non-silicon based lithography...

  8. Aging and life extension of major light water reactor components

    International Nuclear Information System (INIS)

    Shah, V.N.; MacDonald, P.E.

    1993-01-01

    An understanding of the aging degradation of the major pressurized and boiling water reactor structures and components is given. The design and fabrication of each structure or component is briefly described followed by information on the associated stressors. Interactions between the design, materials and various stressors that cause aging degradation are reviewed. In many cases, aging degradation problems have occurred, and the plant experience to date is analyzed. The discussion summarize the available aging-related information and are supported with extensive references, including references to US Nuclear Regulatory Commission (USNRC) documents, Electric Power Research Institute reports, US and international conference proceedings and other publications

  9. Radioactivity in surface waters and its effects

    International Nuclear Information System (INIS)

    Stoeber, I.

    1987-01-01

    In consequence of the reactor accident in Chernobyl, the State Office for Water and Waste Disposal of North-Rhine Westphalia implemented immediate programmes for monitoring radioactivity in surface waters, including their sediments and organisms. Of the initially-measured radionuclides, only cesium-137, with its long half-life of 30 years, is of interest. Only trace amounts of the almost equally long-lived strontium 90 (half-life 28 years) were present in rainfall. Cs-137 is a non-natural-radionuclide, occurring solely as a by-product of nuclear installations and atomic bomb tests. Following the ban on surface testing of nuclear weapons, the Cs-137 content of surface waters had fallen significantly up to April 1986. The load due to the reactor disaster is of the same order of magnitude as that produced by atomic testing at the end of the nineteen-sixties. The paper surveys radioactive pollution of surface waters in North-Rhine Westphalia and its effects on water use, especially in regard to potable water supplies and the fish population. (orig./HSCH) [de

  10. Particle dry deposition to water surfaces: Processes and consequences

    DEFF Research Database (Denmark)

    Pryor, S.C.; Barthelmie, R.J.

    2000-01-01

    flux to coastal waters, atmosphere-surface exchange represents a significant component of the total flux and may be particularly critical during the summertime when both the riverine input and ambient nutrient concentrations are often at a minimum. In this chapter, we present an overview...... of the physical and chemical processes which dictate the quantity (and direction) of atmosphere-surface fluxes of trace chemicals to (and above) water surfaces with particular emphasis on the role of particles. Dry deposition (transfer to the surface in the absence of precipitation) of particles is determined...... efforts to simulate and measure fluxes close to the coastline. These arise in part from the complexity of atmospheric flow in this region where energy and chemical fluxes are highly inhomogeneous in space and time and thermally generated atmospheric circulations are commonplace. (C) 2000 Elsevier Science...

  11. Modelling raster-based monthly water balance components for Europe

    Energy Technology Data Exchange (ETDEWEB)

    Ulmen, C.

    2000-11-01

    The terrestrial runoff component is a comparatively small but sensitive and thus significant quantity in the global energy and water cycle at the interface between landmass and atmosphere. As opposed to soil moisture and evapotranspiration which critically determine water vapour fluxes and thus water and energy transport, it can be measured as an integrated quantity over a large area, i.e. the river basin. This peculiarity makes terrestrial runoff ideally suited for the calibration, verification and validation of general circulation models (GCMs). Gauging stations are not homogeneously distributed in space. Moreover, time series are not necessarily continuously measured nor do they in general have overlapping time periods. To overcome this problems with regard to regular grid spacing used in GCMs, different methods can be applied to transform irregular data to regular so called gridded runoff fields. The present work aims to directly compute the gridded components of the monthly water balance (including gridded runoff fields) for Europe by application of the well-established raster-based macro-scale water balance model WABIMON used at the Federal Institute of Hydrology, Germany. Model calibration and validation is performed by separated examination of 29 representative European catchments. Results indicate a general applicability of the model delivering reliable overall patterns and integrated quantities on a monthly basis. For time steps less then too weeks further research and structural improvements of the model are suggested. (orig.)

  12. Large Scale Evapotranspiration Estimates: An Important Component in Regional Water Balances to Assess Water Availability

    Science.gov (United States)

    Garatuza-Payan, J.; Yepez, E. A.; Watts, C.; Rodriguez, J. C.; Valdez-Torres, L. C.; Robles-Morua, A.

    2013-05-01

    Water security, can be defined as the reliable supply in quantity and quality of water to help sustain future populations and maintaining ecosystem health and productivity. Water security is rapidly declining in many parts of the world due to population growth, drought, climate change, salinity, pollution, land use change, over-allocation and over-utilization, among other issues. Governmental offices (such as the Comision Nacional del Agua in Mexico, CONAGUA) require and conduct studies to estimate reliable water balances at regional or continental scales in order to provide reasonable assessments of the amount of water that can be provided (from surface or ground water sources) to supply all the human needs while maintaining natural vegetation, on an operational basis and, more important, under disturbances, such as droughts. Large scale estimates of evapotranspiration (ET), a critical component of the water cycle, are needed for a better comprehension of the hydrological cycle at large scales, which, in most water balances is left as the residual. For operational purposes, such water balance estimates can not rely on ET measurements since they do not exist, should be simple and require the least ground information possible, information that is often scarce or does not exist at all. Given this limitation, the use of remotely sensed data to estimate ET could supplement the lack of ground information, particularly in remote regions In this study, a simple method, based on the Makkink equation is used to estimate ET for large areas at high spatial resolutions (1 km). The Makkink model used here is forced using three remotely sensed datasets. First, the model uses solar radiation estimates obtained from the Geostationary Operational Environmental Satellite (GOES); Second, the model uses an Enhanced Vegetation Index (EVI) obtained from the Moderate-resolution Imaging Spectroradiometer (MODIS) normalized to get an estimate for vegetation amount and land use which was

  13. Surface tension of normal and heavy water

    International Nuclear Information System (INIS)

    Straub, J.; Rosner, N.; Grigull, V.

    1980-01-01

    A Skeleton Table and simple interpolation equation for the surface tension of light water was developed by the Working Group III of the International Association for the Properties of Steam and is recommended as an International Standard. The Skeleton Table is based on all known measurements of the surface tension and individual data were weighted corresponding to the accuracy of the measurements. The form of the interpolation equation is based on a physical concept. It represents an extension of van der Waals-equation, where the exponent conforms to the 'Scaling Laws'. In addition for application purposes simple relations for the Laplace-coefficient and for the density difference between the liquid and gaseous phases of light water are given. The same form of interpolation equation for the surface tension can be used for heavy water, for which the coefficients are given. However, this equation is based only on a single set of data. (orig.) [de

  14. Effect of cooling water on stability of NLC linac components

    Energy Technology Data Exchange (ETDEWEB)

    F. Le Pimpec et al.

    2003-02-11

    Vertical vibration of linac components (accelerating structures, girders and quadrupoles) in the NLC has been studied experimentally and analytically. Effects such as structural resonances and vibration caused by cooling water both in accelerating structures and quadrupoles have been considered. Experimental data has been compared with analytical predictions and simulations using ANSYS. A design, incorporating the proper decoupling of structure vibrations from the linac quadrupoles, is being pursued.

  15. Effect of Cooling Water on Stability of NLC Linac Components

    Energy Technology Data Exchange (ETDEWEB)

    Le Pimpec, Frederic

    2002-11-01

    Vertical vibration of linac components (accelerating structures, girders and quadrupoles) in the NLC has been studied experimentally and analytically. Effects such as structural resonances and vibration caused by cooling water both in accelerating structures and quadrupoles have been considered. Experimental data has been compared with analytical predictions and simulations using ANSYS. A design, incorporating the proper decoupling of structure vibrations from the linac quadrupoles, is being pursued.

  16. Cosine components in water levels at Yucca Mountain

    International Nuclear Information System (INIS)

    Rice, J.; Lehman, L.; Keen, K.

    1990-01-01

    Water-level records from wells at Yucca Mountain, Nevada are analyzed periodically to determine if they contain periodic (cosine) components. Water-level data from selected wells are input to an iterative numerical procedure that determines a best fitting cosine function. The available water-level data, with coverage of up to 5 years, appear to be representative of the natural water-level changes. From our analysis of 9 water-level records, it appears that there may be periodic components (periods of 2-3 years) in the groundwater-level fluctuations at Yucca Mountain, Nevada, although some records are fit better than others by cosine functions. It also appears that the periodic behavior has a spatial distribution. Wells west of Yucca Mountain have different periods and phase shifts from wells on and east of Yucca Mountain. Interestingly, a similar spatial distribution of groundwater chemistry at Yucca Mountain is reported by Matuska (1988). This suggests a physical cause may underlie the different physical and chemical groundwater conditions. Although a variety of natural processes could cause water-level fluctuations, hydrologic processes are the most likely, because the periodicities are only a few years. A possible cause could be periodic recharge related to a periodicity in precipitation. It is interesting that Cochran et al., (1988), show a crude two-year cycle of precipitation for 1961 to 1970 in southern Nevada. Why periods and phase shifts may differ across Yucca Mountain is unknown. Different phase shifts could indicate different lag times of response to hydrologic stimuli. Difference in periods could mean that the geologic media is heterogeneous and displays heterogeneous response to a single stimulus, or that stimuli differ in certain regions, or that a hydraulic barrier separates the groundwater system into two regions having different water chemistry and recharge areas. 13 refs., 5 figs., 1 tab

  17. Electrolysis of water on (oxidized) metal surfaces

    DEFF Research Database (Denmark)

    Rossmeisl, Jan; Logadottir, Ashildur; Nørskov, Jens Kehlet

    2005-01-01

    Density functional theory calculations are used as the basis for an analysis of the electrochemical process, where by water is split to form molecular oxygen and hydrogen. We develop a method for obtaining the thermochemistry of the electrochemical water splitting process as a function of the bias...... directly from the electronic structure calculations. We consider electrodes of Pt(111) and Au(111) in detail and then discuss trends for a series of different metals. We show that the difficult step in the water splitting process is the formation of superoxy-type (OOH) species on the surface...... by the splitting of a water molecule on top an adsorbed oxygen atom. One conclusion is that this is only possible on metal surfaces that are (partly) oxidized. We show that the binding energies of the different intermediates are linearly correlated for a number of metals. In a simple analysis, where the linear...

  18. Occurrence of Surface Water Contaminations: An Overview

    Science.gov (United States)

    Shahabudin, M. M.; Musa, S.

    2018-04-01

    Water is a part of our life and needed by all organisms. As time goes by, the needs by human increased transforming water quality into bad conditions. Surface water contaminated in various ways which is pointed sources and non-pointed sources. Pointed sources means the source are distinguished from the source such from drains or factory but the non-pointed always occurred in mixed of elements of pollutants. This paper is reviewing the occurrence of the contaminations with effects that occurred around us. Pollutant factors from natural or anthropology factors such nutrients, pathogens, and chemical elements contributed to contaminations. Most of the effects from contaminated surface water contributed to the public health effects also to the environments.

  19. Surface Water Protection by Productive Buffers

    DEFF Research Database (Denmark)

    Christen, Benjamin

    Vegetated riparian buffer zones are a widely recommended best management practice in agriculture for protecting surface and coastal waters from diffuse nutrient pollution. On the background of the EU funded research project NitroEurope (NEU; www.NitroEurope.eu), this study concentrates...... on the mitigation of nitrogen pollution in surface and groundwater, using riparian buffer zones for biomass production. The objectives are to map suitable areas for buffer implementation across the six NEU study landscapes, model tentative N-loss mitigation, calculate biomass production potential and economic...... designed for local conditions could be a way of protecting water quality attractive to many stakeholders....

  20. Aging management of major light water reactor components

    International Nuclear Information System (INIS)

    Shah, V.N.; Sinha, U.P.; Ware, A.G.

    1992-01-01

    Review of technical literature and field experience has identified stress corrosion cracking as one of the major degradation mechanisms for the major light water reactor components. Three of the stress corrosion cracking mechanisms of current concern are (a) primary water stress corrosion cracking (PWSCC) in pressurized water reactors, and (b) intergranular stress corrosion cracking (IGSCC) and (c) irradiation-assisted stress corrosion cracking (IASCC) in boiling water reactors. Effective aging management of stress corrosion cracking mechanisms includes evaluation of interactions between design, materials, stressors, and environment; identification and ranking of susceptible sites; reliable inspection of any damage; assessment of damage rate; mitigation of damage; and repair and replacement using corrosion-resistant materials. Management of PWSCC includes use of lower operating temperatures, reduction in residual tensile stresses, development of reliable inspection techniques, and use of Alloy 690 as replacement material. Management of IGSCC of nozzle and attachment welds includes use of Alloy 82 as weld material, and potential use of hydrogen water chemistry. Management of IASCC also includes potential use of hydrogen water chemistry

  1. Surface-Water Conditions in Georgia, Water Year 2005

    Science.gov (United States)

    Painter, Jaime A.; Landers, Mark N.

    2007-01-01

    INTRODUCTION The U.S. Geological Survey (USGS) Georgia Water Science Center-in cooperation with Federal, State, and local agencies-collected surface-water streamflow, water-quality, and ecological data during the 2005 Water Year (October 1, 2004-September 30, 2005). These data were compiled into layers of an interactive ArcReaderTM published map document (pmf). ArcReaderTM is a product of Environmental Systems Research Institute, Inc (ESRI?). Datasets represented on the interactive map are * continuous daily mean streamflow * continuous daily mean water levels * continuous daily total precipitation * continuous daily water quality (water temperature, specific conductance dissolved oxygen, pH, and turbidity) * noncontinuous peak streamflow * miscellaneous streamflow measurements * lake or reservoir elevation * periodic surface-water quality * periodic ecological data * historical continuous daily mean streamflow discontinued prior to the 2005 water year The map interface provides the ability to identify a station in spatial reference to the political boundaries of the State of Georgia and other features-such as major streams, major roads, and other collection stations. Each station is hyperlinked to a station summary showing seasonal and annual stream characteristics for the current year and for the period of record. For continuous discharge stations, the station summary includes a one page graphical summary page containing five graphs, a station map, and a photograph of the station. The graphs provide a quick overview of the current and period-of-record hydrologic conditions of the station by providing a daily mean discharge graph for the water year, monthly statistics graph for the water year and period of record, an annual mean streamflow graph for the period of record, an annual minimum 7-day average streamflow graph for the period of record, and an annual peak streamflow graph for the period of record. Additionally, data can be accessed through the layer's link

  2. Modeling decadal timescale interactions between surface water and ground water in the central Everglades, Florida, USA

    Science.gov (United States)

    Harvey, Judson W.; Newlin, Jessica T.; Krupa, Steven L.

    2006-04-01

    calculated recharge and discharge) is much less sensitive to vertical mixing compared with residence time alone. We conclude that a small but potentially significant component of flow through the Everglades is recharged to the aquifer and stored there for years to decades before discharged back to surface water. Long-term storage of water and solutes in the ground-water system beneath the wetlands has implications for restoration of Everglades water quality.

  3. Global modelling of Cryptosporidium in surface water

    Science.gov (United States)

    Vermeulen, Lucie; Hofstra, Nynke

    2016-04-01

    Introduction Waterborne pathogens that cause diarrhoea, such as Cryptosporidium, pose a health risk all over the world. In many regions quantitative information on pathogens in surface water is unavailable. Our main objective is to model Cryptosporidium concentrations in surface waters worldwide. We present the GloWPa-Crypto model and use the model in a scenario analysis. A first exploration of global Cryptosporidium emissions to surface waters has been published by Hofstra et al. (2013). Further work has focused on modelling emissions of Cryptosporidium and Rotavirus to surface waters from human sources (Vermeulen et al 2015, Kiulia et al 2015). A global waterborne pathogen model can provide valuable insights by (1) providing quantitative information on pathogen levels in data-sparse regions, (2) identifying pathogen hotspots, (3) enabling future projections under global change scenarios and (4) supporting decision making. Material and Methods GloWPa-Crypto runs on a monthly time step and represents conditions for approximately the year 2010. The spatial resolution is a 0.5 x 0.5 degree latitude x longitude grid for the world. We use livestock maps (http://livestock.geo-wiki.org/) combined with literature estimates to calculate spatially explicit livestock Cryptosporidium emissions. For human Cryptosporidium emissions, we use UN population estimates, the WHO/UNICEF JMP sanitation country data and literature estimates of wastewater treatment. We combine our emissions model with a river routing model and data from the VIC hydrological model (http://vic.readthedocs.org/en/master/) to calculate concentrations in surface water. Cryptosporidium survival during transport depends on UV radiation and water temperature. We explore pathogen emissions and concentrations in 2050 with the new Shared Socio-economic Pathways (SSPs) 1 and 3. These scenarios describe plausible future trends in demographics, economic development and the degree of global integration. Results and

  4. Impinging Water Droplets on Inclined Glass Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Armijo, Kenneth Miguel [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lance, Blake [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ho, Clifford K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-09-01

    Multiphase computational models and tests of falling water droplets on inclined glass surfaces were developed to investigate the physics of impingement and potential of these droplets to self-clean glass surfaces for photovoltaic modules and heliostats. A multiphase volume-of-fluid model was developed in ANSYS Fluent to simulate the impinging droplets. The simulations considered different droplet sizes (1 mm and 3 mm), tilt angles (0°, 10°, and 45°), droplet velocities (1 m/s and 3 m/s), and wetting characteristics (wetting=47° contact angle and non-wetting = 93° contact angle). Results showed that the spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) decreased with increasing inclination angle due to the reduced normal force on the surface. The hydrophilic surface yielded greater spread factors than the hydrophobic surface in all cases. With regard to impact forces, the greater surface tilt angles yielded lower normal forces, but higher shear forces. Experiments showed that the experimentally observed spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) was significantly larger than the simulated spread factor. Observed spread factors were on the order of 5 - 6 for droplet velocities of ~3 m/s, whereas the simulated spread factors were on the order of 2. Droplets were observed to be mobile following impact only for the cases with 45° tilt angle, which matched the simulations. An interesting phenomenon that was observed was that shortly after being released from the nozzle, the water droplet oscillated (like a trampoline) due to the "snapback" caused by the surface tension of the water droplet being released from the nozzle. This oscillation impacted the velocity immediately after the release. Future work should evaluate the impact of parameters such as tilt angle and surface wettability on the impact of particle/soiling uptake and removal to investigate ways that

  5. Thermodynamic properties of water solvating biomolecular surfaces

    Science.gov (United States)

    Heyden, Matthias

    Changes in the potential energy and entropy of water molecules hydrating biomolecular interfaces play a significant role for biomolecular solubility and association. Free energy perturbation and thermodynamic integration methods allow calculations of free energy differences between two states from simulations. However, these methods are computationally demanding and do not provide insights into individual thermodynamic contributions, i.e. changes in the solvent energy or entropy. Here, we employ methods to spatially resolve distributions of hydration water thermodynamic properties in the vicinity of biomolecular surfaces. This allows direct insights into thermodynamic signatures of the hydration of hydrophobic and hydrophilic solvent accessible sites of proteins and small molecules and comparisons to ideal model surfaces. We correlate dynamic properties of hydration water molecules, i.e. translational and rotational mobility, to their thermodynamics. The latter can be used as a guide to extract thermodynamic information from experimental measurements of site-resolved water dynamics. Further, we study energy-entropy compensations of water at different hydration sites of biomolecular surfaces. This work is supported by the Cluster of Excellence RESOLV (EXC 1069) funded by the Deutsche Forschungsgemeinschaft.

  6. Surface-Water Data, Georgia, Water Year 1999

    Science.gov (United States)

    Alhadeff, S. Jack; Landers, Mark N.; McCallum, Brian E.

    1999-01-01

    Water resources data for the 1999 water year for Georgia consists of records of stage, discharge, and water quality of streams; and the stage and contents of lakes and reservoirs published in one volume in a digital format on a CD-ROM. This volume contains discharge records of 121 gaging stations; stage for 13 gaging stations; stage and contents for 18 lakes and reservoirs; continuous water quality records for 10 stations; and the annual peak stage and annual peak discharge for 75 crest-stage partial-record stations. These data represent that part of the National Water Data System collected by the U.S. Geological Survey and cooperating State and Federal agencies in Georgia. Records of discharge and stage of streams, and contents or stage of lakes and reservoirs were first published in a series of U.S. Geological water-supply papers entitled, 'Surface-Water Supply of the United States.' Through September 30, 1960, these water-supply papers were in an annual series and then in a 5-year series for 1961-65 and 1966-70. Records of chemical quality, water temperature, and suspended sediment were published from 1941 to 1970 in an annual series of water-supply papers entitled, 'Quality of Surface Waters of the United States.' Records of ground-water levels were published from 1935 to 1974 in a series of water-supply papers entitled, 'Ground-Water Levels in the United States.' Water-supply papers may be consulted in the libraries of the principal cities in the United States or may be purchased from the U.S. Geological Survey, Branch of Information Services, Federal Center, Box 25286, Denver, CO 80225. For water years 1961 through 1970, streamflow data were released by the U.S. Geological Survey in annual reports on a State-boundary basis prior to the two 5-year series water-supply papers, which cover this period. The data contained in the water-supply papers are considered the official record. Water-quality records for water years 1964 through 1970 were similarly released

  7. Surface water, particulate matter, and sediments of inland waters

    International Nuclear Information System (INIS)

    Mundschenk, H.

    1985-01-01

    The Bundesanstalt fuer Gewaesserkunde (BfG) since 1958 runs a system for monitoring the surface water and sediments of Federal German waterways in its capacity as a directing water monitoring centre. The data recorded over the years show that the radioactivity released by the various emission sources leads to radionuclide concentrations in water, particulate matter, or sediments that generally are below the detection limits defined in the relevant legal provisions governing monitoring and surveillance of nuclear facilities effluents. Representative examples of measuring methods and results (as for e.g. for H-3) are given. (DG) [de

  8. Reactor materials program process water component failure probability

    International Nuclear Information System (INIS)

    Daugherty, W. L.

    1988-01-01

    The maximum rate loss of coolant accident for the Savannah River Production Reactors is presently specified as the abrupt double-ended guillotine break (DEGB) of a large process water pipe. This accident is not considered credible in light of the low applied stresses and the inherent ductility of the piping materials. The Reactor Materials Program was initiated to provide the technical basis for an alternate, credible maximum rate LOCA. The major thrust of this program is to develop an alternate worst case accident scenario by deterministic means. In addition, the probability of a DEGB is also being determined; to show that in addition to being mechanistically incredible, it is also highly improbable. The probability of a DEGB of the process water piping is evaluated in two parts: failure by direct means, and indirectly-induced failure. These two areas have been discussed in other reports. In addition, the frequency of a large bread (equivalent to a DEGB) in other process water system components is assessed. This report reviews the large break frequency for each component as well as the overall large break frequency for the reactor system

  9. Salinization and arsenic contamination of surface water in southwest Bangladesh.

    Science.gov (United States)

    Ayers, John C; George, Gregory; Fry, David; Benneyworth, Laura; Wilson, Carol; Auerbach, Leslie; Roy, Kushal; Karim, Md Rezaul; Akter, Farjana; Goodbred, Steven

    2017-09-11

    concentrations show that all surface water types lie on mixing lines between dry season tidal channel water and rainwater, i.e., all are related by varying degrees of salinization. High As concentrations in dry season tidal channel water and shrimp ponds likely result from groundwater exfiltration and upstream irrigation in the dry season. Arsenic is transferred from tidal channels to rice paddies through irrigation. Including groundwater samples from the same area (Ayers et al. in Geochem Trans 17:1-22, 2016), principal components analysis and correlation analysis reveal that salinization explains most variation in surface water compositions, whereas progressive reduction of buried surface water by dissolved organic carbon is responsible for the nonconservative behavior of S, Fe, and As and changes in Eh and alkalinity of groundwater.

  10. Corrugated metal surface with pillars for terahertz surface plasmon polariton waveguide components

    KAUST Repository

    Yuehong, Xu

    2018-01-12

    In the terahertz regime, due to perfect conductivity of most metals, it is hard to realize a strong confinement of Surface plasmon polaritons (SPPs) although a propagation loss could be sufficiently low. We experimentally demonstrated a structure with periodic pillars arranged on a thin metal surface that supports bound modes of spoof SPPs at terahertz (THz) frequencies. By using scanning near-field THz microscopy, the electric field distribution above the metal surface within a distance of 130 μm was mapped. The results proved that this structure could guide spoof SPPs propagating along subwavelength waveguides, and at the same time reduce field expansion into free space. Further, for the development of integrated optical circuits, several components including straight waveguide, S-bend, Y-splitter and directional couplers were designed and characterized by the same method. We believe that the waveguide components proposed here will pave a new way for the development of flexible, wideband and compact photonic circuits operating at THz frequencies.

  11. Corrugated metal surface with pillars for terahertz surface plasmon polariton waveguide components

    KAUST Repository

    Yuehong, Xu; Yanfeng, Li; Chunxiu, Tian; Jiaguang, Han; Quan, Xu; Xueqian, Zhang; Xixiang, Zhang; Ying, Zhang; Weili, Zhang

    2018-01-01

    In the terahertz regime, due to perfect conductivity of most metals, it is hard to realize a strong confinement of Surface plasmon polaritons (SPPs) although a propagation loss could be sufficiently low. We experimentally demonstrated a structure with periodic pillars arranged on a thin metal surface that supports bound modes of spoof SPPs at terahertz (THz) frequencies. By using scanning near-field THz microscopy, the electric field distribution above the metal surface within a distance of 130 μm was mapped. The results proved that this structure could guide spoof SPPs propagating along subwavelength waveguides, and at the same time reduce field expansion into free space. Further, for the development of integrated optical circuits, several components including straight waveguide, S-bend, Y-splitter and directional couplers were designed and characterized by the same method. We believe that the waveguide components proposed here will pave a new way for the development of flexible, wideband and compact photonic circuits operating at THz frequencies.

  12. Wind effect on water surface of water reservoirs

    Directory of Open Access Journals (Sweden)

    Petr Pelikán

    2013-01-01

    Full Text Available The primary research of wind-water interactions was focused on coastal areas along the shores of world oceans and seas because a basic understanding of coastal meteorology is an important component in coastal and offshore design and planning. Over time the research showed the most important meteorological consideration relates to the dominant role of winds in wave generation. The rapid growth of building-up of dams in 20th century caused spreading of the water wave mechanics research to the inland water bodies. The attention was paid to the influence of waterwork on its vicinity, wave regime respectively, due to the shoreline deterioration, predominantly caused by wind waves. Consequently the similar principles of water wave mechanics are considered in conditions of water reservoirs. The paper deals with the fundamental factors associated with initial wind-water interactions resulting in the wave origination and growth. The aim of the paper is thepresentation of utilization of piece of knowledge from a part of sea hydrodynamics and new approach in its application in the conditions of inland water bodies with respect to actual state of the art. The authors compared foreign and national approach to the solved problems and worked out graphical interpretation and overview of related wind-water interaction factors.

  13. Lithium content in potable water, surface water, ground water, and mineral water on the territory of Republic of Macedonia

    OpenAIRE

    Kostik, Vesna; Bauer, Biljana; Kavrakovski, Zoran

    2014-01-01

    The aim of this study was to determine lithium concentration in potable water, surface water, ground, and mineral water on the territory of the Republic of Macedonia. Water samples were collected from water bodies such as multiple public water supply systems located in 13 cities, wells boreholes located in 12 areas, lakes and rivers located in three different areas. Determination of lithium concentration in potable water, surface water was performed by the technique of inductively coupl...

  14. Interaction of water components in the semi-arid Huasco and Limarí river basins, North Central Chile

    Directory of Open Access Journals (Sweden)

    G. Strauch

    2009-10-01

    Full Text Available For sustainable water resource management in semi-arid regions, sound information is required about interactions between the different components of the water system: rain/snow precipitation, surface/subsurface run-off, groundwater recharge. Exemplarily, the Huasco and Limarí river basins as water stressed river catchments have been studied by isotope and hydrochemical methods for (i the origin of water, (ii water quality, (iii relations of surface and groundwater.

    Applying the complex multi-isotopic and hydrochemical methodology to the water components of the Huasco and Limarí basins, a differentiation of water components concerning subsurface flow and river water along the catchment area and by anthropogenic impacts are detected. Sulphate and nitrate concentrations indicate remarkable input from mining and agricultural activities along the river catchment.

    The 2H-18O relations of river water and groundwater of both catchments point to the behaviour of river waters originated in an arid to semi-arid environment.

    Consequently, the groundwater from several production wells in the lower parts of the catchments is related to the rivers where the wells located, however, it can be distinguished from the river water. Using the hydrological water balance and the isotope mixing model, the interaction between surface and subsurface flows and river flow is estimated.

  15. Surface-water investigations at Barrow, Alaska

    Science.gov (United States)

    Jones, Stanley H.

    1972-01-01

    The U.S. Public Health Service is currently developing plans for a long-term water supply and sewage treatment system for the village of Barrow, Alaska. To assist in planning, the U.S. Geological Survey was requested to initiate a cooperative streamflow data-collection program with the U.S. Public Health Service in June 1972 to determine the availability of surface water and the areal distribution of runoff in the Barrow area. This basic-data report summarizes the streamflow data collected from June 1 through July 10, 1972, at three gaging stations in the Barrow area (fig. 1) and discusses the future data-collection program.

  16. Seismic Design of ITER Component Cooling Water System-1 Piping

    Science.gov (United States)

    Singh, Aditya P.; Jadhav, Mahesh; Sharma, Lalit K.; Gupta, Dinesh K.; Patel, Nirav; Ranjan, Rakesh; Gohil, Guman; Patel, Hiren; Dangi, Jinendra; Kumar, Mohit; Kumar, A. G. A.

    2017-04-01

    The successful performance of ITER machine very much depends upon the effective removal of heat from the in-vessel components and other auxiliary systems during Tokamak operation. This objective will be accomplished by the design of an effective Cooling Water System (CWS). The optimized piping layout design is an important element in CWS design and is one of the major design challenges owing to the factors of large thermal expansion and seismic accelerations; considering safety, accessibility and maintainability aspects. An important sub-system of ITER CWS, Component Cooling Water System-1 (CCWS-1) has very large diameter of pipes up to DN1600 with many intersections to fulfill the process flow requirements of clients for heat removal. Pipe intersection is the weakest link in the layout due to high stress intensification factor. CCWS-1 piping up to secondary confinement isolation valves as well as in-between these isolation valves need to survive a Seismic Level-2 (SL-2) earthquake during the Tokamak operation period to ensure structural stability of the system in the Safe Shutdown Earthquake (SSE) event. This paper presents the design, qualification and optimization of layout of ITER CCWS-1 loop to withstand SSE event combined with sustained and thermal loads as per the load combinations defined by ITER and allowable limits as per ASME B31.3, This paper also highlights the Modal and Response Spectrum Analyses done to find out the natural frequency and system behavior during the seismic event.

  17. Transport and transformation of surface water masses across the ...

    African Journals Online (AJOL)

    Transport and transformation of surface water masses across the Mascarene Plateau during the Northeast Monsoon season. ... Mixing occurs in the central gap between intermediate water masses (Red Sea Water [RSW] and Antarctic Intermediate Water [AAIW]) as well as in the upper waters (Subtropical Surface Water ...

  18. Multi-component joint analysis of surface waves

    Czech Academy of Sciences Publication Activity Database

    Dal Moro, Giancarlo; Moura, R.M.M.; Moustafa, S.S.R.

    2015-01-01

    Roč. 119, AUG (2015), s. 128-138 ISSN 0926-9851 Institutional support: RVO:67985891 Keywords : surface waves * surface wave dispersion * seismic data acquisition * seismic data inversion * velocity spectrum Subject RIV: DB - Geology ; Mineralogy Impact factor: 1.355, year: 2015

  19. Radiological monitoring. Controlling surface water pollution

    International Nuclear Information System (INIS)

    Morin, Maxime

    2018-01-01

    Throughout France, surface waters (from rivers to brooks) located at the vicinity of nuclear or industrial sites, are subject to regular radiological monitoring. An example is given with the radiological monitoring of a small river near La Hague Areva's plant, where contaminations have been detected with the help of the French IRSN nuclear safety research organization. The sampling method and various measurement types are described

  20. Bulk water freezing dynamics on superhydrophobic surfaces

    Science.gov (United States)

    Chavan, S.; Carpenter, J.; Nallapaneni, M.; Chen, J. Y.; Miljkovic, N.

    2017-01-01

    In this study, we elucidate the mechanisms governing the heat-transfer mediated, non-thermodynamic limited, freezing delay on non-wetting surfaces for a variety of characteristic length scales, Lc (volume/surface area, 3 mm commercial superhydrophobic spray coatings, showing a monotonic increase in freezing time with coating thickness. The added thermal resistance of thicker coatings was much larger than that of the nanoscale superhydrophobic features, which reduced the droplet heat transfer and increased the total freezing time. Transient finite element method heat transfer simulations of the water slab freezing process were performed to calculate the overall heat transfer coefficient at the substrate-water/ice interface during freezing, and shown to be in the range of 1-2.5 kW/m2K for these experiments. The results shown here suggest that in order to exploit the heat-transfer mediated freezing delay, thicker superhydrophobic coatings must be deposited on the surface, where the coating resistance is comparable to the bulk water/ice conduction resistance.

  1. Source Water Assessment for the Las Vegas Valley Surface Waters

    Science.gov (United States)

    Albuquerque, S. P.; Piechota, T. C.

    2003-12-01

    The 1996 amendment to the Safe Drinking Water Act of 1974 created the Source Water Assessment Program (SWAP) with an objective to evaluate potential sources of contamination to drinking water intakes. The development of a Source Water Assessment Plan for Las Vegas Valley surface water runoff into Lake Mead is important since it will guide future work on source water protection of the main source of water. The first step was the identification of the watershed boundary and source water protection area. Two protection zones were delineated. Zone A extends 500 ft around water bodies, and Zone B extends 3000 ft from the boundaries of Zone A. These Zones extend upstream to the limits of dry weather flows in the storm channels within the Las Vegas Valley. After the protection areas were identified, the potential sources of contamination in the protection area were inventoried. Field work was conducted to identify possible sources of contamination. A GIS coverage obtained from local data sources was used to identify the septic tank locations. Finally, the National Pollutant Discharge Elimination System (NPDES) Permits were obtained from the State of Nevada, and included in the inventory. After the inventory was completed, a level of risk was assigned to each potential contaminating activity (PCA). The contaminants of concern were grouped into five categories: volatile organic compounds (VOCs), synthetic organic compounds (SOCs), inorganic compounds (IOCs), microbiological, and radionuclides. The vulnerability of the water intake to each of the PCAs was assigned based on these five categories, and also on three other factors: the physical barrier effectiveness, the risk potential, and the time of travel. The vulnerability analysis shows that the PCAs with the highest vulnerability rating include septic systems, golf courses/parks, storm channels, gas stations, auto repair shops, construction, and the wastewater treatment plant discharges. Based on the current water quality

  2. Water Resources: the Central Component of the WEF Nexus?

    Science.gov (United States)

    Ding, K.; Gunda, T.; Hornberger, G. M.

    2017-12-01

    Increasing population growth, consumption of natural resources, and deterioration of the environment coupled with climate change impacts (such as increased variability in precipitation) will challenge our abilities to provide water, energy and food (WEF) to the global populace. Less developed areas, such as the countries in Sub-Saharan Africa, are particularly vulnerable to such resource issues due to immature governance and management structures and strategies. We introduce an integrated approach to resource security analysis, which traditionally has focused on the WEF components separately and apply the methods to a suite of countries in Sub-Saharan Africa. Specifically, we evaluate the inter-connected nature of WEF securities by considering physical, demographic, socioeconomic, health, and institutional parameters related to each of the resource securities and by analyzing the relationships among the metrics. For example, reported food deficits for countries are strongly correlated with reported levels of access to safe drinking water. Multivariate statistical analyses are applied to identify relationships among resources and to develop indices that robustly and comprehensively capture the WEF nexus. Our results indicate that water plays the central role in the WEF nexus, due to its extensive use for both food and energy production in these countries. This approach provides a framework for analyzing the WEF nexus in other regions of the world.

  3. Water and oil wettability of anodized 6016 aluminum alloy surface

    Science.gov (United States)

    Rodrigues, S. P.; Alves, C. F. Almeida; Cavaleiro, A.; Carvalho, S.

    2017-11-01

    This paper reports on the control of wettability behaviour of a 6000 series aluminum (Al) alloy surface (Al6016-T4), which is widely used in the automotive and aerospace industries. In order to induce the surface micro-nanostructuring of the surface, a combination of prior mechanical polishing steps followed by anodization process with different conditions was used. The surface polishing with sandpaper grit size 1000 promoted aligned grooves on the surface leading to static water contact angle (WCA) of 91° and oil (α-bromonaphthalene) contact angle (OCA) of 32°, indicating a slightly hydrophobic and oleophilic character. H2SO4 and H3PO4 acid electrolytes were used to grow aluminum oxide layers (Al2O3) by anodization, working at 15 V/18° C and 100 V/0 °C, respectively, in one or two-steps configuration. Overall, the anodization results showed that the structured Al surfaces were hydrophilic and oleophilic-like with both WCA and OCA below 90°. The one-step configuration led to a dimple-shaped Al alloy surface with small diameter of around 31 nm, in case of H2SO4, and with larger diameters of around 223 nm in case of H3PO4. The larger dimples achieved with H3PO4 electrolyte allowed to reach a slight hydrophobic surface. The thicker porous Al oxide layers, produced by anodization in two-step configuration, revealed that the liquids can penetrate easily inside the non-ordered porous structures and, thus, the surface wettability tended to superhydrophilic and superoleophilic character (CA OCA. This inversion in favour of the hydrophilic-oleophobic surface behaviour is of great interest either for lubrication of mechanical components or in water-oil separation process.

  4. Surface layer scintillometry for estimating the sensible heat flux component of the surface energy balance

    Directory of Open Access Journals (Sweden)

    M. J. Savage

    2010-01-01

    Full Text Available The relatively recently developed scintillometry method, with a focus on the dual-beam surface layer scintillometer (SLS, allows boundary layer atmospheric turbulence, surface sensible heat and momentum flux to be estimated in real-time. Much of the previous research using the scintillometer method has involved the large aperture scintillometer method, with only a few studies using the SLS method. The SLS method has been mainly used by agrometeorologists, hydrologists and micrometeorologists for atmospheric stability and surface energy balance studies to obtain estimates of sensible heat from which evaporation estimates representing areas of one hectare or larger are possible. Other applications include the use of the SLS method in obtaining crucial input parameters for atmospheric dispersion and turbulence models. The SLS method relies upon optical scintillation of a horizontal laser beam between transmitter and receiver for a separation distance typically between 50 and 250 m caused by refractive index inhomogeneities in the atmosphere that arise from turbulence fluctuations in air temperature and to a much lesser extent the fluctuations in water vapour pressure. Measurements of SLS beam transmission allow turbulence of the atmosphere to be determined, from which sub-hourly, real-time and in situ path-weighted fluxes of sensible heat and momentum may be calculated by application of the Monin-Obukhov similarity theory. Unlike the eddy covariance (EC method for which corrections for flow distortion and coordinate rotation are applied, no corrections to the SLS measurements, apart from a correction for water vapour pressure, are applied. Also, path-weighted SLS estimates over the propagation path are obtained. The SLS method also offers high temporal measurement resolution and usually greater spatial coverage compared to EC, Bowen ratio energy balance, surface renewal and other sensible heat measurement methods. Applying the shortened surface

  5. Convergent surface water distributions in U.S. cities

    Science.gov (United States)

    M.K. Steele; J.B. Heffernan; N. Bettez; J. Cavender-Bares; P.M. Groffman; J.M. Grove; S. Hall; S.E. Hobbie; K. Larson; J.L. Morse; C. Neill; K.C. Nelson; J. O' Neil-Dunne; L. Ogden; D.E. Pataki; C. Polsky; R. Roy Chowdhury

    2014-01-01

    Earth's surface is rapidly urbanizing, resulting in dramatic changes in the abundance, distribution and character of surface water features in urban landscapes. However, the scope and consequences of surface water redistribution at broad spatial scales are not well understood. We hypothesized that urbanization would lead to convergent surface water abundance and...

  6. Performance of materials in the component cooling water systems of pressurized water reactors

    International Nuclear Information System (INIS)

    Lee, B.S.

    1993-01-01

    The component cooling water (CCW) system provides cooling water to several important loads throughout the plant under all operating conditions. An aging assessment CCW systems in pressurized water reactors (PWRs) was conducted as part of Nuclear Plant Aging Research Program (NPAR) instituted by the US Nuclear Regulatory Commission. This paper presents some of the results on the performances of materials in respect of their application in CCW Systems. All the CCW system failures reported to the Nuclear Plant Reliability Data System (NPRDS) from January 1988 to June 1990 were reviewed; it is concluded that three of the main contributors to CCW system failures are valves, pumps, and heat exchangers. This study identified the modes and causes of failure for these components; most of the causes for the aging-related failures could be related to the performance of materials. Also, in this paper the materials used for these components are reviewed, and there aging mechanisms under CCW system conditions are discussed

  7. Performance of Water Recirculation Loop Maintentance Components for the Advanced Spacesuit Water Membrane Evaporator

    Science.gov (United States)

    Rector, Tony; Peyton, Barbara; Steele, John W.; Bue, Grant C.; Campbell, Colin; Makinen, Janice

    2014-01-01

    Water loop maintenance components to maintain the water quality of the Advanced Spacesuit Water Membrane Evaporation (SWME) water recirculation loop have undergone a comparative performance evaluation with a second SWME water recirculation loop with no water quality maintenance. Results show the benefits of periodic water maintenance. The SWME is a heat rejection device under development at the NASA Johnson Space Center to perform thermal control for advanced spacesuits. One advantage to this technology is the potential for a significantly greater degree of tolerance to contamination when compared to the existing Sublimator technology. The driver for the evaluation of water recirculation maintenance components was to further enhance this advantage through the leveraging of fluid loop management lessonslearned from the International Space Station (ISS). A bed design that was developed for a UTAS military application, and considered for a potential ISS application with the Urine Processor Assembly, provided a low pressure drop means for water maintenance in a recirculation loop. The bed design is coupled with high capacity ion exchange resins, organic adsorbents, and a cyclic methodology developed for the Extravehicular Mobility Unit (EMU) Transport Water loop. The maintenance cycle included the use of a biocide delivery component developed for ISS to introduce a biocide in a microgravity-compatible manner for the Internal Active Thermal Control System (IATCS). The leveraging of these water maintenance technologies to the SWME recirculation loop is a unique demonstration of applying the valuable lessons learned on the ISS to the next generation of manned spaceflight Environmental Control and Life Support System (ECLSS) hardware.

  8. Performance of Water Recirculation Loop Maintenance Components for the Advanced Spacesuit Water Membrane Evaporator

    Science.gov (United States)

    Rector, Tony; Peyton, Barbara M.; Steele, John W.; Makinen, Janice; Bue, Grant C.; Campbell, Colin

    2014-01-01

    Water loop maintenance components to maintain the water quality of the Advanced Spacesuit Water Membrane Evaporation (SWME) water recirculation loop have undergone a comparative performance evaluation with a second SWME water recirculation loop with no water quality maintenance. Results show the benefits of periodic water maintenance. The SWME is a heat rejection device under development at the NASA Johnson Space Center to perform thermal control for advanced spacesuits. One advantage to this technology is the potential for a significantly greater degree of tolerance to contamination when compared to the existing Sublimator technology. The driver for the evaluation of water recirculation maintenance components was to further enhance this advantage through the leveraging of fluid loop management lessons learned from the International Space Station (ISS). A bed design that was developed for a UTAS military application, and considered for a potential ISS application with the Urine Processor Assembly, provided a low pressure drop means for water maintenance in a recirculation loop. The bed design is coupled with high capacity ion exchange resins, organic adsorbents, and a cyclic methodology developed for the Extravehicular Mobility Unit (EMU) Transport Water loop. The maintenance cycle included the use of a biocide delivery component developed for ISS to introduce a biocide in a microgravity compatible manner for the Internal Active Thermal Control System (IATCS). The leveraging of these water maintenance technologies to the SWME recirculation loop is a unique demonstration of applying the valuable lessons learned on the ISS to the next generation of manned spaceflight Environmental Control and Life Support System (ECLSS) hardware.

  9. Welding residual stress improvement in internal components by water jet peening

    International Nuclear Information System (INIS)

    Enomoto, K.; Hirano, K.; Hayashi, M.; Hayashi, E.

    1996-01-01

    Cavitations are generated when highly pressurized water is jetted in water. Surface residual stress is improved remarkably due to the peening effect of extremely high pressure caused by the collapse of cavitation bubbles. This technique is called water jet peening (WJP). WJP is expected to be an effective maintenance technique for the prevention of stress corrosion cracking caused by residual stress in various components of power generating plants. Various kinds of specimens were water jet peened to evaluate the fundamental characteristics of WJP and to select the most appropriate conditions for the residual stress improvement. Test results showed that WJP markedly improved the tensile residual stress caused by welding and grinding to the high compressive residual stress and seems to prevent the stress corrosion cracking

  10. Detecting and mitigating aging in component cooling water systems

    International Nuclear Information System (INIS)

    Lofaro, R.J.

    1991-01-01

    The time-dependent effects of aging on component cooling water (CCW) systems in nuclear power plants has been studied and documented as part of a research program sponsored by the US Nuclear Regulatory Commission. It was found that age related degradation leads to failures in the CCW system which can result in an increase in system unavailability, if not properly detected and mitigated. To identify effective methods of managing this degradation, information on inspection, monitoring, and maintenance practices currently available was obtained from various operating plants and reviewed. The findings were correlated with the most common aging mechanisms and failure modes and a compilation of aging detection and mitigation practices was formulated. This paper discusses the results of this work

  11. Detecting and mitigating aging in component cooling water systems

    International Nuclear Information System (INIS)

    Lofaro, R.J.; Aggarwal, S.

    1992-01-01

    The time-dependent effects of aging on component cooling water (CCW) systems in nuclear power plants has been studied and documented as part of a research program sponsored by the US Nuclear Regulatory Commission. It was found that age related degradation leads to failures in the CCW system which can result in an increase in system unavailability, if not properly detected and mitigated. To identify effective methods of managing this degradation, information on inspection, monitoring, and maintenance practices currently available was obtained from various operating plants and reviewed. The findings were correlated with the most common aging mechanisms and failure modes, and a compilation of aging detection and mitigation practices was formulated. This paper discusses the results of this work

  12. Surface erosion of fusion reactor components due to radiation blistering and neutron sputtering

    International Nuclear Information System (INIS)

    Das, S.K.; Kaminsky, M.

    1975-01-01

    Radiation blistering and neutron sputtering can lead to the surface erosion of fusion reactor components exposed to plasma radiations. Recent studies of methods to reduce the surface erosion caused by these processes are discussed

  13. Water droplet evaporation from sticky superhydrophobic surfaces

    Science.gov (United States)

    Lee, Moonchan; Kim, Wuseok; Lee, Sanghee; Baek, Seunghyeon; Yong, Kijung; Jeon, Sangmin

    2017-07-01

    The evaporation dynamics of water from sticky superhydrophobic surfaces was investigated using a quartz crystal microresonator and an optical microscope. Anodic aluminum oxide (AAO) layers with different pore sizes were directly fabricated onto quartz crystal substrates and hydrophobized via chemical modification. The resulting AAO layers exhibited hydrophobic or superhydrophobic characteristics with strong adhesion to water due to the presence of sealed air pockets inside the nanopores. After placing a water droplet on the AAO membranes, variations in the resonance frequency and Q-factor were measured throughout the evaporation process, which were related to changes in mass and viscous damping, respectively. It was found that droplet evaporation from a sticky superhydrophobic surface followed a constant contact radius (CCR) mode in the early stage of evaporation and a combination of CCR and constant contact angle modes without a Cassie-Wenzel transition in the final stage. Furthermore, AAO membranes with larger pore sizes exhibited longer evaporation times, which were attributed to evaporative cooling at the droplet interface.

  14. Static Feed Water Electrolysis Subsystem Testing and Component Development

    Science.gov (United States)

    Koszenski, E. P.; Schubert, F. H.; Burke, K. A.

    1983-01-01

    A program was carried out to develop and test advanced electrochemical cells/modules and critical electromechanical components for a static feed (alkaline electrolyte) water electrolysis oxygen generation subsystem. The accomplishments were refurbishment of a previously developed subsystem and successful demonstration for a total of 2980 hours of normal operation; achievement of sustained one-person level oxygen generation performance with state-of-the-art cell voltages averaging 1.61 V at 191 ASF for an operating temperature of 128F (equivalent to 1.51V when normalized to 180F); endurance testing and demonstration of reliable performance of the three-fluid pressure controller for 8650 hours; design and development of a fluid control assembly for this subsystem and demonstration of its performance; development and demonstration at the single cell and module levels of a unitized core composite cell that provides expanded differential pressure tolerance capability; fabrication and evaluation of a feed water electrolyte elimination five-cell module; and successful demonstration of an electrolysis module pressurization technique that can be used in place of nitrogen gas during the standby mode of operation to maintain system pressure and differential pressures.

  15. Biological methods used to assess surface water quality

    Directory of Open Access Journals (Sweden)

    Szczerbiñska Natalia

    2015-12-01

    Full Text Available In accordance with the guidelines of the Water Framework Directive 2000/60 (WFD, both ecological and chemical statuses determine the assessment of surface waters. The profile of ecological status is based on the analysis of various biological components, and physicochemical and hydromorphological indicators complement this assessment. The aim of this article is to present the biological methods used in the assessment of water status with a special focus on bioassay, as well as to provide a review of methods of monitoring water status. Biological test methods include both biomonitoring and bioanalytics. Water biomonitoring is used to assess and forecast the status of water. These studies aim to collect data on water pollution and forecast its impact. Biomonitoring uses organisms which are characterized by particular vulnerability to contaminants. Bioindicator organisms are algae, fungi, bacteria, larval invertebrates, cyanobacteria, macroinvertebrates, and fish. Bioanalytics is based on the receptors of contaminants that can be biologically active substances. In bioanalytics, biosensors such as viruses, bacteria, antibodies, enzymes, and biotests are used to assess degrees of pollution.

  16. Reliability of surface inspection techniques for pressurized components

    International Nuclear Information System (INIS)

    Kauppinen, P.; Sillanpaeae, J.

    1991-01-01

    In the Nordtest NDT-programme (1984 - 1988) the detection of flaws by surface inspection methods has been studied. In the round-robin exercise, 133 test pieces have been inspected by 32 inspectors in Denmark, Finland, Norway and Sweden. From the results, the detectability of defects by magnetic particle and liquid-penetrant testing and the influence of materials and techniques used are evaluated. (author)

  17. Water evaporation on highly viscoelastic polymer surfaces.

    Science.gov (United States)

    Pu, Gang; Severtson, Steven J

    2012-07-03

    Results are reported for a study on the evaporation of water droplets from a highly viscoelastic acrylic polymer surface. These are contrasted with those collected for the same measurements carried out on polydimethylsiloxane (PDMS). For PDMS, the evaporation process involves the expected multistep process including constant drop area, constant contact angle, and finally a combination of these steps until the liquid is gone. In contrast, water evaporation from the acrylic polymer shows a constant drop area mode throughout. Furthermore, during the evaporation process, the drop area actually expands on the acrylic polymer. The single mode evaporation process is consistent with formation of wetting structures, which cannot be propagated by the capillary forces. Expansion of the drop area is attributed to the influence of the drop capillary pressure. Furthermore, the rate of drop area expansion is shown to be dependent on the thickness of the polymer film.

  18. Effect of solid waste landfill on underground and surface water ...

    African Journals Online (AJOL)

    Effect of solid waste landfill on underground and surface water quality at ring road, Ibadan, Nigeria. ... parameters showed increased concentrations over those from control sites. ... Keywords: Landfill, groundwater, surface-water, pollution.

  19. chemical and microbiological assessment of surface water samples

    African Journals Online (AJOL)

    PROF EKWUEME

    concentrations and bacteriological content. Evaluation of the results ... and Aninri local government areas of Enugu state. Surface water ... surface water bodies are prone to impacts from ... Coal Measures (Akamigbo, 1987). The geologic map ...

  20. Integrated Optical Components Utilizing Long-Range Surface Plasmon Polaritons

    DEFF Research Database (Denmark)

    Boltasseva, Alexandra; Nikolajsen, Thomas; Leosson, Kristjan

    2005-01-01

    New optical waveguide technology for integrated optics, based on propagation of long-range surface plasmon polaritons (LR-SPPs) along metal stripes embedded in dielectric, is presented. Guiding and routing of electromagnetic radiation along nanometer-thin and micrometer-wide gold stripes embedded......), and a bend loss of ~5 dB for a bend radius of 15 mm are evaluated for 15-nm-thick and 8-mm-wide stripes at the wavelength of 1550 nm. LR-SPP-based 3-dB power Y-splitters, multimode interference waveguides, and directional couplers are demonstrated and investigated. At 1570 nm, coupling lengths of 1.9 and 0...

  1. Mathematical aspects of surface water waves

    International Nuclear Information System (INIS)

    Craig, Walter; Wayne, Clarence E

    2007-01-01

    The theory of the motion of a free surface over a body of water is a fascinating subject, with a long history in both applied and pure mathematical research, and with a continuing relevance to the enterprises of mankind having to do with the sea. Despite the recent advances in the field (some of which we will hear about during this Workshop on Mathematical Hydrodynamics at the Steklov Institute), and the current focus of the mathematical community on the topic, many fundamental mathematical questions remain. These have to do with the evolution of surface water waves, their approximation by model equations and by computer simulations, the detailed dynamics of wave interactions, such as would produce rogue waves in an open ocean, and the theory (partially probabilistic) of approximating wave fields over large regions by averaged 'macroscopic' quantities which satisfy essentially kinetic equations of motion. In this note we would like to point out open problems and some of the directions of current research in the field. We believe that the introduction of new analytical techniques and novel points of view will play an important role in the future development of the area.

  2. Water infiltration into exposed fractured rock surfaces

    International Nuclear Information System (INIS)

    Rasmussen, T.C.; Evans, D.D.

    1993-01-01

    Fractured rock media are present at many existing and potential waste disposal sites, yet characterization data and physical relationships are not well developed for such media. This study focused on water infiltration characteristics of an exposed fractured rock as an approach for defining the upper boundary condition for unsaturated-zone water percolation and contaminant transport modeling. Two adjacent watersheds of 0.24 and 1.73 ha with slopes up to 45% were instrumented for measuring rainfall and runoff. Fracture density was measured from readily observable fracture traces on the surface. Three methods were employed to evaluate the rainfall-runoff relationship. The first method used the annual totals and indicated that only 22.5% of rainfall occurred as runoff for the 1990-1991 water year, which demonstrates a high water intake rate by the exposed fracture system. The second method employed total rainfall and runoff for individual storms in conjunction with the commonly used USDA Soil Conservation Service curve number method developed for wide ranges of soils and vegetation. Curve numbers between 75 and 85 were observed for summer and winter storms with dry antecedent runoff conditions, while values exceeded 90 for wet conditions. The third method used a mass-balance approach for four major storms, which indicated that water intake rates ranged from 2.0 to 7.3 mm h -1 , yielding fracture intake velocities ranging from 122 to 293 m h -1 . The three analyses show the complexity of the infiltration process for fractured rock. However, they contribute to a better understanding of the upper boundary condition for predicting contaminant transport through an unsaturated fractured rock medium. 17 refs., 4 figs., 1 tab

  3. Vertical components of surface vibrations induced by mining tremors in the Upper Silesian Coalfield, Poland

    International Nuclear Information System (INIS)

    Maciag, E.; Kowalski, W.

    1997-01-01

    Characteristics of vertical components of surface vibration is epicentral zones due to mining tremors in the Upper Silesian Coalfield (USC) are analysed. Both maximum acceleration amplitudes and dominant frequencies of vertical (Z) and horizontal (N-S and E-W) components of vibrations are compared. The role played by the vertical components of vibrations in estimates of hazard for surface structures excited by mining tremors is discussed. 8 refs., 7 figs

  4. Organic acids in naturally colored surface waters

    Science.gov (United States)

    Lamar, William L.; Goerlitz, D.F.

    1966-01-01

    Most of the organic matter in naturally colored surface waters consists of a mixture of carboxylic acids or salts of these acids. Many of the acids color the water yellow to brown; however, not all of the acids are colored. These acids range from simple to complex, but predominantly they are nonvolatile polymeric carboxylic acids. The organic acids were recovered from the water by two techniques: continuous liquid-liquid extraction with n-butanol and vacuum evaporation at 50?C (centigrade). The isolated acids were studied by techniques of gas, paper, and column chromatography and infrared spectroscopy. About 10 percent of the acids recovered were volatile or could be made volatile for gas chromatographic analysis. Approximately 30 of these carboxylic acids were isolated, and 13 of them were individually identified. The predominant part of the total acids could not be made volatile for gas chromatographic analysis. Infrared examination of many column chromatographic fractions indicated that these nonvolatile substances are primarily polymeric hydroxy carboxylic acids having aromatic and olefinic unsaturation. The evidence suggests that some of these acids result from polymerization in aqueous solution. Elemental analysis of the sodium fusion products disclosed the absence of nitrogen, sulfur, and halogens.

  5. Environmetric data interpretation to assess surface water quality

    International Nuclear Information System (INIS)

    Simeonova, P.; Papazova, P.; Lovchinov, V.

    2013-01-01

    Two multivariate statistical methods (Cluster analysis /CA/ and Principal components analysis /PCA/) were applied for model assessment of the water quality of Maritsa River and Tundja River on Bulgarian territory. The study used long-term monitoring data from many sampling sites characterized by various surface water quality indicators. The application of CA to the indicators results in formation of clusters showing the impact of biological, anthropogenic and eutrophication sources. For further assessment of the monitoring data, PCA was implemented, which identified, again, latent factors confirming, in principle, the clustering output. Their identification coincide correctly to the location of real pollution sources along the rivers catchments. The linkage of the sampling sites along the river flow by CA identified several special patterns separated by specific tracers levels. The apportionment models of the pollution determined the contribution of each one of identified pollution factors to the total concentration of each one of the water quality parameters. Thus, a better risk management of the surface water quality is achieved both on local and national level

  6. The interaction between surface water and groundwater and its ...

    Indian Academy of Sciences (India)

    Surface water; groundwater; stable isotopes; water quality; Second Songhua River basin. .... The total dissolved solid (TDS) was calculated by the con- centrations of major ions in ...... evaluating water quality management effectiveness; J.

  7. Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

    KAUST Repository

    Jin, Yong; Zhang, Lianbin; Wang, Peng

    2017-01-01

    Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH

  8. Impact of Water Withdrawals from Groundwater and Surface Water on Continental Water Storage Variations

    Science.gov (United States)

    Doell, Petra; Hoffmann-Dobrev, Heike; Portmann, Felix T.; Siebert, Stefan; Eicker, Annette; Rodell, Matthew; Strassberg, Gil

    2011-01-01

    Humans have strongly impacted the global water cycle, not only water flows but also water storage. We have performed a first global-scale analysis of the impact of water withdrawals on water storage variations, using the global water resources and use model WaterGAP. This required estimation of fractions of total water withdrawals from groundwater, considering five water use sectors. According to our assessment, the source of 35% of the water withdrawn worldwide (4300 cubic km/yr during 1998-2002) is groundwater. Groundwater contributes 42%, 36% and 27% of water used for irrigation, households and manufacturing, respectively, while we assume that only surface water is used for livestock and for cooling of thermal power plants. Consumptive water use was 1400 cubic km/yr during 1998-2002. It is the sum of the net abstraction of 250 cubic km/yr of groundwater (taking into account evapotranspiration and return flows of withdrawn surface water and groundwater) and the net abstraction of 1150 km3/yr of surface water. Computed net abstractions indicate, for the first time at the global scale, where and when human water withdrawals decrease or increase groundwater or surface water storage. In regions with extensive surface water irrigation, such as Southern China, net abstractions from groundwater are negative, i.e. groundwater is recharged by irrigation. The opposite is true for areas dominated by groundwater irrigation, such as in the High Plains aquifer of the central USA, where net abstraction of surface water is negative because return flow of withdrawn groundwater recharges the surface water compartments. In intensively irrigated areas, the amplitude of seasonal total water storage variations is generally increased due to human water use; however, in some areas, it is decreased. For the High Plains aquifer and the whole Mississippi basin, modeled groundwater and total water storage variations were compared with estimates of groundwater storage variations based on

  9. Potentially hazardous substances in surface waters. II. Cholinesterase inhibitors in Dutch surface waters

    NARCIS (Netherlands)

    Greve, P.A.; Freudenthal, J.; Wit, S.L.

    1972-01-01

    Several analytical methods were employed to determine the concentrations of cholinesterase inhibitors in several Dutch surface waters. An Auto-Analyzer method was used for screening purposes; thin-layer chromatography and gas-liquid chromatography-mass spectrometry were used for identification and

  10. Fitting probability distributions to component water quality data from ...

    African Journals Online (AJOL)

    The treatment of water is carried out to make the available water meet the standards for its intended use. Such use may be for drinking and other household needs, industries,livestock rearing or fisheries etc. poor quality water is commonly treated to ensure potability. Potable water should be free from unpleasant tastes and ...

  11. In situ biodenitrification of nitrate surface water

    International Nuclear Information System (INIS)

    Schmidt, G.C.; Ballew, M.B.

    1995-01-01

    The US Department of Energy's Weldon Spring Site Remedial Action Project has successfully operated a full-scale in situ biodenitrification system to treat water with elevated nitrate levels in abandoned raffinate pits. Bench- and pilot-scale studies were conducted to evaluate the feasibility of the process and to support its full-scale design and application. Bench testing evaluated variables that would influence development of an active denitrifying biological culture. The variables were carbon source, phosphate source, presence and absence of raffinate sludge, addition of a commercially available denitrifying microbial culture, and the use of a microbial growth medium. Nitrate levels were reduced from 750 mg/L NO 3 -N to below 10 mg/L NO 3 -N within 17 days. Pilot testing simulated the full-scale process to determine if nitrate levels could be reduced to less than 10 mg/L NO 3 -N when high levels are present below the sludge surface. Four separate test systems were examined along with two control systems. Nitrates were reduced from 1,200 mg/L NO 3 -N to below 2 mg/L NO 3 -N within 21 days. Full-scale operation has been initiated to denitrify 900,000-gal batches alternating between two 1-acre ponds. The process used commercially available calcium acetate solution and monosodium/disodium phosphate solution as a nutrient source for indigenous microorganisms to convert nitrates to molecular nitrogen and water

  12. Assessing Variation in Water Balance Components in Mountainous Inland River Basin Experiencing Climate Change

    Directory of Open Access Journals (Sweden)

    Zhenliang Yin

    2016-10-01

    Full Text Available Quantification of the changes of water balance components is significant for water resource assessment and management. This paper employed the Soil and Water Assessment Tool (SWAT model to estimate the water balance in a mountainous watershed in northwest China at different spatial scales over the past half century. The results showed that both Nash-Sutcliffe efficiency (NSE and determination coefficient (R2 were over 0.90 for the calibration and validation periods. The water balance components presented rising trends at the watershed scale, and the total runoff increased by 30.5% during 1964 to 2013 period. Rising surface runoff and rising groundwater flow contributed 42.7% and 57.3% of the total rising runoff, respectively. The runoff coefficient was sensitive to increasing precipitation and was not significant to the increase of temperature. The alpine meadow was the main landscape which occupied 51.1% of the watershed and contributed 55.5% of the total runoff. Grass land, forest land, bare land, and glacier covered 14.2%, 18.8%, 15.4%, and 0.5% of the watershed and contributed 8.5%, 16.9%, 15.9%, and 3.2% of the total runoff, respectively. The elevation zone from 3500 to 4500 m occupied 66.5% of the watershed area, and contributed the majority of the total runoff (70.7%. The runoff coefficients in the elevation zone from 1637 to 2800 m, 2800 to 3500 m, 3500 to 4000 m, 4000 to 4500 m, and 4500 to 5062 m were 0.20, 0.27, 0.32, 0.43, and 0.78, respectively, which tend to be larger along with the elevation increase. The quantities and change trends of the water balance components at the watershed scale were calculated by the results of the sub-watersheds. Furthermore, we characterized the spatial distribution of quantities and changes in trends of water balance components at the sub-watershed scale analysis. This study provides some references for water resource management and planning in inland river basins.

  13. Export of nutrient rich Northern Component Water preceded early Oligocene Antarctic glaciation

    Science.gov (United States)

    Coxall, Helen K.; Huck, Claire E.; Huber, Matthew; Lear, Caroline H.; Legarda-Lisarri, Alba; O'Regan, Matt; Sliwinska, Kasia K.; van de Flierdt, Tina; de Boer, Agatha M.; Zachos, James C.; Backman, Jan

    2018-03-01

    The onset of the North Atlantic Deep Water formation is thought to have coincided with Antarctic ice-sheet growth about 34 million years ago (Ma). However, this timing is debated, in part due to questions over the geochemical signature of the ancient Northern Component Water (NCW) formed in the deep North Atlantic. Here we present detailed geochemical records from North Atlantic sediment cores located close to sites of deep-water formation. We find that prior to 36 Ma, the northwestern Atlantic was stratified, with nutrient-rich, low-salinity bottom waters. This restricted basin transitioned into a conduit for NCW that began flowing southwards approximately one million years before the initial Antarctic glaciation. The probable trigger was tectonic adjustments in subarctic seas that enabled an increased exchange across the Greenland-Scotland Ridge. The increasing surface salinity and density strengthened the production of NCW. The late Eocene deep-water mass differed in its carbon isotopic signature from modern values as a result of the leakage of fossil carbon from the Arctic Ocean. Export of this nutrient-laden water provided a transient pulse of CO2 to the Earth system, which perhaps caused short-term warming, whereas the long-term effect of enhanced NCW formation was a greater northward heat transport that cooled Antarctica.

  14. Turbine component having surface cooling channels and method of forming same

    Science.gov (United States)

    Miranda, Carlos Miguel; Trimmer, Andrew Lee; Kottilingam, Srikanth Chandrudu

    2017-09-05

    A component for a turbine engine includes a substrate that includes a first surface, and an insert coupled to the substrate proximate the substrate first surface. The component also includes a channel. The channel is defined by a first channel wall formed in the substrate and a second channel wall formed by at least one coating disposed on the substrate first surface. The component further includes an inlet opening defined in flow communication with the channel. The inlet opening is defined by a first inlet wall formed in the substrate and a second inlet wall defined by the insert.

  15. Application of Tank Model for Predicting Water Balance and Flow Discharge Components of Cisadane Upper Catchment

    Directory of Open Access Journals (Sweden)

    Nana Mulyana Arifjaya

    2012-01-01

    Full Text Available The concept of hydrological tank model was well described into four compartments (tanks. The first tank (tank A comprised of one vertical (qA0 and two lateral (qA1 and qA2 water flow components and tank B comprised of one vertical (qB0 and one lateral (qB1 water flow components. Tank C comprised of one vertical (qC0 and one lateral (qC1 water flow components, whereas tank D comprised of one lateral water flow component (qD1.  These vertical water flows would also contribute to the depletion of water flow in the related tanks but would replenish tanks in the deeper layers. It was assumed that at all lateral water flow components would finally accumulate in one stream, summing-up of the lateral water flow, much or less, should be equal to the water discharge (Qo at specified time concerns. Tank A received precipitation (R and evapo-transpiration (ET which was its gradientof (R-ET over time would become the driving force for the changes of water stored in the soil profiles and thosewater flows leaving the soil layer.  Thus tank model could describe th vertical and horizontal water flow withinthe watershed. The research site was Cisadane Upper Catchment, located at Pasir Buncir Village of CaringinSub-District within the Regency of Bogor in West Java Province.  The elevations ranged 512 –2,235 m above sealevel, with a total drainage area of 1,811.5 ha and total length of main stream of 14,340.7 m.  The land cover wasdominated by  forest  with a total of 1,044.6 ha (57.67%,  upland agriculture with a total of 477.96 ha (26.38%,mixed garden with a total of 92.85 ha(5.13% and semitechnical irigated rice field with a total of 196.09 ha (10,8%.  The soil was classified as hydraquent (96.6% and distropept (3.4%.  Based on the calibration of tank model application in the study area, the resulting coefficient of determination (R2 was 0.72 with model efficiency (NSEof= 0.75, thus tank model could well illustrate the water flow distribution of

  16. Radioecological state of some surface water systems of contaminated areas of both Gomel and Mogilev Regions

    International Nuclear Information System (INIS)

    Datskevich, P. I.; Komissariv, F. D.; Khvale', O. D.; Basharina, L. P.; Lobach, I. L.

    1997-01-01

    The radioecological situation of different ecosystems of Belarus and their components has been analysed. Such components of the surface water ecosystems as water, suspensions, sediments and soils of water-collection areas were used for the investigation of the content of cesium 137 and strontium 90. The received data were given since 1990. The content of cesium 137 and strontium 90 in the components of water ecosystems was counted in the laboratory conditions by means of standard methods of beta radiometry, semiconductor gamma spectrometry and radiochemistry. The error of measurement of radioactivity was not higher than 25 and 35% for cesium 137 and strontium 90 accordingly. Water ecosystems were distinguished by the state of contamination of water-collection areas and hydrological parameters. These and some other reasons considered in the article influence on the character of cesium 137 and strontium 90 behaviour in water ecosystems

  17. Evaluating the hydrological consistency of satellite based water cycle components

    KAUST Repository

    Lopez Valencia, Oliver Miguel; Houborg, Rasmus; McCabe, Matthew

    2016-01-01

    observation. Basin-scale studies have shown considerable variability in achieving water budget closure with any degree of accuracy using satellite estimates of the water cycle. In order to assess the suitability of this type of approach for evaluating

  18. Effect of Model Selection on Computed Water Balance Components

    NARCIS (Netherlands)

    Jhorar, R.K.; Smit, A.A.M.F.R.; Roest, C.W.J.

    2009-01-01

    Soil water flow modelling approaches as used in four selected on-farm water management models, namely CROPWAT. FAIDS, CERES and SWAP, are compared through numerical experiments. The soil water simulation approaches used in the first three models are reformulated to incorporate ail evapotranspiration

  19. Water Balance of the Eğirdir Lake and the Influence of Budget Components, Isparta,Turkey

    Directory of Open Access Journals (Sweden)

    Ayşen DAVRAZ

    2014-09-01

    Full Text Available Water budget of lakes must be determined regarding to their sustainable usage as for all water resources. One of the major problems in the management of lakes is the estimation of water budget components. The lack of regularly measured data is the biggest problem in calculation of hydrological balance of a lake. A lake water budget is computed by measuring or estimating all of the lake’s water gains and losses and measuring the corresponding changes in the lake volume over the same time period. Eğirdir Lake is one of the most important freshwater lakes in Turkey and is the most important surface water resources in the region due to different usages. Recharge of the Eğirdir Lake is supplied from especially precipitation, surface and subsurface water inflow. The discharge components of the lake are evaporation and water intake for irrigation, drinking and energy purposes. The difference between recharge and discharge of the lake was calculated as 7.78 hm3 for 1970-2010 period. According to rainfall, evaporation and the lake water level relations, rainfall is dominantly effective on the lake water level such as direct recharge to the lake and indirect recharge with groundwater flow

  20. Systems Reliability Framework for Surface Water Sustainability and Risk Management

    Science.gov (United States)

    Myers, J. R.; Yeghiazarian, L.

    2016-12-01

    framework will significantly improve the efficiency and precision of sustainable watershed management strategies through providing a better understanding of how watershed characteristics and environmental parameters affect surface water quality and sustainability. With microbial contamination posing a serious threat to the availability of clean water across the world, it is necessary to develop a framework that evaluates the safety and sustainability of water systems in respect to non-point source fecal microbial contamination. The concept of water safety is closely related to the concept of failure in reliability theory. In water quality problems, the event of failure can be defined as the concentration of microbial contamination exceeding a certain standard for usability of water. It is pertinent in watershed management to know the likelihood of such an event of failure occurring at a particular point in space and time. Microbial fate and transport are driven by environmental processes taking place in complex, multi-component, interdependent environmental systems that are dynamic and spatially heterogeneous, which means these processes and therefore their influences upon microbial transport must be considered stochastic and variable through space and time. A physics-based stochastic model of microbial dynamics is presented that propagates uncertainty using a unique sampling method based on artificial neural networks to produce a correlation between watershed characteristics and spatial-temporal probabilistic patterns of microbial contamination. These results are used to address the question of water safety through several sustainability metrics: reliability, vulnerability, resilience and a composite sustainability index. System reliability is described uniquely though the temporal evolution of risk along watershed points or pathways. Probabilistic resilience describes how long the system is above a certain probability of failure, and the vulnerability metric describes how

  1. Antibacterial performance of polypropylene nonwoven fabric wound dressing surfaces containing passive and active components

    Energy Technology Data Exchange (ETDEWEB)

    Xin, Zhirong, E-mail: xinzhirong2012@126.com [School of Chemistry and Chemical Engineering, Yantai University, Yantai 264005 (China); Du, Shanshan; Zhao, Chunyu; Chen, Hao; Sun, Miao [School of Chemistry and Chemical Engineering, Yantai University, Yantai 264005 (China); Yan, Shunjie [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Luan, Shifang, E-mail: sfluan@ciac.ac.cn [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Yin, Jinghua [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

    2016-03-01

    Graphical abstract: - Highlights: • PNVP and PHMG components were covalently immobilized on PP{sub NWF} surface. • PP{sub NWF}-g-PNVP-PHMG possessed bacterial adhesion-resistant and bactericidal capabilities. • PP{sub NWF}-g-PNVP-PHMG obviously suppressed platelet and red blood cell adhesion. - Abstract: A growing number of wound dressing-related nosocomial infections necessitate the development of novel antibacterial strategies. Herein, polypropylene non-woven fabric (PP{sub NWF}) was facilely modified with passive and active antibacterial components, namely photografting polymerization both N-Vinyl-2-pyrrolidone (NVP) and glycidyl methacrylate (GMA) monomers, and the introduction of guanidine polymer through the reaction between active amino groups and epoxy groups. The modified samples were confirmed by attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR), X-ray photoelectron spectroscopy (XPS), respectively. Water contact angle measurement, antibacterial test, platelet and red blood cell adhesion were used to evaluate the hydrophilicity, antibacterial properties and hemocompatibility of the samples. It was found that the antibacterial properties were obviously enhanced, meanwhile significantly suppressing platelet and red blood cell adhesion after the above modification. This PP{sub NWF} samples that possess antifouling and antimicrobial properties, have great potential in wound dressing applications.

  2. Antibacterial performance of polypropylene nonwoven fabric wound dressing surfaces containing passive and active components

    International Nuclear Information System (INIS)

    Xin, Zhirong; Du, Shanshan; Zhao, Chunyu; Chen, Hao; Sun, Miao; Yan, Shunjie; Luan, Shifang; Yin, Jinghua

    2016-01-01

    Graphical abstract: - Highlights: • PNVP and PHMG components were covalently immobilized on PP_N_W_F surface. • PP_N_W_F-g-PNVP-PHMG possessed bacterial adhesion-resistant and bactericidal capabilities. • PP_N_W_F-g-PNVP-PHMG obviously suppressed platelet and red blood cell adhesion. - Abstract: A growing number of wound dressing-related nosocomial infections necessitate the development of novel antibacterial strategies. Herein, polypropylene non-woven fabric (PP_N_W_F) was facilely modified with passive and active antibacterial components, namely photografting polymerization both N-Vinyl-2-pyrrolidone (NVP) and glycidyl methacrylate (GMA) monomers, and the introduction of guanidine polymer through the reaction between active amino groups and epoxy groups. The modified samples were confirmed by attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR), X-ray photoelectron spectroscopy (XPS), respectively. Water contact angle measurement, antibacterial test, platelet and red blood cell adhesion were used to evaluate the hydrophilicity, antibacterial properties and hemocompatibility of the samples. It was found that the antibacterial properties were obviously enhanced, meanwhile significantly suppressing platelet and red blood cell adhesion after the above modification. This PP_N_W_F samples that possess antifouling and antimicrobial properties, have great potential in wound dressing applications.

  3. Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

    KAUST Repository

    Jin, Yong

    2017-06-23

    Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH) to elucidate their roles on water mass collection efficiency. The experimental results indicate that a hydrophilic surface promotes nucleation and individual droplets growth, and a surface with a low CAH tends to let a smaller droplet to slide down, but the overall water mass collection efficiency is independent of both surface contact angle and CAH. The experimental results agree well with our theoretical calculations. During water condensation, a balance has to be struck between single droplet growth and droplet density on a surface so as to maintain a constant water droplet surface coverage ratio, which renders the role of both surface wettability and hysteresis insignificant to the ultimate water mass collection. Moreover, water droplets on the edges of a surface grow much faster than those on the non-edge areas and thus dominate the contribution to the water mass collection by the entire surface, directly pointing out the very important role of edge effect on water condensation and collection.

  4. Nuclear electronic components of surface contamination monitor based on multi-electrode proportional counter

    International Nuclear Information System (INIS)

    Du Xiangyang; Zhang Yong; Han Shuping; Rao Xianming; Fang Jintu

    2001-01-01

    The nuclear electronic components applying in Portal Monitor and Hands and Feet Surface Contamination Monitor were based on modern integrated circuit are introduced. The detailed points in circuit design and manufacturing technique are analyzed

  5. Monthly version of HadISST sea surface temperature state-space components

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — State-Space Decomposition of Monthly version of HadISST sea surface temperature component (1-degree). See Rayner, N. A., Parker, D. E., Horton, E. B., Folland, C....

  6. Different types of configurations of equipotential surfaces of binary systems with very luminous components

    Energy Technology Data Exchange (ETDEWEB)

    Zorec, J [Centre National de la Recherche Scientifique, 75 - Paris (France). Inst. d' Astrophysique; Niemela, V [Instituto de Astronomia y Fisica del Espacio, Buenos Aires (Argentina)

    1980-02-04

    If the luminosities and the masses of the components of a binary system are known, it is possible to determine from the diagrams presented here, the type of configuration of equipotential surfaces that correspond to it.

  7. Different types of configurations of equipotential surfaces of binary systems with very luminous components

    International Nuclear Information System (INIS)

    Zorec, Juan

    1980-01-01

    If the luminosities and the masses of the components of a binary system are known, it is possible to determine from the diagrams presented here, the type of configuration of equipotential surfaces that correspond to it [fr

  8. Characterisation of the inorganic chemistry of surface waters in ...

    African Journals Online (AJOL)

    The main purpose of this study was to determine a simple inorganic chemistry index that can be used for all surface waters in South Africa, in order to characterise the inorganic chemistry of surface waters. Water quality data collected up until 1999 from all sample monitoring stations (2 068 monitoring stations, 364 659 ...

  9. Thermophoretically driven water droplets on graphene and boron nitride surfaces

    Science.gov (United States)

    Rajegowda, Rakesh; Kannam, Sridhar Kumar; Hartkamp, Remco; Sathian, Sarith P.

    2018-05-01

    We investigate thermally driven water droplet transport on graphene and hexagonal boron nitride (h-BN) surfaces using molecular dynamics simulations. The two surfaces considered here have different wettabilities with a significant difference in the mode of droplet transport. The water droplet travels along a straighter path on the h-BN sheet than on graphene. The h-BN surface produced a higher driving force on the droplet than the graphene surface. The water droplet is found to move faster on h-BN surface compared to graphene surface. The instantaneous contact angle was monitored as a measure of droplet deformation during thermal transport. The characteristics of the droplet motion on both surfaces is determined through the moment scaling spectrum. The water droplet on h-BN surface showed the attributes of the super-diffusive process, whereas it was sub-diffusive on the graphene surface.

  10. Adsorption-Driven Surface Segregation of the Less Reactive Alloy Component

    DEFF Research Database (Denmark)

    Andersson, Klas Jerker; Calle Vallejo, Federico; Rossmeisl, Jan

    2009-01-01

    Counterintuitive to expectations and all prior observations of adsorbate-induced surface segregation of the more reactive alloy component (the one forming the stronger bond with the adsorbate), we show that CO adsorption at elevated pressures and temperatures pulls the less reactive Cu to the sur......Counterintuitive to expectations and all prior observations of adsorbate-induced surface segregation of the more reactive alloy component (the one forming the stronger bond with the adsorbate), we show that CO adsorption at elevated pressures and temperatures pulls the less reactive Cu...... to the surface of a CuPt near-surface alloy. The Cu surface segregation is driven by the formation of a stable self-organized CO/CuPt surface alloy structure and is rationalized in terms of the radically stronger Pt−CO bond when Cu is present in the first surface layer of Pt. The results, which are expected...

  11. Photochemical Transformation Processes in Sunlit Surface Waters

    Science.gov (United States)

    Vione, D.

    2012-12-01

    Photochemical reactions are major processes in the transformation of hardly biodegradable xenobiotics in surface waters. They are usually classified into direct photolysis and indirect or sensitised degradation. Direct photolysis requires xenobiotic compounds to absorb sunlight, and to get transformed as a consequence. Sensitised transformation involves reaction with transient species (e.g. °OH, CO3-°, 1O2 and triplet states of chromophoric dissolved organic matter, 3CDOM*), photogenerated by so-called photosensitisers (nitrate, nitrite and CDOM). CDOM is a major photosensitiser: is it on average the main source of °OH (and of CO3-° as a consequence, which is mainly produced upon oxidation by °OH of carbonate and bicarbonate) and the only important source of 1O2 and 3CDOM* [1, 2]. CDOM origin plays a key role in sensitised processes: allochthonous CDOM derived from soil runoff and rich in fulvic and humic substances is usually more photoactive than autochthonous CDOM (produced by in-water biological processes and mainly consisting of protein-like material) or of CDOM derived from atmospheric deposition. An interesting gradual evolution of CDOM origin and photochemistry can be found in mountain lakes across the treeline, which afford a gradual transition of allochthonous- autochtonous - atmopheric CDOM when passing from trees to alpine meadows to exposed rocks [3]. Another important issue is the sites of reactive species photoproduction in CDOM. While there is evidence that smaller molecular weight fractions are more photoactive, some studies have reported considerable 1O2 reactivity in CDOM hydrophobic sites and inside particles [4]. We have recently addressed the problem and found that dissolved species in standard humic acids (hydrodynamic diameter pollutants to be assessed and modelled. For instance, it is possible to predict pollutant half-life times by knowing absorption spectrum, direct photolysis quantum yield and reaction rate constants with °OH, CO3

  12. Heavy water: a distinctive and essential component of CANDU

    International Nuclear Information System (INIS)

    Miller, A.I.; van Alstyne, H.M.

    1994-06-01

    The exceptional properties of heavy water as a neutron moderator provide one of the distinctive features of CANDU reactors. Although most of the chemical and physical properties of deuterium and protium (mass 1 hydrogen) are appreciably different, the low terrestrial abundance of deuterium makes the separation of heavy water a relatively costly process, and so of considerable importance to the CANDU system. World heavy-water supplies are currently provided by the Girdler-Sulphide process or processes based on ammonia-hydrogen exchange. Due to cost and hazard considerations, new processes will be required for the production of heavy water in and beyond the next decade. Through AECL's development and refinement of wetproofed catalysts for the exchange of hydrogen isotopes between water and hydrogen, a family of new processes is expected to be deployed. Two monothermal processes, CECE (Combined Electrolysis and Catalytic Exchange, using water-to-hydrogen conversion by electrolysis) and CIRCE (Combined Industrially Reformed hydrogen and Catalytic Exchange, based on steam reforming of hydrocarbons), are furthest advanced. Besides its use for heavy-water production, the CECE process is a highly effective technology for heavy-water upgrading and for tritium separation from heavy (or light) water. (author). 10 refs., 1 tab., 7 figs

  13. Identifying apple surface defects using principal components analysis and artifical neural networks

    Science.gov (United States)

    Artificial neural networks and principal components were used to detect surface defects on apples in near-infrared images. Neural networks were trained and tested on sets of principal components derived from columns of pixels from images of apples acquired at two wavelengths (740 nm and 950 nm). I...

  14. How to repel hot water from a superhydrophobic surface?

    KAUST Repository

    Yu, Zhejun

    2014-01-01

    Superhydrophobic surfaces, with water contact angles greater than 150° and slide angles less than 10°, have attracted a great deal of attention due to their self-cleaning ability and excellent water-repellency. It is commonly accepted that a superhydrophobic surface loses its superhydrophobicity in contact with water hotter than 50 °C. Such a phenomenon was recently demonstrated by Liu et al. [J. Mater. Chem., 2009, 19, 5602], using both natural lotus leaf and artificial leaf-like surfaces. However, our work has shown that superhydrophobic surfaces maintained their superhydrophobicity, even in water at 80 °C, provided that the leaf temperature is greater than that of the water droplet. In this paper, we report on the wettability of water droplets on superhydrophobic thin films, as a function of both their temperatures. The results have shown that both the water contact and slide angles on the surfaces will remain unchanged when the temperature of the water droplet is greater than that of the surface. The water contact angle, or the slide angle, will decrease or increase, however, with droplet temperatures increasingly greater than that of the surfaces. We propose that, in such cases, the loss of superhydrophobicity of the surfaces is caused by evaporation of the hot water molecules and their condensation on the cooler surface. © 2014 the Partner Organisations.

  15. Surface water management: a user's guide to calculate a water balance using the CREAMS model

    International Nuclear Information System (INIS)

    Lane, L.J.

    1984-11-01

    The hydrologic component of the CREAMS model is described and discussed in terms of calculating a surface water balance for shallow land burial systems used for waste disposal. Parameter estimates and estimation procedures are presented in detail in the form of a user's guide. Use of the model is illustrated with three examples based on analysis of data from Los Alamos, New Mexico and Rock Valley, Nevada. Use of the model in design of trench caps for shallow land burial systems is illustrated with the example applications at Los Alamos

  16. Distribution of {sup 129}I in terrestrial surface water environments

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xuegao [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Gong, Meng [College of Hydrology and Water Resources, Hohai University, Nanjing (China); Yi, Peng, E-mail: pengyi1915@163.com [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Aldahan, Ala [Department of Earth Sciences, Uppsala University, Uppsala (Sweden); Department of Geology, United Arab Emirates University, Al Ain (United Arab Emirates); Yu, Zhongbo [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Possnert, Göran [Tandem Laboratory, Uppsala University, Uppsala (Sweden); Chen, Li [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China)

    2015-10-15

    The global distribution of the radioactive isotope iodine-129 in surface waters (lakes and rivers) is presented here and compared with the atmospheric deposition and distribution in surface marine waters. The results indicate relatively high concentrations in surface water systems in close vicinity of the anthropogenic release sources as well as in parts of Western Europe, North America and Central Asia. {sup 129}I level is generally higher in the terrestrial surface water of the Northern hemisphere compared to the southern hemisphere. The highest values of {sup 129}I appear around 50°N and 40°S in the northern and southern hemisphere, separately. Direct gaseous and marine atmospheric emissions are the most likely avenues for the transport of {sup 129}I from the sources to the terrestrial surface waters. To apply iodine-129 as process tracer in terrestrial surface water environment, more data are needed on {sup 129}I distribution patterns both locally and globally.

  17. Application of SWAT99.2 to sensitivity analysis of water balance components in unique plots in a hilly region

    Directory of Open Access Journals (Sweden)

    Jun-feng Dai

    2017-07-01

    Full Text Available Although many sensitivity analyses using the soil and water assessment tool (SWAT in a complex watershed have been conducted, little attention has been paid to the application potential of the model in unique plots. In addition, sensitivity analysis of percolation and evapotranspiration with SWAT has seldom been undertaken. In this study, SWAT99.2 was calibrated to simulate water balance components for unique plots in Southern China from 2000 to 2001, which included surface runoff, percolation, and evapotranspiration. Twenty-one parameters classified into four categories, including meteorological conditions, topographical characteristics, soil properties, and vegetation attributes, were used for sensitivity analysis through one-at-a-time (OAT sampling to identify the factor that contributed most to the variance in water balance components. The results were shown to be different for different plots, with parameter sensitivity indices and ranks varying for different water balance components. Water balance components in the broad-leaved forest and natural grass plots were most sensitive to meteorological conditions, less sensitive to vegetation attributes and soil properties, and least sensitive to topographical characteristics. Compared to those in the natural grass plot, water balance components in the broad-leaved forest plot demonstrated higher sensitivity to the maximum stomatal conductance (GSI and maximum leaf area index (BLAI.

  18. Water quality assessment using SVD-based principal component ...

    African Journals Online (AJOL)

    SVD) of hydrological data was tested for water quality assessment. Using two case studies of waste- and drinking water, PCA via SVD was able to find latent variables which explain 80.8% and 83.7% of the variance, respectively. By means of ...

  19. Descriptive Characteristics of Surface Water Quality in Hong Kong by a Self-Organising Map

    Directory of Open Access Journals (Sweden)

    Yan An

    2016-01-01

    Full Text Available In this study, principal component analysis (PCA and a self-organising map (SOM were used to analyse a complex dataset obtained from the river water monitoring stations in the Tolo Harbor and Channel Water Control Zone (Hong Kong, covering the period of 2009–2011. PCA was initially applied to identify the principal components (PCs among the nonlinear and complex surface water quality parameters. SOM followed PCA, and was implemented to analyze the complex relationships and behaviors of the parameters. The results reveal that PCA reduced the multidimensional parameters to four significant PCs which are combinations of the original ones. The positive and inverse relationships of the parameters were shown explicitly by pattern analysis in the component planes. It was found that PCA and SOM are efficient tools to capture and analyze the behavior of multivariable, complex, and nonlinear related surface water quality data.

  20. Descriptive Characteristics of Surface Water Quality in Hong Kong by a Self-Organising Map.

    Science.gov (United States)

    An, Yan; Zou, Zhihong; Li, Ranran

    2016-01-08

    In this study, principal component analysis (PCA) and a self-organising map (SOM) were used to analyse a complex dataset obtained from the river water monitoring stations in the Tolo Harbor and Channel Water Control Zone (Hong Kong), covering the period of 2009-2011. PCA was initially applied to identify the principal components (PCs) among the nonlinear and complex surface water quality parameters. SOM followed PCA, and was implemented to analyze the complex relationships and behaviors of the parameters. The results reveal that PCA reduced the multidimensional parameters to four significant PCs which are combinations of the original ones. The positive and inverse relationships of the parameters were shown explicitly by pattern analysis in the component planes. It was found that PCA and SOM are efficient tools to capture and analyze the behavior of multivariable, complex, and nonlinear related surface water quality data.

  1. Surface roughness characterization of cast components using 3D optical methods

    DEFF Research Database (Denmark)

    Nwaogu, Ugochukwu Chibuzoh; Tiedje, Niels Skat; Hansen, Hans Nørgaard

    scanning probe image processor (SPIP) software and the results of the surface roughness parameters obtained were subjected to statistical analyses. The bearing area ratio was introduced and applied to the surface roughness analysis. From the results, the surface quality of the standard comparators...... is successfully characterised and it was established that the areal parameters are more informative for sand cast components. The roughness values of the standard visual comparators can serve as a control for the cast components and for order specifications in the foundry industry. A series of iron castings were...... made in green sand moulds and the surface roughness parameter (Sa) values were compared with those of the standards. Sa parameter suffices for the evaluation of casting surface texture. The S series comparators showed a better description of the surface of castings after shot blasting than the A series...

  2. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  3. Variability in chemistry of surface and soil waters of an ...

    African Journals Online (AJOL)

    Water chemistry is important for the maintenance of wetland structure and function. Interpreting ecological patterns in a wetland system therefore requires an in-depth understanding of the water chemistry of that system. We investigated the spatial distribution of chemical solutes both in soil pore water and surface water, ...

  4. Short Communication: Conductivity as an indicator of surface water ...

    African Journals Online (AJOL)

    Various water- soluble species are present in FeCr waste materials and in process water. Considering the size of the South African FeCr industry and its global importance, it is essential to assess the extent of potential surface water pollution in the proximity of FeCr smelters by such watersoluble species. In this study water ...

  5. A geo-informatics approach for estimating water resources management components and their interrelationships

    KAUST Repository

    Liaqat, Umar Waqas

    2016-09-21

    A remote sensing based geo-informatics approach was developed to estimate water resources management (WRM) components across a large irrigation scheme in the Indus Basin of Pakistan. The approach provides a generalized framework for estimating a range of key water management variables and provides a management tool for the sustainable operation of similar schemes globally. A focus on the use of satellite data allowed for the quantification of relationships across a range of spatial and temporal scales. Variables including actual and crop evapotranspiration, net and gross irrigation, net and gross groundwater use, groundwater recharge, net groundwater recharge, were estimated and then their interrelationships explored across the Hakra Canal command area. Spatially distributed remotely sensed estimates of actual evapotranspiration (ETa) rates were determined using the Surface Energy Balance System (SEBS) model and evaluated against ground-based evaporation calculated from the advection-aridity method. Analysis of ETa simulations across two cropping season, referred to as Kharif and Rabi, yielded Pearson correlation (R) values of 0.69 and 0.84, Nash-Sutcliffe criterion (NSE) of 0.28 and 0.63, percentage bias of −3.85% and 10.6% and root mean squared error (RMSE) of 10.6 mm and 12.21 mm for each season, respectively. For the period of study between 2008 and 2014, it was estimated that an average of 0.63 mm day−1 water was supplied through canal irrigation against a crop water demand of 3.81 mm day−1. Approximately 1.86 mm day−1 groundwater abstraction was estimated in the region, which contributed to fulfil the gap between crop water demand and canal water supply. Importantly, the combined canal, groundwater and rainfall sources of water only met 70% of the crop water requirements. As such, the difference between recharge and discharge showed that groundwater depletion was around −115 mm year−1 during the six year study period. Analysis indicated that

  6. TURBIDITY REMOVAL FROM SURFACE WATER USING ...

    African Journals Online (AJOL)

    User

    2016-06-01

    Jun 1, 2016 ... Plant-based coagulants are potential alternatives to chemical coagulants used in drinking water treatment. ... Conventional water treatment systems involve the use of synthetic ..... Thesis, Royal Institute of Technology (KTH),.

  7. Two-component injection moulding simulation of ABS-POM micro structured surfaces

    DEFF Research Database (Denmark)

    Tosello, Guido; Hansen, Hans Nørgaard; Islam, Aminul

    2013-01-01

    Multi-component micro injection moulding (μIM) processes such as two-component (2k) μIM are the key technologies for the mass fabrication of multi-material micro products. 2k-μIM experiments involving a miniaturized test component with micro features in the sub-mm dimensional range and moulding...... a pair of thermoplastic materials (ABS and POM) were conducted. Three dimensional process simulations based on the finite element method have been performed to explore the capability of predicting filling pattern shape at component-level and surface micro feature-level in a polymer/polymer overmoulding...

  8. Indices of quality surface water bodies in the planning of water resources

    Directory of Open Access Journals (Sweden)

    Rodríguez-Miranda, Juan Pablo

    2016-12-01

    Full Text Available This paper considers a review of the literature major and significant methods of quality indices of water applied in surface water bodies, used and proposed for assessing the significance of parameters of water quality in the assessment of surface water currents and they are usually used in making decisions for intervention and strategic prevention measures for those responsible for the conservation and preservation of watersheds where these water bodies belong. An exploratory methodology was applied to realize the conceptualization of each water quality index. As a result, it is observed that there are several important methods for determining the water quality index applied in surface water bodies.

  9. An ontology design pattern for surface water features

    Science.gov (United States)

    Sinha, Gaurav; Mark, David; Kolas, Dave; Varanka, Dalia; Romero, Boleslo E.; Feng, Chen-Chieh; Usery, E. Lynn; Liebermann, Joshua; Sorokine, Alexandre

    2014-01-01

    Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities exist due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology for other more context-dependent ontologies. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex or specialized surface water ontologies. A fundamental distinction is made in this ontology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is implemented in OWL, but Description Logic axioms and a detailed explanation is provided in this paper. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. Also provided is a discussion of why there is a need to complement the pattern with other ontologies, especially the previously developed Surface Network pattern. Finally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through an annotated geospatial dataset and sample queries using the classes of the Surface Water pattern.

  10. Adherence of extracellular matrix components to modified surfaces of titanium alloys

    International Nuclear Information System (INIS)

    Stelzer, C; Uhlmann, E; Meinke, M; Lademann, J; Hansen, U

    2009-01-01

    The adherence of biological materials on metal surfaces is of special importance in biology and medicine. The underlying interactions between surface and biological materials (e.g. extracellular matrix components or cells) are responsible for the application as a medical device. Numerous products are made of pure titanium and titanium alloys. This paper shows the influence of a laser production technology on machined surfaces of TiAl 6 V 4 and the resulting adherence of biological material on the basis of the surface characterisation. In this study, different machined TiAl 6 V 4 surfaces were used for coatings with extracellular matrix components. For this process, different coating with collagen I monomers and a complex mixture of extracellular matrix proteins derived from the dermal-epidermal basement membrane zone were analysed. The efficiency of the coating was analysed by different methods and the results are presented in this paper

  11. Heterogeneous Ice Nucleation: Interplay of Surface Properties and Their Impact on Water Orientations.

    Science.gov (United States)

    Glatz, Brittany; Sarupria, Sapna

    2018-01-23

    Ice is ubiquitous in nature, and heterogeneous ice nucleation is the most common pathway of ice formation. How surface properties affect the propensity to observe ice nucleation on that surface remains an open question. We present results of molecular dynamics studies of heterogeneous ice nucleation on model surfaces. The models surfaces considered emulate the chemistry of kaolinite, an abundant component of mineral dust. We investigate the interplay of surface lattice and hydrogen bonding properties in affecting ice nucleation. We find that lattice matching and hydrogen bonding are necessary but not sufficient conditions for observing ice nucleation at these surfaces. We correlate this behavior to the orientations sampled by the metastable supercooled water in contact with the surfaces. We find that ice is observed in cases where water molecules not only sample orientations favorable for bilayer formation but also do not sample unfavorable orientations. This distribution depends on both surface-water and water-water interactions and can change with subtle modifications to the surface properties. Our results provide insights into the diverse behavior of ice nucleation observed at different surfaces and highlight the complexity in elucidating heterogeneous ice nucleation.

  12. water quality assessment of underground and surface water ...

    African Journals Online (AJOL)

    Dr Osondu

    Water quality assessment in the Ethiopian highlands is crucial owing to increasing ... and provide information for formulating appropriate framework for an integrated ... with four seasons (rainy, dry period, small rains ..... treatment. Annual conference proceedings, American Water Works ... Towns' water supply and sanitation.

  13. Separation and Fixation of Toxic Components in Salt Brines Using a Water-Based Process

    International Nuclear Information System (INIS)

    Franks, Carrie J.; Quach, Anh P.; Birnie, Dunbar P.; Ela, Wendell P.; Saez, Avelino E.; Zelinski, Brian J.; Smith, Harry D.; Smith, Gary Lynn L.

    2004-01-01

    Efforts to implement new water quality standards, increase water reuse and reclamation, and minimize the cost of waste storage motivate the development of new processes for stabilizing waste water residuals that minimize waste volume, water content and the long-term environmental risk from related by products. This work explores the use of an aqueous-based emulsion process to create an epoxy/rubber matrix for separating and encapsulating waste components from salt laden, arsenic contaminated, amorphous iron hydrate sludges. Such sludges are generated from conventional water purification precipitation/adsorption processes, used to convert aqueous brine streams to semi-solid waste streams, such as ion exchange/membrane separation, and from other precipitative heavy metal removal operations. In this study, epoxy and polystyrene butadiene (PSB) rubber emulsions are mixed together and then combined with a surrogate sludge. The surrogate sludge consists of amorphous iron hydrate with 1 part arsenic fixed to the surface of the hydrate per 10 parts iron mixed with sodium nitrate and chloride salts and water. The resulting emulsion is cured and dried at 80 C to remove water. Microstructure characterization by electron microscopy confirms that the epoxy/PSB matrix surrounds and encapsulates the arsenic laden amorphous iron hydrate phase while allowing the salt to migrate to internal and external surfaces of the sample. Salt extraction studies indicate that the porous nature of the resulting matrix promotes the separation and removal of as much as 90% of the original salt content in only one hours time. Long term leaching studies based on the use of the infinite slab diffusion model reveal no evidence of iron migration or, by inference, arsenic migration, and demonstrate that the diffusion coefficients of the unextracted salt yield leachability indices within regulations for non-hazardous landfill disposal. Because salt is the most mobile species, it is inferred that arsenic

  14. Infiltration of pesticides in surface water into nearby drinking water supply wells

    DEFF Research Database (Denmark)

    Malaguerra, Flavio; Albrechtsen, Hans-Jørgen; Binning, Philip John

    Drinking water wells are often placed near streams because streams often overly permeable sediments and the water table is near the surface in valleys, and so pumping costs are reduced. The lowering of the water table by pumping wells can reverse the natural flow from the groundwater to the stream......, inducing infiltration of surface water to groundwater and consequently to the drinking water well. Many attenuation processes can take place in the riparian zone, mainly due to mixing, biodegradation and sorption. However, if the water travel time from the surface water to the pumping well is too short......, or if the compounds are poorly degradable, contaminants can reach the drinking water well at high concentrations, jeopardizing drinking water quality. Here we developed a reactive transport model to evaluate the risk of contamination of drinking water wells by surface water pollution. The model was validated using...

  15. Instability of confined water films between elastic surfaces

    NARCIS (Netherlands)

    de Beer, Sissi; 't Mannetje, Dieter; Zantema, Sietske; Mugele, Friedrich

    2010-01-01

    We investigated the dynamics of nanometer thin water films at controlled ambient humidity adsorbed onto two atomically smooth mica sheets upon rapidly bringing the surfaces into contact. Using a surface forces apparatus (SFA) in imaging mode, we found that the water films break up into a

  16. Models of Fate and Transport of Pollutants in Surface Waters

    Science.gov (United States)

    Okome, Gloria Eloho

    2013-01-01

    There is the need to answer very crucial questions of "what happens to pollutants in surface waters?" This question must be answered to determine the factors controlling fate and transport of chemicals and their evolutionary state in surface waters. Monitoring and experimental methods are used in establishing the environmental states.…

  17. Economic Impacts of Surface Mining on Household Drinking Water Supplies

    Science.gov (United States)

    This report provides information on the economic and social impacts of contaminated surface and ground water supplies on residents and households near surface mining operations. The focus is on coal slurry contamination of water supplies in Mingo County, West Virginia, and descr...

  18. The impact of uncontrolled waste disposal on surface water quality ...

    African Journals Online (AJOL)

    The main threat to the surface water quality in Addis Ababa is environmental pollution derived from domestic and industrial activities. Due to the inadequacy of controlled waste management strategies and waste treatment plants, people are forced to discharge wastes both on open surface and within water bodies.

  19. Sampling procedure for lake or stream surface water chemistry

    Science.gov (United States)

    Robert Musselman

    2012-01-01

    Surface waters collected in the field for chemical analyses are easily contaminated. This research note presents a step-by-step detailed description of how to avoid sample contamination when field collecting, processing, and transporting surface water samples for laboratory analysis.

  20. A study of water hammer phenomena in a one-component two-phase bubbly flow

    International Nuclear Information System (INIS)

    Fujii, Terushige; Akagawa, Koji

    2000-01-01

    Water hammer phenomena caused by a rapid valve closure, that is, shock phenomena in two-phase flows, are an important problem for the safety assessment of a hypothetical LOCA. This paper presents the results of experimental and analytical studies of the water hammer phenomena in a one-component tow-phase bubbly flow. In order to clarify the characteristics of water hammer phenomena, experiments for a one-component two-phase flow of Freon R-113 were conducted and a numerical simulation of pressure transients was developed. An overall picture of the water hammer phenomena in a one-component two-phase flow is presented an discussed. (author)

  1. Water management as a key component of integrated weed management

    Directory of Open Access Journals (Sweden)

    Antonio Berti

    2010-09-01

    Full Text Available Water management within the cropping system is a key factor for an integrated weed management. Soil moisture affects seed persistence and seed dormancy, thus influencing their germination, the establishment of seedlings as well as the competition at adult stage and the number, vitality and dormancy of the new seeds produced by the weeds. The interactions among water availability and competition are very complex and still not fully understood. A research effort in this sector should the be very relevant for the development of new approaches of weed management, such as “Ecological weed management”, aiming to reduce weed density and competitiveness and, in the medium term, to prevent undesired modifications of the weed flora.

  2. Monitoring of Water and Contaminant Migration at the Groundwater-Surface Water Interface

    Science.gov (United States)

    2008-08-01

    seepage is occurring in a freshwater lake environment and to map the lateral extent of any subsurface contamination at the groundwater –surface water ...and Contaminant Migration at the Groundwater -Surface Water Interface August 2008 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public...4. TITLE AND SUBTITLE Monitoring of Water and Contaminant Migration at the Groundwater -Surface Water Interface 5a. CONTRACT NUMBER 5b. GRANT NUMBER

  3. Component failures at pressurized water reactors. Final report

    International Nuclear Information System (INIS)

    Reisinger, M.F.

    1980-10-01

    Objectives of this study were to identify those systems having major impact on safety and availability (i.e. to identify those systems and components whose failures have historically caused the greatest number of challenges to the reactor protective systems and which have resulted in greatest loss of electric generation time). These problems were identified for engineering solutions and recommendations made for areas and programs where research and development should be concentrated. The program was conducted in three major phases: Data Analysis, Engineering Evaluation, Cost Benefit Analysis

  4. Issues of the presence of parasitic protozoa in surface waters

    Directory of Open Access Journals (Sweden)

    Hawrylik Eliza

    2018-01-01

    This paper focuses on the problem of the presence of parasitic protozoa in surface waters. Characteristics of the most frequently recognized pathogens responsible for water-borne outbreaks were described, as well as sources of contamination and surface waters contamination due to protozoa of the genus Cryptosporidium and Giardia were presented. The methods of destroying the cysts and oocysts of parasitic protozoa used nowadays in the world were also presented in a review.

  5. 40 CFR 257.3-3 - Surface water.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Surface water. 257.3-3 Section 257.3-3... and Practices § 257.3-3 Surface water. (a) For purposes of section 4004(a) of the Act, a facility... Water Act, as amended. (b) For purposes of section 4004(a) of the Act, a facility shall not cause a...

  6. 77 FR 12227 - Long Term 2 Enhanced Surface Water Treatment Rule: Uncovered Finished Water Reservoirs; Public...

    Science.gov (United States)

    2012-02-29

    ... Water Treatment Rule: Uncovered Finished Water Reservoirs; Public Meeting AGENCY: Environmental... review of the uncovered finished water reservoir requirement in the Long Term 2 Enhanced Surface Water... uncovered finished water reservoir requirement and the agency's Six Year Review process. EPA also plans to...

  7. Residual stress improved by water jet peening using cavitation for small-diameter pipe inner surfaces

    International Nuclear Information System (INIS)

    Yasuo, Nakamura; Toshizo, Ohya; Koji, Okimura

    2001-01-01

    As one of degradation conditions on components used in water, the overlapping effect of environment, material and stress might cause stress corrosion cracking (SCC). Especially, for the tensile residual stress produced by welding, it is particularly effective to reduce the tensile residual stress on the material surface to prevent SCC. In this paper, the residual stress improvement method using cavitation impact generated by a water jet, called Water Jet Peening (WJP), has been developed as the maintenance technology for the inner surfaces of small-diameter Ni-Cr-Fe alloy (Alloy 600) pipes. As the results, by WJP for the inner surface of Alloy 600 pipe (inner diameter; approximately 10-15 mm), we confirmed that the compressive stress generated within the range from the surface to the inner part about 0.5 mm deep and took a maximum value about 350 MPa on the surface. (author)

  8. Treatability of South African surface waters by enhanced coagulation

    African Journals Online (AJOL)

    The majority of South African inland surface water sources are compromised due to a long-standing national policy of mandatory return flows. With renewed emphasis on the removal of organic carbon in the latest SANS 241 water quality standard, many South African water treatment managers may need to consider ...

  9. Environmental impact of by pass channel of surface waters

    International Nuclear Information System (INIS)

    Vismara, R.; Renoldi, M.; Torretta, V.

    1996-01-01

    In this paper are analyzed the impacts generated by surface waters drawing on river course. This impacts are generated also by reduction of water flow. This effect is most important for the presence of biological community: algae, fiches, micro invertebrates. Are also reported regional laws, water master plan of Lombardia region

  10. Structural integrity of water reactor pressure boundary components

    International Nuclear Information System (INIS)

    Loss, F.J.

    1977-01-01

    The dynamic fracture toughness was determined as a function of temperature for three-point bend specimens of A533-B, A508-2, and A302-B steels. Crack propagation rates at 288 0 C in a water reactor environment were determined for A533-B and A508-2. Radiation-induced degradation of notch toughness of reactor steels and welds was explored. The ''warm prestress'' occurring in a flawed reactor vessel following a LOCA and operation of ECCS was studied. 25 figures

  11. Underground coal mine subsidence impacts on surface water

    International Nuclear Information System (INIS)

    Stump, D.E. Jr.

    1992-01-01

    This paper reports that subsidence from underground coal mining alters surface water discharge and availability. The magnitude and areal extent of these impacts are dependent on many factors, including the amount of subsidence, topography, geology, climate, surface water - ground water interactions, and fractures in the overburden. There alterations may have positive and/or negative impacts. One of the most significant surface water impacts occurred in July 1957 near West Pittston, Pennsylvania. Subsidence in the Knox Mine under the Coxton Yards of the Lehigh Valley Railroad allowed part of the discharge in the Susquehanna River to flow into the mine and create a crater 200 feet in diameter and 300 feet deep. Fourteen railroad gondola cars fell into the hole which was eventually filled with rock, sand, and gravel. Other surface water impacts from subsidence may include the loss of water to the ground water system, the gaining of water from the ground water system, the creation of flooded subsidence troughs, the increasing of impoundment storage capacity, the relocation of water sources (springs), and the alteration of surface drainage patterns

  12. Assessment of the dynamics of the radioactivity contents in surface waters in contaminated areas

    International Nuclear Information System (INIS)

    Komissarov, F.D.; Datskevich, P.I.; Golikov, Y.N.; Basharina, L.P.; Churack, T.N.; Khvaley, O.D.

    1997-01-01

    In the connection with Chernobyl APS accident, since 1988 a network of sites was established for radioecological monitoring of surface water systems, mainly, small rivers on all Belarus territory. Small rivers are the principal way of radionuclides run off in liquid and solid discharges during rains and high-floods and their re-distribution in landscapes. The components of water systems radio-monitoring were water and water suspensions, area water-collection, bottom deposits and biota. In the paper the data are cited of radioecological studies of water systems components. Their analysis is done and some conclusions made which may be used for the development of radioecological prognosis and for taking environmental measures

  13. OCCURRENCE OF ENTERIC VIRUSES IN SURFACE WATERS

    Science.gov (United States)

    Human enteric viruses cause a number of diseases when individuals are exposed to contaminated drinking & recreational waters. Vaccination against poliovirus has virtually eliminated poliomyelitis from the planet. Other members of enterovirus group cause numerous diseases. Hepatit...

  14. Describing the Components of the Water Transport in the Martian Atmosphere

    Science.gov (United States)

    Montmessin, F.; Haberle, R. M.; forget, F.; Rannou, P.; Cabane, M.

    2003-01-01

    In this paper, we examine the meteorological components driving water transport in the Martian atmosphere. A particular emphasis is given to the role of residual mean circulation and water ice clouds in determining the geographical partitioning of water vapor and frost.

  15. Examination of water phase transitions in Loblolly pine and cell wall components by differential scanning calorimetry

    Science.gov (United States)

    Samuel L. Zelinka; Michael J. Lambrecht; Samuel V. Glass; Alex C. Wiedenhoeft; Daniel J. Yelle

    2012-01-01

    This paper examines phase transformations of water in wood and isolated wood cell wall components using differential scanning calorimetry with the purpose of better understanding "Type II water" or "freezable bound water" that has been reported for cellulose and other hydrophilic polymers. Solid loblolly pine (Pinus taeda...

  16. Development of a dynamic model for cleaning ultra filtration membranes fouled by surface water

    NARCIS (Netherlands)

    Zondervan, Edwin; Betlem, Ben H.L.; Roffel, Brian

    2007-01-01

    In this paper, a dynamic model for cleaning ultra filtration membranes fouled by surface water is proposed. A model that captures the dynamics well is valuable for the optimization of the cleaning process. The proposed model is based on component balances and contains three parameters that can be

  17. Presence and risk assessment of pharmaceuticals in surface water and drinking water

    DEFF Research Database (Denmark)

    Sanderson, Hans

    2011-01-01

    Trace amounts of pharmaceuticals have been detected in surface waters in the nano- to microgram per liter range, and in drinking water in the nanogram/L range. The environmental risks of pharmaceuticals in surface waters have been evaluated and generally found to be low if the wastewater is treated...

  18. Coastal surface water suitability analysis for irrigation in Bangladesh

    Science.gov (United States)

    Mahtab, Mohammad Hossain; Zahid, Anwar

    2018-03-01

    Water with adequate quality and quantity is very important for irrigation to ensure the crop yields. Salinity is common problem in the coastal waters in Bangladesh. The intensity of salinity in the coastal zone in Bangladesh is not same. It fluctuates over the year. Sodium is another hazard which may hamper permeability and ultimately affects the fertility. It can reduce the crop yields. Although surface water is available in the coastal zone of Bangladesh, but its quality for irrigation needs to be monitored over the year. This paper will investigate the overall quality of coastal surface waters. Thirty-three water samples from different rivers were collected both in wet period (October-December) and in dry period (February-April). Different physical and chemical parameters are considered for investigation of the adequacy of water with respect to international irrigation water quality standards and Bangladesh standards. A comparison between the dry and wet period coastal surface water quality in Bangladesh will also be drawn here. The analysis shows that coastal surface water in Bangladesh is overall suitable for irrigation during wet period, while it needs treatment (which will increase the irrigation cost) for using for irrigation during dry period. Adaptation to this situation can improve the scenario. An integrated plan should be taken to increase the water storing capacity in the coastal area to harvest water during wet period.

  19. A GPU-based mipmapping method for water surface visualization

    Science.gov (United States)

    Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan

    2018-03-01

    Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

  20. City of Flagstaff Project: Ground Water Resource Evaluation, Remote Sensing Component

    Science.gov (United States)

    Chavez, Pat S.; Velasco, Miguel G.; Bowell, Jo-Ann; Sides, Stuart C.; Gonzalez, Rosendo R.; Soltesz, Deborah L.

    1996-01-01

    (that is, vegetation and/or soil type). The spatial information gives the distribution, variation, and topographic relief of the cover types from pixel to pixel. Therefore, the main characteristics that determine a pixel's brightness/reflectance and, consequently, the digital number (DN) assigned to the pixel, are the physical properties of the surface and near surface, the cover type, and the topographic slope. In this application, the ability to detect and map lineaments, especially those related to fractures and faults, is critical. Therefore, the extraction of spatial information from the digital images was of prime interest in this project. The spatial information varies among the different spectral bands available; in particular, a near infrared spectral band is better than a visible band when extracting spatial information in highly vegetated areas. In this study, both visible and near infrared bands were analyzed and used to extract the desired spatial information from the images. The wide swath coverage of remotely sensed satellite digital images makes them ideal for regional analysis and mapping. Since locating and mapping highly fractured and faulted areas is a major requirement for ground water resource evaluation and exploration this aspect of satellite images was considered critical; it allowed us to stand back (actually up about 440 miles), look at, and map the regional structural setting of the area. The main focus of the remote sensing and digital image processing component of this project was to use both remotely sensed digital satellite images and a Digital Elevation Model (DEM) to extract spatial information related to the structural and topographic patterns in the area. The data types used were digital satellite images collected by the United States' Landsat Thematic Mapper (TM) and French Systeme Probatoire d'Observation de laTerre (SPOT) imaging systems, along with a DEM of the Flagstaff region. The USGS Mini Image Processing Sy

  1. Ceramic Surface Treatment with a Single-component Primer: Resin Adhesion to Glass Ceramics.

    Science.gov (United States)

    Prado, Mayara; Prochnow, Catina; Marchionatti, Ana Maria Estivalete; Baldissara, Paolo; Valandro, Luiz Felipe; Wandscher, Vinicius Felipe

    2018-04-19

    To evaluate the microshear bond strength (μSBS) of composite cement bonded to two machined glass ceramics and its durability, comparing conventional surface conditioning (hydrofluoric acid + silane) to a one-step primer (Monobond Etch & Prime). Machined slices of lithium disilicate ceramic (LDC) (IPS e.max CAD) and feldspathic ceramic (FC) (VITA Mark II) glass ceramics were divided into two groups (n = 10) according to two factors: 1. surface treatment: HF+S (ca 5% hydrofluoric acid [IPS Ceramic Etching GEL] + silane coupling agent [SIL; Monobond Plus]) or MEP (single-component ceramic conditioner; Monobond Etch & Prime); 2. storage condition: baseline (without aging; tested 24 h after cementing) or aged (70 days of water storage + 12,000 thermal cycles). Composite cement (Multilink Automix, Ivoclar Vivadent) was applied to starch matrices on the treated ceramic surfaces and photoactivated. A μSBS test was performed (0.5 mm/min) and the failure pattern was determined. Contact angle and micromorphological analyses were also performed. Data were analyzed with Student's t-test (α = 5%). For both ceramic materials, HF+S resulted in higher mean μSBS (MPa) at baseline (LDC: HF+S 21.2 ± 2.2 > MEP 10.4 ± 2.4; FC: HF+S 19.6 ± 4.3 > MEP 13.5 ± 5.4) and after aging (LDC: HF+S 14.64 ± 2.31 > MEP 9 ± 3.4; FC HF+S: 14.73 ± 3.33 > MEP 11.1 ± 3.3). HF+S resulted in a statistically significant decrease in mean μSBS after aging (p = 0.0001), while MEP yielded no significant reduction. The main failure type was adhesive between composite cement and ceramic. HF+S resuted in the lowest contact angle. Hydrofluoric acid + silane resulted in higher mean μSBS than Monobond Etch & Prime for both ceramics; however, Monobond Etch & Prime had stable bonding after aging.

  2. Water resources data, Iowa, water year 2001, Volume 2. surface water--Missouri River basin, and ground water

    Science.gov (United States)

    Nalley, G.M.; Gorman, J.G.; Goodrich, R.D.; Miller, V.E.; Turco, M.J.; Linhart, S.M.

    2002-01-01

    The Water Resources Division of the U.S. Geological Survey, in cooperation with State, county, municipal, and other Federal agencies, obtains a large amount of data pertaining to the water resources of Iowa each water year. These data, accumulated during many water years, constitute a valuable data base for developing an improved understanding of the water resources of the State. To make this data readily available to interested parties outside of the Geological Survey, the data is published annually in this report series entitled “Water Resources Data - Iowa” as part of the National Water Data System. Water resources data for water year 2001 for Iowa consists of records of stage, discharge, and water quality of streams; stage and contents of lakes and reservoirs; and water levels and water quality of ground water. This report, in two volumes, contains stage or discharge records for 132 gaging stations; stage records for 9 lakes and reservoirs; water-quality records for 4 gaging stations; sediment records for 13 gaging stations; and water levels for 163 ground-water observation wells. Also included are peak-flow data for 92 crest-stage partial-record stations, water-quality data from 86 municipal wells, and precipitation data collected at 6 gaging stations and 2 precipitation sites. Additional water data were collected at various sites not included in the systematic data-collection program, and are published here as miscellaneous measurements and analyses. These data represent that part of the National Water Data System operated by the U.S. Geological Survey and cooperating local, State, and Federal agencies in Iowa.Records of discharge or stage of streams, and contents or stage of lakes and reservoirs were first published in a series of U.S. Geological Survey water-supply papers entitled “Surface Water Supply of the United States.” Through September 30, 1960, these water-supply papers were published in an annual series; during 1961-65 and 1966-70, they

  3. Deuterium content on surface waters VI to X Chile regions

    International Nuclear Information System (INIS)

    Aravena C, R; Pollastri J, A.; Suzuki S, O.

    1984-01-01

    One important parameter on any sitting study for a heavy water plant installation is the deuterium content of the feed water. Deuterium data on surface waters from differents areas located in the south of Chile, are presented. These results allow to idently some potential areas for a future heavy water plant. One of these areas, Lago Llanquihue, was sampled more in detail to study the vertical distribution and spatial variations. (Author)

  4. Possibilities of surface waters monitoring at mining areas using UAV

    Science.gov (United States)

    Lisiecka, Ewa; Motyka, Barbara; Motyka, Zbigniew; Pierzchała, Łukasz; Szade, Adam

    2018-04-01

    The selected, remote measurement methods are discussed, useful for determining surface water properties using mobile unmanned aerial platforms (UAV). The possibilities of using this type of solutions in the scope of measuring spatial, physicochemical and biological parameters of both natural and anthropogenic water reservoirs, including flood polders, water-filled pits, settling tanks and mining sinks were analyzed. Methods of remote identification of the process of overgrowing this type of ecosystems with water and coastal plant formations have also been proposed.

  5. A regional coupled surface water/groundwater model of the Okavango Delta, Botswana

    DEFF Research Database (Denmark)

    Bauer-Gottwein, Peter; Gumbricht, T.; Kinzelbach, W.

    2006-01-01

    In the endorheic Okavango River system in southern Africa a balance between human and environmental water demands has to be achieved. The runoff generated in the humid tropical highlands of Angola flows through arid Namibia and Botswana before forming a large inland delta and eventually being...... of a surface water flow component based on the diffusive wave approximation of the Saint- Venant equations, a groundwater component, and a relatively simple vadose zone component for calculating the net water exchange between land and atmosphere. The numerical scheme is based on the groundwater simulation......, spectacular wildlife, and a first- class tourism infrastructure, depend on the combined effect of the highly seasonal runoff in the Okavango River and variable local climate. The annual fluctuations in the inflow are transformed into vast areas of seasonally inundated floodplains. Water abstraction...

  6. Desert Beetle-Inspired Superwettable Patterned Surfaces for Water Harvesting.

    Science.gov (United States)

    Yu, Zhenwei; Yun, Frank F; Wang, Yanqin; Yao, Li; Dou, Shixue; Liu, Kesong; Jiang, Lei; Wang, Xiaolin

    2017-09-01

    With the impacts of climate change and impending crisis of clean drinking water, designing functional materials for water harvesting from fog with large water capacity has received much attention in recent years. Nature has evolved different strategies for surviving dry, arid, and xeric conditions. Nature is a school for human beings. In this contribution, inspired by the Stenocara beetle, superhydrophilic/superhydrophobic patterned surfaces are fabricated on the silica poly(dimethylsiloxane) (PDMS)-coated superhydrophobic surfaces using a pulsed laser deposition approach with masks. The resultant samples with patterned wettability demonstrate water-harvesting efficiency in comparison with the silica PDMS-coated superhydrophobic surface and the Pt nanoparticles-coated superhydrophilic surface. The maximum water-harvesting efficiency can reach about 5.3 g cm -2 h -1 . Both the size and the percentage of the Pt-coated superhydrophilic square regions on the patterned surface affect the condensation and coalescence of the water droplet, as well as the final water-harvesting efficiency. The present water-harvesting strategy should provide an avenue to alleviate the water crisis facing mankind in certain arid regions of the world. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. [Studies on the interaction of blood components with ultra-smooth polymer surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, T.H. [New Mexico Univ., Albuquerque, NM (United States). School of Medicine

    1989-04-17

    This report is in three parts, though each is briefly described data is provided. The three parts address (1) radioiodination of human thrombin and fibrinogen; (2) interaction of blood components with ultra- smooth polymer surfaces; and (3) initial studies of Tecoflex and treated Tecoflex cups with normal serum samples.

  8. Principal Component Surface (2011) for St. Thomas East End Reserve, St. Thomas

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas the St. Thomas East End Reserve (STEER) in the U.S. Virgin Islands (USVI)....

  9. Ultrasonic detection technology based on joint robot on composite component with complex surface

    Energy Technology Data Exchange (ETDEWEB)

    Hao, Juan; Xu, Chunguang; Zhang, Lan [School of Mechanical Engineering, Beijing Institute of Technology, Beijing (China)

    2014-02-18

    Some components have complex surface, such as the airplane wing and the shell of a pressure vessel etc. The quality of these components determines the reliability and safety of related equipment. Ultrasonic nondestructive detection is one of the main methods used for testing material defects at present. In order to improve the testing precision, the acoustic axis of the ultrasonic transducer should be consistent with the normal direction of the measured points. When we use joint robots, automatic ultrasonic scan along the component surface normal direction can be realized by motion trajectory planning and coordinate transformation etc. In order to express the defects accurately and truly, the robot position and the signal of the ultrasonic transducer should be synchronized.

  10. The hydrochemistry of glacial Ebba River (Petunia Bay, Central Spitsbergen): Groundwater influence on surface water chemistry

    Science.gov (United States)

    Dragon, Krzysztof; Marciniak, Marek; Szpikowski, Józef; Szpikowska, Grażyna; Wawrzyniak, Tomasz

    2015-10-01

    The article presents the investigation of surface water chemistry changes of the glacial Ebba River (Central Spitsbergen) during three melting seasons of 2008, 2009 and 2010. The twice daily water chemistry analyses allow recognition of the surface water chemistry differentiation. The surface water chemistry changes are related to the river discharge and changes in the influence of different water balance components during each melting season. One of the most important process that influence river water component concentration increase is groundwater inflow from active layer occurring on the valley area. The significance of this process is the most important at the end of the melting season when temperatures below 0 °C occur on glaciers (resulting in a slowdown of melting of ice and snow and a smaller recharge of the river by the water from the glaciers) while the flow of groundwater is still active, causing a relatively higher contribution of groundwater to the total river discharge. The findings presented in this paper show that groundwater contribution to the total polar river water balance is more important than previously thought and its recognition allow a better understanding of the hydrological processes occurring in a polar environment.

  11. Ionization by a pulsed plasma surface water

    International Nuclear Information System (INIS)

    Bloyet, E.; Leprince, P.; Marec, J.; Llamas Blasco, M.

    1981-01-01

    The ionization mechanism is studied of a pulsed surface wave generating a microwave discharge. When the plasma is dominated by collisions, it is found that the velocity of the ionization front depends on the ponderomotive force due to the field gradient in the front. (orig.)

  12. Guidelines for surface water quality, vol. l

    International Nuclear Information System (INIS)

    1983-01-01

    A literature survey was carried out on the chemically toxic effects of uranium and uranium compounds on human health, aquatic life, plants and livestock. All the information collected is summarized in this document and, from it, maximum uranium concentrations in water at which toxic effects will not appear are recommended

  13. Hydrochemical characteristics of mine waters from abandoned mining sites in Serbia and their impact on surface water quality.

    Science.gov (United States)

    Atanacković, Nebojša; Dragišić, Veselin; Stojković, Jana; Papić, Petar; Zivanović, Vladimir

    2013-11-01

    Upon completion of exploration and extraction of mineral resources, many mining sites have been abandoned without previously putting environmental protection measures in place. As a consequence, mine waters originating from such sites are discharged freely into surface water. Regional scale analyses were conducted to determine the hydrochemical characteristics of mine waters from abandoned sites featuring metal (Cu, Pb-Zn, Au, Fe, Sb, Mo, Bi, Hg) deposits, non-metallic minerals (coal, Mg, F, B) and uranium. The study included 80 mine water samples from 59 abandoned mining sites. Their cation composition was dominated by Ca2+, while the most common anions were found to be SO4(2-) and HCO3-. Strong correlations were established between the pH level and metal (Fe, Mn, Zn, Cu) concentrations in the mine waters. Hierarchical cluster analysis was applied to parameters generally indicative of pollution, such as pH, TDS, SO4(2-), Fe total, and As total. Following this approach, mine water samples were grouped into three main clusters and six subclusters, depending on their potential environmental impact. Principal component analysis was used to group together variables that share the same variance. The extracted principal components indicated that sulfide oxidation and weathering of silicate and carbonate rocks were the primary processes, while pH buffering, adsorption and ion exchange were secondary drivers of the chemical composition of the analyzed mine waters. Surface waters, which received the mine waters, were examined. Analysis showed increases of sulfate and metal concentrations and general degradation of surface water quality.

  14. Basin scale management of surface and ground water

    International Nuclear Information System (INIS)

    Tracy, J.C.; Al-Sharif, M.

    1993-01-01

    An important element in the economic development of many regions of the Great Plains is the availability of a reliable water supply. Due to the highly variable nature of the climate through out much of the Great Plains region, non-controlled stream flow rates tend to be highly variable from year to year. Thus, the primary water supply has tended towards developing ground water aquifers. However, in regions where shallow ground water is extracted for use, there exists the potential for over drafting aquifers to the point of depleting hydraulically connected stream flows, which could adversely affect the water supply of downstream users. To prevent the potential conflict that can arise when a basin's water supply is being developed or to control the water extractions within a developed basin requires the ability to predict the effect that water extractions in one region will have on water extractions from either surface or ground water supplies else where in the basin. This requires the ability to simulate ground water levels and stream flows on a basin scale as affected by changes in water use, land use practices and climatic changes within the basin. The outline for such a basin scale surface water-ground water model has been presented in Tracy (1991) and Tracy and Koelliker (1992), and the outline for the mathematical programming statement to aid in determining the optimal allocation of water on a basin scale has been presented in Tracy and Al-Sharif (1992). This previous work has been combined into a computer based model with graphical output referred to as the LINOSA model and was developed as a decision support system for basin managers. This paper will present the application of the LINOSA surface-ground water management model to the Rattlesnake watershed basin that resides within Ground Water Management District Number 5 in south central Kansas

  15. Turbulent flow over an interactive alternating land-water surface

    Science.gov (United States)

    Van Heerwaarden, C.; Mellado, J. P.

    2014-12-01

    The alternating land-water surface is a challenging surface to represent accurately in weather and climate models, but it is of great importance for the surface energy balance in polar regions. The complexity of this surface lies in the fact that secondary circulations, which form at the boundary of water and land, interact strongly with the surface energy balance. Due to its large heat capacity, the water temperature adapts slowly to the flow, thus the properties of the atmosphere determine the uptake of energy from the water. In order to study this complex system in a simpler way, retaining only the most essential physics, we have simplified the full surface energy balance including radiation. We have derived a boundary condition that mimics the full balance and can be formulated as a so-called Robin boundary condition: a linear combination of Dirichlet (fixed temperature) and Neumann (fixed temperature gradient) ones. By spatially varying the coefficients, we are able to express land and water using this boundary condition. We have done a series of direct numerical simulations in which we generate artificial land-water patterns from noise created from a Gaussian spectrum centered around a dominant wave number. This method creates realistic random patterns, but we are still in control of the length scales. We show that the system can manifest itself in three regimes: micro-, meso- and macro-scale. In the micro-scale, we find perfect mixing of the near-surface atmosphere that results in identical air properties over water and land. In the meso-scale, secondary circulations alter the heat exchange considerably by advecting air between land and water. In addition, they bring the surface temperature of the land closer to that of the air, thereby modulating the energy loss due to outgoing longwave radiation. In the macro-scale regime, the flow over land and water become independent of each other and only the large scale forcings determine the energy balance.

  16. The Rheology of a Three Component System: COAL/WATER/#4 Oil Emulsions.

    Science.gov (United States)

    Gilmartin, Barbara Jean

    The purpose of this investigation was to study the rheology of a three component system, coal/water/#4 oil emulsions (COW), in which the third component, water, was present in a significant concentration, and to determine the applicability of existing theories from suspension rheology to the three component system studied. In a coal/water/oil emulsion, free coal particles adhere to the surface of the water droplets, preventing their coagulation, while the larger coal particles reside in the matrix of stabilized water droplets. The use of liquid fuels containing coal is a means of utilizing our nation's coal reserves while conserving oil. These fuels can be burned in conventional oil-fired furnaces. In this investigation, a high sulfur, high ash, bituminous coal was used, along with a heavy #4 oil to prepare the emulsions. The coal was ground to a log-normal distribution with an average particle size of 62 microns. A Haake RV3 concentric cylinder viscometer, with a ribbed measuring system, was used to determine the viscosity of the emulsions. A physical pendulum settling device measured the shift in center of mass of the COW as a function of time. The flow behavior of the fuel in pipes was also tested. In interpreting the data from the viscometer and the pipe flow experiments, a power law analysis was used in the region from 30 s('-1) to 200 s('-1). Extrapolation methods were used to obtain the low and high shear behavior of the emulsions. In the shear rate region found in boiler feed systems, COW are shear thinning with a flow behavior index of 0.7. The temperature dependent characteristic of the emulsions studied were similar and followed an Arrhenius type relationship. The viscosity of the COW decreases with increasing coal average particle size and is also a function of the width of the size distribution used. The type of coal used strongly influences the rheology of the fuel. The volatile content and the atomic oxygen to nitrogen ratio of the coal are the most

  17. Method of providing extended life expectancy for components of boiling water reactors

    International Nuclear Information System (INIS)

    Niedrach, L.W.

    1992-01-01

    This patent describes a containment for a boiling water nuclear reactor, a stainless steel containment, the containment having a deposit of a metal of the platinum group of metals on the surfaces thereof exposed to high temperature, high pressure water of the boiling water nuclear reactor

  18. Assessment of Surface Water Quality in the Malaysian Coastal Waters by Using Multivariate Analyses

    International Nuclear Information System (INIS)

    Yap, C.K.; Chee, M.W.; Shamarina, S.; Edward, F.B.; Chew, W.; Tan, S.G.

    2011-01-01

    Coastal water samples were collected from 20 sampling sites in the southern part of Peninsular Malaysia. Seven physico-chemical parameters were measured directly in-situ while water samples were collected and analysed for 6 dissolved trace metal concentrations. The surface water (0-20 cm) physico-chemical parameters including temperature, salinity, dissolved oxygen (DO), pH, total dissolved solids (TDS), specific conductance (SpC) and turbidity while the dissolved trace metals were Cd, Cu, Fe, Ni, Pb and Zn. The ranges for the physico-chemical parameters were 28.07-35.6 degree Celsius for temperature, 0.18-32.42 ppt for salinity, 2.20-12.03 mg/ L for DO, 5.50-8.53 for pH, 0.24-31.65 mg/ L for TDS, 368-49452 μS/ cm for SpC and 0-262 NTU for turbidity while the dissolved metals (mg/ L) were 0.013-0.147 for Cd, 0.024-0.143 for Cu, 0.266-2.873 for Fe, 0.027-0.651 for Ni, 0.018-0.377 for Pb and 0.032-0.099 for Zn. Based on multivariate analysis (including correlation, cluster and principal component analyses), the polluted sites were found at Kg. Pasir Puteh and Tg. Kupang while Ni and Pb were identified as two major dissolved metals of high variation in the coastal waters. Therefore, water quality monitoring and control of release of untreated anthropogenic wastes into rivers and coastal waters are strongly needed. (author)

  19. Cooperativity in Surface Bonding and Hydrogen Bonding of Water and Hydroxyl at Metal Surfaces

    DEFF Research Database (Denmark)

    Schiros, T.; Ogasawara, H.; Naslund, L. A.

    2010-01-01

    of the mixed phase at metal surfaces. The surface bonding can be considered to be similar to accepting a hydrogen bond, and we can thereby apply general cooperativity rules developed for hydrogen-bonded systems. This provides a simple understanding of why water molecules become more strongly bonded...... to the surface upon hydrogen bonding to OH and why the OH surface bonding is instead weakened through hydrogen bonding to water. We extend the application of this simple model to other observed cooperativity effects for pure water adsorption systems and H3O+ on metal surfaces.......We examine the balance of surface bonding and hydrogen bonding in the mixed OH + H2O overlayer on Pt(111), Cu(111), and Cu(110) via density functional theory calculations. We find that there is a cooperativity effect between surface bonding and hydrogen bonding that underlies the stability...

  20. chemical and microbiological assessment of surface water samples

    African Journals Online (AJOL)

    PROF EKWUEME

    were investigated in this study: Nine samples from different surface water bodies, two samples from two effluent sources ... Ezeagu, Udi, Nkanu, Oji River and some parts of Awgu and Aninri ..... Study of Stream Output from Small Catchments.

  1. Exciton-Promoted Desorption From Solid Water Surfaces A2

    DEFF Research Database (Denmark)

    McCoustra, M.R.S.; Thrower, J.D.

    2018-01-01

    Abstract Desorption from solid water surfaces resulting from interaction with electromagnetic and particle radiation is reviewed in the context of the role of nonthermal desorption in astrophysical environments. Experimental observations are interpreted in terms of mechanisms sharing a common basis...

  2. Titanium Dioxide-Based Antibacterial Surfaces for Water Treatment

    Science.gov (United States)

    The field of water disinfection is gaining much interest since waterborne diseases caused by pathogenic microorganisms directly endanger human health. Antibacterial surfaces offer a new, ecofriendly technique to reduce the harmful disinfection byproducts that form in medical and ...

  3. Insight into Chemistry on Cloud/Aerosol Water Surfaces.

    Science.gov (United States)

    Zhong, Jie; Kumar, Manoj; Francisco, Joseph S; Zeng, Xiao Cheng

    2018-05-15

    Cloud/aerosol water surfaces exert significant influence over atmospheric chemical processes. Atmospheric processes at the water surface are observed to follow mechanisms that are quite different from those in the gas phase. This Account summarizes our recent findings of new reaction pathways on the water surface. We have studied these surface reactions using Born-Oppenheimer molecular dynamics simulations. These studies provide useful information on the reaction time scale, the underlying mechanism of surface reactions, and the dynamic behavior of the product formed on the aqueous surface. According to these studies, the aerosol water surfaces confine the atmospheric species into a specific orientation depending on the hydrophilicity of atmospheric species or the hydrogen-bonding interactions between atmospheric species and interfacial water. As a result, atmospheric species are activated toward a particular reaction on the aerosol water surface. For example, the simplest Criegee intermediate (CH 2 OO) exhibits high reactivity toward the interfacial water and hydrogen sulfide, with the reaction times being a few picoseconds, 2-3 orders of magnitude faster than that in the gas phase. The presence of interfacial water molecules induces proton-transfer-based stepwise pathways for these reactions, which are not possible in the gas phase. The strong hydrophobicity of methyl substituents in larger Criegee intermediates (>C1), such as CH 3 CHOO and (CH 3 ) 2 COO, blocks the formation of the necessary prereaction complexes for the Criegee-water reaction to occur at the water droplet surface, which lowers their proton-transfer ability and hampers the reaction. The aerosol water surface provides a solvent medium for acids (e.g., HNO 3 and HCOOH) to participate in reactions via mechanisms that are different from those in the gas and bulk aqueous phases. For example, the anti-CH 3 CHOO-HNO 3 reaction in the gas phase follows a direct reaction between anti-CH 3 CHOO and HNO 3

  4. Effect of saline irrigation water on yield and yield components of rice ...

    African Journals Online (AJOL)

    vaio

    2013-05-29

    May 29, 2013 ... levels at different growth stages of rice on yield and its components. Treatments included ... Therefore, irrigation with saline water at the early growth stages has more negative effect on ...... diversification. Land Degrad. Dev.

  5. NEXAFS characterization of DNA components and molecular-orientation of surface-bound DNA oligomers

    International Nuclear Information System (INIS)

    Samuel, Newton T.; Lee, C.-Y.; Gamble, Lara J.; Fischer, Daniel A.; Castner, David G.

    2006-01-01

    Single stranded DNA oligomers (ssDNA) immobilized onto solid surfaces forms the basis for several biotechnological applications such as DNA microarrays, affinity separations, and biosensors. Surface structure of Surface-bound oligomers is expected to significantly influence their biological activity and interactions with the environment. In this study near-edge X-ray absorption fine structure spectroscopy (NEXAFS) is used to characterize the components of DNA (nucleobases, nucleotides and nucleosides) and the orientation information of surface-bound ssDNA. The K-edges of carbon, nitrogen and oxygen have spectra with features that are characteristic of the different chemical species present in the nucleobases of DNA. The effect of addition of the DNA sugar and phosphate components on the NEXAFS K-edge spectra was also investigated. The polarization-dependent nitrogen K-edge NEXAFS data show significant changes for different orientations of surface bound ssDNA. These results establish NEXAFS as a powerful technique for chemical and structural characterization of surface-bound DNA oligomers

  6. An Integrated Surface Engineering Technology Development for Improving Energy Efficiency of Engine Components

    Energy Technology Data Exchange (ETDEWEB)

    Stephen Hsu; Liming Chang; Huan Zhan

    2009-05-31

    Frictional losses are inherent in most practical mechanical systems. The ability to control friction offers many opportunities to achieve energy conservation. Over the years, materials, lubricants, and surface modifications have been used to reduce friction in automotive and diesel engines. However, in recent years, progress in friction reduction technology has slowed because many of the inefficiencies have been eliminated. A new avenue for friction reduction is needed. Designing surfaces specifically for friction reduction with concomitant enhanced durability for various engine components has emerged recently as a viable opportunity due to advances in fabrication and surface finishing techniques. Recently, laser ablated dimples on surfaces have shown friction reduction properties and have been demonstrated successfully in conformal contacts such as seals where the speed is high and the load is low. The friction reduction mechanism in this regime appears to depend on the size, patterns, and density of dimples in the contact. This report describes modeling efforts in characterizing surface textures and understanding their mechanisms for enhanced lubrication under high contact pressure conditions. A literature survey is first presented on the development of descriptors for irregular surface features. This is followed by a study of the hydrodynamic effects of individual micro-wedge dimples using the analytical solution of the 1-D Reynolds equation and the determination of individual components of the total friction resistance. The results obtained provide a better understanding of the dimple orientation effects and the approach which may be used to further compare the friction reduction provided by different texture patterns.

  7. Radiolysis of water in the vicinity of passive surfaces

    International Nuclear Information System (INIS)

    Moreau, S.; Fenart, M.; Renault, J.P.

    2014-01-01

    Highlights: • HO° production through water radiolysis is enhanced near metal surfaces. • Hastelloy and Stainless steel surfaces can also produce HO° radicals through hydrogen peroxide activation. • There is a deficit in solvated electron production compared to hydroxyl radicals near metal surfaces. - Abstract: Porous metals were used to describe the water radiolysis in the vicinity of metal surfaces. The hydroxyl radical production under gamma irradiation was measured by benzoate scavenging in water confined in a 200 nm porous Ni base alloy or in Stainless steel. The presence of the metallic surfaces changed drastically the HO° production level and lifetime. The solvated electron production was measured via glycylglycine scavenging for Stainless steel and was found to be significantly smaller than hydroxyl production. These observations imply that interfacial radiolysis may deeply impact the corrosion behavior of the SS and Ni based alloys

  8. Water evaporation from substrate tooth surface during dentin treatments.

    Science.gov (United States)

    Kusunoki, Mizuho; Itoh, Kazuo; Gokan, Yuka; Nagai, Yoshitaka; Tani, Chihiro; Hisamitsu, Hisashi

    2011-01-01

    The purpose of this study was to evaluate changes in the quantity of water evaporation from tooth surfaces. The amount of water evaporation was measured using Multi probe adapter MPA5 and Tewameter TM300 (Courage+Khazaka Electric GmbH, Köln, Germany) after acid etching and GM priming of enamel; and after EDTA conditioning and GM priming of dentin. The results indicated that the amount of water evaporation from the enamel surface was significantly less than that from the dentin. Acid etching did not affect the water evaporation from enamel, though GM priming significantly decreased the evaporation (83.48 ± 15.14% of that before priming). The evaporation from dentin was significantly increased by EDTA conditioning (131.38 ± 42.08% of that before conditioning) and significantly reduced by GM priming (80.26 ± 7.43% of that before priming). It was concluded that dentin priming reduced water evaporation from the dentin surface.

  9. Unique water-water coordination tailored by a metal surface

    DEFF Research Database (Denmark)

    Schiros, T.; Andersson, Klas Jerker; MacNaughton, J.

    2013-01-01

    (2006)]. Using x-ray absorption spectroscopy we find an anomalous low-energy resonance at ~533.1 eV which, based on density functional theory spectrum simulations, we assign to an unexpected configuration of water units whose uncoordinated O-H bonds directly face those of their neighbors...

  10. Anomalous water dynamics at surfaces and interfaces: synergistic effects of confinement and surface interactions

    Science.gov (United States)

    Biswas, Rajib; Bagchi, Biman

    2018-01-01

    In nature, water is often found in contact with surfaces that are extended on the scale of molecule size but small on a macroscopic scale. Examples include lipid bilayers and reverse micelles as well as biomolecules like proteins, DNA and zeolites, to name a few. While the presence of surfaces and interfaces interrupts the continuous hydrogen bond network of liquid water, confinement on a mesoscopic scale introduces new features. Even when extended on a molecular scale, natural and biological surfaces often have features (like charge, hydrophobicity) that vary on the scale of the molecular diameter of water. As a result, many new and exotic features, which are not seen in the bulk, appear in the dynamics of water close to the surface. These different behaviors bear the signature of both water-surface interactions and of confinement. In other words, the altered properties are the result of the synergistic effects of surface-water interactions and confinement. Ultrafast spectroscopy, theoretical modeling and computer simulations together form powerful synergistic approaches towards an understanding of the properties of confined water in such systems as nanocavities, reverse micelles (RMs), water inside and outside biomolecules like proteins and DNA, and also between two hydrophobic walls. We shall review the experimental results and place them in the context of theory and simulations. For water confined within RMs, we discuss the possible interference effects propagating from opposite surfaces. Similar interference is found to give rise to an effective attractive force between two hydrophobic surfaces immersed and kept fixed at a separation of d, with the force showing an exponential dependence on this distance. For protein and DNA hydration, we shall examine a multitude of timescales that arise from frustration effects due to the inherent heterogeneity of these surfaces. We pay particular attention to the role of orientational correlations and modification of the

  11. Documentation of the Santa Clara Valley regional ground-water/surface-water flow model, Santa Clara Valley, California

    Science.gov (United States)

    Hanson, R.T.; Li, Zhen; Faunt, C.C.

    2004-01-01

    The Santa Clara Valley is a long, narrow trough extending about 35 miles southeast from the southern end of San Francisco Bay where the regional alluvial-aquifer system has been a major source of water. Intensive agricultural and urban development throughout the 20th century and related ground-water development resulted in ground-water-level declines of more than 200 feet and land subsidence of as much as 12.7 feet between the early 1900s and the mid-1960s. Since the 1960s, Santa Clara Valley Water District has imported surface water to meet growing demands and reduce dependence on ground-water supplies. This importation of water has resulted in a sustained recovery of the ground-water flow system. To help support effective management of the ground-water resources, a regional ground-water/surface-water flow model was developed. This model simulates the flow of ground water and surface water, changes in ground-water storage, and related effects such as land subsidence. A numerical ground-water/surface-water flow model of the Santa Clara Valley subbasin of the Santa Clara Valley was developed as part of a cooperative investigation with the Santa Clara Valley Water District. The model better defines the geohydrologic framework of the regional flow system and better delineates the supply and demand components that affect the inflows to and outflows from the regional ground-water flow system. Development of the model includes revisions to the previous ground-water flow model that upgraded the temporal and spatial discretization, added source-specific inflows and outflows, simulated additional flow features such as land subsidence and multi-aquifer wellbore flow, and extended the period of simulation through September 1999. The transient-state model was calibrated to historical surface-water and ground-water data for the period 197099 and to historical subsidence for the period 198399. The regional ground-water flow system consists of multiple aquifers that are grouped

  12. Independent principal component analysis for simulation of soil water content and bulk density in a Canadian Watershed

    Directory of Open Access Journals (Sweden)

    Alaba Boluwade

    2016-09-01

    Full Text Available Accurate characterization of soil properties such as soil water content (SWC and bulk density (BD is vital for hydrologic processes and thus, it is importance to estimate θ (water content and ρ (soil bulk density among other soil surface parameters involved in water retention and infiltration, runoff generation and water erosion, etc. The spatial estimation of these soil properties are important in guiding agricultural management decisions. These soil properties vary both in space and time and are correlated. Therefore, it is important to find an efficient and robust technique to simulate spatially correlated variables. Methods such as principal component analysis (PCA and independent component analysis (ICA can be used for the joint simulations of spatially correlated variables, but they are not without their flaws. This study applied a variant of PCA called independent principal component analysis (IPCA that combines the strengths of both PCA and ICA for spatial simulation of SWC and BD using the soil data set from an 11 km2 Castor watershed in southern Quebec, Canada. Diagnostic checks using the histograms and cumulative distribution function (cdf both raw and back transformed simulations show good agreement. Therefore, the results from this study has potential in characterization of water content variability and bulk density variation for precision agriculture.

  13. A Probabilistic Analysis of Surface Water Flood Risk in London.

    Science.gov (United States)

    Jenkins, Katie; Hall, Jim; Glenis, Vassilis; Kilsby, Chris

    2017-10-30

    Flooding in urban areas during heavy rainfall, often characterized by short duration and high-intensity events, is known as "surface water flooding." Analyzing surface water flood risk is complex as it requires understanding of biophysical and human factors, such as the localized scale and nature of heavy precipitation events, characteristics of the urban area affected (including detailed topography and drainage networks), and the spatial distribution of economic and social vulnerability. Climate change is recognized as having the potential to enhance the intensity and frequency of heavy rainfall events. This study develops a methodology to link high spatial resolution probabilistic projections of hourly precipitation with detailed surface water flood depth maps and characterization of urban vulnerability to estimate surface water flood risk. It incorporates probabilistic information on the range of uncertainties in future precipitation in a changing climate. The method is applied to a case study of Greater London and highlights that both the frequency and spatial extent of surface water flood events are set to increase under future climate change. The expected annual damage from surface water flooding is estimated to be to be £171 million, £343 million, and £390 million/year under the baseline, 2030 high, and 2050 high climate change scenarios, respectively. © 2017 Society for Risk Analysis.

  14. Chlorine stress mediates microbial surface attachment in drinking water systems.

    Science.gov (United States)

    Liu, Li; Le, Yang; Jin, Juliang; Zhou, Yuliang; Chen, Guowei

    2015-03-01

    Microbial attachment to drinking water pipe surfaces facilitates pathogen survival and deteriorates disinfection performance, directly threatening the safety of drinking water. Notwithstanding that the formation of biofilm has been studied for decades, the underlying mechanisms for the origins of microbial surface attachment in biofilm development in drinking water pipelines remain largely elusive. We combined experimental and mathematical methods to investigate the role of environmental stress-mediated cell motility on microbial surface attachment in chlorination-stressed drinking water distribution systems. Results show that at low levels of disinfectant (0.0-1.0 mg/L), the presence of chlorine promotes initiation of microbial surface attachment, while higher amounts of disinfectant (>1.0 mg/L) inhibit microbial attachment. The proposed mathematical model further demonstrates that chlorination stress (0.0-5.0 mg/L)-mediated microbial cell motility regulates the frequency of cell-wall collision and thereby controls initial microbial surface attachment. The results reveal that transport processes and decay patterns of chlorine in drinking water pipelines regulate microbial cell motility and, thus, control initial surface cell attachment. It provides a mechanistic understanding of microbial attachment shaped by environmental disinfection stress and leads to new insights into microbial safety protocols in water distribution systems.

  15. Effect of the ODS-4 surfactant and its components on the efficiency of decontamination of solid surfaces

    International Nuclear Information System (INIS)

    Dvorak, J.; Duris, P.

    1994-01-01

    The efficiency was examined of the desorption of carrier-free traces of 147 Pm adsorbed from an acid aqueous solution at pH 2.6 in static conditions on a paint routinely applied to military facilities. The desorption was performed by using the ODS-4 decontamination and deactivation mixture and its components at various concentrations. It is concluded that the surfactant is not very well suited to the decontamination of solid surfaces contaminated with radionuclides which form the water-soluble component of radioactive contamination (in dependence on pH). This is due to the composition and the associated high alkalinity of the ODS-4 agent, which, however, is necessary if detoxication of toxic agents is required. In practice, however, the efficiency of decontamination will be appreciably higher because the military decontamination procedures involve dynamic (mechanical) treatment of the surfaces using brushes with flowing liquid, pressure application of the surfactant and water, moving baths, etc. (P.A.). 7 tabs., 2 figs., 10 refs

  16. Impact of industrial effluents on surface waters

    International Nuclear Information System (INIS)

    Ahmed, K.

    2000-01-01

    The indiscriminate discharge of untreated municipal and industrial effluents has given rise to serious problems of water pollution and human health in Pakistan. The City of Lahore discharges about 365 mgd of wastewater with a BOD load of 250 tons per day, without treatment, into Ravi river. Because of the untreated industrial discharges, river Ravi is devoid of dissolved oxygen through most of its react between Lahore and Upper Chenab Canal under low flow conditions. Pollution levels can be controlled if each industry treats its own wastewater prior to disposal, in accordance with NEQS (Pakistan). (author)

  17. Recovery from acidification in European surface waters

    Czech Academy of Sciences Publication Activity Database

    Evans, C. D.; Cullen, J. M.; Alewell, C.; Kopáček, Jiří; Marchetto, A.; Moldan, F.; Prechtel, A.; Rogora, M.; Veselý, J.; Wright, R.

    2001-01-01

    Roč. 5, č. 3 (2001), s. 283-297 ISSN 1027-5606 R&D Projects: GA ČR GA206/00/0063 Grant - others:CEC RECOVER(XE) 2010 EVK1-CT-1999-00018; GMER(DE) PT BEO 51-0339476; UKDETR(GB) EPG1/3/92; NNP(NO) SFT2000; CEC(XE) EMERGE EVK1-CT-1999-00032 Keywords : acidification * recovery * sulphate Subject RIV: DJ - Water Pollution ; Quality Impact factor: 1.127, year: 2001

  18. Recovery of acidified European surface waters

    Czech Academy of Sciences Publication Activity Database

    Wright, R. F.; Larssen, T.; Camarero, L.; Cosby, B. J.; Ferrier, R. C.; Helliwell, R.; Forsius, M.; Jenkins, A.; Kopáček, Jiří; Majer, V.; Moldan, F.; Posch, M.; Rogora, M.; Schöpp, W.

    2005-01-01

    Roč. 39, č. 3 (2005), 64A-72A ISSN 0013-936X. [ Acid Rain 2005. International Conference on Acid Deposition /7./. Prague, 12.06.2005-17.06.2005] Grant - others:EC(XE) EMERGE EVK1-CT-1999-00032; EC(XE) RECOVER:2010 EVK1-CT-1999-00018; DEFRA(GB) EPG 1/3/194; ICST(ES) REN2000-0889/GLO Institutional research plan: CEZ:AV0Z60170517 Keywords : acid ification * recovery * European lake districts Subject RIV: DJ - Water Pollution ; Quality Impact factor: 4.054, year: 2005

  19. GENERIC, COMPONENT FAILURE DATA BASE FOR LIGHT WATER AND LIQUID SODIUM REACTOR PRAs

    Energy Technology Data Exchange (ETDEWEB)

    S. A. Eide; S. V. Chmielewski; T. D. Swantz

    1990-02-01

    A comprehensive generic component failure data base has been developed for light water and liquid sodium reactor probabilistic risk assessments (PRAs) . The Nuclear Computerized Library for Assessing Reactor Reliability (NUCLARR) and the Centralized Reliability Data Organization (CREDO) data bases were used to generate component failure rates . Using this approach, most of the failure rates are based on actual plant data rather than existing estimates .

  20. The water vapor nitrogen process for removing sodium from LMFBR components

    Energy Technology Data Exchange (ETDEWEB)

    Crippen, M D; Funk, C W; Lutton, J M [Hanford Engineering Development Laboratory, Richland (United States)

    1978-08-01

    Application and operation of the Water Vapor-Nitrogen Process for removing sodium from LMFBR components is reviewed. Emphasis is placed on recent efforts to verify the technological bases of the process, to refine the values of process parameters and to ensure the utility of the process for cleaning and requalifying components. (author)

  1. Experimental study on fouling in the heat exchangers of surface water heat pumps

    International Nuclear Information System (INIS)

    Bai, Xuelian; Luo, Te; Cheng, Kehui; Chai, Feng

    2014-01-01

    Fouling in the heat exchangers plays a key role on the performance of surface water heat pumps. It is also the basement for the system design criteria and operation energy efficiency. In this paper, experimental measurements are performed both in the field and the laboratory with different water qualities, temperatures and velocities. The research will focus on the dynamic growth characteristics of fouling and its main components. By studying the variation rules of fouling resistance, the fouling resistance allowance for certain water condition is recommended. Furthermore, a fouling prediction model in surface water heat pump will be developed and validated based on elaborating with fouling principle under specified water conditions. - Highlights: • Field and laboratory experiments are taken to measure the fouling variation. • Fouling growth process can be divided into four stages. • We recommend fouling resistance allowances for certain conditions. • A fouling prdiction model is developed and validated

  2. Adsorption of surface functionalized silica nanoparticles onto mineral surfaces and decane/water interface

    International Nuclear Information System (INIS)

    Metin, Cigdem O.; Baran, Jimmie R.; Nguyen, Quoc P.

    2012-01-01

    The adsorption of silica nanoparticles onto representative mineral surfaces and at the decane/water interface was studied. The effects of particle size (the mean diameters from 5 to 75 nm), concentration and surface type on the adsorption were studied in detail. Silica nanoparticles with four different surfaces [unmodified, surface modified with anionic (sulfonate), cationic (quaternary ammonium (quat)) or nonionic (polyethylene glycol (PEG)) surfactant] were used. The zeta potential of these silica nanoparticles ranges from −79.8 to 15.3 mV. The shape of silica particles examined by a Hitachi-S5500 scanning transmission electron microscope (STEM) is quite spherical. The adsorption of all the nanoparticles (unmodified or surface modified) on quartz and calcite surfaces was found to be insignificant. We used interfacial tension (IFT) measurements to investigate the adsorption of silica nanoparticles at the decane/water interface. Unmodified nanoparticles or surface modified ones with sulfonate or quat do not significantly affect the IFT of the decane/water interface. It also does not appear that the particle size or concentration influences the IFT. However, the presence of PEG as a surface modifying material significantly reduces the IFT. The PEG surface modifier alone in an aqueous solution, without the nanoparticles, yields the same IFT reduction for an equivalent PEG concentration as that used for modifying the surface of nanoparticles. Contact angle measurements of a decane droplet on quartz or calcite plate immersed in water (or aqueous nanoparticle dispersion) showed a slight change in the contact angle in the presence of the studied nanoparticles. The results of contact angle measurements are in good agreement with experiments of adsorption of nanoparticles on mineral surfaces or decane/water interface. This study brings new insights into the understanding and modeling of the adsorption of surface-modified silica nanoparticles onto mineral surfaces and

  3. Methods on estimation of the evaporation from water surface

    International Nuclear Information System (INIS)

    Trajanovska, Lidija; Tanushevska, Dushanka; Aleksovska, Nina

    2001-01-01

    The whole world water supply on the Earth is in close dependence on hydrological cycle connected with water circulation at Earth-Atmosphere route through evaporation, precipitation and water runoff. Evaporation exists worldwide where the atmosphere is unsatiated of water steam (when there is humidity in short supply) and it depends on climatic conditions in some regions. The purpose of this paper is to determine a method for estimation of evaporation of natural water surface in our areas, that means its determination as exact as possible. (Original)

  4. Non-equilibrium Thermodynamic Dissolution Theory for Multi-Component Solid/Liquid Surfaces Involving Surface Adsorption and Radiolysis Kinetics

    International Nuclear Information System (INIS)

    Stout, R B

    2001-01-01

    A theoretical expression is developed for the dissolution rate response for multi-component radioactive materials that have surface adsorption kinetics and radiolysis kinetics when wetted by a multi-component aqueous solution. An application for this type of dissolution response is the performance evaluation of multi-component spent nuclear fuels (SNFs) for long term interim storage and for geological disposition. Typically, SNF compositions depend on initial composition, uranium oxide and metal alloys being most common, and on reactor burnup which results in a wide range of fission product and actinide concentrations that decay by alpha, beta, and gamma radiation. These compositional/burnup ranges of SNFs, whether placed in interim storage or emplaced in a geologic repository, will potentially be wetted by multi-component aqueous solutions, and these solutions may be further altered by radiolytic aqueous species due to three radiation fields. The solid states of the SNFs are not thermodynamically stable when wetted and will dissolve, with or without radiolysis. The following development of a dissolution theory is based on a non-equilibrium thermodynamic analysis of energy reactions and energy transport across a solid-liquid phase change discontinuity that propagates at a quasi-steady, dissolution velocity. The integral form of the energy balance equation is used for this spatial surface discontinuity analysis. The integral formulation contains internal energy functional of classical thermodynamics for both the SNFs' solid state and surface adsorption species, and the adjacent liquid state, which includes radiolytic chemical species. The steady-state concentrations of radiolytic chemical species are expressed by an approximate analysis of the decay radiation transport equation. For purposes of illustration a modified Temkin adsorption isotherm was assumed for the surface adsorption kinetics on an arbitrary, finite area of the solid-liquid dissolution interface. For

  5. Dynamics of ice nucleation on water repellent surfaces.

    Science.gov (United States)

    Alizadeh, Azar; Yamada, Masako; Li, Ri; Shang, Wen; Otta, Shourya; Zhong, Sheng; Ge, Liehui; Dhinojwala, Ali; Conway, Ken R; Bahadur, Vaibhav; Vinciquerra, A Joseph; Stephens, Brian; Blohm, Margaret L

    2012-02-14

    Prevention of ice accretion and adhesion on surfaces is relevant to many applications, leading to improved operation safety, increased energy efficiency, and cost reduction. Development of passive nonicing coatings is highly desirable, since current antiicing strategies are energy and cost intensive. Superhydrophobicity has been proposed as a lead passive nonicing strategy, yet the exact mechanism of delayed icing on these surfaces is not clearly understood. In this work, we present an in-depth analysis of ice formation dynamics upon water droplet impact on surfaces with different wettabilities. We experimentally demonstrate that ice nucleation under low-humidity conditions can be delayed through control of surface chemistry and texture. Combining infrared (IR) thermometry and high-speed photography, we observe that the reduction of water-surface contact area on superhydrophobic surfaces plays a dual role in delaying nucleation: first by reducing heat transfer and second by reducing the probability of heterogeneous nucleation at the water-substrate interface. This work also includes an analysis (based on classical nucleation theory) to estimate various homogeneous and heterogeneous nucleation rates in icing situations. The key finding is that ice nucleation delay on superhydrophobic surfaces is more prominent at moderate degrees of supercooling, while closer to the homogeneous nucleation temperature, bulk and air-water interface nucleation effects become equally important. The study presented here offers a comprehensive perspective on the efficacy of textured surfaces for nonicing applications.

  6. How to repel hot water from a superhydrophobic surface?

    KAUST Repository

    Yu, Zhejun; Yang, Jieyi; Wan, Fang; Ge, Quan; Yang, Longlai; Ding, Zunliang; Yang, Dequan; Sacher, Edward R.; Isimjan, Tayirjan T.

    2014-01-01

    Superhydrophobic surfaces, with water contact angles greater than 150° and slide angles less than 10°, have attracted a great deal of attention due to their self-cleaning ability and excellent water-repellency. It is commonly accepted that a

  7. Heavy Metals Pollution on Surface Water Sources in Kaduna ...

    African Journals Online (AJOL)

    This study examine the effects of heavy metal pollutants to aquatic ecosystems and the environment by considering the role of urban, municipal, agricultural, industrial and other anthropogenic processes as sources of heavy metal pollution in surface water sources of Kaduna metropolis. Samples of the polluted water were ...

  8. Pesticides distribution in surface waters and sediments of lotic and ...

    African Journals Online (AJOL)

    An investigation on the availability and distribution of Lindane (HCHs) and Total organochlorine phosphate (TOCP) in the surface waters and sediments of selected water bodies in Agbede wetlands was carried out from December, 2012 to May, 2014 in order to cover seasonal trends in both matrixes. A Gas Chromatograph ...

  9. Macro-invertebrate decline in surface water polluted with imidacloprid

    NARCIS (Netherlands)

    van Dijk, T.; van Staalduinen, M.A.; van der Sluijs, J.P.|info:eu-repo/dai/nl/073427489

    Imidacloprid is one of the most widely used insecticides in the world. Its concentration in surface water exceeds the water quality norms in many parts of the Netherlands. Several studies have demonstrated harmful effects of this neonicotinoid to a wide range of non-target species. Therefore we

  10. Flow Components in a NaK Test Loop Designed to Simulate Conditions in a Nuclear Surface Power Reactor

    Science.gov (United States)

    Polzin, Kurt A.; Godfroy, Thomas J.

    2008-01-01

    A test loop using NaK as the working fluid is presently in use to study material compatibility effects on various components that comprise a possible nuclear reactor design for use on the lunar surface. A DC electromagnetic (EM) pump has been designed and implemented as a means of actively controlling the NaK flow rate through the system and an EM flow sensor is employed to monitor the developed flow rate. These components allow for the matching of the flow rate conditions in test loops with those that would be found in a full-scale surface-power reactor. The design and operating characteristics of the EM pump and flow sensor are presented. In the EM pump, current is applied to a set of electrodes to produce a Lorentz body force in the fluid. A measurement of the induced voltage (back-EMF) in the flow sensor provides the means of monitoring flow rate. Both components are compact, employing high magnetic field strength neodymium magnets thermally coupled to a water-cooled housing. A vacuum gap limits the heat transferred from the high temperature NaK tube to the magnets and a magnetically-permeable material completes the magnetic circuit. The pump is designed to produce a pressure rise of 5 psi, and the flow sensor's predicted output is roughly 20 mV at the loop's nominal flow rate of 0.5 GPM.

  11. Modeling groundwater/surface-water interactions in an Alpine valley (the Aosta Plain, NW Italy): the effect of groundwater abstraction on surface-water resources

    Science.gov (United States)

    Stefania, Gennaro A.; Rotiroti, Marco; Fumagalli, Letizia; Simonetto, Fulvio; Capodaglio, Pietro; Zanotti, Chiara; Bonomi, Tullia

    2018-02-01

    A groundwater flow model of the Alpine valley aquifer in the Aosta Plain (NW Italy) showed that well pumping can induce river streamflow depletions as a function of well location. Analysis of the water budget showed that ˜80% of the water pumped during 2 years by a selected well in the downstream area comes from the baseflow of the main river discharge. Alluvial aquifers hosted in Alpine valleys fall within a particular hydrogeological context where groundwater/surface-water relationships change from upstream to downstream as well as seasonally. A transient groundwater model using MODFLOW2005 and the Streamflow-Routing (SFR2) Package is here presented, aimed at investigating water exchanges between the main regional river (Dora Baltea River, a left-hand tributary of the Po River), its tributaries and the underlying shallow aquifer, which is affected by seasonal oscillations. The three-dimensional distribution of the hydraulic conductivity of the aquifer was obtained by means of a specific coding system within the database TANGRAM. Both head and flux targets were used to perform the model calibration using PEST. Results showed that the fluctuations of the water table play an important role in groundwater/surface-water interconnections. In upstream areas, groundwater is recharged by water leaking through the riverbed and the well abstraction component of the water budget changes as a function of the hydraulic conditions of the aquifer. In downstream areas, groundwater is drained by the river and most of the water pumped by wells comes from the base flow component of the river discharge.

  12. Rapid surface-water volume estimations in beaver ponds

    Science.gov (United States)

    Karran, Daniel J.; Westbrook, Cherie J.; Wheaton, Joseph M.; Johnston, Carol A.; Bedard-Haughn, Angela

    2017-02-01

    Beaver ponds are surface-water features that are transient through space and time. Such qualities complicate the inclusion of beaver ponds in local and regional water balances, and in hydrological models, as reliable estimates of surface-water storage are difficult to acquire without time- and labour-intensive topographic surveys. A simpler approach to overcome this challenge is needed, given the abundance of the beaver ponds in North America, Eurasia, and southern South America. We investigated whether simple morphometric characteristics derived from readily available aerial imagery or quickly measured field attributes of beaver ponds can be used to approximate surface-water storage among the range of environmental settings in which beaver ponds are found. Studied were a total of 40 beaver ponds from four different sites in North and South America. The simplified volume-area-depth (V-A-h) approach, originally developed for prairie potholes, was tested. With only two measurements of pond depth and corresponding surface area, this method estimated surface-water storage in beaver ponds within 5 % on average. Beaver pond morphometry was characterized by a median basin coefficient of 0.91, and dam length and pond surface area were strongly correlated with beaver pond storage capacity, regardless of geographic setting. These attributes provide a means for coarsely estimating surface-water storage capacity in beaver ponds. Overall, this research demonstrates that reliable estimates of surface-water storage in beaver ponds only requires simple measurements derived from aerial imagery and/or brief visits to the field. Future research efforts should be directed at incorporating these simple methods into both broader beaver-related tools and catchment-scale hydrological models.

  13. An Ontology Design Pattern for Surface Water Features

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, Gaurav [Ohio University; Mark, David [University at Buffalo (SUNY); Kolas, Dave [Raytheon BBN Technologies; Varanka, Dalia [U.S. Geological Survey, Rolla, MO; Romero, Boleslo E [University of California, Santa Barbara; Feng, Chen-Chieh [National University of Singapore; Usery, Lynn [U.S. Geological Survey, Rolla, MO; Liebermann, Joshua [Tumbling Walls, LLC; Sorokine, Alexandre [ORNL

    2014-01-01

    Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities can be found due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology. It can then be used to systematically incor-porate concepts that are specific to a culture, language, or scientific domain. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex surface water ontologies. A fundamental distinction is made in this on-tology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is imple-mented in OWL, but Description Logic axioms and a detailed explanation is provided. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. A discussion about why there is a need to complement the pattern with other ontologies, es-pecially the previously developed Surface Network pattern is also provided. Fi-nally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through a few queries and annotated geospatial datasets.

  14. Practical aspects of tritium measurement in ground and surface waters

    Energy Technology Data Exchange (ETDEWEB)

    Nitzsche, O [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Angewandte Physik; Hebert, D [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Angewandte Physik

    1997-03-01

    Tritium measurements are a powerful tool in hydrological and hydrogeological investigations for detecting mean residence times of several water reservoirs. Due to the low tritium activities in precipitation, ground and surface waters a low level measurement is necessary. Therefore often the liquid scintillation counting after an electrolytic enrichment of water is used. In this paper some practical aspects and problems of measurement are discussed and the problem of contamination in low level laboratories is shown. (orig.)

  15. Influence of Road Surface Microtexture on Thin Water Film Traction

    OpenAIRE

    BEAUTRU , Yannick; Kane , Malal; Do , Minh Tan; Cerezo , Véronique

    2012-01-01

    This paper deals with the contribution of road surface microtexture to the relationship between tire/road friction and water depth. The main objectives are the estimation of local water depths trapped at the tire/road interface and the definition of a critical water depth which can be used for driver assistance and information systems. Tests are performed in laboratory. Specimens are slabs made of asphalt concrete and mosaics composed of coarse aggregates. The aggregate mosaics are sandblaste...

  16. Concentration Dependences of the Surface Tension and Density of Solutions of Acetone-Ethanol-Water Systems at 293 K

    Science.gov (United States)

    Dadashev, R. Kh.; Dzhambulatov, R. S.; Mezhidov, V. Kh.; Elimkhanov, D. Z.

    2018-05-01

    Concentration dependences of the surface tension and density of solutions of three-component acetone-ethanol-water systems and the bounding binary systems at 273 K are studied. The molar volume, adsorption, and composition of surface layers are calculated. Experimental data and calculations show that three-component solutions are close to ideal ones. The surface tensions of these solutions are calculated using semi-empirical and theoretical equations. Theoretical equations qualitatively convey the concentration dependence of surface tension. A semi-empirical method based on the Köhler equation allows us to predict the concentration dependence of surface tension within the experimental error.

  17. Influences of surface and solvent on retention of HEMA/mixture components after evaporation.

    Science.gov (United States)

    Garcia, Fernanda C P; Wang, Linda; Pereira, Lúcia C G; de Andrade e Silva, Safira M; Júnior, Luiz M; Carrilho, Marcela Rocha de Oliveira

    2010-01-01

    This study examined the retention of solvents within experimental HEMA/solvent primers after two conditions for solvent evaporation: from a free surface or from dentine surface. Experimental primers were prepared by mixing 35% HEMA with 65% water, methanol, ethanol or acetone (v/v). Aliquots of each primer (50 microl) were placed on glass wells or they were applied to the surface of acid-etched dentine cubes (2mm x 2mm x 2mm) (n=5). For both conditions (i.e. from free surface or dentine cubes), change in primers mass due to solvent evaporation was gravimetrically measured for 10min at 51% RH and 21 degrees C. The rate of solvent evaporation was calculated as a function of loss of primers mass (%) over time. Data were analysed by two-way ANOVA and Student-Newman-Keuls (pevaporation rate (%/min) depending on the solvent present in the primer and the condition for evaporation (from free surface or dentine cubes) (pevaporation for HEMA/acetone primer was almost 2- to 10-times higher than for HEMA/water primer depending whether evaporation occurred, respectively, from a free surface or dentine cubes. The rate of solvent evaporation varied with time, being in general highest at the earliest periods. The rate of solvent evaporation and its retention into HEMA/solvent primers was influenced by the type of the solvent and condition allowed for their evaporation.

  18. A Novel Method for Surface Defect Detection of Photovoltaic Module Based on Independent Component Analysis

    Directory of Open Access Journals (Sweden)

    Xuewu Zhang

    2013-01-01

    Full Text Available This paper proposed a new method for surface defect detection of photovoltaic module based on independent component analysis (ICA reconstruction algorithm. Firstly, a faultless image is used as the training image. The demixing matrix and corresponding ICs are obtained by applying the ICA in the training image. Then we reorder the ICs according to the range values and reform the de-mixing matrix. Then the reformed de-mixing matrix is used to reconstruct the defect image. The resulting image can remove the background structures and enhance the local anomalies. Experimental results have shown that the proposed method can effectively detect the presence of defects in periodically patterned surfaces.

  19. Simulated plasma facing component measurements for an in situ surface diagnostic on Alcator C-Moda)

    Science.gov (United States)

    Hartwig, Z. S.; Whyte, D. G.

    2010-10-01

    The ideal in situ plasma facing component (PFC) diagnostic for magnetic fusion devices would perform surface element and isotope composition measurements on a shot-to-shot (˜10 min) time scale with ˜1 μm depth and ˜1 cm spatial resolution over large areas of PFCs. To this end, the experimental adaptation of the customary laboratory surface diagnostic—nuclear scattering of MeV ions—to the Alcator C-Mod tokamak is being guided by ACRONYM, a Geant4 synthetic diagnostic. The diagnostic technique and ACRONYM are described, and synthetic measurements of film thickness for boron-coated PFCs are presented.

  20. Dynamics of leaf water relations components in co-occurring iso- and anisohydric conifer species

    Science.gov (United States)

    Frederick Meinzer; David Woodruff; Danielle Marias; Katherine McCulloh; Sanna Sevanto

    2014-01-01

    Because iso- and anisohydric species differ in stomatal regulation of the rate and magnitude of fluctuations in shoot water potential, they may be expected to show differences in the plasticity of their shoot water relations components, but explicit comparisons of this nature have rarely been made. We subjected excised shoots of co-occurring anisohydric Juniperus...

  1. Assessment of radioecological state of surface waters in the Gomel and Mogilev regions

    International Nuclear Information System (INIS)

    Khvaley, O.D.; Datskevich, P.I.; Komissarov, F.D.; Levosechko, S.I.

    2000-01-01

    Article states that aplication of the republican Admissible Levels (RAL-96) in practice and their juxtaposition with the obtained results of analyses are not always justified because water of the studied systems is excluded from economic water supply to population in resettlement zone. The radioecological criteria of quality of surface waters were developed in 1993 by Ukrainian hydrobiologists O.P.Oksiyuk, V.N.Zhukinsky and others contain six levels (classes) of radioecological pollution of water: 1 - non-polluted, 2 - lowly polluted, 3 - moderately polluted, 4 - highly polluted, 5 - very high pollution, 6 - utmost pollution; three classes of water quality and six categories of water quality. It is believed that according to this complex clasification of quality of surface terrestrial waters, water of the studied systems of Gomel and Mogilev regions very often has exceeded the RAL-96 for 90Sr. According to the proposed complex classification of quality of surface terrestrial waters, water of the studied systems belongs mainly - for 137Cs and 90Sr - to the quality categories: 3b ''lowly polluted'' and 4a ''moderately polluted'' independent on sampling period. On some sites of 30...10 km zone, water quality corresponds to categories 5a ''very high pollution'' and 5b ''utmost pollution'' for 90Sr (rivers Slovechna, Nesvich and Pogonyansky channel). Thus, in the studied water systems, in radioecological relation, there is not a single one with water quality corresponding to indices 3a, i.e.sufficiently clean. 90Sr has high migration ability and is able to participate in different migration cycles including biological (food chains). The cases of exceeding the RAL indices for 90Sr in water indicate the necessity to study also other components of water systems of Belarus relating to this isotope

  2. Water slip and friction at a solid surface

    Energy Technology Data Exchange (ETDEWEB)

    Brigo, L; Pierno, M; Mammano, F; Sada, C; Fois, G; Pozzato, A; Zilio, S dal; Mistura, G [Dipartimento di Fisica G Galilei, Universita degli Studi di Padova, via Marzolo 8, 35131 Padova (Italy); Natali, M [Istituto di Chimica Inorganica e delle Superfici (ICIS), CNR, Corso Stati Uniti 4, 35127 Padova (Italy); Tormen, M [TASC-INFM, CNR, S S 14 km 163.5 Area Science Park, 34012 Basovizza, Trieste (Italy)], E-mail: mistura@padova.infm.it

    2008-09-03

    A versatile micro-particle imaging velocimetry ({mu}-PIV) recording system is described, which allows us to make fluid velocity measurements in a wide range of flow conditions both inside microchannels and at liquid-solid interfaces by using epifluorescence and total internal reflection fluorescence excitation. This set-up has been applied to study the slippage of water over flat surfaces characterized by different degrees of hydrophobicity and the effects that a grooved surface has on the fluid flow inside a microchannel. Preliminary measurements of the slip length of water past various flat surfaces show no significant dependence on the contact angle.

  3. Stormwater Priority Pollutants Versus Surface Water Quality Criteria

    DEFF Research Database (Denmark)

    Eriksson, Eva; Ledin, Anna; Baun, Anders

    2011-01-01

    Stormwater in urban areas comprises of a substantial part of the urban water cycle, dominating the flow in many small urban streams, and the pollution levels are sizeable. No stormwater quality criteria were found here and no European or national emission limit values exist. Stormwater pollutants...... however are present in levels exceeding most of the regulated surface water quality criteria and environmental quality standards. Therefore catchment characterisation is needed to chose suitable treatment prior to discharge into receiving surface waters, as the mixing may be insufficient in small streams....

  4. Context of surveillance of underground and surface waters

    International Nuclear Information System (INIS)

    2010-01-01

    This document briefly describes the evolutions of regulations on site liquid effluents and of guideline values concerning radioactive wastes, briefly presents the surveillance of underground and surface waters of CEA sites, comments the guideline values of the radiological quality of waters aimed at human consumption, and gives an overview of information which are brought to public's attention. Then, for different CEA sites (Cadarache, Marcoule, Saclay, Grenoble, Fontenay-aux-Roses, Valduc, DIF), this document proposes a presentation of the hydrological context, regulatory context, the surface and underground water surveillance process and values, the storing zones of old wastes

  5. Residual radioactivity guidelines for the heavy water components test reactor at the Savannah River Site

    International Nuclear Information System (INIS)

    Owen, M.B. Smith, R.; McNeil, J.

    1997-04-01

    Guidelines were developed for acceptable levels of residual radioactivity in the Heavy Water Components Test Reactor (HWCTR) facility at the conclusion of its decommissioning. Using source terms developed from data generated in a detailed characterization study, the RESRAD and RASRAD-BUILD computer codes were used to calculate derived concentration guideline levels (DCGLs) for the radionuclides that will remain in the facility. The calculated DCGLs, when compared to existing concentrations of radionuclides measured during a 1996 characterization program, indicate that no decontamination of concrete surfaces will be necessary. Also, based on the results of the calculations, activated concrete in the reactor biological shield does not have to be removed, and imbedded radioactive piping in the facility can remain in place. Viewed in another way, the results of the calculations showed that the present inventory of residual radioactivity in the facility (not including that associated with the reactor vessel and steam generators) would produce less than one millirem per year above background to a hypothetical individual on the property. The residual radioactivity is estimated to be approximately 0.04 percent of the total inventory in the facility as of March, 1997. According to the results, the only radionuclides that would produce greater than 0.0.1-millirem per year are Am-241 (0.013 mrem/yr at 300 years), C-14 (0.022 mrem/yr at 1000 years) and U-238 (0.034 mrem/yr at 6000 years). Human exposure would occur only through the groundwater pathways, that is, from water drawn from, a well on the property. The maximum exposure would be approximately one percent of the 4 millirem per year ground water exposure limit established by the U.S. Environmental Protection Agency. 11 refs., 13 figs., 15 tabs

  6. Accelerator system for producing two-component beams for studies of interactive surface effects

    International Nuclear Information System (INIS)

    Kaminsky, M.; Das, S.K.; Ekern, R.; Hess, D.C.

    1977-01-01

    For studies of interactive surface effects caused by the simultaneous bombardment of targets by both chemically active and inactive ion species (e.g., D + and He + , respectively) a two beam component accelerator facility was placed in operation. One component, consisting of light ions (e.g., H, D, He) is accelerated by a 2-MV Van de Graaff accelerator which provides a mass analyzed and focussed beam for the energy range from approximately 100-keV to 2-MeV (for singly charged ions). The other component is a beam of light ions in the energy range from approximately 10-keV to 100-keV. This is furnished by a 100-kV dc accelerator system which provides a mass analyzed focussed beam. This beam is guided into the beam line of the Van de Graaff accelerator electrostatically, and with the aid of beam steerers it is made to be co-axial with the Van de Graaff generated beam. The angle of incidence becomes hereby a free parameter for the interaction of the mixed beams with a surface. For each beam component, current densities of 650 μA cm -2 on target can readily be obtained. In order to reduce carbon contamination of the irradiated targets significantly, stainless steel beam lines have been used together with a combination of turbomolecular pumps and ion-sublimation pumps.A total pressure of 2 to 3 x 10 -8 torr in the beam lines and of 2 x 10 -9 torr in the target chamber can be obtained readily. Experimental results on the surface damage of Ni bombarded simultaneously with He + and D + ions are presented. The importance of such studies of interactive surface effects for the controlled thermonuclear fusion program are discussed

  7. Quantitative determination of the intensities of known components in spectra obtained from surface analytical techniques

    International Nuclear Information System (INIS)

    Nelson, G.C.

    1984-01-01

    Linear least-squares methods have been used to quantitatively decompose experimental data obtained from surface analytical techniques into its separate components. The mathematical procedure for accomplishing this is described and examples are given of the use of this method with data obtained from Auger electron spectroscopy [both N(E) and derivative], x-ray photoelectron spectroscopy, and low energy ion scattering spectroscopy. The requirements on the quality of the data are discussed

  8. The Proposed Surface Water and Ocean Topography (SWOT) Mission

    Science.gov (United States)

    Fu, Lee-Lueng; Alsdorf, Douglas; Rodriguez, Ernesto; Morrow, Rosemary; Mognard, Nelly; Vaze, Parag; Lafon, Thierry

    2012-01-01

    A new space mission concept called Surface Water and Ocean Topography (SWOT) is being developed jointly by a collaborative effort of the international oceanographic and hydrological communities for making high-resolution measurement of the water elevation of both the ocean and land surface water to answer the questions about the oceanic submesoscale processes and the storage and discharge of land surface water. The key instrument payload would be a Ka-band radar interferometer capable of making high-resolution wide-swath altimetry measurement. This paper describes the proposed science objectives and requirements as well as the measurement approach of SWOT, which is baselined to be launched in 2019. SWOT would demonstrate this new approach to advancing both oceanography and land hydrology and set a standard for future altimetry missions.

  9. Polarization Patterns of Transmitted Celestial Light under Wavy Water Surfaces

    Directory of Open Access Journals (Sweden)

    Guanhua Zhou

    2017-03-01

    Full Text Available This paper presents a model to describe the polarization patterns of celestial light, which includes sunlight and skylight, when refracted by wavy water surfaces. The polarization patterns and intensity distribution of refracted light through the wave water surface were calculated. The model was validated by underwater experimental measurements. The experimental and theoretical values agree well qualitatively. This work provides a quantitative description of the repolarization and transmittance of celestial light transmitted through wave water surfaces. The effects of wind speed and incident sources on the underwater refraction polarization patterns are discussed. Scattering skylight dominates the polarization patterns while direct solar light is the dominant source of the intensity of the underwater light field. Wind speed has an influence on disturbing the patterns under water.

  10. Aging assessment and mitigation for major LWR [light water reactor] components

    International Nuclear Information System (INIS)

    Shah, Y.N.; Ware, A.G.; Conley, D.A.; MacDonald, P.E.; Burns, J.J. Jr.

    1989-01-01

    This paper summarizes some of the results of the Aging Assessment and Mitigation Project sponsored by the US Nuclear Regulatory Commission (USNRC), Office of Nuclear Regulatory Research. The objective of the project is to develop an understanding of the aging degradation of the major light water reactor (LWR) structures and components and to develop methods for predicting the useful life of these components so that the impact of aging on the safe operation of nuclear power plants can be evaluated and addressed. The research effort consists of integrating, evaluating, and updating the available aging-related information. This paper discusses current accomplishments and summarizes the significant degradation processes active in two major components: pressurized water reactor pressurizer surge and spray lines and nozzles, and light water reactor primary coolant pumps. This paper also evaluates the effectiveness of the current inservice inspection programs and presents conclusions and recommendations related to aging of these two major components. 37 refs., 7 figs., 3 tabs

  11. Water quality responses to the interaction between surface water and groundwater along the Songhua River, NE China

    Science.gov (United States)

    Teng, Yanguo; Hu, Bin; Zheng, Jieqiong; Wang, Jinsheng; Zhai, Yuanzheng; Zhu, Chen

    2018-03-01

    Investigation of surface water and groundwater interaction (SW-GW interaction) provides basic information for regional water-resource protection, management, and development. In this survey of a 10-km-wide area along both sides of the Songhua River, northeast China, the hydrogeochemical responses to different SW-GW interactions were studied. Three types of SW-GW interactions were identified—"recharge", "discharge", and "flow-through"—according to the hydraulic connection between the surface water and groundwater. The single factor index, principal component analysis, and hierarchical cluster analysis of the hydrogeochemistry and pollutant data illuminated the hydrogeochemical response to the various SW-GW interactions. Clear SW-GW interactions along the Songhua River were revealed: (1) upstream in the study area, groundwater usually discharges into the surface water, (2) groundwater is recharged by surface water downstream, and (3) discharge and flow-through coexist in between. Statistical analysis indicated that the degree of hydrogeochemical response in different types of hydraulic connection varied, being clear in recharge and flow-through modes, and less obvious in discharge mode. During the interaction process, dilution, adsorption, redox reactions, nitrification, denitrification, and biodegradation contributed to the pollutant concentration and affected hydrogeochemical response in the hyporheic zone.

  12. The influence of lithology on surface water sources | Science ...

    Science.gov (United States)

    Understanding the temporal and spatial variability of surface water sources within a basin is vital to our ability to manage the impacts of climate variability and land cover change. Water stable isotopes can be used as a tool to determine geographic and seasonal sources of water at the basin scale. Previous studies in the Coastal Range of Oregon reported that the variation in the isotopic signatures of surface water does not conform to the commonly observed “rainout effect”, which exhibits a trend of increasing isotopic depletion with rising elevation. The primary purpose of this research is to investigate the mechanisms governing seasonal and spatial variations in the isotopic signature of surface waters within the Marys River Basin, located in the leeward side of the Oregon Coastal Range. Surface water and precipitation samples were collected every 2-3 weeks for isotopic analysis of δ18O and δ2H for one year. Results indicate a significant difference in isotopic signature between watersheds underlain by basalt and sandstone. The degree of separation was the most distinct during the summer when low flows reflect deeper groundwater sources, whereas isotopic signatures during the rainy season (fall and winter) showed a greater degree of similarity between the two lithologies. This indicates that baseflow within streams drained by sandstone versus basalt is being supplied from two distinctly separate water sources. In addition, Marys River flow at the outle

  13. Using IR Imaging of Water Surfaces for Estimating Piston Velocities

    Science.gov (United States)

    Gålfalk, M.; Bastviken, D.; Arneborg, L.

    2013-12-01

    The transport of gasses dissolved in surface waters across the water-atmosphere interface is controlled by the piston velocity (k). This coefficient has large implications for, e.g., greenhouse gas fluxes but is challenging to quantify in situ. At present, empirical k-wind speed relationships from a small number of studies and systems are often extrapolated without knowledge of model performance. It is therefore of interest to search for new methods for estimating k, and to compare the pros and cons of existing and new methods. Wind speeds in such models are often measured at a height of 10 meters. In smaller bodies of water such as lakes, wind speeds can vary dramatically across the surface through varying degrees of wind shadow from e.g. trees at the shoreline. More local measurements of the water surface, through wave heights or surface motion mapping, could give improved k-estimates over a surface, also taking into account wind fetch. At thermal infrared (IR) wavelengths water has very low reflectivity (depending on viewing angle) than can go below 1%, meaning that more than 99% is heat radiation giving a direct measurement of surface temperature variations. Using an IR camera at about 100 frames/s one could map surface temperature structures at a fraction of a mm depth even with waves present. In this presentation I will focus on IR imaging as a possible tool for estimating piston velocities. Results will be presented from IR field measurements, relating the motions of surface temperature structures to k calculated from other simultaneous measurements (flux chamber and ADV-Based Dissipation Rate), but also attempting to calculate k directly from the IR surface divergence. A relation between wave height and k will also be presented.

  14. Issues of the presence of parasitic protozoa in surface waters

    Science.gov (United States)

    Hawrylik, Eliza

    2018-02-01

    Parasitic protozoa are very numerous organisms in the environment that play an important role in the spread of water-borne diseases. Water-borne epidemics caused by parasitic protozoa are noted throughout the world. Within these organisms, intestinal protozoa of the genera Cryptosporidium and Giardia are ones of the most serious health hazards for humans. This paper focuses on the problem of the presence of parasitic protozoa in surface waters. Characteristics of the most frequently recognized pathogens responsible for water-borne outbreaks were described, as well as sources of contamination and surface waters contamination due to protozoa of the genus Cryptosporidium and Giardia were presented. The methods of destroying the cysts and oocysts of parasitic protozoa used nowadays in the world were also presented in a review.

  15. Water chemistry and corrosion control of cladding and primary circuit components. Proceedings of a technical committee meeting

    International Nuclear Information System (INIS)

    1999-12-01

    Corrosion is the principal life limiting degradation mechanism in nuclear steam supply systems, especially taking into account the trends to increase fuel burnup, thermal rate and cycle length. Primary circuit components of water cooled power reactors have an impact on Zr-based alloys behaviour due to crud (primary circuit corrosion products) formation, transport and deposition on heat transfer surfaces. Crud deposits influence water chemistry, radiation and thermal hydraulic conditions near cladding surface, and by this way-Zr-based alloy corrosion. During the last decade, significant improvements were achieved in the reduction of the corrosion and dose rates by changing the cladding material for one more resistant to corrosion or by the improvement of water chemistry conditions. However, taking into account the above mentioned tendency for heavier fuel duties, corrosion and water chemistry, control will remain a serious task to work with for nuclear power plant operators and scientists, as well as development of generally accepted corrosion model of Zr-based alloys in a water environment in a new millennium. Upon the recommendation of the International Working Group on Water Reactor Fuel Performance and Technology, water chemistry and corrosion of cladding and primary circuit components are in the focus of the IAEA activities in the area of fuel technology and performance. At present the IAEA performs two co-ordinated research projects (CRPs): on On-line High Temperature Monitoring of Water Chemistry and Corrosion (WACOL) and on Activity Transport in Primary Circuits. Two CRPs deal with hydrogen and hydride degradation of the Zr-based alloys. A state-of-the-art review entitled: 'Waterside Corrosion of Zirconium Alloys in Nuclear Power Plants' was published in 1998. Technical Committee meetings on the subject were held in 1985 (Cadarache, France), 1989 (Portland, USA), 1993 (Rez, Czech Republic). During the last few years extensive exchange of experience in

  16. Sediment studies at Bikini Atoll part 1. distribution of fine and coarse components in surface sediments

    International Nuclear Information System (INIS)

    Noshkin, V. E.; Eagle, R.J.; Robison, W.L.

    1997-01-01

    In 1979, 21 years after the moratorium on nuclear testing in the Marshall Islands, surface sediment samples (to depths of 2 and 4 cm) were collected from 87 locations over the floor of Bikini lagoon. The main purpose for the collections was to map the distribution of long- lived man-made radionuclides associated with the bottom material. In addition the samples were processed to estimate the fraction of fine and coarse components to show what modifications occurred since the sediment composition was first described in samples collected before testing in 1946. In this report a comparison is made of the amount and distribution of fine material associated with the lagoon surface sediment before and after the testing of nuclear devices. Nuclear testing produced more finely divided material in-the surface sediment layer over large areas of the lagoon and especially in regions of the lagoon and reef adjacent to test sites. Five cratering events at Bikini Atoll generated sufficient material to account for the inventory of new fine material found over the bottom surface of the lagoon. Although the fraction of fine material in the bottom sediments was altered by the nuclear events, the combined processes of formation, transport and deposition were not sufficiently dynamic to alter the geographical features of the major sedimentary components over most of the lagoon floor

  17. 2D surface temperature measurement of plasma facing components with modulated active pyrometry

    International Nuclear Information System (INIS)

    Amiel, S.; Loarer, T.; Pocheau, C.; Roche, H.; Gauthier, E.; Aumeunier, M.-H.; Courtois, X.; Jouve, M.; Balorin, C.; Moncada, V.; Le Niliot, C.; Rigollet, F.

    2014-01-01

    In nuclear fusion devices, such as Tore Supra, the plasma facing components (PFC) are in carbon. Such components are exposed to very high heat flux and the surface temperature measurement is mandatory for the safety of the device and also for efficient plasma scenario development. Besides this measurement is essential to evaluate these heat fluxes for a better knowledge of the physics of plasma-wall interaction, it is also required to monitor the fatigue of PFCs. Infrared system (IR) is used to manage to measure surface temperature in real time. For carbon PFCs, the emissivity is high and known (ε ∼ 0.8), therefore the contribution of the reflected flux from environment and collected by the IR cameras can be neglected. However, the future tokamaks such as WEST and ITER will be equipped with PFCs in metal (W and Be/W, respectively) with low and variable emissivities (ε ∼ 0.1–0.4). Consequently, the reflected flux will contribute significantly in the collected flux by IR camera. The modulated active pyrometry, using a bicolor camera, proposed in this paper allows a 2D surface temperature measurement independently of the reflected fluxes and the emissivity. Experimental results with Tungsten sample are reported and compared with simultaneous measurement performed with classical pyrometry (monochromatic and bichromatic) with and without reflective flux demonstrating the efficiency of this method for surface temperature measurement independently of the reflected flux and the emissivity

  18. Sediment studies at Bikini Atoll part 1. distribution of fine and coarse components in surface sediments

    Energy Technology Data Exchange (ETDEWEB)

    Noshkin, V. E.; Eagle, R.J.; Robison, W.L.

    1997-01-01

    In 1979, 21 years after the moratorium on nuclear testing in the Marshall Islands, surface sediment samples (to depths of 2 and 4 cm) were collected from 87 locations over the floor of Bikini lagoon. The main purpose for the collections was to map the distribution of long- lived man-made radionuclides associated with the bottom material. In addition the samples were processed to estimate the fraction of fine and coarse components to show what modifications occurred since the sediment composition was first described in samples collected before testing in 1946. In this report a comparison is made of the amount and distribution of fine material associated with the lagoon surface sediment before and after the testing of nuclear devices. Nuclear testing produced more finely divided material in-the surface sediment layer over large areas of the lagoon and especially in regions of the lagoon and reef adjacent to test sites. Five cratering events at Bikini Atoll generated sufficient material to account for the inventory of new fine material found over the bottom surface of the lagoon. Although the fraction of fine material in the bottom sediments was altered by the nuclear events, the combined processes of formation, transport and deposition were not sufficiently dynamic to alter the geographical features of the major sedimentary components over most of the lagoon floor.

  19. Near-surface thermal characterization of plasma facing components using the 3-omega method

    International Nuclear Information System (INIS)

    Dechaumphai, Edward; Barton, Joseph L.; Tesmer, Joseph R.; Moon, Jaeyun; Wang, Yongqiang; Tynan, George R.; Doerner, Russell P.; Chen, Renkun

    2014-01-01

    Near-surface regime plays an important role in thermal management of plasma facing components in fusion reactors. Here, we applied a technique referred to as the ‘3ω’ method to measure the thermal conductivity of near-surface regimes damaged by ion irradiation. By modulating the frequency of the heating current in a micro-fabricated heater strip, the technique enables the probing of near-surface thermal properties. The technique was applied to measure the thermal conductivity of a thin ion-irradiated layer on a tungsten substrate, which was found to decrease by nearly 60% relative to pristine tungsten for a Cu ion dosage of 0.2 dpa

  20. Reaction of water vapor with a clean liquid uranium surface

    International Nuclear Information System (INIS)

    Siekhaus, W.

    1985-01-01

    To study the reaction of water vapor with uranium, we have exposed clean liquid uranium surfaces to H 2 O under UHV conditions. We have measured the surface concentration of oxygen as a function of exposure, and determined the maximum attainable surface oxygen concentration X 0 /sup s/ as a function of temperature. We have used these measurements to estimate, close to the melting point, the solubility of oxygen (X 0 /sup b/, -4 ) and its surface segregation coefficient β/sup s/(> 10 3 ). 8 refs., 5 figs., 1 tab

  1. Surface engineering glass-metal coatings designed for induction heating of ceramic components

    International Nuclear Information System (INIS)

    Khan, Amir Azam; Labbe, Jean Claude

    2014-01-01

    The term Surface Engineering is of relatively recent origin and use, however, the use of coatings and treatments to render surfaces of materials more suitable for certain application or environment is not new. With the advent of Vacuum Technology, Surface Engineering has gained a whole new impetus, whereby expensive materials with adequate mechanical, chemical and thermal properties are being coated or treated on their surfaces in order to achieve what is called as Surface Engineered materials. The present paper presents an overview of recent achievements in Surface Engineering and gives a detailed view of a specific application where glass-metal composite coatings were deposited on ceramic components in order to render them sensitive to induction heating. Sintered glaze coatings containing silver particles in appropriate concentration can be used for the induction heating of porcelain. Mixtures of glass ceramic powders with silver are used to prepare self-transfer patterns, which are deposited over porcelain. Several configurations of these coatings, which are aesthetic to start with, are employed and heating patterns are recorded. The microstructure of these coatings is discussed in relation to the heating ability by a classical household induction system. The results show that this technique is practical and commercially viable

  2. The effect of cell surface components on adhesion ability of Lactobacillus rhamnosus.

    Science.gov (United States)

    Polak-Berecka, Magdalena; Waśko, Adam; Paduch, Roman; Skrzypek, Tomasz; Sroka-Bartnicka, Anna

    2014-10-01

    The aim of this study was to analyze the cell envelope components and surface properties of two phenotypes of Lactobacillus rhamnosus isolated from the human gastrointestinal tract. The ability of the bacteria to adhere to human intestinal cells and to aggregate with other bacteria was determined. L. rhamnosus strains E/N and PEN differed with regard to the presence of exopolysaccharides (EPS) and specific surface proteins. Transmission electron microscopy showed differences in the structure of the outer cell surface of the strains tested. Bacterial surface properties were analyzed by Fourier transform infrared spectroscopy, fatty acid methyl esters and hydrophobicity assays. Aggregation capacity and adhesion of the tested strains to the human colon adenocarcinoma cell line HT29 was determined. The results indicated a high adhesion and aggregation ability of L. rhamnosus PEN, which possessed specific surface proteins, had a unique fatty acid content, and did not synthesize EPS. Adherence of L. rhamnosus was dependent on specific interactions and was promoted by surface proteins (42-114 kDa) and specific fatty acids. Polysaccharides likely hindered bacterial adhesion and aggregation by masking protein receptors. This study provides information on the cell envelope constituents of lactobacilli that influence bacterial aggregation and adhesion to intestinal cells. This knowledge will help to understand better their specific contribution in commensal-host interactions and adaptation to this ecological niche.

  3. Molecular Dynamics Simulations of Water Nanodroplets on Silica Surfaces

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Jaffe, Richard L.

    2009-01-01

    and DNA microarrays technologies.4,5,6,7,8 Although extensive experimental, theoretical and computational work has been devoted to study the nature of the interaction between silica and water,2,9-16 at the molecular level a complete understanding of silica-water systems has not been reached. Contact angle...... computations of water droplets on silica surfaces offers a useful fundamental and quantitative measurement in order to study chemical and physical properties of water-silica systems.3,16,17,18 For hydrophobic systems the static and dynamic properties of the fluid-solid interface are influenced by the presence...

  4. Impacts of thermal and chemical discharges to surface water

    International Nuclear Information System (INIS)

    Stober, Q.J.

    1974-01-01

    Various aspects of thermal and chemical discharges to surface water are outlined. The major impacts of nuclear power plants on aquatic resources are disruption during construction, intake of cooling water, discharge problems, and interactions with other water users. The following topics are included under the heading, assessment of aquatic ecology: identification of flora and fauna; abundance of aquatic organisms; species-environment relationships; and identification of pre-existing environmental stress. The following topics are included under the heading, environmental effects of plant operation: entrapment of fish by cooling water; passage of plankton through cooling system; discharge area and thermal plume; chemical effluents; and plant construction. (U.S.)

  5. Possibilities of surface waters monitoring at mining areas using UAV

    Directory of Open Access Journals (Sweden)

    Lisiecka Ewa

    2018-01-01

    Full Text Available The selected, remote measurement methods are discussed, useful for determining surface water properties using mobile unmanned aerial platforms (UAV. The possibilities of using this type of solutions in the scope of measuring spatial, physicochemical and biological parameters of both natural and anthropogenic water reservoirs, including flood polders, water-filled pits, settling tanks and mining sinks were analyzed. Methods of remote identification of the process of overgrowing this type of ecosystems with water and coastal plant formations have also been proposed.

  6. Hydraulics and drones: observations of water level, bathymetry and water surface velocity from Unmanned Aerial Vehicles

    DEFF Research Database (Denmark)

    Bandini, Filippo

    -navigable rivers and overpass obstacles (e.g. river structures). Computer vision, autopilot system and beyond visual line-of-sight (BVLOS) flights will ensure the possibility to retrieve hyper-spatial observations of water depth, without requiring the operator to access the area. Surface water speed can......The planet faces several water-related threats, including water scarcity, floods, and pollution. Satellite and airborne sensing technology is rapidly evolving to improve the observation and prediction of surface water and thus prevent natural disasters. While technological developments require....... Although UAV-borne measurements of surface water speed have already been documented in the literature, a novel approach was developed to avoid GCPs. This research is the first demonstration that orthometric water level can be measured from UAVs with a radar system and a GNSS (Global Navigation Satellite...

  7. Surface water classification and monitoring using polarimetric synthetic aperture radar

    Science.gov (United States)

    Irwin, Katherine Elizabeth

    Surface water classification using synthetic aperture radar (SAR) is an established practice for monitoring flood hazards due to the high temporal and spatial resolution it provides. Surface water change is a dynamic process that varies both spatially and temporally, and can occur on various scales resulting in significant impacts on affected areas. Small-scale flooding hazards, caused by beaver dam failure, is an example of surface water change, which can impact nearby infrastructure and ecosystems. Assessing these hazards is essential to transportation and infrastructure maintenance. With current satellite missions operating in multiple polarizations, spatio-temporal resolutions, and frequencies, a comprehensive comparison between SAR products for surface water monitoring is necessary. In this thesis, surface water extent models derived from high resolution single-polarization TerraSAR-X (TSX) data, medium resolution dual-polarization TSX data and low resolution quad-polarization RADARSAT-2 (RS-2) data are compared. There exists a compromise between acquiring SAR data with a high resolution or high information content. Multi-polarization data provides additional phase and intensity information, which makes it possible to better classify areas of flooded vegetation and wetlands. These locations are often where fluctuations in surface water occur and are essential for understanding dynamic underlying processes. However, often multi-polarized data is acquired at a low resolution, which cannot image these zones effectively. High spatial resolution, single-polarization TSX data provides the best model of open water. However, these single-polarization observations have limited information content and are affected by shadow and layover errors. This often hinders the classification of other land cover types. The dual-polarization TSX data allows for the classification of flooded vegetation, but classification is less accurate compared to the quad-polarization RS-2 data

  8. Assembling surface mounted components on ink-jet printed double sided paper circuit board

    International Nuclear Information System (INIS)

    Andersson, Henrik A; Manuilskiy, Anatoliy; Haller, Stefan; Sidén, Johan; Nilsson, Hans-Erik; Hummelgård, Magnus; Olin, Håkan; Hummelgård, Christine

    2014-01-01

    Printed electronics is a rapidly developing field where many components can already be manufactured on flexible substrates by printing or by other high speed manufacturing methods. However, the functionality of even the most inexpensive microcontroller or other integrated circuit is, at the present time and for the foreseeable future, out of reach by means of fully printed components. Therefore, it is of interest to investigate hybrid printed electronics, where regular electrical components are mounted on flexible substrates to achieve high functionality at a low cost. Moreover, the use of paper as a substrate for printed electronics is of growing interest because it is an environmentally friendly and renewable material and is, additionally, the main material used for many packages in which electronics functionalities could be integrated. One of the challenges for such hybrid printed electronics is the mounting of the components and the interconnection between layers on flexible substrates with printed conductive tracks that should provide as low a resistance as possible while still being able to be used in a high speed manufacturing process. In this article, several conductive adhesives are evaluated as well as soldering for mounting surface mounted components on a paper circuit board with ink-jet printed tracks and, in addition, a double sided Arduino compatible circuit board is manufactured and programmed. (paper)

  9. Assembling surface mounted components on ink-jet printed double sided paper circuit board.

    Science.gov (United States)

    Andersson, Henrik A; Manuilskiy, Anatoliy; Haller, Stefan; Hummelgård, Magnus; Sidén, Johan; Hummelgård, Christine; Olin, Håkan; Nilsson, Hans-Erik

    2014-03-07

    Printed electronics is a rapidly developing field where many components can already be manufactured on flexible substrates by printing or by other high speed manufacturing methods. However, the functionality of even the most inexpensive microcontroller or other integrated circuit is, at the present time and for the foreseeable future, out of reach by means of fully printed components. Therefore, it is of interest to investigate hybrid printed electronics, where regular electrical components are mounted on flexible substrates to achieve high functionality at a low cost. Moreover, the use of paper as a substrate for printed electronics is of growing interest because it is an environmentally friendly and renewable material and is, additionally, the main material used for many packages in which electronics functionalities could be integrated. One of the challenges for such hybrid printed electronics is the mounting of the components and the interconnection between layers on flexible substrates with printed conductive tracks that should provide as low a resistance as possible while still being able to be used in a high speed manufacturing process. In this article, several conductive adhesives are evaluated as well as soldering for mounting surface mounted components on a paper circuit board with ink-jet printed tracks and, in addition, a double sided Arduino compatible circuit board is manufactured and programmed.

  10. Assembling surface mounted components on ink-jet printed double sided paper circuit board

    Energy Technology Data Exchange (ETDEWEB)

    Andersson, Henrik A; Manuilskiy, Anatoliy; Haller, Stefan; Sidén, Johan; Nilsson, Hans-Erik [Department of Electronics Design, Mid Sweden University, SE-851 70 Sundsvall (Sweden); Hummelgård, Magnus; Olin, Håkan [Department of Natural Science, Mid Sweden University, SE-851 70 Sundsvall (Sweden); Hummelgård, Christine [Acreo Swedish ICT AB, Håstaholmen 4, SE-824 42 Hudiksvall (Sweden)

    2014-03-07

    Printed electronics is a rapidly developing field where many components can already be manufactured on flexible substrates by printing or by other high speed manufacturing methods. However, the functionality of even the most inexpensive microcontroller or other integrated circuit is, at the present time and for the foreseeable future, out of reach by means of fully printed components. Therefore, it is of interest to investigate hybrid printed electronics, where regular electrical components are mounted on flexible substrates to achieve high functionality at a low cost. Moreover, the use of paper as a substrate for printed electronics is of growing interest because it is an environmentally friendly and renewable material and is, additionally, the main material used for many packages in which electronics functionalities could be integrated. One of the challenges for such hybrid printed electronics is the mounting of the components and the interconnection between layers on flexible substrates with printed conductive tracks that should provide as low a resistance as possible while still being able to be used in a high speed manufacturing process. In this article, several conductive adhesives are evaluated as well as soldering for mounting surface mounted components on a paper circuit board with ink-jet printed tracks and, in addition, a double sided Arduino compatible circuit board is manufactured and programmed. (paper)

  11. Lawrence Livermore National Laboratory Surface Water Protection: A Watershed Approach

    Energy Technology Data Exchange (ETDEWEB)

    Coty, J

    2009-03-16

    This surface water protection plan (plan) provides an overview of the management efforts implemented at Lawrence Livermore National Laboratory (LLNL) that support a watershed approach to protect surface water. This plan fulfills a requirement in the Department of Energy (DOE) Order 450.1A to demonstrate a watershed approach for surface water protection that protects the environment and public health. This plan describes the use of a watershed approach within which the Laboratory's current surface water management and protections efforts have been structured and coordinated. With more than 800 million acres of land in the U.S. under federal management and stewardship, a unified approach across agencies provides enhanced resource protection and cost-effectiveness. The DOE adopted, along with other federal agencies, the Unified Federal Policy for a Watershed Approach to Federal Land and Resource Management (UFP) with a goal to protect water quality and aquatic ecosystems on federal lands. This policy intends to prevent and/or reduce water pollution from federal activities while fostering a cost-effective watershed approach to federal land and resource management. The UFP also intends to enhance the implementation of existing laws (e.g., the Clean Water Act [CWA] and National Environmental Policy Act [NEPA]) and regulations. In addition, this provides an opportunity for the federal government to serve as a model for water quality stewardship using a watershed approach for federal land and resource activities that potentially impact surface water and its uses. As a federal land manager, the Laboratory is responsible for a small but important part of those 800 million acres of land. Diverse land uses are required to support the Laboratory's mission and provide an appropriate work environment for its staff. The Laboratory comprises two sites: its main site in Livermore, California, and the Experimental Test Site (Site 300), near Tracy, California. The main site

  12. The significant surface-water connectivity of "geographically isolated wetlands"

    Science.gov (United States)

    Calhoun, Aram J.K.; Mushet, David M.; Alexander, Laurie C.; DeKeyser, Edward S.; Fowler, Laurie; Lane, Charles R.; Lang, Megan W.; Rains, Mark C.; Richter, Stephen; Walls, Susan

    2017-01-01

    We evaluated the current literature, coupled with our collective research expertise, on surface-water connectivity of wetlands considered to be “geographically isolated” (sensu Tiner Wetlands 23:494–516, 2003a) to critically assess the scientific foundation of grouping wetlands based on the singular condition of being surrounded by uplands. The most recent research on wetlands considered to be “geographically isolated” shows the difficulties in grouping an ecological resource that does not reliably indicate lack of surface water connectivity in order to meet legal, regulatory, or scientific needs. Additionally, the practice of identifying “geographically isolated wetlands” based on distance from a stream can result in gross overestimates of the number of wetlands lacking ecologically important surface-water connections. Our findings do not support use of the overly simplistic label of “geographically isolated wetlands”. Wetlands surrounded by uplands vary in function and surface-water connections based on wetland landscape setting, context, climate, and geographic region and should be evaluated as such. We found that the “geographically isolated” grouping does not reflect our understanding of the hydrologic variability of these wetlands and hence does not benefit conservation of the Nation’s diverse wetland resources. Therefore, we strongly discourage use of categorizations that provide overly simplistic views of surface-water connectivity of wetlands fully embedded in upland landscapes.

  13. Properties of water surface discharge at different pulse repetition rates

    International Nuclear Information System (INIS)

    Ruma,; Yoshihara, K.; Hosseini, S. H. R.; Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-01-01

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H 2 O 2 ) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H 2 O 2 and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  14. Amoco-US Environmental Protection Agency, pollution prevention project, Yorktown, Virginia: Surface water data

    International Nuclear Information System (INIS)

    Baloo, S.

    1991-08-01

    The report summarizes the surface water sampling program at the Amoco Refinery at Yorktown, Virginia. This was undertaken as a part of the joint project between Amoco Corporation and the United States Environmental Protection Agency to review pollution prevention alternatives at a petroleum refinery. The surface water data provides a snapshot of surface water pollutant generation and discharge from the refinery. Different process units contribute to the total wastewater flow of 460 GPM in the refinery. Water in the ditch system, which is non-process water, is free of organic contamination. Oil and grease, phenols, ammonia and sulfides are the significant components measured in the process wastewater. The concentrations of organics in most water streams leaving the individual process units are relatively low, in the 1-5 parts per million (ppm) range. A few individual streams such as the crude desalter brine and tank water draws have high pollutant loadings. Concentrations of metals in the refinery wastewater are very low. The wastewater treatment plant is very effective in reducing the pollutant loading in the water with overall removal efficiencies greater than 99% for most organics and inorganics

  15. A multivariate analysis of intrinsic soil components influencing the mean-weight diameter of water-stable aggregates

    International Nuclear Information System (INIS)

    Mbagwu, J.S.C.; Chukwu, W.I.E.

    1994-06-01

    A knowledge of the soil properties influencing the water-stability of soil aggregates is needed for selecting those more easily-determined properties that would be useful in areas where lack of facilities makes its direct determination impossible. In this laboratory study we evaluated the main soil physical, chemical and mineralogical properties influencing the stability of macro aggregates of some Italian surface soils in water. The objective is to select a subset of soil properties which predict optimally, soil aggregate stability. The index of stability used is the mean weight diameter of water-stable aggregates whereas the method of evaluation is the principal component analysis (PCA). The range in coefficients of variation (CV) among the properties was least in the physical (12.0-61.0%), medium in the mineralogical (28.0-116.2%) and highest in the chemical (8.2-110.8%) properties. The wider the range in CV in each subset of properties, the greater the number of components extracted by the PCA. The component defining variables, i.e. those with the highest loadings on each component and therefore, provide the best relationship between the variables and aggregate stability, revealed the ratio of total sand/clay and plastic limit as the significant physical properties. The significant chemical properties are Al 2 O 3 , FeO, MgO and MnO which contribute positively to aggregate stability. Feldspar, quartz and muscovite are the significant mineralogical properties each of which is negatively related to aggregate stability. These soil components are useful for developing empirical models for estimating the stability of aggregates of these soils in water. (author). 38 refs, 7 tabs

  16. Water redistribution at the soil surface : ponding and surface runoff in flat areas

    NARCIS (Netherlands)

    Appels, W.M.

    2013-01-01

    In The Netherlands, one of the most important targets for the improvement of surface water quality as aimed for in the European Water Framework Directive, is the reduction of nutrient concentrations (both nitrogen and phosphorus). To identify the most suitable and effective measures for reducing the

  17. Foulant characteristics comparison in recycling cooling water system makeup by municipal reclaimed water and surface water in power plant.

    Science.gov (United States)

    Ping, Xu; Jing, Wang; Yajun, Zhang; Jie, Wang; Shuai, Si

    2015-01-01

    Due to water shortage, municipal reclaimed water rather than surface water was replenished into recycling cooling water system in power plants in some cities in China. In order to understand the effects of the measure on carbon steel corrosion, characteristics of two kinds of foulant produced in different systems were studied in the paper. Differences between municipal reclaimed water and surface water were analyzed firstly. Then, the weight and the morphology of two kinds of foulant were compared. Moreover, other characteristics including the total number of bacteria, sulfate reducing bacteria, iron bacteria, extracellular polymeric substance (EPS), protein (PN), and polysaccharide (PS) in foulant were analyzed. Based on results, it could be concluded that microbial and corrosive risk would be increased when the system replenished by municipal reclaimed water instead of surface water.

  18. Hydrologic Science and Satellite Measurements of Surface Water (Invited)

    Science.gov (United States)

    Alsdorf, D. E.; Mognard, N. M.; Lettenmaier, D. P.

    2010-12-01

    While significant advances continue to be made for satellite measurements of surface waters, important science and application opportunities remain. Examples include the following: (1) Our current methods of measuring floodwater dynamics are either sparsely distributed or temporally inadequate. As an example, flood depths are measured by using high water marks, which capture only the peak of the flood wave, not its temporal variability. (2) Discharge is well measured at individual points along stream networks using in-situ gauges, but these do not capture within-reach hydraulic variability such as the water surface slope changes on the rising and falling limbs of flood waves. (3) Just a 1.0 mm/day error in ET over the Congo Basin translates to a 35,000 m3/s discharge error. Knowing the discharge of the Congo River and its many tributaries should significantly improve our understanding of the water balance throughout the basin. The Congo is exemplary of many other basins around the globe. (4) Arctic hydrology is punctuated by millions of unmeasured lakes. Globally, there might be as many as 30 million lakes larger than a hectare. Storage changes in these lakes are nearly unknown, but in the Arctic such changes are likely an indication of global warming. (5) Well over 100 rivers cross international boundaries, yet the sharing of water data is poor. Overcoming this helps to better manage the entire river basin while also providing a better assessment of potential water related disasters. The Surface Water and Ocean Topography (SWOT, http://swot.jpl.nasa.gov/) mission is designed to meet these needs by providing global measurements of surface water hydrodynamics. SWOT will allow estimates of discharge in rivers wider than 100m (50m goal) and storage changes in water bodies larger than 250m by 250m (and likely as small as one hectare).

  19. Regional patterns of pesticide concentrations in surface waters of New York in 1997

    Science.gov (United States)

    Phillips, P.J.; Eckhardt, D.A.; Freehafer, D.A.; Wall, G.R.; Ingleston, H.H.

    2002-01-01

    The predominant mixtures of pesticides found in New York surface waters consist of five principal components. First, herbicides commonly used on corn (atrazine, metolachlor, alachlor, cyanazine) and a herbicide degradate (deethylatrazine) were positively correlated to a corn-herbicide component, and watersheds with the highest corn-herbicide component scores were those in which large amounts of row crops are grown. Second, two insecticides (diazinon and carbaryl) and one herbicide (prometon) widely used in urban and residential settings were positively correlated to an urban/residential component. Watersheds with the highest urban/residential component scores were those with large amounts of urban and residential land use. A third component was related to two herbicides (EPTC and cyanazine) used on dry beans and corn, the fourth to an herbicide (simazine) and an insecticide (carbaryl) commonly used in orchards and vineyards, and the fifth to an herbicide (DCPA). Results of this study indicate that this approach can be used to: (1) identify common mixtures of pesticides in surface waters, (2) relate these mixtures to land use and pesticide applications, and (3) indicate regions where these mixtures of pesticides are commonly found.

  20. Impact of Water Recovery from Wastes on the Lunar Surface Mission Water Balance

    Science.gov (United States)

    Fisher, John W.; Hogan, John Andrew; Wignarajah, Kanapathipi; Pace, Gregory S.

    2010-01-01

    Future extended lunar surface missions will require extensive recovery of resources to reduce mission costs and enable self-sufficiency. Water is of particular importance due to its potential use for human consumption and hygiene, general cleaning, clothes washing, radiation shielding, cooling for extravehicular activity suits, and oxygen and hydrogen production. Various water sources are inherently present or are generated in lunar surface missions, and subject to recovery. They include: initial water stores, water contained in food, human and other solid wastes, wastewaters and associated brines, ISRU water, and scavenging from residual propellant in landers. This paper presents the results of an analysis of the contribution of water recovery from life support wastes on the overall water balance for lunar surface missions. Water in human wastes, metabolic activity and survival needs are well characterized and dependable figures are available. A detailed life support waste model was developed that summarizes the composition of life support wastes and their water content. Waste processing technologies were reviewed for their potential to recover that water. The recoverable water in waste is a significant contribution to the overall water balance. The value of this contribution is discussed in the context of the other major sources and loses of water. Combined with other analyses these results provide guidance for research and technology development and down-selection.

  1. Polysaccharide components from the scape of Musa paradisiaca: main structural features of water-soluble polysaccharide component.

    Science.gov (United States)

    Anjaneyalu, Y V; Jagadish, R L; Raju, T S

    1997-06-01

    Polysaccharide components present in the pseudo-stem (scape) of M. paradisiaca were purified from acetone powder of the scape by delignification followed by extraction with aqueous solvents into water soluble polysaccharide (WSP), EDTA-soluble polysaccharide (EDTA-SP), alkali-soluble polysaccharide (ASP) and alkali-insoluble polysaccharide (AISP) fractions. Sugar compositional analysis showed that WSP and EDTA-SP contained only D-Glc whereas ASP contained D-Glc, L-Ara and D-Xyl in approximately 1:1:10 ratio, respectively, and AISP contained D-Glc, L-Ara and D-Xyl in approximately 10:1:2 ratio, respectively. WSP was further purified by complexation with iso-amylalcohol and characterized by specific rotation, IR spectroscopy, Iodine affinity, ferricyanide number, blue value, hydrolysis with alpha-amylase and glucoamylase, and methylation linkage analysis, and shown to be a amylopectin type alpha-D-glucan.

  2. Macroelements in the surface microlayer of water of urban ponds

    Directory of Open Access Journals (Sweden)

    Antonowicz Józef Piotr

    2016-03-01

    Full Text Available Analyses were conducted concerning the accumulation of four metals representing the group of macroelements, i.e. sodium, potassium, calcium and magnesium in two ponds located in the city of Słupsk. Water samples for chemical analyses were collected from the surface microlayer using a Garrett net. At the same time subsurface water samples were collected. Concentrations of metals were determined using a mass spectrometer. Generally, amounts of sodium, potassium, calcium and magnesium were similar in surface microlayer and subsurface water. Only in the case of potassium and calcium was low enrichment observed in the surface microlayer in one pond, while the greatest extent for magnesium enrichment was observed in the spring period.

  3. Wavefront modulation of water surface wave by a metasurface

    International Nuclear Information System (INIS)

    Sun Hai-Tao; Cheng Ying; Liu Xiao-Jun; Wang Jing-Shi

    2015-01-01

    We design a planar metasurface to modulate the wavefront of a water surface wave (WSW) on a deep sub-wavelength scale. The metasurface is composed of an array of coiling-up-space units with specially designed parameters, and can take on the work of steering the wavefront when it is pierced into water. Like their acoustic counterparts, the modulation of WSW is ascribed to the gradient phase shift of the coiling-up-space units, which can be perfectly tuned by changing the coiling plate length and channel number inside the units. According to the generalized Snell’s law, negative refraction and ‘driven’ surface mode of WSW are also demonstrated at certain incidences. Specially, the transmitted WSW could be efficiently guided out by linking a symmetrically-corrugated channel in ‘driven’ surface mode. This work may have potential applications in water wave energy extraction and coastal protection. (paper)

  4. Lactic acid bacteria in dairy food: surface characterization and interactions with food matrix components.

    Science.gov (United States)

    Burgain, J; Scher, J; Francius, G; Borges, F; Corgneau, M; Revol-Junelles, A M; Cailliez-Grimal, C; Gaiani, C

    2014-11-01

    This review gives an overview of the importance of interactions occurring in dairy matrices between Lactic Acid Bacteria and milk components. Dairy products are important sources of biological active compounds of particular relevance to human health. These compounds include immunoglobulins, whey proteins and peptides, polar lipids, and lactic acid bacteria including probiotics. A better understanding of interactions between bioactive components and their delivery matrix may successfully improve their transport to their target site of action. Pioneering research on probiotic lactic acid bacteria has mainly focused on their host effects. However, very little is known about their interaction with dairy ingredients. Such knowledge could contribute to designing new and more efficient dairy food, and to better understand relationships between milk constituents. The purpose of this review is first to provide an overview of the current knowledge about the biomolecules produced on bacterial surface and the composition of the dairy matter. In order to understand how bacteria interact with dairy molecules, adhesion mechanisms are subsequently reviewed with a special focus on the environmental conditions affecting bacterial adhesion. Methods dedicated to investigate the bacterial surface and to decipher interactions between bacteria and abiotic dairy components are also detailed. Finally, relevant industrial implications of these interactions are presented and discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Thermographic analysis of plasma facing components covered by carbon surface layer in tokamaks

    International Nuclear Information System (INIS)

    Gardarein, Jean-Laurent

    2007-01-01

    Tokamaks are reactors based on the thermonuclear fusion energy with magnetic confinement of the plasma. In theses machines, several MW are coupled to the plasma for about 10 s. A large part of this power is directed towards plasma facing components (PFC). For better understanding and control the heat flux transfer from the plasma to the surrounding wall, it is very important to measure the surface temperature of the PFC and to estimate the imposed heat flux. In most of tokamaks using carbon PFC, the eroded carbon is circulating in the plasma and redeposited elsewhere. During the plasma operations, this leads at some locations to the formation of thin or thick carbon layers usually poorly attached to the PFC. These surface layers with unknown thermal properties complicate the calculation of the heat flux from IR surface temperature measurements. To solve this problem, we develop first, inverse method to estimate the heat flux using thermocouple (not sensitive to the carbon surface layers) temperature measurements. Then, we propose a front face pulsed photothermal method allowing an estimation of layers thermal diffusivity, conductivity, effusivity and the thermal contact resistance between the layer and the tile. The principle is to study with an infrared sensor, the cooling of the layer surface after heating by a short laser pulse, this cooling depending on the thermal properties of the successive layers. (author) [fr

  6. Reliability analysis of nuclear component cooling water system using semi-Markov process model

    International Nuclear Information System (INIS)

    Veeramany, Arun; Pandey, Mahesh D.

    2011-01-01

    Research highlights: → Semi-Markov process (SMP) model is used to evaluate system failure probability of the nuclear component cooling water (NCCW) system. → SMP is used because it can solve reliability block diagram with a mixture of redundant repairable and non-repairable components. → The primary objective is to demonstrate that SMP can consider Weibull failure time distribution for components while a Markov model cannot → Result: the variability in component failure time is directly proportional to the NCCW system failure probability. → The result can be utilized as an initiating event probability in probabilistic safety assessment projects. - Abstract: A reliability analysis of nuclear component cooling water (NCCW) system is carried out. Semi-Markov process model is used in the analysis because it has potential to solve a reliability block diagram with a mixture of repairable and non-repairable components. With Markov models it is only possible to assume an exponential profile for component failure times. An advantage of the proposed model is the ability to assume Weibull distribution for the failure time of components. In an attempt to reduce the number of states in the model, it is shown that usage of poly-Weibull distribution arises. The objective of the paper is to determine system failure probability under these assumptions. Monte Carlo simulation is used to validate the model result. This result can be utilized as an initiating event probability in probabilistic safety assessment projects.

  7. Surface conditioning with Escherichia coli cell wall components can reduce biofilm formation by decreasing initial adhesion

    Directory of Open Access Journals (Sweden)

    Luciana C. Gomes

    2017-07-01

    Full Text Available Bacterial adhesion and biofilm formation on food processing surfaces pose major risks to human health. Non-efficient cleaning of equipment surfaces and piping can act as a conditioning layer that affects the development of a new biofilm post-disinfection. We have previously shown that surface conditioning with cell extracts could reduce biofilm formation. In the present work, we hypothesized that E. coli cell wall components could be implicated in this phenomena and therefore mannose, myristic acid and palmitic acid were tested as conditioning agents. To evaluate the effect of surface conditioning and flow topology on biofilm formation, assays were performed in agitated 96-well microtiter plates and in a parallel plate flow chamber (PPFC, both operated at the same average wall shear stress (0.07 Pa as determined by computational fluid dynamics (CFD. It was observed that when the 96-well microtiter plate and the PPFC were used to form biofilms at the same shear stress, similar results were obtained. This shows that the referred hydrodynamic feature may be a good scale-up parameter from high-throughput platforms to larger scale flow cell systems as the PPFC used in this study. Mannose did not have any effect on E. coli biofilm formation, but myristic and palmitic acid inhibited biofilm development by decreasing cell adhesion (in about 50%. These results support the idea that in food processing equipment where biofilm formation is not critical below a certain threshold, bacterial lysis and adsorption of cell components to the surface may reduce biofilm buildup and extend the operational time.

  8. Integrated Modeling of Groundwater and Surface Water Interactions in a Manmade Wetland

    Directory of Open Access Journals (Sweden)

    Guobiao Huang Gour-Tsyh Yeh

    2012-01-01

    Full Text Available A manmade pilot wetland in south Florida, the Everglades Nutrient Removal (ENR project, was modeled with a physics-based integrated approach using WASH123D (Yeh et al. 2006. Storm water is routed into the treatment wetland for phosphorus removal by plant and sediment uptake. It overlies a highly permeable surficial groundwater aquifer. Strong surface water and groundwater interactions are a key component of the hydrologic processes. The site has extensive field measurement and monitoring tools that provide point scale and distributed data on surface water levels, groundwater levels, and the physical range of hydraulic parameters and hydrologic fluxes. Previous hydrologic and hydrodynamic modeling studies have treated seepage losses empirically by some simple regression equations and, only surface water flows are modeled in detail. Several years of operational data are available and were used in model historical matching and validation. The validity of a diffusion wave approximation for two-dimensional overland flow (in the region with very flat topography was also tested. The uniqueness of this modeling study is notable for (1 the point scale and distributed comparison of model results with observed data; (2 model parameters based on available field test data; and (3 water flows in the study area include two-dimensional overland flow, hydraulic structures/levees, three-dimensional subsurface flow and one-dimensional canal flow and their interactions. This study demonstrates the need and the utility of a physics-based modeling approach for strong surface water and groundwater interactions.

  9. The sign, magnitude and potential drivers of change in surface water extent in Canadian tundra

    Science.gov (United States)

    Carroll, Mark L.; Loboda, Tatiana V.

    2018-04-01

    The accelerated rate of warming in the Arctic has considerable implications for all components of ecosystem functioning in the High Northern Latitudes. Changes to hydrological cycle in the Arctic are particularly complex as the observed and projected warming directly impacts permafrost and leads to variable responses in surface water extent which is currently poorly characterized at the regional scale. In this study we take advantage of the 30 plus years of medium resolution (30 m) Landsat data to quantify the spatial patterns of change in the extent of water bodies in the Arctic tundra in Nunavut, Canada. Our results show a divergent pattern of change—growing surface water extent in the north-west and shrinking in the south-east—which is not a function of the overall distribution of surface water in the region. The observed changes cannot be explained by latitudinal stratification, nor is it explained by available temperature and precipitation records. However, the sign of change appears to be consistent within the boundaries of individual watersheds defined by the Canada National Hydro Network based on the random forest analysis. Using land cover maps as a proxy for ecological function we were able to link shrinking tundra water bodies to substrates with shallow soil layers (i.e. bedrock and barren landscapes) with a moderate correlation (R 2 = 0.46, p evaporation as an important driver of surface water decrease in these cases.

  10. Development of the interactive model between Component Cooling Water System and Containment Cooling System using GOTHIC

    International Nuclear Information System (INIS)

    Byun, Choong Sup; Song, Dong Soo; Jun, Hwang Yong

    2006-01-01

    In a design point of view, component cooling water (CCW) system is not full-interactively designed with its heat loads. Heat loads are calculated from the CCW design flow and temperature condition which is determined with conservatism. Then the CCW heat exchanger is sized by using total maximized heat loads from above calculation. This approach does not give the optimized performance results and the exact trends of CCW system and the loads during transient. Therefore a combined model for performance analysis of containment and the component cooling water(CCW) system is developed by using GOTHIC software code. The model is verified by using the design parameters of component cooling water heat exchanger and the heat loads during the recirculation mode of loss of coolant accident scenario. This model may be used for calculating the realistic containment response and CCW performance, and increasing the ultimate heat sink temperature limits

  11. Surface inspection system for industrial components based on shape from shading minimization approach

    Science.gov (United States)

    Kotan, Muhammed; Öz, Cemil

    2017-12-01

    An inspection system using estimated three-dimensional (3-D) surface characteristics information to detect and classify the faults to increase the quality control on the frequently used industrial components is proposed. Shape from shading (SFS) is one of the basic and classic 3-D shape recovery problems in computer vision. In our application, we developed a system using Frankot and Chellappa SFS method based on the minimization of the selected basis function. First, the specialized image acquisition system captured the images of the component. To eliminate noise, wavelet transform is applied to the taken images. Then, estimated gradients were used to obtain depth and surface profiles. Depth information was used to determine and classify the surface defects. Also, a comparison made with some linearization-based SFS algorithms was discussed. The developed system was applied to real products and the results indicated that using SFS approaches is useful and various types of defects can easily be detected in a short period of time.

  12. Identification of Aspergillus fumigatus Surface Components That Mediate Interaction of Conidia and Hyphae With Human Platelets.

    Science.gov (United States)

    Rambach, Günter; Blum, Gerhard; Latgé, Jean-Paul; Fontaine, Thierry; Heinekamp, Thorsten; Hagleitner, Magdalena; Jeckström, Hanna; Weigel, Günter; Würtinger, Philipp; Pfaller, Kristian; Krappmann, Sven; Löffler, Jürgen; Lass-Flörl, Cornelia; Speth, Cornelia

    2015-10-01

    Platelets were recently identified as a part of innate immunity. They are activated by contact with Aspergillus fumigatus; putative consequences include antifungal defense but also thrombosis, excessive inflammation, and thrombocytopenia. We aimed to identify those fungal surface structures that mediate interaction with platelets. Human platelets were incubated with Aspergillus conidia and hyphae, isolated wall components, or fungal surface mutants. Interaction was visualized microscopically; activation was quantified by flow cytometry of specific markers. The capacity of A. fumigatus conidia to activate platelets is at least partly due to melanin, because this effect can be mimicked with "melanin ghosts"; a mutant lacking melanin showed reduced platelet stimulating potency. In contrast, conidial hydrophobin masks relevant structures, because an A. fumigatus mutant lacking the hydrophobin protein induced stronger platelet activation than wild-type conidia. A. fumigatus hyphae also contain surface structures that interact with platelets. Wall proteins, galactomannan, chitin, and β-glucan are not the relevant hyphal components; instead, the recently identified fungal polysaccharide galactosaminogalactan potently triggered platelet activation. Conidial melanin and hydrophobin as well as hyphal galactosaminogalactan represent important pathogenicity factors that modulate platelet activity and thus might influence immune responses, inflammation, and thrombosis in infected patients. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Molecular Dynamics Studies of Overbased Detergents on a Water Surface.

    Science.gov (United States)

    Bodnarchuk, M S; Dini, D; Heyes, D M; Breakspear, A; Chahine, S

    2017-07-25

    Molecular dynamics (MD) simulations are reported of model overbased detergent nanoparticles on a model water surface which mimic their behavior on a Langmuir trough or large water droplet in engine oil. The simulations predict that the structure of the nanoparticle on a water surface is different to when it is immersed in a bulk hydrophobic solvent. The surfactant tails are partly directed out of the water, while the carbonate core maximizes its extent of contact with the water. Umbrella sampling calculations of the potential of mean force between two particles showed that they are associated with varying degrees with a maximum binding free energy of ca. 10 k B T for the salicylate stabilized particle, ca. 8 k B T for a sulfurized alkyl phenate stabilized particle, and ca. 5 k B T for a sulfonate stabilized particle. The differences in the strength of attraction depend on the proximity of nearest approach and the energy penalty associated with the disruption of the hydration shell of water molecules around the calcium carbonate core when the two particles approach. This is greatest for the sulfonate particle, which partially loses the surfactant ions to the solution, and least for the salicylate, which forms the weakest water "cage". The particles are separated by a water hydration layer, even at the point of closest approach.

  14. Spring and surface water quality of the Cyprus ophiolites

    Directory of Open Access Journals (Sweden)

    C. Neal

    2002-01-01

    Full Text Available A survey of surface, spring and borehole waters associated with the ophiolite rocks of Cyprus shows five broad water types (1 Mg-HCO3, (2 Na-SO4-Cl-HCO3, (3 Na-Ca-Cl-SO4-OH-CO3, (4 Na-Cl-SO4 and (5 Ca-SO4. The waters represent a progression in chemical reactivity from surface waters that evolve within a groundwater setting due to hydrolysis of the basic/ultrabasic rock as modified by CO2-weathering. An increase in salinity is also observed which is due to mixing with a saline end-member (modified sea-water and dissolution of gypsum/anhydrite. In some cases, the waters have pH values greater than 11. Such high values are associated with low temperature serpentinisation reactions. The system is a net sink for CO2. This feature is related not only to the hydrolysis of the primary minerals in the rock, but also to CaCO3 or Ca-Mg-CO3 solubility controls. Under hyperalkaline conditions, virtually all the carbon dioxide is lost from the water due to the sufficiently high calcium levels and carbonate buffering is then insignificant. Calcium sulphate solubility controls may also be operative when calcium and sulphate concentrations are particularly high. Keywords: Cyprus, Troodos, ophiolite, serpentinisation, spring, stream, water quality, bromide, iodine, boron, trace elements, hyperalkaline.

  15. Modification of surface properties of LLDPE by water plasma discharge

    International Nuclear Information System (INIS)

    Chantara Thevy Ratnam; Hill, D.J.T.; Firas Rasoul; Whittaker, A.K.; Imelda Keen

    2007-01-01

    Linear low density polyethylene (LLDPE) surface was modified by water plasma treatment. The LLDPE surface was treated at 10 and 20 W discharge power at various exposure times. A laboratory scale Megatherm radio frequency (RF) plasma apparatus that operates at 27 MHz was used to generate the water plasmas. The changes in chemical structure of the LLDPE polymeric chain upon plasma treatment were characterized by FTIR and XPS techniques. The selectivity of trifluoroacetic anhydride (TFAA) toward hydroxyl groups is used to quantify the hydroxyl groups formed on the polymer surface upon plasma treatment. After exposition to the plasma discharge a decline in water contact angle were observed. FTIR and XPS measurements indicate an oxidation of degraded polymeric chains and creation of hydroxyl, carbonyl, ether, ester and carboxyl groups. Chemical derivatization with TFAA of water plasma treated polymer surfaces has shown that under the conditions employed, a very small (less than 5%) of the oxygen introduced by the water plasma treatment was present as hydroxyl group. (Author)

  16. Characteristics of pulse corona discharge over water surface

    Science.gov (United States)

    Fujii, Tomio; Arao, Yasushi; Rea, Massimo

    2008-12-01

    Production of ozone and OH radical is required to advance the plasma chemical reactions in the NOx removal processes for combustion gas treatment. The corona discharge to the water surface is expected to induce the good conditions for the proceeding of the NO oxidation and the NO2 dissolution removal into water. In order to get the fundamental data of the corona discharge over the water surface, the positive and negative V-I characteristics and the ozone production were measured with the multi needle and the saw-edge type of the discharge electrodes. The pulse corona characteristics were also measured with some different waveforms of the applied pulse voltage. The experiments were carried out under the atmospheric pressure and room temperature. Both the DC and the pulse corona to the water surface showed a stable and almost the same V-I characteristics as to plate electrodes though the surface of water was waved by corona wind. The positive streamer corona showed more ozone production than the negative one both in the DC and in the pulse corona.

  17. Modeling global distribution of agricultural insecticides in surface waters

    International Nuclear Information System (INIS)

    Ippolito, Alessio; Kattwinkel, Mira; Rasmussen, Jes J.; Schäfer, Ralf B.; Fornaroli, Riccardo; Liess, Matthias

    2015-01-01

    Agricultural insecticides constitute a major driver of animal biodiversity loss in freshwater ecosystems. However, the global extent of their effects and the spatial extent of exposure remain largely unknown. We applied a spatially explicit model to estimate the potential for agricultural insecticide runoff into streams. Water bodies within 40% of the global land surface were at risk of insecticide runoff. We separated the influence of natural factors and variables under human control determining insecticide runoff. In the northern hemisphere, insecticide runoff presented a latitudinal gradient mainly driven by insecticide application rate; in the southern hemisphere, a combination of daily rainfall intensity, terrain slope, agricultural intensity and insecticide application rate determined the process. The model predicted the upper limit of observed insecticide exposure measured in water bodies (n = 82) in five different countries reasonably well. The study provides a global map of hotspots for insecticide contamination guiding future freshwater management and conservation efforts. - Highlights: • First global map on insecticide runoff through modelling. • Model predicts upper limit of insecticide exposure when compared to field data. • Water bodies in 40% of global land surface may be at risk of adverse effects. • Insecticide application rate, terrain slope and rainfall main drivers of exposure. - We provide the first global map on insecticide runoff to surface water predicting that water bodies in 40% of global land surface may be at risk of adverse effects

  18. Characteristics of pulse corona discharge over water surface

    International Nuclear Information System (INIS)

    Fujii, Tomio; Arao, Yasushi; Rea, Massimo

    2008-01-01

    Production of ozone and OH radical is required to advance the plasma chemical reactions in the NOx removal processes for combustion gas treatment. The corona discharge to the water surface is expected to induce the good conditions for the proceeding of the NO oxidation and the NO 2 dissolution removal into water. In order to get the fundamental data of the corona discharge over the water surface, the positive and negative V-I characteristics and the ozone production were measured with the multi needle and the saw-edge type of the discharge electrodes. The pulse corona characteristics were also measured with some different waveforms of the applied pulse voltage. The experiments were carried out under the atmospheric pressure and room temperature. Both the DC and the pulse corona to the water surface showed a stable and almost the same V-I characteristics as to plate electrodes though the surface of water was waved by corona wind. The positive streamer corona showed more ozone production than the negative one both in the DC and in the pulse corona.

  19. Volatile organic components migrating from plastic pipes (HDPE, PEX and PVC) into drinking water.

    Science.gov (United States)

    Skjevrak, Ingun; Due, Anne; Gjerstad, Karl Olav; Herikstad, Hallgeir

    2003-04-01

    High-density polyethylene pipes (HDPE), crossbonded polyethylene pipes (PEX) and polyvinyl chloride (PVC) pipes for drinking water were tested with respect to migration of volatile organic components (VOC) to water. The odour of water in contact with plastic pipes was assessed according to the quantitative threshold odour number (TON) concept. A major migrating component from HDPE pipes was 2,4-di-tert-butyl-phenol (2,4-DTBP) which is a known degradation product from antioxidants such as Irgafos 168(R). In addition, a range of esters, aldehydes, ketones, aromatic hydrocarbons and terpenoids were identified as migration products from HDPE pipes. Water in contact with HDPE pipes was assessed with respect to TON, and values > or =4 were determined for five out of seven brands of HDPE pipes. The total amount of VOC released to water during three successive test periods were fairly constant for the HDPE pipes. Corresponding migration tests carried out for PEX pipes showed that VOC migrated in significant amounts into the test water, and TON >/=5 of the test water were observed in all tests. Several of the migrated VOC were not identified. Oxygenates predominated the identified VOC in the test water from PEX pipes. Migration tests of PVC pipes revealed few volatile migrants in the test samples and no significant odour of the test water.

  20. Application of the regulations on pressurized components or light water reactor primary coolant circuits

    International Nuclear Information System (INIS)

    Barthelemy, F.; Menjon, G.

    1977-01-01

    This paper describes the philosophy and the provisions of the Order of 26 February 1974 concerning application of the regulations on pressurized components for light water reactor steam supply systems. The aim is to show how these regulations which differ from other regulations on pressurized components and is more detailed on many points, is applied in practice in France in the various stages of the design, construction and operation of PWRs. (NEA) [fr

  1. Managing Water for African Cities Johannesburg City Implementation Plan Environmental Component Appraisal Report

    OpenAIRE

    Damhaug, T.

    2000-01-01

    Årsliste 2000 This is an appraisal of the environmental component of the Johannesburg City Implementation Plan under the Habitat guided programme "Managing Water for African Cities". The objective of this appraisal was to ensure the conformity of the plan with the objectives of the Regional Project and South Africa's needs and to explore the availability of domestic resources (human, institutional, and financial) required for efficient project implementation. The environmental component wi...

  2. Integrated-Optics Components Utilizing Long-Range Surface Plasmon Polaritons

    DEFF Research Database (Denmark)

    Boltasseva, Alexandra

    2004-01-01

    This thesis describes a new class of components for integrated optics, based on the propagation of long-range surface plasmon polaritons (LR-SPPs) along metal stripes embedded in a dielectric. These novel components can provide guiding of light as well as coupling and splitting from/into a number...... with experimental results is obtained. The interaction of LR-SPPs with photonic crystals (PCs) is also studied. The PC structures are formed by periodic arrays of gold bumps that are arranged in a triangular lattice and placed symmetrically on both sides of a thin gold film. The LR-SPP transmission through...... of channels with good performance. Guiding of LR-SPPs along nm-thin and µm-wide gold stripes embedded in polymer is investigated in the wavelength range of 1250 – 1650 nm. LR-SPP guiding properties, such as the propagation loss and mode field diameter, are studied for different stripe widths and thicknesses...

  3. Studies Concerning Water-Surface Deposits in Recovery Boilers

    Energy Technology Data Exchange (ETDEWEB)

    Strandberg, O; Arvesen, J; Dahl, L

    1971-11-15

    The Feed-water Committee of the Stiftelsen Svensk Cellulosaforskning (Foundation for Swedish Cellulose Research) has initiated research and investigations which aim to increase knowledge about water-surface deposits in boiler tubes, and the resulting risks of gas-surface corrosion in chemical recovery boilers (sulphate pulp industry). The Committee has arranged with AB Atomenergi, Studsvik, for investigations into the water-surface deposits on tubes from six Scandinavian boilers. These investigations have included direct measurements of the thermal conductivity of the deposits, and determinations of their quantity, thickness and structure have been carried out. Previous investigations have shown that gas-surface corrosion can occur at tube temperatures above 330 deg C. The measured values for the thermal conductivity of the deposits indicate that even with small quantities of deposit (c. 1 g/dm2 ) and a moderate boiler pressure (40 atm), certain types of deposit can give rise to the above-mentioned surface temperature, at which the risk of gas-surface corrosion becomes appreciable. For higher boiler pressures the risk is great even with a minimal layer of deposit. The critical deposit thickness can be as low as 0.1 mm

  4. Capacity building in water demand management as a key component for attaining millennium development goals

    Science.gov (United States)

    Gumbo, Bekithemba; Forster, Laura; Arntzen, Jaap

    Successful water demand management (WDM) implementation as a component of integrated water resource management (IWRM) can play a significant role in the alleviation of poverty through more efficient use of available water resources. The urban population in Southern African cities is characterised by so-called ‘water poor’ communities who typically expend a high percentage of their household income on poor quality water. Usually they have no access to an affordable alternative source. Although WDM as a component of IWRM is not a panacea for poverty, it can help alleviate poverty by facilitating water services management by municipal water supply agencies (MWSAs) in the region. WDM is a key strategy for achieving the millennium development goals (MDGs) and, as such, should be given due attention in the preparation of national IWRM and water efficiency plans. Various studies in the Southern African region have indicated that capacity building is necessary for nations to develop IWRM and water-use efficiency plans to meet the targets set out in the MDGs. WDM education and training of water professionals and end-users is particularly important in developing countries, which are resource and information-access poor. In response to these findings, The World Conservation Union (IUCN) and its consulting partners, the Training and Instructional Design Academy of South Africa (TIDASA), and Centre for Applied Research (CAR) designed, developed and presented a pilot WDM Guideline Training Module for MWSAs as part of Phase II of IUCN’s Southern Africa regional WDM project. Pilot training was conducted in July 2004 in Lusaka, Zambia for a group of 36 participants involved in municipal water supply from nine Southern African countries. This paper looks at the links between building the capacity of professionals, operational staff and other role-players in the municipal water supply chain to implement WDM as part of broader IWRM strategies, and the subsequent potential for

  5. Water footprint components required to address the water-energy-food nexus, with the recent Urban Water Atlas for Europe as an example

    Science.gov (United States)

    Vanham, Davy

    2017-04-01

    The first part of this presentation analyses which water footprint (WF) components are necessary in WF accounting to provide relevant information to address the Sustainable Development Goals (SDG's) water security (SDG 6), food security (SDG 2) and energy security (SDG 7) in a nexus setting. It is strongly based on the publication Vanham (2016) http://dx.doi.org/10.1016/j.ecoser.2015.08.003. First, the nexus links between (1) the planetary boundary freshwater resources (green and blue water resources) and (2) food, energy and blue water security are discussed. Second, it is shown which water uses are mostly represented in WF accounting. General water management and WF studies only account for the water uses agriculture, industry and domestic water. Important water uses are however mostly not identified as separate entities or even included, i.e. green and blue water resources for aquaculture, wild foods, biofuels, hydroelectric cooling, hydropower, recreation/tourism, forestry (for energy and other biomass uses) and navigation. Third, therefore a list of essential separate components to be included within WF accounting is presented. The latter would be more coherent with the water-food-energy-ecosystem nexus. The second part of the presentation gives a brief overview of the recently published Urban Water Atlas for Europe. It shows for a selected city which WF components are represented and which not. As such, it also identifies research gaps.

  6. Application of principal component regression and partial least squares regression in ultraviolet spectrum water quality detection

    Science.gov (United States)

    Li, Jiangtong; Luo, Yongdao; Dai, Honglin

    2018-01-01

    Water is the source of life and the essential foundation of all life. With the development of industrialization, the phenomenon of water pollution is becoming more and more frequent, which directly affects the survival and development of human. Water quality detection is one of the necessary measures to protect water resources. Ultraviolet (UV) spectral analysis is an important research method in the field of water quality detection, which partial least squares regression (PLSR) analysis method is becoming predominant technology, however, in some special cases, PLSR's analysis produce considerable errors. In order to solve this problem, the traditional principal component regression (PCR) analysis method was improved by using the principle of PLSR in this paper. The experimental results show that for some special experimental data set, improved PCR analysis method performance is better than PLSR. The PCR and PLSR is the focus of this paper. Firstly, the principal component analysis (PCA) is performed by MATLAB to reduce the dimensionality of the spectral data; on the basis of a large number of experiments, the optimized principal component is extracted by using the principle of PLSR, which carries most of the original data information. Secondly, the linear regression analysis of the principal component is carried out with statistic package for social science (SPSS), which the coefficients and relations of principal components can be obtained. Finally, calculating a same water spectral data set by PLSR and improved PCR, analyzing and comparing two results, improved PCR and PLSR is similar for most data, but improved PCR is better than PLSR for data near the detection limit. Both PLSR and improved PCR can be used in Ultraviolet spectral analysis of water, but for data near the detection limit, improved PCR's result better than PLSR.

  7. Scenario forecasting changes in the water balance components of the Olenek and Iindigirka river basins due to possible climate change

    Directory of Open Access Journals (Sweden)

    Ye. M. Gusev

    2015-06-01

    Full Text Available Scenario projections of the dynamics of meteorological characteristics for the basins of the Olenek and Indigirka rivers (the Republic of Sakha in the XXI century have been obtained for four IPCC global climate change scenarios of SRES family which correspond to specified scenarios of economic, technological, political, and demographic development of human civilization. The projections have been used to calculate scenarios of possible changes in water balance components for the basins under consideration up to the year of 2063. The calculation procedure involves a physically-based model for heat and mass exchange between the land surface and the atmosphere SWAP and climate scenario generator MAGICC/SCENGEN.

  8. Channel Storage change: a new remote sensed surface water measurement

    Science.gov (United States)

    Coss, S. P.; Durand, M. T.; Yi, Y.; Guo, Q.; Shum, C. K.; Allen, G. H.; Pavelsky, T.

    2017-12-01

    Here we present river channel storage change (CSC) measurements for 17 major world rivers from 2002-2016. We combined interpolated daily 1 km resolution Global River Radar Altimeter Time Series (GRRATS) river surface elevation data with static widths from the global river Global River Widths from Landsat (GRWL) dataset, to generate preliminary channel storage measurements. CSC is a previously unmeasured component of the terrestrial water balance It is a fundamental Earth science quantity with global bearing on floodplains, ecology, and geochemistry. CSC calculations require only remote sensed data, making them an ideal tool for studying remote regions where hydrological data is not easily accessible. CSC is uniquely suited to determine the role of hydrologic and hydraulic controls in basins with strong seasonal cycles (freeze-up and break-up). The cumulative CSC anomaly can impart spatial details that discharge measurements cannot. With this new measurement, we may be able to determine critical hydrological and hydraulic controls on rapidly changing systems like Arctic rivers. Results for Mississippi River indicate that peak CSC anomaly was the highest in 2011 (12.6 km3) and minimum CSC anomaly was in 2012 (-12.2 km3). Peak CSC has most frequently occurs in May (5 years), but has come as late in the year as July, and as early as January. Results for the Yukon River indicate that peak CSC anomaly was the highest in 2013 (13.9 km3) and minimum CSC anomaly was in 2010 (-14.2 km3). Peak CSC has most frequently come in early to mid-June (4-18), but has occurred in May (19-31) four years in the study period (three of the last 6 years) and once on April 30th.

  9. Water and nutrient budgets at field and regional scale : travel times of drainage water and nutrient loads to surface water

    NARCIS (Netherlands)

    Eertwegh, van den G.A.P.H.

    2002-01-01

    Keywords : water and nutrient budget, travel time of drainage water, dual-porosity concept, agricultural nutrient losses, loads to surface water, field-scale experiments, regional-scale

  10. Need and trends of volumetric tests in recurring inspection of pressurized components in pressurized water reactors

    International Nuclear Information System (INIS)

    Bergemann, W.

    1982-01-01

    On the basis of the types of stress occurring in nuclear power plants and of practical results it has been shown that cracks in primary circuit components arise due to operating stresses in both the materials surfaces and the bulk of the materials. For this reason, volumetric materials testing is necessary in addition to surface testing. An outlook is given on the trends of volumetric testing. (author)

  11. Theoretical Insight of Physical Adsorption for a Single-Component Adsorbent + Adsorbate System: I. Thermodynamic Property Surfaces

    KAUST Repository

    Chakraborty, Anutosh

    2009-02-17

    Thermodynamic property surfaces for a single-component adsorbent + adsorbate system are derived and developed from the viewpoint of classical thermodynamics, thermodynamic requirements of chemical equilibrium, Gibbs law, and Maxwell relations. They enable us to compute the entropy and enthalpy of the adsorbed phase, the isosteric heat of adsorption, specific heat capacity, and the adsorbed phase volume thoroughly. These equations are very simple and easy to handle for calculating the energetic performances of any adsorption system. We have shown here that the derived thermodynamic formulations fill up the information gap with respect to the state of adsorbed phase to dispel the confusion as to what is the actual state of the adsorbed phase. We have also discussed and established the temperature-entropy diagrams of (i) CaCl 2-in-silica gel + water system for cooling applications, and (ii) activated carbon (Maxsorb III) + methane system for gas storage. © Copyright 2009 American Chemical Society.

  12. Delay of turbulent by surface heating in water

    International Nuclear Information System (INIS)

    Arakeri, V.H.

    1980-01-01

    Boundary layer flow visualization studies in water on a 1.5 cal tangent ogive body with surface heating are reported. Existing laminar boundary layer separation was observed to be eliminated with sufficient surface heating. In addition, transition location was observed to be significantly delayed. With surface temperature difference of about 27 0 C no disturbances in the boundary layer could be detected up to (X/D) = 2.5 as compared to observed transition at about (X/D) = 1.32 under slightly heated conditions. Present observations are found to be in agreement with the theoretical computations of Wazzan et al. in a qualitative sense. (orig.)

  13. A study on the establishment of component/equipment performance criteria considering Heavy Water Reactor characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Keun Sun; Kwon, Young Chul; Lee, Min Kyu; Lee, Yun Soo [Sunmoon Univ., Asan (Korea, Republic of); Chang, Seong Hoong; Ryo, Chang Hyun [Korea Advanced Institute of Science and Technology, Taejon (Korea, Republic of); Kim, Soong Pyung; Hwnag, Jung Rye; Chung, Chul Kee [Chosun Univ., Gwangju (Korea, Republic of)

    2002-03-15

    Foreign and domestic technology trends, regulatory requirements, design and researches for heavy water reactors are analyzed. Safety design guides of Canada industry and regulatory documents and consultative documents of Canada regulatory agency are reviewed. Applicability of MOST guidance 16 Revision 'guidance for technical criteria of nuclear reactor facility' is reviewed. Specific performance criteria are established for components and facilities for heavy water reactor.

  14. Nanofiltration in Transforming Surface Water into Healthy Water: Comparison with Reverse Osmosis

    Directory of Open Access Journals (Sweden)

    L. D. Naidu

    2015-01-01

    Full Text Available The natural surface water, especially available through rivers, is the main source of healthy water for the living beings throughout the world from ancient days as it consists of all essential minerals. With the advent of industrialization, gradually even the most prominent rivers have been polluted in all parts of the world. Although there are lots of technologies, nanofiltration (NF has been chosen to transform river water into healthy water due to its unique advantages of retaining optimum TDS (with essential minerals required for human body, consuming of lower energy, and no usage of any chemicals. The prominent parameters of surface water and macro/microminerals of treated water have been analyzed. It is shown that NF is better in producing healthy water with high flux by consuming low energy.

  15. Molecular Dynamics Simulations of Water Droplets On Hydrophilic Silica Surfaces

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Jaffe, Richard L.

    2009-01-01

    and DNA microarrays technologies.Although extensive experimental, theoretical and computational work has been devoted to study the nature of the interaction between silica and water, at the molecular level a complete understanding of silica-water systems has not been reached. Contact angle computations...... dynamics (MD) simulations of a hydrophilic air-water-silica system using the MD package FASTTUBE. We employ quantum chemistry calculation to obtain air-silica interaction parameters for the simulations. Our simulations are based in the following force fields: i) The silica-silica interaction is based...... of water droplets on silica surfaces offers a useful fundamental and quantitative measurement in order to study chemical and physical properties of water-silica systems. For hydrophobic systems the static and dynamic properties of the fluid-solid interface are influenced by the presence of air. Hence...

  16. Theoretical Study of Sodium-Water Surface Reaction Mechanism

    Science.gov (United States)

    Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR).

  17. Theoretical study of sodium-water surface reaction mechanism

    International Nuclear Information System (INIS)

    Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro

    2012-01-01

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR). (author)

  18. Impacts of transportation infrastructure on storm water and surfaces waters in Chittenden County, Vermont, USA.

    Science.gov (United States)

    2014-06-01

    Transportation infrastructure is a major source of stormwater runoff that can alter hydrology and : contribute significant loading of nutrients, sediment, and other pollutants to surface waters. These : increased loads can contribute to impairment of...

  19. Surface Water Data at Los Alamos National Laboratory 1998 Water Year

    International Nuclear Information System (INIS)

    Shaull, D.A.; Alexander, M.R.; Reynolds, R.P.; McLean, C.T.; Romero, R.P.

    1999-01-01

    The principal investigators collected and computed surface water discharge data from 19 stream-gaging stations that cover most of Los Alamos National Laboratory. Also included are discharge data from three springs that flow into Caiion de Vane

  20. Biphilic Surfaces for Enhanced Water Collection from Humid Air

    Science.gov (United States)

    Benkoski, Jason; Gerasopoulos, Konstantinos; Luedeman, William

    Surface wettability plays an important role in water recovery, distillation, dehumidification, and heat transfer. The efficiency of each process depends on the rate of droplet nucleation, droplet growth, and mass transfer. Unfortunately, hydrophilic surfaces are good at nucleation but poor at shedding. Hydrophobic surfaces are the reverse. Many plants and animals overcome this tradeoff through biphilic surfaces with patterned wettability. For example, the Stenocara beetle uses hydrophilic patches on a superhydrophobic background to collect fog from air. Cribellate spiders similarly collect fog on their webs through periodic spindle-knot structures. In this study, we investigate the effects of wettability patterns on the rate of water collection from humid air. The steady state rate of water collection per unit area is measured as a function of undercooling, angle of inclination, water contact angle, hydrophilic patch size, patch spacing, area fraction, and patch height relative to the hydrophobic background. We then model each pattern by comparing the potential and kinetic energy of a droplet as it rolls downwards at a fixed angle. The results indicate that the design rules for collecting fog differ from those for condensation from humid air. The authors gratefully acknowledge the Office of Naval Research for financial support through Grant Number N00014-15-1-2107.

  1. Hydrobiological constraints of trace metals in surface water, coastal ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... of Calabar River are presented in Tables 1, 2 and 3. Table 4, 5 and 6 present the correlation matrices for sediment, surface water and N. lotus samples respec- tively, showing values of Pearson's correlation coefficient. (p<0.05, n=4) for pairs of heavy metals at the four locations. The concentrations of As, Cd, ...

  2. Surface water risk assessment of pesticides in Ethiopia

    NARCIS (Netherlands)

    Teklu, B.M.; Adriaanse, P.I.; Horst, ter M.M.S.; Deneer, J.W.; Brink, van den P.J.

    2015-01-01

    Scenarios for future use in the pesticide registration procedure in Ethiopia were designed for 3 separate Ethiopian locations, which are aimed to be protective for the whole of Ethiopia. The scenarios estimate concentrations in surface water resulting from agricultural use of pesticides for a small

  3. Dissolved Carbon Dioxide in Tropical East Atlantic Surface Waters

    NARCIS (Netherlands)

    Bakker, D.C.E.; Baar, H.J.W. de; Jong, E. de

    1999-01-01

    Variability of dissolved inorganic carbon (DIC) and the fugacity of carbon dioxide (fCO2) is discussed for tropical East Atlantic surface waters in October–November 1993 and May–June 1994. High precipitation associated with the Intertropical Convergence Zone, river input and equatorial upwelling

  4. Shale gas development impacts on surface water quality in Pennsylvania

    Science.gov (United States)

    Olmstead, Sheila M.; Muehlenbachs, Lucija A.; Shih, Jhih-Shyang; Chu, Ziyan; Krupnick, Alan J.

    2013-01-01

    Concern has been raised in the scientific literature about the environmental implications of extracting natural gas from deep shale formations, and published studies suggest that shale gas development may affect local groundwater quality. The potential for surface water quality degradation has been discussed in prior work, although no empirical analysis of this issue has been published. The potential for large-scale surface water quality degradation has affected regulatory approaches to shale gas development in some US states, despite the dearth of evidence. This paper conducts a large-scale examination of the extent to which shale gas development activities affect surface water quality. Focusing on the Marcellus Shale in Pennsylvania, we estimate the effect of shale gas wells and the release of treated shale gas waste by permitted treatment facilities on observed downstream concentrations of chloride (Cl−) and total suspended solids (TSS), controlling for other factors. Results suggest that (i) the treatment of shale gas waste by treatment plants in a watershed raises downstream Cl− concentrations but not TSS concentrations, and (ii) the presence of shale gas wells in a watershed raises downstream TSS concentrations but not Cl− concentrations. These results can inform future voluntary measures taken by shale gas operators and policy approaches taken by regulators to protect surface water quality as the scale of this economically important activity increases. PMID:23479604

  5. Uranium in US surface, ground, and domestic waters

    International Nuclear Information System (INIS)

    Drury, J.S.; Reynolds, S.; Owen, P.T.; Ross, R.H.; Ensminger, J.T.

    1981-04-01

    The report Uranium in US Surface, Ground, and Domestic Waters comprises four volumes. Volumes 2, 3, and 4 contain data characterizing the location, sampling date, type, use, and uranium concentrations of 89,994 individual samples presented in tabular form. The tabular data in volumes 2, 3, and 4 are summarized in volume 1 in narrative form and with maps and histograms

  6. Circulation of the surface waters in the north Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Varadachari, V.V.R.; Sharma, G.S.

    The circulation pattern of the surface waters in the North Indian Ocean for different months of the year is discussed. In order to arrive at a reliable and detailed picture of the circulation pattern, streamlines are drawn using the isogon technique...

  7. Uranium in US surface, ground, and domestic waters. Volume 2

    International Nuclear Information System (INIS)

    Drury, J.S.; Reynolds, S.; Owen, P.T.; Ross, R.H.; Ensminger, J.T.

    1981-04-01

    The report Uranium in US Surface, Ground, and Domestic Waters comprises four volumes. Volumes 2, 3, and 4 contain data characterizing the location, sampling date, type, use, and uranium conentrations of 89,994 individual samples presented in tabular form. The tabular data in volumes 2, 3, and 4 are summarized in volume 1 in narrative form and with maps and histograms

  8. The interaction of water and hydrogen with nickel surfaces

    NARCIS (Netherlands)

    Shan, Junjun

    2009-01-01

    As nickel and platinum are in the same group of the periodic table, the Ni(111) and Pt(111) surfaces may be expected to show similar interaction with water and hydrogen. However in this thesis, we show these interactions for Ni(111) are quite different from those of Pt(111). Moreover, our results

  9. Uranium in US surface, ground, and domestic waters

    International Nuclear Information System (INIS)

    Drury, J.S.; Reynolds, S.; Owen, P.T.; Ross, R.H.; Ensminger, J.T.

    1981-04-01

    The report Uranium in US Surface, Ground, and Domestic Waters, comprises four volumes. Volumes 2, 3, and 4 contain data characterizing the location, sampling date, type, use, and uranium concentrations of 89,994 individual samples presented in tabular form. The tabular data in volumes 2, 3, and 4 are summarized in volume 1 in narrative form and with maps and histograms

  10. Metal concentration at surface water using multivariate analysis and ...

    African Journals Online (AJOL)

    Metal concentration at surface water using multivariate analysis and human health risk assessment. F Azaman, H Juahir, K Yunus, A Azid, S.I. Khalit, A.D. Mustafa, M.A. Amran, C.N.C. Hasnam, M.Z.A.Z. Abidin, M.A.M. Yusri ...

  11. Riparian shrub buffers reduce surface water pollutant loads

    Science.gov (United States)

    W. A. Geyer; C. Barden; K. Mankin; D. Devlin

    2003-01-01

    Surface water resources in Kansas often contain concentrations of pesticides, nutrients, and sediments that are of concern to local citizens. The United States Geological Survey reported in 1999 that 97 percent of streams and 82 percent of lakes in Kansas would not fully support all uses as designated by state statutes (U.S. Geological Survey 1999). Bacteria and...

  12. Surface water assessment on the influence of space distribution on ...

    African Journals Online (AJOL)

    In this work, the influence of space distribution on physico-chemical parameters of refinery effluent discharge has been studied, using treated effluent water discharged from the Port Harcourt Refinery Company (PHRC) into the Ekerekana Creek in Okrika as reference. Samples were collected at surface level from the ...

  13. Oxide/water interfaces: how the surface chemistry modifies interfacial water properties

    International Nuclear Information System (INIS)

    Gaigeot, Marie-Pierre; Sprik, Michiel; Sulpizi, Marialore

    2012-01-01

    The organization of water at the interface with silica and alumina oxides is analysed using density functional theory-based molecular dynamics simulation (DFT-MD). The interfacial hydrogen bonding is investigated in detail and related to the chemistry of the oxide surfaces by computing the surface charge density and acidity. We find that water molecules hydrogen-bonded to the surface have different orientations depending on the strength of the hydrogen bonds and use this observation to explain the features in the surface vibrational spectra measured by sum frequency generation spectroscopy. In particular, ‘ice-like’ and ‘liquid-like’ features in these spectra are interpreted as the result of hydrogen bonds of different strengths between surface silanols/aluminols and water. (paper)

  14. An analytical solution to calculate bulk mole fractions for any number of components in aerosol droplets after considering partitioning to a surface layer

    Directory of Open Access Journals (Sweden)

    D. Topping

    2010-11-01

    Full Text Available Calculating the equilibrium composition of atmospheric aerosol particles, using all variations of Köhler theory, has largely assumed that the total solute concentrations define both the water activity and surface tension. Recently however, bulk to surface phase partitioning has been postulated as a process which significantly alters the predicted point of activation. In this paper, an analytical solution to calculate the removal of material from a bulk to a surface layer in aerosol particles has been derived using a well established and validated surface tension framework. The applicability to an unlimited number of components is possible via reliance on data from each binary system. Whilst assumptions regarding behaviour at the surface layer have been made to facilitate derivation, it is proposed that the framework presented can capture the overall impact of bulk-surface partitioning. Demonstrations of the equations for two and five component mixtures are given while comparisons are made with more detailed frameworks capable at modelling ternary systems at higher levels of complexity. Predictions made by the model across a range of surface active properties should be tested against measurements. Indeed, reccomendations are given for experimental validation and to assess sensitivities to accuracy and required level of complexity within large scale frameworks. Importantly, the computational efficiency of using the solution presented in this paper is roughly a factor of 20 less than a similar iterative approach, a comparison with highly coupled approaches not available beyond a 3 component system.

  15. Water Surface Overgrowing of the Tatra’s Lakes

    Directory of Open Access Journals (Sweden)

    Kapusta Juraj

    2018-03-01

    Full Text Available Tatra’s lakes are vulnerable ecosystems and an important element of the alpine landscape. Mainly some shallow lake basins succumb to intense detritus sedimentation, fine fractions of material from the catchment area or to the overgrowing of water level by vegetation. In this paper, changes and dynamics of the 12 Tatra’s lake shorelines that were selected based on the detailed mapping of their extent are pointed out. Changes were assessed by accurate comparisons of historical and current orthophoto maps from the years 1949, 1955 and 2015 – and therefore, based on the oldest and the latest relevant materials. Due to the overgrowing of lakes caused by vegetation, their water surface decreased from −0.9% up to −47.9%, during the examined period. Losses were caused by the overgrowing of open water surface by the communities of sedges and peat bogs. The most significant dynamics of the shorelines during the last decades were reached by those lakes, into which fine sediments were simultaneously deposited by means of mountain water coarse. These sediments made the marginal parts of the lake basins shallower and accelerated rapid expansion of vegetation to the detriment of the open water surface. The overgrowing of shallow moraine lakes lying in the vegetation zone is a significant phenomenon of the High Tatras alpine landscape. It leads to their gradual extinction, turn into peat bogs and wet alpine meadows.

  16. [Occurrence of bacteria of the Yersinia genus in surface water].

    Science.gov (United States)

    Krogulska, B; Maleszewska, J

    1992-01-01

    The aim of the study was determination of the frequency of occurrence of Yersinia genus bacteria in surface waters polluted to various degrees with bacteria of the coliform and of fecal coli. For detection of Yersinia rods the previously elaborated medium Endo MLCe and the membrane filter method were applied. Samples of 42 surface waters were examined, including 26 from rivers and 16 from lakes, ponds and clay-pits. On the basis of sanitary bacteriological analysis 16 surface waters were classified to class I purity, 10 to class II, the remaining ones to class III or beyond classification. Yersinia rods were detected in 15 water bodies that is 35.7% of the examined waters. A total of 27 Yersinia strains were identified with dominance of Y. intermedia (14 strains) and Y. enterocolitica (10 strains). Three strains represented by the species Yersinia frederiksenii. Most of the Y. enterocolitica strains belonged to biotype 1, the particular strains being represented by various serotypes. Hence their different origin may be concluded. The pathogenic serotypes 0:3 and 0:9 of Yersinia enterocolitica were not detected.

  17. Structure and optical properties of water covered Cu(110) surfaces

    International Nuclear Information System (INIS)

    Baghbanpourasl, A.

    2014-01-01

    In this thesis structural and optical properties of the water covered Cu(110) surface is studied using density functional theory within independent particle approximation. Several stable adsorption structures are studied such as water clusters (monomer, dimer, trimer, tetramer and pentamer), different hexagonal monolayers, partially dissociated water monolayers and three different types of chains among them a chain that consists of pentagon rings. For a copper surface in contact with water vapor, the energetically stable H 2 O/OH adsorbed structures are compared thermodynamically using adsorption free energy (change of free energy due to adsorption). Several phase diagrams with respect to temperature and pressure are calculated. It is found that among the large number of energetically stable structures (i.e. structures with positive adsorption energy ) only limited number of them are thermodynamically stable. These thermodynamically stable structures are the class of almost energetically degenerate hexagonal overlayers, one type of partially dissociated water structure that contains Bjerrum defect in the hydrogen bond network and pentagon chain. Since hydrogen atoms are light weight their vibrational effects can be considerable. Zero point vibration decreases the adsorption energy up to 0.1 eV and free energy of adsorbed molecules arising from vibrational degree of freedom can go up to -0.2 eV per adsorbed molecule at 500 Kelvin. However zero point energy and vibrational free energy of adsorbed molecules do not alter relative stability of the adsorbed structures. To account for the long range van der Waals interactions, a semi-empirical scheme is applied. Reflectance Anisotropy Spectroscopy (RAS) is a fast and non destructive optical method that can be used to prob the surface in different conditions such as vacuum and electro-chemical environment. Elasto-optic coeficients of bulk are calculated from first principles and the change of the RA spectrum of the bare Cu

  18. The conservative behavior of dissolved organic carbon in surface waters of the southern Chukchi Sea, Arctic Ocean, during early summer.

    Science.gov (United States)

    Tanaka, Kazuki; Takesue, Nobuyuki; Nishioka, Jun; Kondo, Yoshiko; Ooki, Atsushi; Kuma, Kenshi; Hirawake, Toru; Yamashita, Youhei

    2016-09-23

    The spatial distribution of dissolved organic carbon (DOC) concentrations and the optical properties of dissolved organic matter (DOM) determined by ultraviolet-visible absorbance and fluorescence spectroscopy were measured in surface waters of the southern Chukchi Sea, western Arctic Ocean, during the early summer of 2013. Neither the DOC concentration nor the optical parameters of the DOM correlated with salinity. Principal component analysis using the DOM optical parameters clearly separated the DOM sources. A significant linear relationship was evident between the DOC and the principal component score for specific water masses, indicating that a high DOC level was related to a terrigenous source, whereas a low DOC level was related to a marine source. Relationships between the DOC and the principal component scores of the surface waters of the southern Chukchi Sea implied that the major factor controlling the distribution of DOC concentrations was the mixing of plural water masses rather than local production and degradation.

  19. Protection of surface assets on Mars from wind blown jettisoned spacecraft components

    Science.gov (United States)

    Paton, Mark

    2017-07-01

    Jettisoned Entry, Descent and Landing System (EDLS) hardware from landing spacecraft have been observed by orbiting spacecraft, strewn over the Martian surface. Future Mars missions that land spacecraft close to prelanded assets will have to use a landing architecture that somehow minimises the possibility of impacts from these jettisoned EDLS components. Computer modelling is used here to investigate the influence of wind speed and direction on the distribution of EDLS components on the surface. Typical wind speeds encountered in the Martian Planetary Boundary Layer (PBL) were found to be of sufficient strength to blow items having a low ballistic coefficient, i.e. Hypersonic Inflatable Aerodynamic Decelerators (HIADs) or parachutes, onto prelanded assets even when the lander itself touches down several kilometres away. Employing meteorological measurements and careful characterisation of the Martian PBL, e.g. appropriate wind speed probability density functions, may then benefit future spacecraft landings, increase safety and possibly help reduce the delta v budget for Mars landers that rely on aerodynamic decelerators.

  20. Stable water isotope and surface heat flux simulation using ISOLSM: Evaluation against in-situ measurements

    KAUST Repository

    Cai, Mick Y.; Wang, Lixin; Parkes, Stephen; Strauss, Josiah; McCabe, Matthew; Evans, Jason P.; Griffiths, Alan D.

    2015-01-01

    The stable isotopes of water are useful tracers of water sources and hydrological processes. Stable water isotope-enabled land surface modeling is a relatively new approach for characterizing the hydrological cycle, providing spatial and temporal variability for a number of hydrological processes. At the land surface, the integration of stable water isotopes with other meteorological measurements can assist in constraining surface heat flux estimates and discriminate between evaporation (E) and transpiration (T). However, research in this area has traditionally been limited by a lack of continuous in-situ isotopic observations. Here, the National Centre for Atmospheric Research stable isotope-enabled Land Surface Model (ISOLSM) is used to simulate the water and energy fluxes and stable water isotope variations. The model was run for a period of one month with meteorological data collected from a coastal sub-tropical site near Sydney, Australia. The modeled energy fluxes (latent heat and sensible heat) agreed reasonably well with eddy covariance observations, indicating that ISOLSM has the capacity to reproduce observed flux behavior. Comparison of modeled isotopic compositions of evapotranspiration (ET) against in-situ Fourier Transform Infrared spectroscopy (FTIR) measured bulk water vapor isotopic data (10. m above the ground), however, showed differences in magnitude and temporal patterns. The disparity is due to a small contribution from local ET fluxes to atmospheric boundary layer water vapor (~1% based on calculations using ideal gas law) relative to that advected from the ocean for this particular site. Using ISOLSM simulation, the ET was partitioned into E and T with 70% being T. We also identified that soil water from different soil layers affected T and E differently based on the simulated soil isotopic patterns, which reflects the internal working of ISOLSM. These results highlighted the capacity of using the isotope-enabled models to discriminate

  1. Stable water isotope and surface heat flux simulation using ISOLSM: Evaluation against in-situ measurements

    KAUST Repository

    Cai, Mick Y.

    2015-04-01

    The stable isotopes of water are useful tracers of water sources and hydrological processes. Stable water isotope-enabled land surface modeling is a relatively new approach for characterizing the hydrological cycle, providing spatial and temporal variability for a number of hydrological processes. At the land surface, the integration of stable water isotopes with other meteorological measurements can assist in constraining surface heat flux estimates and discriminate between evaporation (E) and transpiration (T). However, research in this area has traditionally been limited by a lack of continuous in-situ isotopic observations. Here, the National Centre for Atmospheric Research stable isotope-enabled Land Surface Model (ISOLSM) is used to simulate the water and energy fluxes and stable water isotope variations. The model was run for a period of one month with meteorological data collected from a coastal sub-tropical site near Sydney, Australia. The modeled energy fluxes (latent heat and sensible heat) agreed reasonably well with eddy covariance observations, indicating that ISOLSM has the capacity to reproduce observed flux behavior. Comparison of modeled isotopic compositions of evapotranspiration (ET) against in-situ Fourier Transform Infrared spectroscopy (FTIR) measured bulk water vapor isotopic data (10. m above the ground), however, showed differences in magnitude and temporal patterns. The disparity is due to a small contribution from local ET fluxes to atmospheric boundary layer water vapor (~1% based on calculations using ideal gas law) relative to that advected from the ocean for this particular site. Using ISOLSM simulation, the ET was partitioned into E and T with 70% being T. We also identified that soil water from different soil layers affected T and E differently based on the simulated soil isotopic patterns, which reflects the internal working of ISOLSM. These results highlighted the capacity of using the isotope-enabled models to discriminate

  2. Tritium in surface water of the Yenisei river Basin

    International Nuclear Information System (INIS)

    Bondareva, L.G.; Bolsunovsky, A.Ya.

    2005-01-01

    The paper reports an investigation of the tritium content in the surface waters of the Yenisei River basin near the Mining-and-Chemical Combine (MCC). In 2001-2003 the maximum tritium concentration in the Yenisei River did not exceed 4±1 Bq/L. It has been found that there are surface waters containing enhanced tritium, up to 168 Bq/L, as compared with the background values for the Yenisei River. There are two possible sources of tritium input. First, the last operating reactor of the MCC, which still uses the Yenisei water as coolant. Second, tritium may come from the deep aquifers at the Severny testing site. For the first time tritium has been found in two aquatic plant species of the Yenisei River with maximal tritium concentration 304 Bq/Kg wet weight. Concentration factors of tritium for aquatic plants are much higher than 1

  3. Membranes with Surface-Enhanced Antifouling Properties for Water Purification

    Science.gov (United States)

    Shahkaramipour, Nima; Tran, Thien N.; Ramanan, Sankara; Lin, Haiqing

    2017-01-01

    Membrane technology has emerged as an attractive approach for water purification, while mitigation of fouling is key to lower membrane operating costs. This article reviews various materials with antifouling properties that can be coated or grafted onto the membrane surface to improve the antifouling properties of the membranes and thus, retain high water permeance. These materials can be separated into three categories, hydrophilic materials, such as poly(ethylene glycol), polydopamine and zwitterions, hydrophobic materials, such as fluoropolymers, and amphiphilic materials. The states of water in these materials and the mechanisms for the antifouling properties are discussed. The corresponding approaches to coat or graft these materials on the membrane surface are reviewed, and the materials with promising performance are highlighted. PMID:28273869

  4. Tritiated water vapor in the surface air at Tokyo

    International Nuclear Information System (INIS)

    Inoue, Hisayuki; Katsuragi, Yukio; Shigehara, Koji

    1984-01-01

    Tritium concentration in water vapor in the air near the surface and in the precipitation at Tokyo was measured during the period from 9 August to 20 November in 1974. From August to the middle of October, tritium mixing ratios in the surface air had relatively higher values except those in air masses which were associated with a typhoon. The mixing ratios of tritium in the air decreased abruptly at the middle of October, which indicates the decrease of tritium influx from aloft. These data exhibit the salient feature that variations in tritium concentration in TR are linear to the reciprocal of the content of water vapor during each period. Tritium concentrations in vapor and rain water collected simultaneously show nearly equal values. One of the reasons for the good correlation of tritium concentration between falling drops and ambient air is considered to be the result of the rapid isotopic exchange. (author)

  5. Water surface modeling from a single viewpoint video.

    Science.gov (United States)

    Li, Chuan; Pickup, David; Saunders, Thomas; Cosker, Darren; Marshall, David; Hall, Peter; Willis, Philip

    2013-07-01

    We introduce a video-based approach for producing water surface models. Recent advances in this field output high-quality results but require dedicated capturing devices and only work in limited conditions. In contrast, our method achieves a good tradeoff between the visual quality and the production cost: It automatically produces a visually plausible animation using a single viewpoint video as the input. Our approach is based on two discoveries: first, shape from shading (SFS) is adequate to capture the appearance and dynamic behavior of the example water; second, shallow water model can be used to estimate a velocity field that produces complex surface dynamics. We will provide qualitative evaluation of our method and demonstrate its good performance across a wide range of scenes.

  6. Reprint of "How do components of real cloud water affect aqueous pyruvate oxidation?"

    Science.gov (United States)

    Boris, Alexandra J.; Desyaterik, Yury; Collett, Jeffrey L.

    2015-01-01

    Chemical oxidation of dissolved volatile or semi-volatile organic compounds within fog and cloud droplets in the atmosphere could be a major pathway for secondary organic aerosol (SOA) formation. This proposed pathway consists of: (1) dissolution of organic chemicals from the gas phase into a droplet; (2) reaction with an aqueous phase oxidant to yield low volatility products; and (3) formation of particle phase organic matter as the droplet evaporates. The common approach to simulating aqueous SOA (aqSOA) reactions is photo-oxidation of laboratory standards in pure water. Reactions leading to aqSOA formation should be studied within real cloud and fog water to determine whether additional competing processes might alter apparent rates of reaction as indicated by rates of reactant loss or product formation. To evaluate and identify the origin of any cloud water matrix effects on one example of observed aqSOA production, pyruvate oxidation experiments simulating aqSOA formation were monitored within pure water, real cloud water samples, and an aqueous solution of inorganic salts. Two analysis methods were used: online electrospray ionization high-resolution time-of-flight mass spectrometry (ESI-HR-ToF-MS), and offline anion exchange chromatography (IC) with quantitative conductivity and qualitative ESI-HR-ToF-MS detection. The apparent rate of oxidation of pyruvate was slowed in cloud water matrices: overall measured degradation rates of pyruvate were lower than in pure water. This can be at least partially accounted for by the observed formation of pyruvate from reactions of other cloud water components. Organic constituents of cloud water also compete for oxidants and/or UV light, contributing to the observed slowed degradation rates of pyruvate. The oxidation of pyruvate was not significantly affected by the presence of inorganic anions (nitrate and sulfate) at cloud-relevant concentrations. Future bulk studies of aqSOA formation reactions using simplified

  7. GC/MS analysis of pesticides in the Ferrara area (Italy) surface water: a chemometric study.

    Science.gov (United States)

    Pasti, Luisa; Nava, Elisabetta; Morelli, Marco; Bignami, Silvia; Dondi, Francesco

    2007-01-01

    The development of a network to monitor surface waters is a critical element in the assessment, restoration and protection of water quality. In this study, concentrations of 42 pesticides--determined by GC-MS on samples from 11 points along the Ferrara area rivers--have been analyzed by chemometric tools. The data were collected over a three-year period (2002-2004). Principal component analysis of the detected pesticides was carried out in order to define the best spatial locations for the sampling points. The results obtained have been interpreted in view of agricultural land use. Time series data regarding pesticide contents in surface waters has been analyzed using the Autocorrelation function. This chemometric tool allows for seasonal trends and makes it possible to optimize sampling frequency in order to detect the effective maximum pesticide content.

  8. GC/MS Analysis of Pesticides in the Ferrara Area (Italy) Surface Water: A Chemometric Study

    International Nuclear Information System (INIS)

    Pasti, L.; Dondi, F.; Nava, E.; Morelli, M.; Bignami, S.

    2007-01-01

    The development of a network to monitor surface waters is a critical element in the assessment, restoration and protection of water quality. In this study, concentrations of 42 pesticides - determined by GC-MS on samples from 11 points along the Ferrara area rivers - have been analyzed by chemometric tools. The data were collected over a three-year period (2002-2004). Principal component analysis of the detected pesticides was carried out in order to define the best spatial locations for the sampling points. The results obtained have been interpreted in view of agricultural land use. Time series data regarding pesticide contents in surface waters has been analyzed using the Autocorrelation function. This chemometric tool allows for seasonal trends and makes it possible to optimize sampling frequency in order to detect the effective maximum pesticide content

  9. On-line component ratio measurement of oil/gas/water mixtures using an admittance sensor

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, J A

    1984-01-01

    The operator of a production platform is primarily interested in which types of fluids a well is producing and how quickly these different components are being produced. The component ratio and production rate of a well vary during the life of a field. To optimize production, measurement of each well's output is thus desirable. Current designs for subsea production systems lack means of continuously measuring three-component flows. A new method of component ratio measurement is described. The fraction of oil, gas and water flowing between two insulated electrode plates is determined by measuring both the electrical conductance and suseptance across the sensor. A preliminary evaluation of the new measurement system has been performed using a process oil/ water/air mixture. The method is not limited to small pipe diameters. The only possible limitation is that for low velocities in very large pipe diameters an in-line mixer may be required. Advantages of this new system are that real-time measurement of void fraction and water content is possible if a non-intrusive rugged sensor is used, and there are no range limitations, as each component may be measured for any given concentration. 4 references.

  10. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  11. Using containment analysis to improve component cooling water heat exchanger limits

    International Nuclear Information System (INIS)

    Da Silva, H.C.; Tajbakhsh, A.

    1995-01-01

    The Comanche Peak Steam Electric Station design requires that exit temperatures from the Component Cooling Water Heat Exchanger remain below 330.37 K during the Emergency Core Cooling System recirculation stage, following a hypothetical Loss of Coolant Accident (LOCA). Due to measurements indicating a higher than expected combination of: (a) high fouling factor in the Component Cooling Water Heat Exchanger with (b) high ultimate heat sink temperatures, that might lead to temperatures in excess of the 330.37 K limit, if a LOCA were to occur, TUElectric adjusted key flow rates in the Component Cooling Water network. This solution could only be implemented with improvements to the containment analysis methodology of record. The new method builds upon the CONTEMPT-LT/028 code by: (a) coupling the long term post-LOCA thermohydraulics with a more detailed analytical model for the complex Component Cooling Water Heat Exchanger network and (b) changing the way mass and energy releases are calculated after core reflood and steam generator energy is dumped to the containment. In addition, a simple code to calculate normal cooldowns was developed to confirm RHR design bases were met with the improved limits

  12. Analysis of Removal Alternatives for the Heavy Water Components Test Reactor at the Savannah River Site

    International Nuclear Information System (INIS)

    Owen, M.B.

    1996-08-01

    This engineering study was developed to evaluate different options for decommissioning of the Heavy Water Components Test Reactor (HWCTR) at the Savannah River Site. This document will be placed in the DOE-SRS Area reading rooms for a period of 30 days in order to obtain public input to plans for the demolition of HWCTR

  13. Effect of water stress on yield and yield components of sunflower ...

    African Journals Online (AJOL)

    A field experiment during year 2009 was conducted in the research station of the University of Tehran, College of Abouraihan in Pakdasht region, Iran. The study was aimed to investigate the effect of water stress on seed yield, yield component and some quantitative traits of four sunflower hybrids namely Azargol, Alstar, ...

  14. Surface wastewater in Samara and their impact on water basins as water supply sources

    Science.gov (United States)

    Strelkov, Alexander; Shuvalov, Mikhail; Gridneva, Marina

    2017-10-01

    The paper gives an overview of surface wastewater outlets in Samara through the rainwater sewer system into the Saratov water reservoir and the Samara river. The rainwater sewer system in Samara is designed and executed according to a separate scheme, except for the old part of the city, where surface run-off is dumped into the sewer system through siphoned drain. The rainwater system disposes of surface, drainage, industrial clean-contamined waters, emergency and technology discharges from the city’s heat supply and water supply systems. The effluent discharge is carried out by means of separate wastewater outlets into ravines or directly into the Samara river and the Saratov water reservoir without cleaning. The effluent discharge is carried out through the rainwater sewer system with 17 wastewater outlets into the Saratov water reservoir. In the Samara river, surface runoff drainage and clean-contamined water of industrial enterprises is carried out through 14 wastewater outlets. This study emphasizes the demand to arrange effluent discharge and construction of sewage treatment plants to prevent contamination of water objects by surface run-off from residential areas and industrial territories.

  15. A Study on Water Surface Profiles of Rivers with Constriction

    Science.gov (United States)

    Qian, Chaochao; Yamada, Tadashi

    2013-04-01

    Water surface profile of rivers with constrictions is precious in both classic hydraulics and river management practice. This study was conducted to clarify the essences of the water surface profiles. 3 cases of experiments and 1D numerical calculations with different discharges were made in the study and analysis solutions of the non-linear basic equation of surface profile in varied flow without considering friction were derived. The manning's number was kept in the same in each case by using crosspiece roughness. We found a new type of water surface profile of varied flow from the results of 1D numerical calculation and that of experiments and named it as Mc curve because of its mild condition with constriction segment. This kind of curves appears as a nature phenomenon ubiquitously. The process of water surface forming is dynamic and bore occurs at the upper side of constriction during increasing discharge before the surface profile formed. As a theoretical work, 3 analysis solutions were derived included 2 physical-meaning solutions in the study by using Man-Machine system. One of the derived physical-meaning solutions was confirmed that it is validity by comparing to the results of 1D numerical calculation and that of experiments. The solution represents a flow profile from under critical condition at the upper side to super critical condition at the down side of constriction segment. The other derived physical-meaning solution represents a flow profile from super critical condition at the upper side to under critical condition at the down side of constriction segment. These two kinds of flow profiles exist in the nature but no theoretical solution can express the phenomenon. We find the depth distribution only concerned with unit width discharge distribution and critical depth under a constant discharge from the derived solutions. Therefor, the profile can be gained simply and precisely by using the theoretical solutions instead of numerical calculation even

  16. IMPROVING CYANOBACTERIA AND CYANOTOXIN MONITORING IN SURFACE WATERS FOR DRINKING WATER SUPPLY

    Directory of Open Access Journals (Sweden)

    Jing Li

    2017-06-01

    Full Text Available Cyanobacteria in fresh water can cause serious threats to drinking water supplies. Managing cyanobacterial blooms particularly at small drinking water treatment plants is challenging. Because large amount of cyanobacteria may cause clogging in the treatment process and various cyanotoxins are hard to remove, while they may cause severe health problems. There is lack of instructions of what cyanobacteria/toxin amount should trigger what kind of actions for drinking water management except for Microcystins. This demands a Cyanobacteria Management Tool (CMT to help regulators/operators to improve cyanobacteria/cyanotoxin monitoring in surface waters for drinking water supply. This project proposes a CMT tool, including selecting proper indicators for quick cyanobacteria monitoring and verifying quick analysis methods for cyanobacteria and cyanotoxin. This tool is suggested for raw water management regarding cyanobacteria monitoring in lakes, especially in boreal forest climate. In addition, it applies to regions that apply international WHO standards for water management. In Swedish context, drinking water producers which use raw water from lakes that experience cyanobacterial blooms, need to create a monitoring routine for cyanobacteria/cyanotoxin and to monitor beyond such as Anatoxins, Cylindrospermopsins and Saxitoxins. Using the proposed CMT tool will increase water safety at surface water treatment plants substantially by introducing three alerting points for actions. CMT design for each local condition should integrate adaptive monitoring program.

  17. Roles of surface water areas for water and solute cycle in Hanoi city, Viet Nam

    Science.gov (United States)

    Hayashi, Takeshi; Kuroda, Keisuke; Do Thuan, An; Tran Thi Viet, Nga; Takizawa, Satoshi

    2013-04-01

    Hanoi city, the capital of Viet Nam, has developed beside the Red river. Recent rapid urbanization of this city has reduced a large number of natural water areas such as lakes, ponds and canals not only in the central area but the suburban area. Contrary, the urbanization has increased artificial water areas such as pond for fish cultivation and landscaping. On the other hand, the urbanization has induced the inflow of waste water from households and various kinds of factories to these water areas because of delay of sewerage system development. Inflow of the waste water has induced eutrophication and pollution of these water areas. Also, there is a possibility of groundwater pollution by infiltration of polluted surface water. However, the role of these water areas for water cycle and solute transport is not clarified. Therefore, this study focuses on the interaction between surface water areas and groundwater in Hanoi city to evaluate appropriate land development and groundwater resource management. We are carrying out three approaches: a) understanding of geochemical characteristics of surface water and groundwater, b) monitoring of water levels of pond and groundwater, c) sampling of soil and pond sediment. Correlation between d18O and dD of precipitation (after GNIP), the Red River (after GNIR) and the water samples of this study showed that the groundwater is composed of precipitation, the Red River and surface water that has evaporation process. Contribution of the surface water with evaporation process was widely found in the study area. As for groundwater monitoring, the Holocene aquifers at two sites were in unconfined condition in dry season and the groundwater levels in the aquifer continued to increase through rainy season. The results of isotopic analysis and groundwater level monitoring showed that the surface water areas are one of the major groundwater sources. On the other hand, concentrations of dissolved Arsenic (filtered by 0.45um) in the pore

  18. Simplifying and upscaling water resources systems models that combine natural and engineered components

    Science.gov (United States)

    McIntyre, N.; Keir, G.

    2014-12-01

    Water supply systems typically encompass components of both natural systems (e.g. catchment runoff, aquifer interception) and engineered systems (e.g. process equipment, water storages and transfers). Many physical processes of varying spatial and temporal scales are contained within these hybrid systems models. The need to aggregate and simplify system components has been recognised for reasons of parsimony and comprehensibility; and the use of probabilistic methods for modelling water-related risks also prompts the need to seek computationally efficient up-scaled conceptualisations. How to manage the up-scaling errors in such hybrid systems models has not been well-explored, compared to research in the hydrological process domain. Particular challenges include the non-linearity introduced by decision thresholds and non-linear relations between water use, water quality, and discharge strategies. Using a case study of a mining region, we explore the nature of up-scaling errors in water use, water quality and discharge, and we illustrate an approach to identification of a scale-adjusted model including an error model. Ways forward for efficient modelling of such complex, hybrid systems are discussed, including interactions with human, energy and carbon systems models.

  19. An Evaluation Tool for CONUS-Scale Estimates of Components of the Water Balance

    Science.gov (United States)

    Saxe, S.; Hay, L.; Farmer, W. H.; Markstrom, S. L.; Kiang, J. E.

    2016-12-01

    Numerous research groups are independently developing data products to represent various components of the water balance (e.g. runoff, evapotranspiration, recharge, snow water equivalent, soil moisture, and climate) at the scale of the conterminous United States. These data products are derived from a range of sources, including direct measurement, remotely-sensed measurement, and statistical and deterministic model simulations. An evaluation tool is needed to compare these data products and the components of the water balance they contain in order to identify the gaps in the understanding and representation of continental-scale hydrologic processes. An ideal tool will be an objective, universally agreed upon, framework to address questions related to closing the water balance. This type of generic, model agnostic evaluation tool would facilitate collaboration amongst different hydrologic research groups and improve modeling capabilities with respect to continental-scale water resources. By adopting a comprehensive framework to consider hydrologic modeling in the context of a complete water balance, it is possible to identify weaknesses in process modeling, data product representation and regional hydrologic variation. As part of its National Water Census initiative, the U.S. Geological survey is facilitating this dialogue to developing prototype evaluation tools.

  20. Quality of surface-water supplies in the Triangle area of North Carolina, water year 2008

    Science.gov (United States)

    Giorgino, M.J.; Rasmussen, R.B.; Pfeifle, C.A.

    2012-01-01

    Surface-water supplies are important sources of drinking water for residents in the Triangle area of North Carolina, which is located within the upper Cape Fear and Neuse River Basins. Since 1988, the U.S. Geological Survey and a consortium of governments have tracked water-quality conditions and trends in several of the area's water-supply lakes and streams. This report summarizes data collected through this cooperative effort, known as the Triangle Area Water Supply Monitoring Project, during October 2007 through September 2008. Major findings for this period include:

  1. Diminished Mercury Emission From Water Surfaces by Duckweed (Lemna minor)

    Science.gov (United States)

    Wollenberg, J. L.; Peters, S. C.

    2007-12-01

    Aquatic plants of the family Lemnaceae (generally referred to as duckweeds) are a widely distributed type of floating vegetation in freshwater systems. Under suitable conditions, duckweeds form a dense vegetative mat on the water surface, which reduces light penetration into the water column and decreases the amount of exposed water surface. These two factors would be expected to reduce mercury emission by limiting a) direct photoreduction of Hg(II), b) indirect reduction via coupled DOC photooxidation-Hg(II) reduction, and c) gas diffusion across the water-air interface. Conversely, previous studies have demonstrated transpiration of Hg(0) by plants, so it is therefore possible that the floating vegetative mat would enhance emission via transpiration of mercury vapor. The purpose of this experiment was to determine whether duckweed limits mercury flux to the atmosphere by shading and the formation of a physical barrier to diffusion, or whether it enhances emission from aquatic systems via transpiration of Hg(0). Deionized water was amended with mercury to achieve a final concentration of approximately 35 ng/L and allowed to equilibrate prior to the experiment. Experiments were conducted in rectangular polystyrene flux chambers with measured UV-B transmittance greater than 60% (spectral cutoff approximately 290 nm). Light was able to penetrate the flux chamber from the sides as well as the top throughout the experiment, limiting the effect of shading by duckweed on the water surface. Flux chambers contained 8L of water with varying percent duckweed cover, and perforated plastic sheeting was used as an abiotic control. Exposures were conducted outside on days with little to no cloud cover. Real time mercury flux was measured using atomic absorption (Mercury Instruments UT-3000). Total solar and ultraviolet radiation, as well as a suite of meteorological parameters, were also measured. Results indicate that duckweed diminishes mercury emission from the water surface

  2. Evaluation of ATP measurements to detect microbial ingress by wastewater and surface water in drinking water

    DEFF Research Database (Denmark)

    Vang, Óluva Karin; Corfitzen, Charlotte B.; Smith, Christian

    2014-01-01

    in this respect. Compared to traditional microbiological methods, the ATP assay could detect wastewater and surface water in drinking water to a higher degree than total direct counts (TDCs), while both heterotrophic plate counts (HPC 22 °C and HPC 37 °C) and Colilert-18 (Escherichia coli and coliforms) were more...

  3. Surface Water Data at Los Alamos National Laboratory 2006 Water Year

    Energy Technology Data Exchange (ETDEWEB)

    R.P. Romero, D. Ortiz, G. Kuyumjian

    2007-08-01

    The principal investigators collected and computed surface water discharge data from 44 stream-gaging stations that cover most of Los Alamos National Laboratory and one at Bandelier National Monument. Also included are discharge data from three springs--two that flow into Canon de Valle and one that flows into Water Canyon--and peak flow data for 44 stations.

  4. Perfluoroalkyl substances in the Maltese Environment - (I) Surface water and rain water

    NARCIS (Netherlands)

    Sammut, G.; Sinagra, E.; Helmus, R.; de Voogt, P.

    2017-01-01

    The presence of perfluoroalkyl substances (PFASs) in rain water on the Maltese Islands is reported here for the first time and an extensive survey of these substances in surface water also reported. The Maltese archipelago lies at the centre of the Mediterranean Sea and consists of three main

  5. Water level observations from Unmanned Aerial Vehicles for improving estimates of surface water-groundwater interaction

    DEFF Research Database (Denmark)

    Bandini, Filippo; Butts, Michael; Vammen Jacobsen, Torsten

    2017-01-01

    spatial resolution; ii) spatially continuous profiles along or across the water body; iii) flexible timing of sampling. A semi-synthetic study was conducted to analyse the value of the new UAV-borne datatype for improving hydrological models, in particular estimates of GW (Groundwater)- SW (Surface Water...

  6. Multi-functional surfaces with controllable wettability and water adhesion

    Science.gov (United States)

    Anastasiadis, Spiros H.; Frysali, Melani A.; Kenanakis, George; Kaklamani, Georgia; Papoutsakis, Lampros

    The design of multifunctional surfaces based on biomimetic structures has gained the interest of the scientific community. Novel multifunctional surfaces have been developed, able to alter their wetting properties in response to temperature and pH as well as light illumination, by combining proper chemistry and surface micro/nano-structuring using ultrafast (femtosecond) laser irradiation. The combination of the hierarchical surface with a ZnO and/or a responsive polymer coating results in efficient photo-active properties as well as reversible superhydrophobic / superhydrophilic surfaces in response to external stimuli. These surfaces can be optimized to exhibit high or zero water adhesion and/or controllable directionality as well. Moreover, they can be seeded with human fibroblasts to examine the cellular response on both surface roughness and surface chemistry. Acknowledgements: This research has been co-financed by the General Secretariat for Research and Technology (''ARISTEIA II'' Action, SMART-SURF) and the European Union (NFFA Europe -Grant agreement No. 654360).

  7. Observation of dynamic water microadsorption on Au surface

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xiaokang, E-mail: xiaokang.huang@tqs.com; Gupta, Gaurav; Gao, Weixiang; Tran, Van; Nguyen, Bang; McCormick, Eric; Cui, Yongjie; Yang, Yinbao; Hall, Craig; Isom, Harold [TriQuint Semiconductor, Inc., 500 W Renner Road, Richardson, Texas 75080 (United States)

    2014-05-15

    Experimental and theoretical research on water wettability, adsorption, and condensation on solid surfaces has been ongoing for many decades because of the availability of new materials, new detection and measurement techniques, novel applications, and different scales of dimensions. Au is a metal of special interest because it is chemically inert, has a high surface energy, is highly conductive, and has a relatively high melting point. It has wide applications in semiconductor integrated circuitry, microelectromechanical systems, microfluidics, biochips, jewelry, coinage, and even dental restoration. Therefore, its surface condition, wettability, wear resistance, lubrication, and friction attract a lot of attention from both scientists and engineers. In this paper, the authors experimentally investigated Au{sub 2}O{sub 3} growth, wettability, roughness, and adsorption utilizing atomic force microscopy, scanning electron microscopy, reflectance spectrometry, and contact angle measurement. Samples were made using a GaAs substrate. Utilizing a super-hydrophilic Au surface and the proper surface conditions of the surrounding GaAs, dynamic microadsorption of water on the Au surface was observed in a clean room environment. The Au surface area can be as small as 12 μm{sup 2}. The adsorbed water was collected by the GaAs groove structure and then redistributed around the structure. A model was developed to qualitatively describe the dynamic microadsorption process. The effective adsorption rate was estimated by modeling and experimental data. Devices for moisture collection and a liquid channel can be made by properly arranging the wettabilities or contact angles of different materials. These novel devices will be very useful in microfluid applications or biochips.

  8. Radioactivity levels in surface water of lakes around Izmir / Turkey

    International Nuclear Information System (INIS)

    Doyurum, S.; Turkozu, D. A.; Aslani, M. A. A.; Aytas, S.; Eral, M.; Kaygun, A. K.

    2006-01-01

    Radioactivity presents in surface continental waters is mainly due to the presence of radioactive elements in the earth's crust, other artificial radionuclides have appeared due to such human activities as nuclear power plants, nuclear weapons testing and manufacture and use of radioactive sources It is well known that natural radionuclides can be effective as tracers for the different processes controlling the distribution of elements among dissolved and particulate phases in aquatic systems. The detection of high radionuclide concentrations was proposed as a public health problem in several areas and consequently studies into the risks of radionuclides were started in the 2000s. Especially, these radioactive substances in groundwater are an unwanted and involuntary risk factor from natural sources, not artificial sources. These radioactive substances include uranium, radon found in uranium series, and other radioactive substances such as radium and gross alpha. Uranium present in rock, soil, and natural materials, and is found in small quantities in air, water, and food that people always contact. In this project, lake water samples were collected from three lakes around Izmir-Turkey. In surface lake water samples, pH, mV and conductivity values were measured and alkaline content was determined titrimetrically. The uranium concentrations in the lake water samples were measured using uranium analyzer. The radioactivity concentrations related to gross radium isotopes, gross-? and gross-? activities in the surface lake water were determined. The correlation among some parameters for water samples and concentrations of uranium, activity concentration of gross radium isotopes, gross alpha and gross beta radioactivity are also discussed

  9. Movement of Irrigation Water in Soil from a Surface Emitter

    Directory of Open Access Journals (Sweden)

    Ibrahim Abbas Dawood

    2016-09-01

    Full Text Available rickle irrigation is one of the most conservative irrigation techniques since it implies supplying water directly on the soil through emitters. Emitters dissipate energy of water at the end of the trickle irrigation system and provide water at emission points. The area wetted by an emitter depends upon the discharge of emitter, soil texture, initial soil water content, and soil permeability. The objectives of this research were to predict water distribution profiles through different soils for different conditions and quantify the distribution profiles in terms of main characteristics of soil and emitter. The wetting patterns were simulated at the end of each hour for a total time of application of 12 hrs, emitter discharges of 0.5, 0.75, 1, 2, 3, 4, and 5 lph, and five initial volumetric soil water contents. Simulation of water flow from a single surface emitter was carried out by using the numerically-based software Hydrus-2D/3D, Version 2.04. Two approaches were used in developing formulas to predict the domains of the wetted pattern. In order to verify the results obtained by implementing the software Hydrus-2D/3D a field experiment was conducted to measure the wetted diameter and compare measured values with simulated ones. The results of the research showed that the developed formulas to express the wetted diameter and depth in terms of emitter discharge, time of application, and initial soil water content are very general and can be used with very good accuracy.

  10. Evaluation of ATP measurements to detect microbial ingress by wastewater and surface water in drinking water.

    Science.gov (United States)

    Vang, Óluva K; Corfitzen, Charlotte B; Smith, Christian; Albrechtsen, Hans-Jørgen

    2014-11-01

    Fast and reliable methods are required for monitoring of microbial drinking water quality in order to protect public health. Adenosine triphosphate (ATP) was investigated as a potential real-time parameter for detecting microbial ingress in drinking water contaminated with wastewater or surface water. To investigate the ability of the ATP assay in detecting different contamination types, the contaminant was diluted with non-chlorinated drinking water. Wastewater, diluted at 10(4) in drinking water, was detected with the ATP assay, as well as 10(2) to 10(3) times diluted surface water. To improve the performance of the ATP assay in detecting microbial ingress in drinking water, different approaches were investigated, i.e. quantifying microbial ATP or applying reagents of different sensitivities to reduce measurement variations; however, none of these approaches contributed significantly in this respect. Compared to traditional microbiological methods, the ATP assay could detect wastewater and surface water in drinking water to a higher degree than total direct counts (TDCs), while both heterotrophic plate counts (HPC 22 °C and HPC 37 °C) and Colilert-18 (Escherichia coli and coliforms) were more sensitive than the ATP measurements, though with much longer response times. Continuous sampling combined with ATP measurements displays definite monitoring potential for microbial drinking water quality, since microbial ingress in drinking water can be detected in real-time with ATP measurements. The ability of the ATP assay to detect microbial ingress is influenced by both the ATP load from the contaminant itself and the ATP concentration in the specific drinking water. Consequently, a low ATP concentration of the specific drinking water facilitates a better detection of a potential contamination of the water supply with the ATP assay. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Near-field Oblique Remote Sensing of Stream Water-surface Elevation, Slope, and Surface Velocity

    Science.gov (United States)

    Minear, J. T.; Kinzel, P. J.; Nelson, J. M.; McDonald, R.; Wright, S. A.

    2014-12-01

    A major challenge for estimating discharges during flood events or in steep channels is the difficulty and hazard inherent in obtaining in-stream measurements. One possible solution is to use near-field remote sensing to obtain simultaneous water-surface elevations, slope, and surface velocities. In this test case, we utilized Terrestrial Laser Scanning (TLS) to remotely measure water-surface elevations and slope in combination with surface velocities estimated from particle image velocimetry (PIV) obtained by video-camera and/or infrared camera. We tested this method at several sites in New Mexico and Colorado using independent validation data consisting of in-channel measurements from survey-grade GPS and Acoustic Doppler Current Profiler (ADCP) instruments. Preliminary results indicate that for relatively turbid or steep streams, TLS collects tens of thousands of water-surface elevations and slopes in minutes, much faster than conventional means and at relatively high precision, at least as good as continuous survey-grade GPS measurements. Estimated surface velocities from this technique are within 15% of measured velocity magnitudes and within 10 degrees from the measured velocity direction (using extrapolation from the shallowest bin of the ADCP measurements). Accurately aligning the PIV results into Cartesian coordinates appears to be one of the main sources of error, primarily due to the sensitivity at these shallow oblique look angles and the low numbers of stationary objects for rectification. Combining remotely-sensed water-surface elevations, slope, and surface velocities produces simultaneous velocity measurements from a large number of locations in the channel and is more spatially extensive than traditional velocity measurements. These factors make this technique useful for improving estimates of flow measurements during flood flows and in steep channels while also decreasing the difficulty and hazard associated with making measurements in these

  12. Characteristics of meter-scale surface electrical discharge propagating along water surface at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Hoffer, Petr; Sugiyama, Y.; Hosseini, S.H.R.; Akiyama, H.; Lukeš, Petr; Akiyama, M.

    2016-01-01

    Roč. 49, č. 41 (2016), č. článku 415202. ISSN 0022-3727 Institutional support: RVO:61389021 Keywords : water surface * spectroscopy * high-speed photography * pulsed plasma discharge * Atmospheric - pressure plasmas * electric discharges * liquids * water Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 2.588, year: 2016 http://iopscience.iop.org/article/10.1088/0022-3727/49/41/415202

  13. Characteristics of meter-scale surface electrical discharge propagating along water surface at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Hoffer, Petr; Sugiyama, Y.; Hosseini, S.H.R.; Akiyama, H.; Lukeš, Petr; Akiyama, M.

    2016-01-01

    Roč. 49, č. 41 (2016), č. článku 415202. ISSN 0022-3727 Institutional support: RVO:61389021 Keywords : water surface * spectroscopy * high-speed photography * pulsed plasma discharge * Atmospheric-pressure plasmas * electric discharges * liquids * water Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 2.588, year: 2016 http://iopscience.iop.org/article/10.1088/0022-3727/49/41/415202

  14. Spatial aspects of surface water quality in the Jakara Basin, Nigeria using chemometric analysis.

    Science.gov (United States)

    Mustapha, Adamu; Aris, Ahmad Zaharin

    2012-01-01

    Multivariate statistical techniques such as hierarchical Agglomerated cluster analysis (HACA), discriminant analysis (DA), principal component analysis (PCA), and factor analysis (FA) were applied to identify the spatial variation and pollution sources of Jakara River, Kano, Nigeria. Thirty surface water samples were collected: 23 along Getsi River and 7 along the main channel of River Jakara. Twenty-three water quality parameters, namely pH, temperature, turbidity, electrical conductivity (EC), dissolved oxygen (DO), 5-day biochemical oxygen demand (BOD(5)), Faecal coliform, total solids (TS), nitrates (NO(3)(-)), phosphates (PO(4)(3-)), cobalt (Co), iron (Fe), nickel (Ni), manganese (Mn), copper (Cu), sodium (Na), potassium (K), mercury (Hg), chromium (Cr), cadmium (Cd), lead (Pb), magnesium (Mg), and calcium(Ca) were analysed. HACA grouped the sampling points into three clusters based on the similarities of river water quality characteristics: industrial, domestic, and agricultural water pollution sources. Forward and backward DA effectively discriminated 5 and 15 water quality variables, respectively, each assigned with 100% correctness from the original 23 variables. PCA and FA were used to investigate the origin of each water quality parameter due to various land use activities, 7 principal components were obtained with 77.5% total variance, and in addition PCA identified 3 latent pollution sources to support HACA. From this study, one can conclude that the application of multivariate techniques derives meaningful information from water quality data.

  15. Self-induced free surface oscillations caused by water jet

    International Nuclear Information System (INIS)

    Fukaya, M.; Madarame, H.; Okamoto, K.; Iida, M.; Someya, S.

    1995-01-01

    The interaction between the high speed flow and the free surfaces could induced surface oscillations. Recently, some kinds of self-induced free surface oscillations caused by water jet were discovered, e.g., a self-induced sloshing, 'Jet-Flutter' and a self-induced manometer oscillation. These oscillations have many different characteristics with each other. In this study, the similarities and differences of these oscillations are examined, and the geometrical effects on the phenomena are experimentally investigated. The self-induced sloshing and the Jet-Flutter have different dimensionless traveling times, which suggests a difference in the energy supply mechanism. When the distance between the inlet and the outlet is small in a vessel, the self-induced manometer oscillation could occur in the multi-free-surface system. (author)

  16. The Character of the Solar Wind, Surface Interactions, and Water

    Science.gov (United States)

    Farrell, William M.

    2011-01-01

    We discuss the key characteristics of the proton-rich solar wind and describe how it may interact with the lunar surface. We suggest that solar wind can be both a source and loss of water/OH related volatiles, and review models showing both possibilities. Energy from the Sun in the form of radiation and solar wind plasma are in constant interaction with the lunar surface. As such, there is a solar-lunar energy connection, where solar energy and matter are continually bombarding the lunar surface, acting at the largest scale to erode the surface at 0.2 Angstroms per year via ion sputtering [1]. Figure 1 illustrates this dynamically Sun-Moon system.

  17. The influence of the surface composition of mixed monolayer films on the evaporation coefficient of water.

    Science.gov (United States)

    Miles, Rachael E H; Davies, James F; Reid, Jonathan P

    2016-07-20

    We explore the dependence of the evaporation coefficient of water from aqueous droplets on the composition of a surface film, considering in particular the influence of monolayer mixed component films on the evaporative mass flux. Measurements with binary component films formed from long chain alcohols, specifically tridecanol (C13H27OH) and pentadecanol (C15H31OH), and tetradecanol (C14H29OH) and hexadecanol (C16H33OH), show that the evaporation coefficient is dependent on the mole fractions of the two components forming the monolayer film. Immediately at the point of film formation and commensurate reduction in droplet evaporation rate, the evaporation coefficient is equal to a mole fraction weighted average of the evaporation coefficients through the equivalent single component films. As a droplet continues to diminish in surface area with continued loss of water, the more-soluble, shorter alkyl chain component preferentially partitions into the droplet bulk with the evaporation coefficient tending towards that through a single component film formed simply from the less-soluble, longer chain alcohol. We also show that the addition of a long chain alcohol to an aqueous-sucrose droplet can facilitate control over the degree of dehydration achieved during evaporation. After undergoing rapid gas-phase diffusion limited water evaporation, binary aqueous-sucrose droplets show a continued slow evaporative flux that is limited by slow diffusional mass transport within the particle bulk due to the rapidly increasing particle viscosity and strong concentration gradients that are established. The addition of a long chain alcohol to the droplet is shown to slow the initial rate of water loss, leading to a droplet composition that remains more homogeneous for a longer period of time. When the sucrose concentration has achieved a sufficiently high value, and the diffusion constant of water has decreased accordingly so that bulk phase diffusion arrest occurs in the monolayer

  18. Mathematical modelling of ultrasonic testing of components with defects close to a non-planar surface

    International Nuclear Information System (INIS)

    Westlund, Jonathan; Bostroem, Anders

    2011-05-01

    Nondestructive testing with ultrasound is a standard procedure in the nuclear power industry. To develop and qualify the methods extensive experimental work with test blocks is usually required. This can be very time-consuming and costly and it also requires a good physical intuition of the situation. A reliable mathematical model of the testing situation can, therefore, be very valuable and cost-effective as it can reduce experimental work significantly. A good mathematical model enhances the physical intuition and is very useful for parametric studies, as a pedagogical tool, and for the qualification of procedures and personnel. The aim of the present report is to describe work that has been performed to model ultrasonic testing of components that contain a defect close to a nonplanar surface. For nuclear power applications this may be a crack or other defect on the inside of a pipe with a diameter change or connection. This is an extension of the computer program UTDefect, which previously only admits a planar back surface (which is often applicable also to pipes if the pipe diameter is large enough). The problems are investigated in both 2D and 3D, and in 2D both the simpler anti-plane (SH) and the in-plane (P-SV) problem are studied. The 2D investigations are primarily solved to get a 'feeling' for the solution procedure, the discretizations, etc. In all cases an integral equation approach with a Green's function in the kernel is taken. The nonplanar surface is treated by the boundary element method (BEM) where a division of the surface is made in small elements. The defects are mainly cracks, strip-like (in 2D) or rectangular (in 3D), and these are treated with more analytical methods. In 2D also more general defects are treated with the help of their transition (T) matrix. As in other parts of UTDefect the ultrasonic probes in transmission and reception are included in the model. In 3D normalization by a side drilled hole is possible. Some numerical results

  19. RISK ASSESSMENT OF SURFACE WATERS ASSOCIATED WITH WATER CIRCULATION TECHNOLOGIES ON TROUT FARMS

    Directory of Open Access Journals (Sweden)

    Marcin Sidoruk

    2014-07-01

    Full Text Available Dynamic development of aquaculture has led to an increasing impact on the status of surface waters. Fish production generates wastes that, at high concentrations, may present a serious risk to the aquatic environment. Studies on the assessment of the impact of water management technologies in trout production on the quality of surface waters were conducted in 2011. Six farms were selected for the studies and were divided into two groups based on water management solutions (n = 3: farms with a flow through system (FTS and farms with a recirculation aquaculture system (RAS. On all farms, water measurement points were set and they depicted the quality of inflow water, the quality of water in ponds and the quality of outflow water. The studies did not demonstrate any impact of applied technology on electrolyte conductivity or calcium and magnesium concentrations in outflow water from a trout operation. In addition, it was found that the use of water for production purposes resulted in a slight increase in phosphorus and total nitrogen concentrations in waste waters.

  20. Trace-level mercury removal from surface water

    International Nuclear Information System (INIS)

    Klasson, K.T.; Bostick, D.T.

    1998-01-01

    Many sorbents have been developed for the removal of mercury and heavy metals from waters; however, most of the data published thus far do not address the removal of mercury to the target levels represented in this project. The application to which these sorbents are targeted for use is the removal of mercury from microgram-per-liter levels to low nanogram-per-liter levels. Sorbents with thiouronium, thiol, amine, sulfur, and proprietary functional groups were selected for these studies. Mercury was successfully removed from surface water via adsorption onto Ionac SR-4 and Mersorb resins to levels below the target goal of 12 ng/L in batch studies. A thiol-based resin performed the best, indicating that over 200,000 volumes of water could be treated with one volume of resin. The cost of the resin is approximately $0.24 per 1,000 gal of water

  1. Modelling of long term nitrogen retention in surface waters

    Science.gov (United States)

    Halbfaß, S.; Gebel, M.; Bürger, S.

    2010-12-01

    In order to derive measures to reduce nutrient loadings into waters in Saxony, we calculated nitrogen inputs with the model STOFFBILANZ on the regional scale. Thereby we have to compare our modelling results to measured loadings at the river basin outlets, considering long term nutrient retention in surface waters. The most important mechanism of nitrogen retention is the denitrification in the contact zone of water and sediment, being controlled by hydraulic and micro-biological processes. Retention capacity is derived on the basis of the nutrient spiralling concept, using water residence time (hydraulic aspect) and time-specific N-uptake by microorganisms (biological aspect). Short time related processes of mobilization and immobilization are neglected, because they are of minor importance for the derivation of measures on the regional scale.

  2. Quality-control design for surface-water sampling in the National Water-Quality Network

    Science.gov (United States)

    Riskin, Melissa L.; Reutter, David C.; Martin, Jeffrey D.; Mueller, David K.

    2018-04-10

    The data-quality objectives for samples collected at surface-water sites in the National Water-Quality Network include estimating the extent to which contamination, matrix effects, and measurement variability affect interpretation of environmental conditions. Quality-control samples provide insight into how well the samples collected at surface-water sites represent the true environmental conditions. Quality-control samples used in this program include field blanks, replicates, and field matrix spikes. This report describes the design for collection of these quality-control samples and the data management needed to properly identify these samples in the U.S. Geological Survey’s national database.

  3. Prediction of water droplet evaporation on zircaloy surface

    International Nuclear Information System (INIS)

    Lee, Chi Young; In, Wang Kee

    2014-01-01

    In the present experimental study, the prediction of water droplet evaporation on a zircaloy surface was investigated using various initial droplet sizes. To the best of our knowledge, this may be the first valuable effort for understanding the details of water droplet evaporation on a zircaloy surface. The initial contact diameters of the water droplets tested ranged from 1.76 to 3.41 mm. The behavior (i.e., time-dependent droplet volume, contact angle, droplet height, and contact diameter) and mode-transition time of the water droplet evaporation were strongly influenced by the initial droplet size. Using the normalized contact angle (θ*) and contact diameter (d*), the transitions between evaporation modes were successfully expressed by a single curve, and their criteria were proposed. To predict the temporal droplet volume change and evaporation rate, the range of θ* > 0.25 and d* > 0.9, which mostly covered the whole evaporation period and the initial contact diameter remained almost constant during evaporation, was targeted. In this range, the previous contact angle functions for the evaporation model underpredicted the experimental data. A new contact angle function of a zircaloy surface was empirically proposed, which represented the present experimental data within a reasonable degree of accuracy. (author)

  4. Linking land use with pesticides in Dutch surface waters.

    Science.gov (United States)

    Van't, Zelfde M T; Tamis, W L M; Vijver, M G; De Snoo, G R

    2012-01-01

    Compared with other European countries The Netherlands has a relatively high level of pesticide consumption, particularly in agriculture. Many of the compounds concerned end up in surface waters. Surface water quality is routinely monitored and numerous pesticides are found to be present in high concentrations, with various standards being regularly exceeded. Many standards-breaching pesticides exhibit regional patterns that can be traced back to land use. These patterns have been statistically analysed by correlating surface area per land use category with standards exceedance per pesticide, thereby identifying numerous significant correlations with respect to breaches of both the ecotoxicological standard (Maximum Tolerable Risk, MTR) and the drinking water standard. In the case of the MTR, greenhouse horticulture, floriculture and bulb-growing have the highest number as well as percentage of standard-breaching pesticides, despite these market segments being relatively small in terms of area cropped. Cereals, onions, vegetables, perennial border plants and pulses are also associated with many pesticides that exceed the drinking water standard. When a correction is made for cropped acreage, cereals and potatoes also prove to be a major contributor to monitoring sites where the MTR standard is exceeded. Over the period 1998-2006 the land-use categories with the most and highest percentage of standards-exceeding pesticides (greenhouse horticulture, bulb-growing and flower cultivation) showed an increase in the percentage of standards-exceeding compounds.

  5. Radioactivity in the Dutch surface waters after Chernobylsk

    International Nuclear Information System (INIS)

    Kroesbergen, J.; Ballegooijen, L. van; Uunk, E.J.B.

    1988-12-01

    A survey is given of the impact of the nuclear accident in Chernobylsk upon the Dutch surface waters. With this the measurements, which have been performed in the various compartments (water, suspended matter, bottom, biota) are presented. Since the investigation is still going, the period from May 1986 - December 1987 has been chosen. This period is long enough in order to obtain an impression of the long-term effects. In chapter 2 a description is given of the measuring program performed and the analyzing methods employed. In chapter 3 the activation measurements in the surface waters, the suspended matter and the bottom are considered. Also the contamination of biologic matter and the purification mud is discussed. Chapter 4 gives a survey of the amount of radionuclides, which have been accumulated in the Dutch surface waters as a result of the Chernobylsk accident. The investigation of the processes are discussed in chapter 5. Since the study of the effects of radionuclides in the aquatic environment is still going, only some aspects are treated. Chapter 6 gives a general discussion of the results. Also an estimation is presented towards the future development of the contamination of the aquatic environment. Finally in chapter 7 the most important conclusions are summarized. Also some recommendations are made with regard to future measurements to be taken. (author). 72 refs.; 36 figs.; 26 tabs

  6. Analysis of water microdroplet condensation on silicon surfaces

    Science.gov (United States)

    Honda, Takuya; Fujimoto, Kenya; Yoshimoto, Yuta; Mogi, Katsuo; Kinefuchi, Ikuya; Sugii, Yasuhiko; Takagi, Shu; Univ. of Tokyo Team; Tokyo Inst. of Tech. Team

    2016-11-01

    We observed the condensation process of water microdroplets on flat silicon (100) surfaces by means of the sequential visualization of the droplets using an environmental scanning electron microscope. As previously reported for nanostructured surfaces, the condensation process of water microdroplets on the flat silicon surfaces also exhibits two modes: the constant base (CB) area mode and the constant contact angle (CCA) mode. In the CB mode, the contact angle increases with time while the base diameter is constant. Subsequently, in the CCA mode, the base diameter increases with time while the contact angle remains constant. The dropwise condensation model regulated by subcooling temperature does not reproduce the experimental results. Because the subcooling temperature is not constant in the case of a slow condensation rate, this model is not applicable to the condensation of the long time scale ( several tens of minutes). The contact angle of water microdroplets ( several μm) tended to be smaller than the macro contact angle. Two hypotheses are proposed as the cause of small contact angles: electrowetting and the coalescence of sub- μm water droplets.

  7. Pesticide monitoring in surface water and groundwater using passive samplers

    Science.gov (United States)

    Kodes, V.; Grabic, R.

    2009-04-01

    Passive samplers as screening devices have been used within a czech national water quality monitoring network since 2002 (SPMD and DGT samplers for non polar substances and metals). The passive sampler monitoring of surface water was extended to polar substances, in 2005. Pesticide and pharmaceutical POCIS samplers have been exposed in surface water at 21 locations and analysed for polar pesticides, perfluorinated compounds, personal care products and pharmaceuticals. Pesticide POCIS samplers in groundwater were exposed at 5 locations and analysed for polar pesticides. The following active substances of plant protection products were analyzed in surface water and groundwater using LC/MS/MS: 2,4,5-T, 2,4-D, Acetochlor, Alachlor, Atrazine, Atrazine_desethyl, Azoxystrobin, Bentazone, Bromacil, Bromoxynil, Carbofuran, Clopyralid, Cyanazin, Desmetryn, Diazinon, Dicamba, Dichlobenil, Dichlorprop, Dimethoat, Diuron, Ethofumesate, Fenarimol, Fenhexamid, Fipronil, Fluazifop-p-butyl, Hexazinone, Chlorbromuron, Chlorotoluron, Imazethapyr, Isoproturon, Kresoxim-methyl, Linuron, MCPA, MCPP, Metalaxyl, Metamitron, Methabenzthiazuron, Methamidophos, Methidathion, Metobromuron, Metolachlor, Metoxuron, Metribuzin, Monolinuron, Nicosulfuron, Phorate, Phosalone, Phosphamidon, Prometryn, Propiconazole, Propyzamide, Pyridate, Rimsulfuron, Simazine, Tebuconazole, Terbuthylazine, Terbutryn, Thifensulfuron-methyl, Thiophanate-methyl and Tri-allate. The POCIS samplers performed very well being able to provide better picture than grab samples. The results show that polar pesticides and also perfluorinated compounds, personal care products and pharmaceuticals as well occur in hydrosphere of the Czech republic. Acknowledgment: Authors acknowledge the financial support of grant No. 2B06095 by the Ministry of Education, Youth and Sports.

  8. Sensors and OBIA synergy for operational monitoring of surface water

    Science.gov (United States)

    Masson, Eric; Thenard, Lucas

    2010-05-01

    This contribution will focus on combining Object Based Image Analysis (i.e. OBIA with e-Cognition 8) and recent sensors (i.e. Spot 5 XS, Pan and ALOS Prism, Avnir2, Palsar) to address the technical feasibility for an operational monitoring of surface water. Three cases of river meandering (India), flood mapping (Nepal) and dam's seasonal water level monitoring (Morocco) using recent sensors will present various application of surface water monitoring. The operational aspect will be demonstrated either by sensor properties (i.e. spatial resolution and bandwidth), data acquisition properties (i.e. multi sensor, return period and near real-time acquisition) but also with OBIA algorithms (i.e. fusion of multi sensors / multi resolution data and batch processes). In the first case of river meandering (India) we will address multi sensor and multi date satellite acquisition to monitor the river bed mobility within a floodplain using an ALOS dataset. It will demonstrate the possibility of an operational monitoring system that helps the geomorphologist in the analysis of fluvial dynamic and sediment budget for high energy rivers. In the second case of flood mapping (Nepal) we will address near real time Palsar data acquisition at high spatial resolution to monitor and to map a flood extension. This ALOS sensor takes benefit both from SAR and L band properties (i.e. atmospheric transparency, day/night acquisition, low sensibility to surface wind). It's a real achievement compared to optical imagery or even other high resolution SAR properties (i.e. acquisition swath, bandwidth and data price). These advantages meet the operational needs set by crisis management of hydrological disasters but also for the implementation of flood risk management plans. The last case of dam surface water monitoring (Morocco) will address an important issue of water resource management in countries affected by water scarcity. In such countries water users have to cope with over exploitation

  9. Transitions for fipronil quant in surface water, Summary of Current Fipronil Water Data and Water Data for WWTPs

    Data.gov (United States)

    U.S. Environmental Protection Agency — Comparison of fipronil sources in North Carolina surface water and identification of a novel fipronil transformation product in recycled wastewater. This dataset is...

  10. Time series analysis of water surface temperature and heat flux components in the Itumbiara Reservoir (GO, Brazil Análise da série temporal da temperatura da superfície da água e dos componentes do balanço de calor no Reservatório de Itumbiara (GO, Brasil

    Directory of Open Access Journals (Sweden)

    Enner Herenio de Alcântara

    2011-09-01

    Full Text Available AIM: Water temperature plays an important role in ecological functioning and in controlling the biogeochemical processes of the aquatic system. Conventional water quality monitoring is expensive and time consuming. It is particularly challenging for large water bodies. Conversely, remote sensing can be considered a powerful tool to assess important properties of aquatic systems because it provides synoptic and frequent data acquisition over large areas. The objective of this study was to analyze time series of surface water temperature and heat flux to advance the understanding of temporal variations in a hydroelectric reservoir. METHOD: MODIS water-surface temperature (WST level 2, 1 km nominal resolution data (MOD11L2, version 5 were used. All available clear-sky MODIS/Terra images from 2003 to 2008 were used, resulting in a total of 786 daytime and 473 nighttime images. Time series of surface water temperature was obtained computing the monthly mean in a 3×3 window of three reservoir selected sites: 1 near the dam, 2 at the centre of the reservoir and 3 in the confluence of the rivers. In-situ meteorological data from 2003 to 2008 were used to calculate surface energy budget time series. Cross-wavelet, coherence and phase analysis were carried out to compute the correlation between daytime and nighttime surface water temperatures and the computed heat fluxes. RESULTS: The monthly mean of the day-time WST shows lager variability than the night-time WST. All time series (daytime and nighttime have a cyclical pattern, passing for a minimum (June - July and a maximum (December and January. Fourier and the Wavelet Analysis were applied to analyze this cyclical pattern. The daytime time series, presents peaks in 4.5, 6 12 and 36 months and the nighttime WST shows the highest spectral density at 12, 6, 3 and 2 months. The multiple regression analysis shows that for daytime WST, the heat flux terms explain 89% of the annual variation (RMS = 0.89

  11. Surface Water Quality Trends from EPA's LTM Network

    Science.gov (United States)

    Funk, C.; Lynch, J. A.

    2013-12-01

    Surface water chemistry provides direct indicators of the potential effects of anthropogenic impacts, such as acid deposition and climate change, on the overall health of aquatic ecosystems. Long-term surface water monitoring networks provide a host of environmental data that can be used, in conjunction with other networks, to assess how water bodies respond to stressors and if they are potentially at risk (e.g., receiving pollutant deposition beyond its critical load). Two EPA-administered monitoring programs provide information on the effects of acidic deposition on headwater aquatic systems: the Long Term Monitoring (LTM) program and the Temporally Integrated Monitoring of Ecosystems (TIME) program, designed to track the effectiveness of the 1990 Clean Air Act Amendments (CAAA) in reducing the acidity of surface waters in acid sensitive ecoregions of the Northeast and Mid-Atlantic. Here we present regional variability of long term trends in surface water quality in response to substantial reductions in atmospheric deposition. Water quality trends at acid sensitive LTM sites exhibit decreasing concentrations of sulfate at 100% of monitored sites in the Adirondack Mountains and New England, 80% of Northern Appalachian Plateau sites, and yet only 15% of sites in the Ridge and Blue Ridge Provinces over the 1990-2011 period of record. Across all regions, most LTM sites exhibited constant or only slightly declining nitrate concentrations over the same time period. Acid Neutralizing Capacity (ANC) levels improved at 68% and 45% of LTM sites in the Adirondacks and Northern Appalachian Plateau, respectively, but few sites showed increases in New England or the Ridge and Blue Ridge Provinces due to lagging improvements in base cation concentration. The ANC of northeastern TIME lakes was also evaluated from 1991 to 1994 and 2008 to 2011. The percentage of lakes with ANC values below 50 μeq/L, lakes of acute or elevated concern, dropped by about 7%, indicating improvement

  12. Tracer experiment by using radioisotope in surface water environment

    International Nuclear Information System (INIS)

    Suh, K.S.; Kim, K.C.; Chun, I.Y.; Jung, S.H.; Lee, C.W.

    2007-01-01

    Complete text of publication follows. 1. Objective An expansion of industrial activities and urbanization result in still increasing amount of pollutants discharged into surface water. Discharged pollutants in surface water have harmful effects on the ecology of a river system and human beings. Pollutants discharged into surface water is transported and dispersed under conditions characteristic to particular natural water receiver. Radiotracer method is a useful tool for monitoring the pollutant dispersion and description of mixing process taking place in natural streams. A tracer experiment using radioisotope was carried out to investigate the characteristics of a pollutant transport and a determination of the diffusion coefficients in a river system. 2. Methods The upper area of the Keum river was selected for the tracer experiment, which is located in a mid west of Korea. The measurements of the velocity and bathymetry before a tracer experiment were performed to select the sampling lines for a detection of the radioisotope. The radioisotope was instantaneously injected into a flow as a point source by an underwater glass-vial crusher. The detection was made with 60 2inch NaI(Tl) scintillation detectors at 3 transverse lines at a downstream position. The multi-channel data acquisition systems were used to collect and process the signals transmitted from the detectors. Two-dimensional numerical models were used to simulate the hydraulic parameters and the concentration distributions of the radioisotope injected into the river. 3. Results and Conclusion The calculated results such as velocity and concentrations were compared with the measured ones. The dispersion characteristics of the radioisotope were analyzed according to a variation of the flow rate, water level and diffusion coefficients. Also, the diffusion coefficients were calculated by using the measured concentrations and the coefficients obtained from the field experiment were compared with the ones

  13. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  14. Algae form brominated organic compounds in surface waters

    Energy Technology Data Exchange (ETDEWEB)

    Huetteroth, A; Putschew, A; Jekel, M [Tech. Univ. Berlin (Germany)

    2004-09-15

    Monitoring of organic halogen compounds, measured as adsorbable organic bromine (AOBr) revealed seasonal high concentrations of organic bromine compounds in a surface water (Lake Tegel, Berlin, Germany). Usually, in late summer, concentrations are up to five times higher than during the rest of the year. The AOBr of the lake inflows (throughout the year less then 6 {mu}g/L) were always lower then those in the lake, which indicates a production of AOBr in the lake. A correlation of the AOBr and chlorophyll-a concentration (1) in the lake provides first evidence for the influence of phototrophic organisms. The knowledge of the natural production of organohalogens is relatively recent. Up to now there are more then 3800 identified natural organohalogen compounds that have been detected in marine plants, animals, and bacteria and also in terrestrial plants, fungi, lichen, bacteria, insects, some higher animals, and humans. Halogenated organic compounds are commonly considered to be of anthropogenic origin; derived from e.g. pharmaceuticals, herbicides, fungicides, insecticides, flame retardants, intermediates in organic synthesis and solvents. Additionally they are also produced as by-products during industrial processes and by waste water and drinking water disinfection. Organohalogen compounds may be toxic, persistent and/or carcinogenic. In order to understand the source and environmental relevance of naturally produced organobromine compounds in surface waters, the mechanism of the formation was investigated using batch tests with lake water and algae cultures.

  15. The impact of land use on microbial surface water pollution.

    Science.gov (United States)

    Schreiber, Christiane; Rechenburg, Andrea; Rind, Esther; Kistemann, Thomas

    2015-03-01

    Our knowledge relating to water contamination from point and diffuse sources has increased in recent years and there have been many studies undertaken focusing on effluent from sewage plants or combined sewer overflows. However, there is still only a limited amount of microbial data on non-point sources leading to diffuse pollution of surface waters. In this study, the concentrations of several indicator micro-organisms and pathogens in the upper reaches of a river system were examined over a period of 16 months. In addition to bacteria, diffuse pollution caused by Giardia lamblia and Cryptosporidium spp. was analysed. A single land use type predestined to cause high concentrations of all microbial parameters could not be identified. The influence of different land use types varies between microbial species. The microbial concentration in river water cannot be explained by stable non-point effluent concentrations from different land use types. There is variation in the ranking of the potential of different land use types resulting in surface water contamination with regard to minimum, median and maximum effects. These differences between median and maximum impact indicate that small-scale events like spreading manure substantially influence the general contamination potential of a land use type and may cause increasing micro-organism concentrations in the river water by mobilisation during the next rainfall event. Copyright © 2014 Elsevier GmbH. All rights reserved.

  16. Studies on the treatment of surface water using rajma seeds

    Directory of Open Access Journals (Sweden)

    Merlin S. Babitha

    2018-03-01

    Full Text Available Indiscriminate disposal of wastewater with suspended solids have led to higher amount of pollution to the natural water bodies. Turbidity removal becomes an essential part in the water treatment when surface water is used for drinking purpose, this can be achieved by means of coagulation process. Coagulation process is the dosing of a coagulant in water, resulting in the destabilization of negatively charged particles. Commercial coagulants which were widely used can synthesize by-products in turn may pollute the environment and deteriorate the ecosystem at a slow rate. So, now-a-days natural coagulants are used as a potential substitute because it’s biodegradable, ecofriendly and non-toxic. In this study, the turbid surface water samples were treated using powdered seeds of Rajma (natural coagulant followed by variations in dosage, settling time and pH were also studied. From the results obtained, it was found that the Rajma seeds powder achieved 48.80% efficiency for 0.5 g/l of optimum dose at pH 6 for 20 min settling time respectively.

  17. Studies on the treatment of surface water using rajma seeds

    Science.gov (United States)

    Merlin, S. Babitha; Abirami, M.; Kumar, R. Suresh

    2018-03-01

    Indiscriminate disposal of wastewater with suspended solids have led to higher amount of pollution to the natural water bodies. Turbidity removal becomes an essential part in the water treatment when surface water is used for drinking purpose, this can be achieved by means of coagulation process. Coagulation process is the dosing of a coagulant in water, resulting in the destabilization of negatively charged particles. Commercial coagulants which were widely used can synthesize by-products in turn may pollute the environment and deteriorate the ecosystem at a slow rate. So, now-a-days natural coagulants are used as a potential substitute because it's biodegradable, ecofriendly and non-toxic. In this study, the turbid surface water samples were treated using powdered seeds of Rajma (natural coagulant) followed by variations in dosage, settling time and pH were also studied. From the results obtained, it was found that the Rajma seeds powder achieved 48.80% efficiency for 0.5 g/l of optimum dose at pH 6 for 20 min settling time respectively.

  18. GSFLOW - Coupled Ground-Water and Surface-Water Flow Model Based on the Integration of the Precipitation-Runoff Modeling System (PRMS) and the Modular Ground-Water Flow Model (MODFLOW-2005)

    Science.gov (United States)

    Markstrom, Steven L.; Niswonger, Richard G.; Regan, R. Steven; Prudic, David E.; Barlow, Paul M.

    2008-01-01

    The need to assess the effects of variability in climate, biota, geology, and human activities on water availability and flow requires the development of models that couple two or more components of the hydrologic cycle. An integrated hydrologic model called GSFLOW (Ground-water and Surface-water FLOW) was developed to simulate coupled ground-water and surface-water resources. The new model is based on the integration of the U.S. Geological Survey Precipitation-Runoff Modeling System (PRMS) and the U.S. Geological Survey Modular Ground-Water Flow Model (MODFLOW). Additional model components were developed, and existing components were modified, to facilitate integration of the models. Methods were developed to route flow among the PRMS Hydrologic Response Units (HRUs) and between the HRUs and the MODFLOW finite-difference cells. This report describes the organization, concepts, design, and mathematical formulation of all GSFLOW model components. An important aspect of the integrated model design is its ability to conserve water mass and to provide comprehensive water budgets for a location of interest. This report includes descriptions of how water budgets are calculated for the integrated model and for individual model components. GSFLOW provides a robust modeling system for simulating flow through the hydrologic cycle, while allowing for future enhancements to incorporate other simulation techniques.

  19. Global analysis of urban surface water supply vulnerability

    International Nuclear Information System (INIS)

    Padowski, Julie C; Gorelick, Steven M

    2014-01-01

    This study presents a global analysis of urban water supply vulnerability in 71 surface-water supplied cities, with populations exceeding 750 000 and lacking source water diversity. Vulnerability represents the failure of an urban supply-basin to simultaneously meet demands from human, environmental and agricultural users. We assess a baseline (2010) condition and a future scenario (2040) that considers increased demand from urban population growth and projected agricultural demand. We do not account for climate change, which can potentially exacerbate or reduce urban supply vulnerability. In 2010, 35% of large cities are vulnerable as they compete with agricultural users. By 2040, without additional measures 45% of cities are vulnerable due to increased agricultural and urban demands. Of the vulnerable cities in 2040, the majority are river-supplied with mean flows so low (1200 liters per person per day, l/p/d) that the cities experience ‘chronic water scarcity’ (1370 l/p/d). Reservoirs supply the majority of cities facing individual future threats, revealing that constructed storage potentially provides tenuous water security. In 2040, of the 32 vulnerable cities, 14 would reduce their vulnerability via reallocating water by reducing environmental flows, and 16 would similarly benefit by transferring water from irrigated agriculture. Approximately half remain vulnerable under either potential remedy. (letter)

  20. Simulation of gas compressible flow by free surface water flow

    International Nuclear Information System (INIS)

    Altafini, C.R.; Silva Ferreira, R.T. da

    1981-01-01

    The analogy between the water flow with a free surface and the compressible fluid flow, commonly called hydraulic analogy, is analyzed and its limitations are identified. The water table is the equipment used for this simulation, which allows the quatitative analysis of subsonic and supersonic flow with a low cost apparatus. The hydraulic analogy is applied to subsonic flow around circular cylinders and supersonic flow around cones. The results are compared with available theoretical and experimental data and a good agreement is achieved. (Author) [pt

  1. Water condensation on ultrahydrophobic flexible micro pillar surface

    Science.gov (United States)

    Narhe, Ramchandra

    2016-05-01

    We investigated the growth dynamics of water drops in controlled condensation on ultrahydrophobic geometrically patterned polydimethylsiloxane (PDMS) cylindrical micro pillars. At the beginning, the condensed drops size is comparable to the pattern dimensions. The interesting phenomenon we observe is that, as the condensation progresses, water drops between the pillars become unstable and enforced to grow in the upward direction along the pillars surface. The capillary force of these drops is of the order of μ\\text{N} and acts on neighboring pillars. That results into bending of the pillars. Pillars bending enhances the condensation and favors the most energetically stable Wenzel state.

  2. Theoretical Insight of Physical Adsorption for a Single-Component Adsorbent + Adsorbate System: I. Thermodynamic Property Surfaces

    KAUST Repository

    Chakraborty, Anutosh; Saha, Bidyut Baran; Ng, Kim Choon; Koyama, Shigeru; Srinivasan, Kandadai

    2009-01-01

    Thermodynamic property surfaces for a single-component adsorbent + adsorbate system are derived and developed from the viewpoint of classical thermodynamics, thermodynamic requirements of chemical equilibrium, Gibbs law, and Maxwell relations

  3. Strategic Evaluation Tool for Surface Water Quality Management Remedies in Drinking Water Catchments

    Directory of Open Access Journals (Sweden)

    Huda Almaaofi

    2017-09-01

    Full Text Available Drinking water catchments (DWC are under pressure from point and nonpoint source pollution due to the growing human activities. This worldwide challenge is causing number of adverse effects, such as degradation in water quality, ecosystem health, and other economic and social pressures. Different evaluation tools have been developed to achieve sustainable and healthy drinking water catchments. However, a holistic and strategic framework is still required to adequately consider the uncertainty associated with feasible management remedies of surface water quality in drinking water catchments. A strategic framework was developed to adequately consider the uncertainty associated with management remedies for surface water quality in drinking water catchments. A Fuzzy Multiple Criteria Decision Analysis (FMCDA approach was embedded into a strategic decision support framework to evaluate and rank water quality remediation options within a typical fixed budget constraint faced by bulk water providers. The evaluation framework consists of four core aspects; namely, water quality, environmental, economic and social, and number of associated quantitative and qualitative criteria and sub-criteria. Final remediation strategy ranking was achieved through the application of the Euclidean Distance by the In-center of Centroids (EDIC.

  4. Evaluation of Human Enteric Viruses in Surface Water and Drinking Water Resources in Southern Ghana

    Science.gov (United States)

    Gibson, Kristen E.; Opryszko, Melissa C.; Schissler, James T.; Guo, Yayi; Schwab, Kellogg J.

    2011-01-01

    An estimated 884 million people worldwide do not have access to an improved drinking water source, and the microbial quality of these sources is often unknown. In this study, a combined tangential flow, hollow fiber ultrafiltration (UF), and real-time PCR method was applied to large volume (100 L) groundwater (N = 4), surface water (N = 9), and finished (i.e., receiving treatment) drinking water (N = 6) samples for the evaluation of human enteric viruses and bacterial indicators. Human enteric viruses including norovirus GI and GII, adenovirus, and polyomavirus were detected in five different samples including one groundwater, three surface water, and one drinking water sample. Total coliforms and Escherichia coli assessed for each sample before and after UF revealed a lack of correlation between bacterial indicators and the presence of human enteric viruses. PMID:21212196

  5. The study of dynamic force acted on water strider leg departing from water surface

    Science.gov (United States)

    Sun, Peiyuan; Zhao, Meirong; Jiang, Jile; Zheng, Yelong

    2018-01-01

    Water-walking insects such as water striders can skate on the water surface easily with the help of the hierarchical structure on legs. Numerous theoretical and experimental studies show that the hierarchical structure would help water strider in quasi-static case such as load-bearing capacity. However, the advantage of the hierarchical structure in the dynamic stage has not been reported yet. In this paper, the function of super hydrophobicity and the hierarchical structure was investigated by measuring the adhesion force of legs departing from the water surface at different lifting speed by a dynamic force sensor. The results show that the adhesion force decreased with the increase of lifting speed from 0.02 m/s to 0.4 m/s, whose mechanic is investigated by Energy analysis. In addition, it can be found that the needle shape setae on water strider leg can help them depart from water surface easily. Thus, it can serve as a starting point to understand how the hierarchical structure on the legs help water-walking insects to jump upward rapidly to avoid preying by other insects.

  6. Electrodialysis and nanofiltration of surface water for subsequent use as infiltration water.

    Science.gov (United States)

    Van der Bruggen, B; Milis, R; Vandecasteele, C; Bielen, P; Van San, E; Huysman, K

    2003-09-01

    In order to achieve stable groundwater levels, an equilibrium between the use of groundwater for drinking water production and natural or artificial groundwater recharge by infiltration is needed. Local governments usually require that the composition of the water used for artificial recharge is similar to the surface water that is naturally present in the specific recharge area. In this paper, electrodialysis (ED) and nanofiltration were evaluated as possible treatment technologies for surface water from a canal in Flanders, the North of Belgium, in view of infiltration at critical places on heathlands. Both methods were evaluated on the basis of a comparison between the water composition after treatment and the composition of local surface waters. The treatment generally consists of a tuning of pH and the removal of contaminants originating from industrial and agricultural activity, e.g., nitrates and pesticides. Further evaluation of the influence of the composition of the water on the characteristics of the artificial recharge, however, was not envisaged. In a case study of water from the canal Schoten-Dessel, satisfactory concentration reductions of Cl(-), SO(4)(2-), NO(3)(-), HCO(3)(-), Na(+), Mg(2+), K(+) and Ca(2+) were obtained by ultrafiltration pretreatment followed by ED. Nanofiltration with UTC-20, N30F, Desal 51 HL, UTC-60 and Desal 5 DL membranes resulted in an insufficient removal level, especially for the monovalent ions.

  7. The study of dynamic force acted on water strider leg departing from water surface

    Directory of Open Access Journals (Sweden)

    Peiyuan Sun

    2018-01-01

    Full Text Available Water-walking insects such as water striders can skate on the water surface easily with the help of the hierarchical structure on legs. Numerous theoretical and experimental studies show that the hierarchical structure would help water strider in quasi-static case such as load-bearing capacity. However, the advantage of the hierarchical structure in the dynamic stage has not been reported yet. In this paper, the function of super hydrophobicity and the hierarchical structure was investigated by measuring the adhesion force of legs departing from the water surface at different lifting speed by a dynamic force sensor. The results show that the adhesion force decreased with the increase of lifting speed from 0.02 m/s to 0.4 m/s, whose mechanic is investigated by Energy analysis. In addition, it can be found that the needle shape setae on water strider leg can help them depart from water surface easily. Thus, it can serve as a starting point to understand how the hierarchical structure on the legs help water-walking insects to jump upward rapidly to avoid preying by other insects.

  8. Mathematical modelization of surface waters for drinking water; Modelizacion matematica de la potabilizacion de aguas superficiales

    Energy Technology Data Exchange (ETDEWEB)

    Marin Llanes, L.A.; Alvarez Rosell, S.

    1995-06-01

    The application of the general strategy of deterministic modelling to the water treatment for human consumption process for surface waters is treated in this paper. Deterministic models that describe the behaviour of clarification processes: coagulation-flocculation an filtration with respect to the principal parameters that define the water principal parameters that define the water quality: turbidity, color, pH, organic matter an presence of iron, manganese and aluminium cations were obtained. The models have been checked in actual operation conditions of water treatment plant for human consumption located in Campo Florido, Havana, cuba, named Planta Norte Habana. This plant receives water from three dams. The obtained results were good. The models are valid to describe the process, to corroborate the main theories related to water clarification and to know more about this process. The complexity of the models permits their rapid and efficient solution even without the aid of a digital computer. (Author) 5 refs.

  9. Hot water surface pasteurization for inactivating Salmonella on surfaces of mature green tomatoes

    Science.gov (United States)

    Outbreaks of salmonellosis have been associated with the consumption of tomatoes contaminated with Salmonella. Commercial washing processes for tomatoes are limited in their ability to inactivate and/or remove this human pathogen. Our objective was to develop a hot water surface pasteurization pro...

  10. Research of application of new material to light water reactor components

    International Nuclear Information System (INIS)

    Mihara, Tanetoyo

    1992-01-01

    Advanced Nuclear Equipment Research Institute (ANERI) has been doing the research to apply the new material including metal, fine ceramics and high polymer which were developed and applied in other industries to components and parts of light water reactor for the purpose of Improvement of reliability of components, improvement of efficiency of periodic inspection, improvement of repair and reduction of radiation exposure of worker. This project started upon the sponsorship of Ministry of International Trade and Industry (MITI) by the schedule of FY1985-FY1993 (9 years) and effective results has been obtained. (author)

  11. Radionuclide transfer onto ground surface in surface water flow. 2. Undisturbed tuff rock

    International Nuclear Information System (INIS)

    Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu

    1994-09-01

    Radionuclide migration with ground surface water flow is considered to be one of path ways in the scenario for environmental migration of the radionuclide leaked from LLRW depository. To study the radionuclide migration demonstratively, a ground surface radionuclide migration test was carried out by simulating radioactive solution flowing on the sloped tuff rock surface. Tuff rock sample of 240 cm in length taken from the Shimokita district was used to test the transfer of 60 Co, 85 Sr and 137 Cs onto the sample surface from the flowing radioactive solution under restricted infiltration condition at flow rates of 25, 80, 160ml/min and duration of 56h. The concentration change of the radionuclides in effluent was nearly constant as a function of elapsed time during the experimental period, but decreased with lower flow rates. Among the three radionuclides, 137 Cs was greatly decreased its concentration to 30% of the inflow. Adsorbed distribution of the radionuclides concentration on the ground surface decreased gradually with the distance from the inlet, and showed greater gradient at lower flow rate. Analyzing the result by the migration model, where a vertical advection distribution and two-dimensional diffusion in surface water are adopted with a first order adsorption reaction, value of migration parameters was obtained relating to the radionuclide adsorption and the surface water flow, and the measured distribution could be well simulated by adopting the value to the model. By comparing the values with the case of loamy soil layer, all values of the migration parameters showed not so great difference between two samples for 60 Co and 85 Sr. For 137 Cs, reflecting a few larger value of adsorption to the tuff rock, larger ability to reduce the concentration of flowing radioactive solution could be indicated than that to the loamy soil surface by estimation for long flowed distance. (author)

  12. Surface-Water and Ground-Water Interactions in the Central Everglades, Florida

    Science.gov (United States)

    Harvey, Judson W.; Newlin, Jessica T.; Krest, James M.; Choi, Jungyill; Nemeth, Eric A.; Krupa, Steven L.

    2004-01-01

    Recharge and discharge are hydrological processes that cause Everglades surface water to be exchanged for subsurface water in the peat soil and the underlying sand and limestone aquifer. These interactions are thought to be important to water budgets, water quality, and ecology in the Everglades. Nonetheless, relatively few studies of surface water and ground water interactions have been conducted in the Everglades, especially in its vast interior areas. This report is a product of a cooperative investigation conducted by the USGS and the South Florida Water Management District (SFWMD) aimed at developing and testing techniques that would provide reliable estimates of recharge and discharge in interior areas of WCA-2A (Water Conservation Area 2A) and several other sites in the central Everglades. The new techniques quantified flow from surface water to the subsurface (recharge) and the opposite (discharge) using (1) Darcy-flux calculations based on measured vertical gradients in hydraulic head and hydraulic conductivity of peat; (2) modeling transport through peat and decay of the naturally occurring isotopes 224Ra and 223Ra (with half-lives of 4 and 11 days, respectively); and (3) modeling transport and decay of naturally occurring and 'bomb-pulse' tritium (half-life of 12.4 years) in ground water. Advantages and disadvantages of each method for quantifying recharge and discharge were compared. In addition, spatial and temporal variability of recharge and discharge were evaluated and controlling factors identified. A final goal was to develop appropriately simplified (that is, time averaged) expressions of the results that will be useful in addressing a broad range of hydrological and ecological problems in the Everglades. Results were compared with existing information about water budgets from the South Florida Water Management Model (SFWMM), a principal tool used by the South Florida Water Management District to plan many of the hydrological aspects of the

  13. Control of water infiltration into near surface LLW disposal units

    International Nuclear Information System (INIS)

    O'Donnell, E.; Ridky, R.W.; Schulz, R.K.

    1989-01-01

    Water infiltration to buried waste is the prime problem of concern in designing waste disposal units for the humid areas. Conventional compacted clay layers (resistance layer barriers) have been subject to failure by subsidence and by permeability increases brought about by plant roots. A clay barrier with a rock cover sans plants is being investigated. Also a combination of a resistive layer overlying a conductive layer is being investigated. Laboratory studies indicate that this approach can be very effective and field evaluations are underway. However, it must be noted that subsidence will negate the effectiveness of any buried layer barriers. A surface barrier (bioengineering management) has been valuated in the field and found to be very effective in preventing water entry into waste disposal units. This surface barrier is easily repairable if damaged by subsidence and could be the system of choice under active subsidence conditions

  14. Surface characterization of polymethylmetacrylate bombarded by charged water droplets

    International Nuclear Information System (INIS)

    Hiraoka, Kenzo; Takaishi, Riou; Asakawa, Daiki; Sakai, Yuji; Iijima, Yoshitoki

    2009-01-01

    The electrospray droplet impact (EDI), in which the charged electrospray water droplets are introduced in vacuum, accelerated, and allowed to impact the sample, is applied to polymethylmetacrylate (PMMA). The secondary ions generated were measured by an orthogonal time-of-flight mass spectrometer. In EDI mass spectra for PMMA, fragment ions originating from PMMA could not be detected. This is due to the fact that the proton affinities of fragments formed from PMMA are smaller than those from acetic acid contained in the charged droplet. The x-ray photoelectron spectroscopy spectra of PMMA irradiated by water droplets did not change with prolonged cluster irradiation, i.e., EDI is capable of shallow surface etching for PMMA with a little damage of the sample underneath the surface.

  15. Detection of explosives on the surface of banknotes by Raman hyperspectral imaging and independent component analysis.

    Science.gov (United States)

    Almeida, Mariana R; Correa, Deleon N; Zacca, Jorge J; Logrado, Lucio Paulo Lima; Poppi, Ronei J

    2015-02-20

    The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50 μg cm(-2). Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Capillary condensation of water between mica surfaces above and below zero-effect of surface ions.

    Science.gov (United States)

    Nowak, Dominika; Christenson, Hugo K

    2009-09-01

    We have studied the capillary condensation of water from saturated vapor below 0 degrees C in the annular wedge-pore formed around two mica surfaces in contact in a surface force apparatus. The condensed water remains liquid down to at least -9 degrees C, and the measured condensate size is close to the predictions of a recent model for the dependence of the interfacial curvature of supercooled capillary condensates on temperature and surface tension. The small deviation observed may be accounted for by assuming that solute as K(2)CO(3) from the mica-condensate interface dissolves in the condensates and gives rise to an additional depression of the freezing point apart from that caused by the interface curvature. By contrast, measurements of the interface curvature at relative vapor pressures of 0.95-0.99 at 20 degrees C confirm a significantly larger deviation from the Kelvin equation. The magnitude of the deviation is in remarkable agreement with that calculated from the results of an earlier study of capillary condensation of water from a nonpolar liquid, also at T = 20 degrees C. Evidently, additional solute from the surrounding mica surface migrates into the condensates at room temperature. We conclude that the surface diffusion of ions on mica is much slower at subzero temperatures than at room temperature.

  17. Integrating remotely sensed surface water extent into continental scale hydrology.

    Science.gov (United States)

    Revilla-Romero, Beatriz; Wanders, Niko; Burek, Peter; Salamon, Peter; de Roo, Ad

    2016-12-01

    In hydrological forecasting, data assimilation techniques are employed to improve estimates of initial conditions to update incorrect model states with observational data. However, the limited availability of continuous and up-to-date ground streamflow data is one of the main constraints for large-scale flood forecasting models. This is the first study that assess the impact of assimilating daily remotely sensed surface water extent at a 0.1° × 0.1° spatial resolution derived from the Global Flood Detection System (GFDS) into a global rainfall-runoff including large ungauged areas at the continental spatial scale in Africa and South America. Surface water extent is observed using a range of passive microwave remote sensors. The methodology uses the brightness temperature as water bodies have a lower emissivity. In a time series, the satellite signal is expected to vary with changes in water surface, and anomalies can be correlated with flood events. The Ensemble Kalman Filter (EnKF) is a Monte-Carlo implementation of data assimilation and used here by applying random sampling perturbations to the precipitation inputs to account for uncertainty obtaining ensemble streamflow simulations from the LISFLOOD model. Results of the updated streamflow simulation are compared to baseline simulations, without assimilation of the satellite-derived surface water extent. Validation is done in over 100 in situ river gauges using daily streamflow observations in the African and South American continent over a one year period. Some of the more commonly used metrics in hydrology were calculated: KGE', NSE, PBIAS%, R 2 , RMSE, and VE. Results show that, for example, NSE score improved on 61 out of 101 stations obtaining significant improvements in both the timing and volume of the flow peaks. Whereas the validation at gauges located in lowland jungle obtained poorest performance mainly due to the closed forest influence on the satellite signal retrieval. The conclusion is that

  18. Evaporation kinetics of sessile water droplets on micropillared superhydrophobic surfaces.

    Science.gov (United States)

    Xu, Wei; Leeladhar, Rajesh; Kang, Yong Tae; Choi, Chang-Hwan

    2013-05-21

    Evaporation modes and kinetics of sessile droplets of water on micropillared superhydrophobic surfaces are experimentally investigated. The results show that a constant contact radius (CCR) mode and a constant contact angle (CCA) mode are two dominating evaporation modes during droplet evaporation on the superhydrophobic surfaces. With the decrease in the solid fraction of the superhydrophobic surfaces, the duration of a CCR mode is reduced and that of a CCA mode is increased. Compared to Rowan's kinetic model, which is based on the vapor diffusion across the droplet boundary, the change in a contact angle in a CCR (pinned) mode shows a remarkable deviation, decreasing at a slower rate on the superhydrophobic surfaces with less-solid fractions. In a CCA (receding) mode, the change in a contact radius agrees well with the theoretical expectation, and the receding speed is slower on the superhydrophobic surfaces with lower solid fractions. The discrepancy between experimental results and Rowan's model is attributed to the initial large contact angle of a droplet on superhydrophobic surfaces. The droplet geometry with a large contact angle results in a narrow wedge region of air along the contact boundary, where the liquid-vapor diffusion is significantly restricted. Such an effect becomes minor as the evaporation proceeds with the decrease in a contact angle. In both the CCR and CCA modes, the evaporative mass transfer shows the linear relationship between mass(2/3) and evaporation time. However, the evaporation rate is slower on the superhydrophobic surfaces, which is more significant on the surfaces with lower solid fractions. As a result, the superhydrophobic surfaces slow down the drying process of a sessile droplet on them.

  19. Impact of river restoration on groundwater - surface water - interactions

    Science.gov (United States)

    Kurth, Anne-Marie; Schirmer, Mario

    2014-05-01

    Since the end of the 19th century, flood protection was increasingly based on the construction of impermeable dams and side walls (BWG, 2003). In spite of providing flood protection, these measures also limited the connectivity between the river and the land, restricted the area available for flooding, and hampered the natural flow dynamics of the river. Apart from the debilitating effect on riverine ecosystems due to loss of habitats, these measures also limited bank filtration, inhibited the infiltration of storm water, and affected groundwater-surface water-interactions. This in turn had a profound effect on ecosystem health, as a lack of groundwater-surface water interactions led to decreased cycling of pollutants and nutrients in the hyporheic zone and limited the moderation of the water temperature (EA, 2009). In recent decades, it has become apparent that further damages to riverine ecosystems must be prohibited, as the damages to ecology, economy and society surmount any benefits gained from exploiting them. Nowadays, the restoration of rivers is a globally accepted means to restore ecosystem functioning, protect water resources and amend flood protection (Andrea et al., 2012; Palmer et al., 2005; Wortley et al., 2013). In spite of huge efforts regarding the restoration of rivers over the last 30 years, the question of its effectiveness remains, as river restorations often reconstruct a naturally looking rather than a naturally functioning stream (EA, 2009). We therefore focussed our research on the effectiveness of river restorations, represented by the groundwater-surface water-interactions. Given a sufficiently high groundwater level, a lack of groundwater-surface water-interactions after restoration may indicate that the vertical connectivity in the stream was not fully restored. In order to investigate groundwater-surface water-interactions we determined the thermal signature on the stream bed and in +/- 40 cm depth by using Distributed Temperature

  20. Estimation of precipitable water from surface dew point temperature

    International Nuclear Information System (INIS)

    Abdel Wahab, M.; Sharif, T.A.

    1991-09-01

    The Reitan (1963) regression equation which is of the form lnw=a+bT d has been examined and tested to estimate precipitable water content from surface dew point temperature at different locations. The study confirms that the slope of this equation (b) remains constant at the value of .0681 deg. C., while the intercept (a) changes rapidly with the latitude. The use of the variable intercept can improve the estimated result by 2%. (author). 6 refs, 4 figs, 3 tabs

  1. Effects of pulsating water jet impact on aluminium surface

    Czech Academy of Sciences Publication Activity Database

    Foldyna, Josef; Sitek, Libor; Ščučka, Jiří; Martinec, Petr; Valíček, Jan; Páleníková, K.

    2009-01-01

    Roč. 2009, č. 20 (2009), s. 6174-6180 ISSN 0924-0136 R&D Projects: GA ČR GA101/07/1451; GA ČR GP101/07/P512 Institutional research plan: CEZ:AV0Z30860518 Keywords : pulsating water jet * jet impact * material erosion * surface characteristics Subject RIV: JQ - Machines ; Tools Impact factor: 1.420, year: 2009 http://www.sciencedirect.com/science

  2. Surface Interrogation Scanning Electrochemical Microscopy for a Photoelectrochemical Reaction: Water Oxidation on a Hematite Surface.

    Science.gov (United States)

    Kim, Jae Young; Ahn, Hyun S; Bard, Allen J

    2018-03-06

    To understand the pathway of a photoelectrochemical (PEC) reaction, quantitative knowledge of reaction intermediates is important. We describe here surface interrogation scanning electrochemical microscopy for this purpose (PEC SI-SECM), where a light pulse to a photoactive semiconductor film at a given potential generates intermediates that are then analyzed by a tip generated titrant at known times after the light pulse. The improvements were demonstrated for photoelectrochemical water oxidation (oxygen evolution) reaction on a hematite surface. The density of photoactive sites, proposed to be Fe 4+ species, on a hematite surface was successfully quantified, and the photoelectrochemical water oxidation reaction dynamics were elucidated by time-dependent redox titration experiments. The new configuration of PEC SI-SECM should find expanded usage to understand and investigate more complicated PEC reactions with other materials.

  3. Improvement of a land surface model for accurate prediction of surface energy and water balances

    International Nuclear Information System (INIS)

    Katata, Genki

    2009-02-01

    In order to predict energy and water balances between the biosphere and atmosphere accurately, sophisticated schemes to calculate evaporation and adsorption processes in the soil and cloud (fog) water deposition on vegetation were implemented in the one-dimensional atmosphere-soil-vegetation model including CO 2 exchange process (SOLVEG2). Performance tests in arid areas showed that the above schemes have a significant effect on surface energy and water balances. The framework of the above schemes incorporated in the SOLVEG2 and instruction for running the model are documented. With further modifications of the model to implement the carbon exchanges between the vegetation and soil, deposition processes of materials on the land surface, vegetation stress-growth-dynamics etc., the model is suited to evaluate an effect of environmental loads to ecosystems by atmospheric pollutants and radioactive substances under climate changes such as global warming and drought. (author)

  4. Mass transfer behavior of tritium from air to water through the water surface

    International Nuclear Information System (INIS)

    Takata, Hiroki; Nishikawa, Masabumi; Kamimae, Kozo

    2005-01-01

    It is anticipated that a certain amount of tritiated water exists in the atmosphere of tritium handling facilities, and it is recognized that the hazardous potential of tritiated water is rather high. Then, it is important to grasp the behavior of tritiated water for preserving of the radiation safety. The mass transfer behavior of tritium from air to water through the water surface was discussed in this study. The evaporation rate of water and the condensation rate of water were experimentally examined from measurement of change of the weight of distilled water. The tritium transfer rate from the tritiated water in air to the distilled water was also experimentally examined by using a liquid scintillation counter. Experimental results about change of tritium level in a small beaker placed in the atmosphere with tritiated water showed that diffusion of tritium in water and gas flow in the atmosphere gives considerable effect on tritium transfer. The estimation method of the tritium transfer made in this study was applied to explain the data at The Japan Atomic Power Company second power station at Tsuruga and good agreement was obtained. (author)

  5. Macro-invertebrate decline in surface water polluted with imidacloprid.

    Directory of Open Access Journals (Sweden)

    Tessa C Van Dijk

    Full Text Available Imidacloprid is one of the most widely used insecticides in the world. Its concentration in surface water exceeds the water quality norms in many parts of the Netherlands. Several studies have demonstrated harmful effects of this neonicotinoid to a wide range of non-target species. Therefore we expected that surface water pollution with imidacloprid would negatively impact aquatic ecosystems. Availability of extensive monitoring data on the abundance of aquatic macro-invertebrate species, and on imidacloprid concentrations in surface water in the Netherlands enabled us to test this hypothesis. Our regression analysis showed a significant negative relationship (P<0.001 between macro-invertebrate abundance and imidacloprid concentration for all species pooled. A significant negative relationship was also found for the orders Amphipoda, Basommatophora, Diptera, Ephemeroptera and Isopoda, and for several species separately. The order Odonata had a negative relationship very close to the significance threshold of 0.05 (P = 0.051. However, in accordance with previous research, a positive relationship was found for the order Actinedida. We used the monitoring field data to test whether the existing three water quality norms for imidacloprid in the Netherlands are protective in real conditions. Our data show that macrofauna abundance drops sharply between 13 and 67 ng l(-1. For aquatic ecosystem protection, two of the norms are not protective at all while the strictest norm of 13 ng l(-1 (MTR seems somewhat protective. In addition to the existing experimental evidence on the negative effects of imidacloprid on invertebrate life, our study, based on data from large-scale field monitoring during multiple years, shows that serious concern about the far-reaching consequences of the abundant use of imidacloprid for aquatic ecosystems is justified.

  6. Macro-Invertebrate Decline in Surface Water Polluted with Imidacloprid

    Science.gov (United States)

    Van Dijk, Tessa C.; Van Staalduinen, Marja A.; Van der Sluijs, Jeroen P.

    2013-01-01

    Imidacloprid is one of the most widely used insecticides in the world. Its concentration in surface water exceeds the water quality norms in many parts of the Netherlands. Several studies have demonstrated harmful effects of this neonicotinoid to a wide range of non-target species. Therefore we expected that surface water pollution with imidacloprid would negatively impact aquatic ecosystems. Availability of extensive monitoring data on the abundance of aquatic macro-invertebrate species, and on imidacloprid concentrations in surface water in the Netherlands enabled us to test this hypothesis. Our regression analysis showed a significant negative relationship (Pmacro-invertebrate abundance and imidacloprid concentration for all species pooled. A significant negative relationship was also found for the orders Amphipoda, Basommatophora, Diptera, Ephemeroptera and Isopoda, and for several species separately. The order Odonata had a negative relationship very close to the significance threshold of 0.05 (P = 0.051). However, in accordance with previous research, a positive relationship was found for the order Actinedida. We used the monitoring field data to test whether the existing three water quality norms for imidacloprid in the Netherlands are protective in real conditions. Our data show that macrofauna abundance drops sharply between 13 and 67 ng l−1. For aquatic ecosystem protection, two of the norms are not protective at all while the strictest norm of 13 ng l−1 (MTR) seems somewhat protective. In addition to the existing experimental evidence on the negative effects of imidacloprid on invertebrate life, our study, based on data from large-scale field monitoring during multiple years, shows that serious concern about the far-reaching consequences of the abundant use of imidacloprid for aquatic ecosystems is justified. PMID:23650513

  7. Eddy current technique for detecting and sizing surface cracks in steel components

    International Nuclear Information System (INIS)

    Cecco, V.S.; Carter, J.R.; Sullivan, S.P.

    1995-01-01

    Cracking has occurred in pressure vessel nozzles and girth welds due to thermal fatigue. Pipe welds, welds in support structures, and welds in reactor vault liner panels in nuclear facilities have failed because of cracks. Cracking can also occur in turbine rotor bore surfaces due to high cycle fatigue. Dye penetrant, magnetic particle and other surface NDT methods are used to detect cracks but cannot be used for depth sizing. Crack depth can be measured with various NDT methods such as ultrasonic time-of-flight diffraction (TOFD), potential drop, and eddy current. The TOFD technique can be difficult to implement on nozzle welds and is best suited for sizing deep cracks (>5 mm). The conventional eddy current method is easy to implement, but crack sizing is normally limited to shallow cracks ( 2 mm) cracks. Eddy current testing (ET) techniques are readily amenable to remote/automatic inspections. These new probes could augment present magnetic particle (MT) and dye penetrant (PT) testing through provision of reliable defect depth information. Reliable crack sizing permits identification of critical cracks for plant life extension and licensing purposes. In addition, performing PT and MT generates low level radioactive waste in some inspection applications in nuclear facilities. Replacing these techniques with ET for some components will eliminate some of this radioactive waste. (author)

  8. Surface water and groundwater interaction in Marala - Khanki area, Punjab

    International Nuclear Information System (INIS)

    Akram, W.; Ahmad, M.; Latif, Z.; Tariq, J.A.; Malik, M.R.

    2011-07-01

    Isotope hydrological investigations were carried out in two selected areas of Indus Basin viz. Haripur Area and Chashma- Taunsa Area for elucidating various aspects of surface water and groundwater interaction. Groundwater samples were collected on seasonal basis (low and high river discharge periods) while surface water samples were collected more frequently (weekly or monthly basis). Isotopic data suggested that there is no contribution of surface water to groundwater recharge in Haripur Area and rain is the prevailing source of groundwater recharge. The data further revealed that isotopic values of the Haripur pocket of Tarbela Lake are higher than those of Main Lake / Indus River meaning that there is a significant contribution of base flow in this pocket. Indus River appeared to be the dominant source of groundwater recharge at most of the locations in Chashma- Taunsa Area. Isotopic data of Indus River showed an increase at Taunsa as compared to Chashma in low flow period indicating the high contribution of base flow at this point in time. Stable isotopes were successfully used to quantify the base flow contribution. (author)

  9. Water and Regolith Shielding for Surface Reactor Missions

    Science.gov (United States)

    Poston, David I.; Ade, Brian J.; Sadasivan, Pratap; Leichliter, Katrina J.; Dixon, David D.

    2006-01-01

    This paper investigates potential shielding options for surface power fission reactors. The majority of work is focused on a lunar shield that uses a combination of water in stainless-steel cans and lunar regolith. The major advantage of a water-based shield is that development, testing, and deployment should be relatively inexpensive. This shielding approach is used for three surface reactor concepts: (1) a moderated spectrum, NaK cooled, Hastalloy/UZrH reactor, (2) a fast-spectrum, NaK-cooled, SS/UO2 reactor, and (3) a fast-spectrum, K-heat-pipe-cooled, SS/UO2 reactor. For this study, each of these reactors is coupled to a 25-kWt Stirling power system, designed for 5 year life. The shields are designed to limit the dose both to the Stirling alternators and potential astronauts on the surface. The general configuration used is to bury the reactor, but several other options exist as well. Dose calculations are presented as a function of distance from reactor, depth of buried hole, water boron concentration (if any), and regolith repacked density.

  10. Water and Regolith Shielding for Surface Reactor Missions

    International Nuclear Information System (INIS)

    Poston, David I.; Sadasivan, Pratap; Dixon, David D.; Ade, Brian J.; Leichliter, Katrina J.

    2006-01-01

    This paper investigates potential shielding options for surface power fission reactors. The majority of work is focused on a lunar shield that uses a combination of water in stainless-steel cans and lunar regolith. The major advantage of a water-based shield is that development, testing, and deployment should be relatively inexpensive. This shielding approach is used for three surface reactor concepts: (1) a moderated spectrum, NaK cooled, Hastalloy/UZrH reactor, (2) a fast-spectrum, NaK-cooled, SS/UO2 reactor, and (3) a fast-spectrum, K-heat-pipe-cooled, SS/UO2 reactor. For this study, each of these reactors is coupled to a 25-kWt Stirling power system, designed for 5 year life. The shields are designed to limit the dose both to the Stirling alternators and potential astronauts on the surface. The general configuration used is to bury the reactor, but several other options exist as well. Dose calculations are presented as a function of distance from reactor, depth of buried hole, water boron concentration (if any), and regolith repacked density

  11. Modelling episodic acidification of surface waters: the state of science.

    Science.gov (United States)

    Eshleman, K N; Wigington, P J; Davies, T D; Tranter, M

    1992-01-01

    Field studies of chemical changes in surface waters associated with rainfall and snowmelt events have provided evidence of episodic acidification of lakes and streams in Europe and North America. Modelling these chemical changes is particularly challenging because of the variability associated with hydrological transport and chemical transformation processes in catchments. This paper provides a review of mathematical models that have been applied to the problem of episodic acidification. Several empirical approaches, including regression models, mixing models and time series models, support a strong hydrological interpretation of episodic acidification. Regional application of several models has suggested that acidic episodes (in which the acid neutralizing capacity becomes negative) are relatively common in surface waters in several regions of the US that receive acid deposition. Results from physically based models have suggested a lack of understanding of hydrological flowpaths, hydraulic residence times and biogeochemical reactions, particularly those involving aluminum. The ability to better predict episodic chemical responses of surface waters is thus dependent upon elucidation of these and other physical and chemical processes.

  12. Recovery of energetically overexploited urban aquifers using surface water

    Science.gov (United States)

    García-Gil, Alejandro; Vázquez-Suñé, Enric; Sánchez-Navarro, José Ángel; Mateo Lázaro, Jesús

    2015-12-01

    Shallow aquifers have an important role in reducing greenhouse gases through helping manage the temperature of urban environments. Nevertheless, the uncontrolled rapid use of shallow groundwater resources to heat or cool urban environments can cause thermal pollution that will limit the long term sustainability of the resource. Therefore, there is a need for appropriate mitigation/remediation strategies capable of recovering energetically overexploited aquifers. In this work, a novel remediation strategy based on surface water recharge into aquifers is presented. To evaluate the capabilities of such measures for effective remediation, this strategy is optimized for a management problem raised in the overheated "Urban Alluvial Aquifer of Zaragoza" (Spain). The application of a transient groundwater flow and heat transport model under 512 different mitigation scenarios has enabled to quantify and discuss the magnitude of the remediation effect as a respond to injection rates of surface water, seasonal schedule of the injection and location of injection. The quantification of the relationship between these variables together with the evaluation of the amount of surface water injected per year in each scenario proposed have provided a better understanding of the system processes and an optimal management alternative. This work also makes awareness of the magnitude of the remediation procedure which is in an order of magnitude of tenths of years.

  13. Mechanical Balance Laws for Boussinesq Models of Surface Water Waves

    Science.gov (United States)

    Ali, Alfatih; Kalisch, Henrik

    2012-06-01

    Depth-integrated long-wave models, such as the shallow-water and Boussinesq equations, are standard fare in the study of small amplitude surface waves in shallow water. While the shallow-water theory features conservation of mass, momentum and energy for smooth solutions, mechanical balance equations are not widely used in Boussinesq scaling, and it appears that the expressions for many of these quantities are not known. This work presents a systematic derivation of mass, momentum and energy densities and fluxes associated with a general family of Boussinesq systems. The derivation is based on a reconstruction of the velocity field and the pressure in the fluid column below the free surface, and the derivation of differential balance equations which are of the same asymptotic validity as the evolution equations. It is shown that all these mechanical quantities can be expressed in terms of the principal dependent variables of the Boussinesq system: the surface excursion η and the horizontal velocity w at a given level in the fluid.

  14. Surface Water Quality Assessment and Prioritize the Factors Pollute This Water Using Topsis Fuzzy Hierarchical Analysis

    Directory of Open Access Journals (Sweden)

    Mehdi Komasi

    2017-03-01

    Full Text Available Background & Objective: Nowadays, according to growth of industry and increasing population, water resources are seriousely shortened. This lack of water resources will require special management to be considered in industry and agriculture. Among the various sources of water, surface waters are more susceptible to infection. The most important of these sources of pollution are industrial pollution, detergent, pesticides, radioactive materials, heat and salt concentration.  Materials & methods: In this article, at first the importance of each pollutant will be evaluated base on the effects and its results and then quality evaluation of surface water will be studied. In order to assess the relative importance of these pollutants primarily using TOPSIS software, prioritize these factors as one of the hierarchical analysis and then is modeled with decision tree method using Weka software, the importance of each factor is evaluated and if it does not meet the minimal importance of the decision tree will be removed. Results: The results obtained from the Topsis fuzzy analysis indicate that surface water and groundwater are exposed to pollution about 74% and 26% respectively among the six pollutants examined in this study. In addition, results obtaned from the hierarchical tree in software Weka has shown that the heat factor, soluble salts and industrial pollutants give impac factor or purity about 0.1338, 0.0523 and 1.2694 respectively. Conclusion: Surface water is at greater risk of being polluted compared with groundwater. The heat factor and low concentration of dissolved salts have the low impact and industrial pollutants are considered as the most influential factors in surface water pollution.

  15. Statistical Methods and Sampling Design for Estimating Step Trends in Surface-Water Quality

    Science.gov (United States)

    Hirsch, Robert M.

    1988-01-01

    This paper addresses two components of the problem of estimating the magnitude of step trends in surface water quality. The first is finding a robust estimator appropriate to the data characteristics expected in water-quality time series. The J. L. Hodges-E. L. Lehmann class of estimators is found to be robust in comparison to other nonparametric and moment-based estimators. A seasonal Hodges-Lehmann estimator is developed and shown to have desirable properties. Second, the effectiveness of various sampling strategies is examined using Monte Carlo simulation coupled with application of this estimator. The simulation is based on a large set of total phosphorus data from the Potomac River. To assure that the simulated records have realistic properties, the data are modeled in a multiplicative fashion incorporating flow, hysteresis, seasonal, and noise components. The results demonstrate the importance of balancing the length of the two sampling periods and balancing the number of data values between the two periods.

  16. Analysis of factors controlling soil phosphorus loss with surface runoff in Huihe National Nature Reserve by principal component and path analysis methods.

    Science.gov (United States)

    He, Jing; Su, Derong; Lv, Shihai; Diao, Zhaoyan; Bu, He; Wo, Qiang

    2018-01-01

    Phosphorus (P) loss with surface runoff accounts for the P input to and acceleration of eutrophication of the freshwater. Many studies have focused on factors affecting P loss with surface runoff from soils, but rarely on the relationship among these factors. In the present study, rainfall simulation on P loss with surface runoff was conducted in Huihe National Nature Reserve, in Hulunbeier grassland, China, and the relationships between P loss with surface runoff, soil properties, and rainfall conditions were examined. Principal component analysis and path analysis were used to analyze the direct and indirect effects on P loss with surface runoff. The results showed that P loss with surface runoff was closely correlated with soil electrical conductivity, soil pH, soil Olsen P, soil total nitrogen (TN), soil total phosphorus (TP), and soil organic carbon (SOC). The main driving factors which influenced P loss with surface runoff were soil TN, soil pH, soil Olsen P, and soil water content. Path analysis and determination coefficient analysis indicated that the standard multiple regression equation for P loss with surface runoff and each main factor was Y = 7.429 - 0.439 soil TN - 6.834 soil pH + 1.721 soil Olsen-P + 0.183 soil water content (r = 0.487, p runoff. The effect of physical and chemical properties of undisturbed soils on P loss with surface runoff was discussed, and the soil water content and soil Olsen P were strongly positive influences on the P loss with surface runoff.

  17. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  18. Inservice inspection of heavy water plants - a tool in assessing damage to components and life extension

    International Nuclear Information System (INIS)

    Subramanian, C.V.; Thavasimuthu, M.; Bhattacharys, D.K.; Baldev Raj

    1994-01-01

    Any system and its components are expected to give trouble free service over a certain period of time known as life time. The life time is estimated during the design stage. To achieve the design life, certain level of quality are to be defined and this quality has to be worked into the components by proper fabrication processes and their compliance with quality are to be checked. In addition, one has to guard against initiation or propagation of defects which may occur due to normal and abnormal service conditions. Non-destructive test (NDT) techniques are widely used for finding the health of the component. The role of NDT extends from the production stage to the entire life period of the system. This paper highlights the periodic in-service inspection (ISI) carried out on various components of the Heavy Water Plants (HWP) in India in assessing the integrity of the components and predicting the life of the components. (author). 3 refs., 4 figs

  19. Effective modification of particle surface properties using ultrasonic water mist

    DEFF Research Database (Denmark)

    Genina, Natalja; Räikkönen, Heikki; Heinämäki, Jyrki

    2009-01-01

    The goal of the present study was to design a new technique to modify particle surface properties and, through that, to improve flowability of poorly flowing drug thiamine hydrochloride and pharmaceutical sugar lactose monohydrate of two different grades. The powdered particles were supplied...... properties. It was found that rapid exposition of pharmaceutical materials by water mist resulted in the improvement of powder technical properties. The evident changes in flowability of coarser lactose were obviously due to smoothing of particle surface and decreasing in the level of fines with very slight...... increment in particle size. The changes in thiamine powder flow were mainly due to narrowing in particle size distribution where the tendency for better flow of finer lactose was related to surface and size modifications. The aqueous mist application did not cause any alteration of the crystal structures...

  20. Adsorption of water, sulfates and chloride on arsenopyrite surface

    Science.gov (United States)

    Silva, Juliana C. M.; dos Santos, Egon C.; de Oliveira, Aline; Heine, Thomas; De Abreu, Heitor A.; Duarte, Hélio A.

    2018-03-01

    Arsenopyrite is one of the sulfide minerals responsible for acid rock drainage (ARD) and is one of the most hazardous in regions affected by mining activities. This phenomenon involves complex reaction mechanism. Although it is intensely investigated, there is a lack of consensus concerning the reaction mechanisms and more information is still necessary. In this work, the adsorption of water, hydrochloric acid, and sulfuric acid on arsenopyrite (001) surface was investigated by means of Density Functional calculations and the results compared to other sulfides aiming to understand the mineral/water interface. The interaction of the chemical species with the (001) FeAsS surface is the first step to understand the intricate oxidation mechanism of arsenopyrite. Molecular water adsorption on (001) FeAsS is more favored than the adsorption of sulfate favoring the dissolution of sulfates and enhancing its oxidation. The estimated adsorption energies of water, sulfates and chloride on other sulfide minerals are compared with the estimated values for arsenopyrite and the chemical reactivity differences discussed in detail.

  1. Impact on surface water quality due to coke oven effluents

    International Nuclear Information System (INIS)

    Ghose, M.K.; Roy, S.

    1994-01-01

    Large quantities of water are used for the quenching of hot coke and also for washing the gas produced from the coke ovens. Liquid effluents thus generated are highly polluted and are being discharged into the river Damodar without proper treatment. Four coke plants of Bharat Coking Coal Ltd.(BCCL) have been surveyed for characterization and to assess the impact on surface water quality. About 175-200 kilolitres of waste water is being generated per day by each of the coke plants. The concentration of CO, BOD, COD, TSS, phenol and cyanide in each of the coke plants were found to exceed the limits specified by pollution control board. Ammonia, oil and grease and TDS were found to be 19.33 mg/l, 7.81 mg/l, 1027.75 mg/l respectively. Types of samples collected, sampling frequencies, sample preservation and the results obtained have been discussed. (author). 6 refs., 1 tab., 1 fig

  2. Water heating solar system using collector with polycarbonate absorber surface

    Energy Technology Data Exchange (ETDEWEB)

    Souza, Luiz Guilherme Meira de; Sodre, Dilton; Cavalcanti, Eduardo Jose Cidade; Souza, Luiz Guilherme Vieira Meira de; Mendes, Jose Ubiragi de Lima [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil)], e-mails: lguilherme@dem.ufrn.br, diltonsodre@ifba.edu.br, ubiragi@ct.ufrn.br

    2010-07-01

    It is presented s solar collector to be used in a heating water for bath system, whose main characteristics are low cost and easy fabrication and assembly processes. The collector absorber surface consists of a polycarbonate plate with an area of 1.5 m{sup 2}. The water inlet and outlet are made of PVC 50mm, and were coupled to a 6mm thick polycarbonate plate using fiberglass resin. A 200 liters thermal reservoir will be used. This reservoir is also alternative. The absorber heating system works under thermo-siphon regimen. Thermal parameters will be evaluated to prove the feasibility of the studied solar heating system to obtain bath water for a four people family. (author)

  3. Satellite-based estimates of surface water dynamics in the Congo River Basin

    Science.gov (United States)

    Becker, M.; Papa, F.; Frappart, F.; Alsdorf, D.; Calmant, S.; da Silva, J. Santos; Prigent, C.; Seyler, F.

    2018-04-01

    In the Congo River Basin (CRB), due to the lack of contemporary in situ observations, there is a limited understanding of the large-scale variability of its present-day hydrologic components and their link with climate. In this context, remote sensing observations provide a unique opportunity to better characterize those dynamics. Analyzing the Global Inundation Extent Multi-Satellite (GIEMS) time series, we first show that surface water extent (SWE) exhibits marked seasonal patterns, well distributed along the major rivers and their tributaries, and with two annual maxima located: i) in the lakes region of the Lwalaba sub-basin and ii) in the "Cuvette Centrale", including Tumba and Mai-Ndombe Lakes. At an interannual time scale, we show that SWE variability is influenced by ENSO and the Indian Ocean dipole events. We then estimate water level maps and surface water storage (SWS) in floodplains, lakes, rivers and wetlands of the CRB, over the period 2003-2007, using a multi-satellite approach, which combines the GIEMS dataset with the water level measurements derived from the ENVISAT altimeter heights. The mean annual variation in SWS in the CRB is 81 ± 24 km3 and contributes to 19 ± 5% of the annual variations of GRACE-derived terrestrial water storage (33 ± 7% in the Middle Congo). It represents also ∼6 ± 2% of the annual water volume that flows from the Congo River into the Atlantic Ocean.

  4. Physical basis for river segmentation from water surface observables

    Science.gov (United States)

    Samine Montazem, A.; Garambois, P. A.; Calmant, S.; Moreira, D. M.; Monnier, J.; Biancamaria, S.

    2017-12-01

    With the advent of satellite missions such as SWOT we will have access to high resolution estimates of the elevation, slope and width of the free surface. A segmentation strategy is required in order to sub-sample the data set into reach master points for further hydraulic analyzes and inverse modelling. The question that arises is : what will be the best node repartition strategy that preserves hydraulic properties of river flow? The concept of hydraulic visibility introduced by Garambois et al. (2016) is investigated in order to highlight and characterize the spatio-temporal variations of water surface slope and curvature for different flow regimes and reach geometries. We show that free surface curvature is a powerful proxy for characterizing the hydraulic behavior of a reach since concavity of water surface is driven by variations in channel geometry that impacts the hydraulic properties of the flow. We evaluated the performance of three segmentation strategies by means of a well documented case, that of the Garonne river in France. We conclude that local extrema of free surface curvature appear as the best candidate for locating the segment boundaries for an optimal hydraulic representation of the segmented river. We show that for a given river different segmentation scales are possible: a fine-scale segmentation which is driven by fine-scale hydraulic to large-scale segmentation driven by large-scale geomorphology. The segmentation technique is then applied to high resolution GPS profiles of free surface elevation collected on the Negro river basin, a major contributor of the Amazon river. We propose two segmentations: a low-resolution one that can be used for basin hydrology and a higher resolution one better suited for local hydrodynamic studies.

  5. Probability of misclassifying biological elements in surface waters.

    Science.gov (United States)

    Loga, Małgorzata; Wierzchołowska-Dziedzic, Anna

    2017-11-24

    Measurement uncertainties are inherent to assessment of biological indices of water bodies. The effect of these uncertainties on the probability of misclassification of ecological status is the subject of this paper. Four Monte-Carlo (M-C) models were applied to simulate the occurrence of random errors in the measurements of metrics corresponding to four biological elements of surface waters: macrophytes, phytoplankton, phytobenthos, and benthic macroinvertebrates. Long series of error-prone measurement values of these metrics, generated by M-C models, were used to identify cases in which values of any of the four biological indices lay outside of the "true" water body class, i.e., outside the class assigned from the actual physical measurements. Fraction of such cases in the M-C generated series was used to estimate the probability of misclassification. The method is particularly useful for estimating the probability of misclassification of the ecological status of surface water bodies in the case of short sequences of measurements of biological indices. The results of the Monte-Carlo simulations show a relatively high sensitivity of this probability to measurement errors of the river macrophyte index (MIR) and high robustness to measurement errors of the benthic macroinvertebrate index (MMI). The proposed method of using Monte-Carlo models to estimate the probability of misclassification has significant potential for assessing the uncertainty of water body status reported to the EC by the EU member countries according to WFD. The method can be readily applied also in risk assessment of water management decisions before adopting the status dependent corrective actions.

  6. Effects of seawater components on radiolysis of water at elevated temperature

    International Nuclear Information System (INIS)

    Wada, Yoichi; Tachibana, Masahiko; Ishida, Kazushige; Ota, Nobuyuki; Shigenaka, Naoto; Inagaki, Hiromitsu; Noda, Hiroshi

    2014-01-01

    Effects of seawater components on radiolysis of water at elevated temperature have been studied with a radiolysis model in order to evaluate influence on integrity of materials used in an ABWR. In 2011, seawater flowed into a wide part of the nuclear power plant system of the Hamaoka Nuclear Power Station Reactor No. 5 owned by Chubu Electric Power Co., Inc. after condenser tubes broke during the plant shutdown operation. The reactor water temperature was 250°C and its maximum Cl − concentration was ca. 450 ppm when seawater was mixed with reactor water. In order to clarify effects of the sea water components on radiolysis of water at elevated temperature, a radiolysis model calculation was conducted with Hitachi's radiolysis analysis code 'SIMFONY'. For the calculation, the temperature range was set from 50 to 250°C with 50°C increments and the gamma dose rate was set at 60 Gys −1 to see the effect of gamma irradiation from fuels under shutdown conditions. Concentrations of radiolytic species were calculated for 10 5 s. Dilution ratio of seawater was changed to see the effects of concentration of seawater components. Reaction rate constants of the Cl − , Br − , HCO 3 − , and SO 4 2− systems were considered. The main radiolytic species were predicted to be hydrogen and oxygen. Hydrogen peroxide of low concentration was produced in seawater-mixed water at elevated temperatures. Compared with these main products, concentrations of radiolytic products originating from chloride ion and other seawater components were found to be rather low. The dominant product among them was ClO 3 − and its concentration was found to be below 0.01ppm at 10 5 s. Then, during the plant shutdown operation, the harmful influence from radiolytic species originating from seawater components on integrity of fuel materials must be smaller than that of chloride ion which is the main ionic species in seawater. (author)

  7. Friction and wear studies of nuclear power plant components in pressurized high temperature water environments

    International Nuclear Information System (INIS)

    Ko, P.L.; Zbinden, M.; Taponat, M.C.; Robertson, M.F.

    1997-01-01

    The present paper is part of a series of papers aiming to present the friction and wear results of a collaborative study on nuclear power plant components tested in pressurized high temperature water. The high temperature test facilities and the methodology in presenting the kinetics and wear results are described in detail. The results of the same material combinations obtained from two very different high temperature test facilities (NRCC and EDF) are presented and discussed. (K.A.)

  8. Estimation of available water capacity components of two-layered soils using crop model inversion: Effect of crop type and water regime

    Science.gov (United States)

    Sreelash, K.; Buis, Samuel; Sekhar, M.; Ruiz, Laurent; Kumar Tomer, Sat; Guérif, Martine

    2017-03-01

    Characterization of the soil water reservoir is critical for understanding the interactions between crops and their environment and the impacts of land use and environmental changes on the hydrology of agricultural catchments especially in tropical context. Recent studies have shown that inversion of crop models is a powerful tool for retrieving information on root zone properties. Increasing availability of remotely sensed soil and vegetation observations makes it well suited for large scale applications. The potential of this methodology has however never been properly evaluated on extensive experimental datasets and previous studies suggested that the quality of estimation of soil hydraulic properties may vary depending on agro-environmental situations. The objective of this study was to evaluate this approach on an extensive field experiment. The dataset covered four crops (sunflower, sorghum, turmeric, maize) grown on different soils and several years in South India. The components of AWC (available water capacity) namely soil water content at field capacity and wilting point, and soil depth of two-layered soils were estimated by inversion of the crop model STICS with the GLUE (generalized likelihood uncertainty estimation) approach using observations of surface soil moisture (SSM; typically from 0 to 10 cm deep) and leaf area index (LAI), which are attainable from radar remote sensing in tropical regions with frequent cloudy conditions. The results showed that the quality of parameter estimation largely depends on the hydric regime and its interaction with crop type. A mean relative absolute error of 5% for field capacity of surface layer, 10% for field capacity of root zone, 15% for wilting point of surface layer and root zone, and 20% for soil depth can be obtained in favorable conditions. A few observations of SSM (during wet and dry soil moisture periods) and LAI (within water stress periods) were sufficient to significantly improve the estimation of AWC

  9. Equivalent water height extracted from GRACE gravity field model with robust independent component analysis

    Science.gov (United States)

    Guo, Jinyun; Mu, Dapeng; Liu, Xin; Yan, Haoming; Dai, Honglei

    2014-08-01

    The Level-2 monthly GRACE gravity field models issued by Center for Space Research (CSR), GeoForschungs Zentrum (GFZ), and Jet Propulsion Laboratory (JPL) are treated as observations used to extract the equivalent water height (EWH) with the robust independent component analysis (RICA). The smoothing radii of 300, 400, and 500 km are tested, respectively, in the Gaussian smoothing kernel function to reduce the observation Gaussianity. Three independent components are obtained by RICA in the spatial domain; the first component matches the geophysical signal, and the other two match the north-south strip and the other noises. The first mode is used to estimate EWHs of CSR, JPL, and GFZ, and compared with the classical empirical decorrelation method (EDM). The EWH STDs for 12 months in 2010 extracted by RICA and EDM show the obvious fluctuation. The results indicate that the sharp EWH changes in some areas have an important global effect, like in Amazon, Mekong, and Zambezi basins.

  10. Detecting geothermal anomalies and evaluating LST geothermal component by combining thermal remote sensing time series and land surface model data

    NARCIS (Netherlands)

    Romaguera, M.; Vaughan, R. G.; Ettema, J.; Izquierdo-Verdiguier, E.; Hecker, C. A.; van der Meer, F. D.

    This paper explores for the first time the possibilities to use two land surface temperature (LST) time series of different origins (geostationary Meteosat Second Generation satellite data and Noah land surface modelling, LSM), to detect geothermal anomalies and extract the geothermal component of

  11. Detecting geothermal anomalies and evaluating LST geothermal component by combining thermal remote sensing time series and land surface model data

    NARCIS (Netherlands)

    Romaguera, M.; Vaughan, R. G.; Ettema, J.; Izquierdo-Verdiguier, E.; Hecker, C. A.; van der Meer, F. D.

    2017-01-01

    This paper explores for the first time the possibilities to use two land surface temperature (LST) time series of different origins (geostationary Meteosat Second Generation satellite data and Noah land surface modelling, LSM), to detect geothermal anomalies and extract the geothermal component of

  12. Results of an aging-related failure survey of light water safety systems and components

    International Nuclear Information System (INIS)

    Meale, B.M.; Satterwhite, D.G.; MacDonald, P.E.

    1988-01-01

    The collection and evaluation of operating experience data are necessary in determining the effects of aging on the safety of operating nuclear plants. This paper presents the final results of a two-year research effort evaluating aging impacts on components in light water reactor systems. This research was performed as a part of the Nuclear Plant Aging Research program, sponsored by the US Nuclear Regulatory Commission. Two unique types of data analyses were performed. In the first, an aging-survey study, aging-related failure data for fifteen light water reactor systems were obtained from the Nuclear Plant Reliability Data System (NPRDS). These included safety, support, and power conversion systems. A computerized sort of these records classified each record into one of five generic categories, based on the utility's choice of the failure's NPRDS cause category. Systems and components within the systems that were most affected by aging were identified. In the second analysis, information on aging-related reported causes of failures was evaluated for component failures reported to NPRDS for auxiliary feedwater, high pressure injection, service water, and Class 1E electrical power distribution systems. 3 refs., 13 figs., 4 tabs

  13. Safety analysis of water cooled components inside the JET thermonuclear fusion tokamak

    International Nuclear Information System (INIS)

    Ageladarakis, P.; O'Dowd, N.; Papastergiou, S.

    1998-04-01

    The transient thermal behaviour of a number of components, installed in the vessel of the world's largest Fusion Tokamak (JET) has been examined with a theoretical model, which simulated normal operational conditions and abnormal scenarios namely: Loss of Coolant Flow; Loss of Torus Vacuum; and combinations. A number of theoretical results related to water and cryogenically cooled devices have been validated by a comprehensive experimental campaign conducted both inside the JET plasma chamber and in a test rig. The performance of water cooled components which may be subjected to boiling or freeze-up risks in case of a Loss of Water Flow event has also been analysed. Time constants of transient temperature changes were determined by the model while protective actions were prescribed in order to safeguard the equipment against associated risks. A completely automatic safety protection system has been designed on the basis of these analyses and implemented in the routine JET operation. During operation of JET the safety code reacted several times within the specified time limits and protected the relevant components during real off-normal events. (author)

  14. Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

    NARCIS (Netherlands)

    van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

    2014-01-01

    Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in

  15. Innovative coatings and surface modification of titanium for sea water condenser applications

    International Nuclear Information System (INIS)

    George, R.P.; Anandkumar, B.; Vanithakumari, S.C.; Kamachi Mudali, U.

    2016-01-01

    Effectiveness of cooling water systems in various power plants to maintain highest electrical energy output per tonne of fuel is important as part of good energy management. Cooling water systems of nuclear power plants using seawater for cooling comes under constant attack from the marine and sea water environment. Many metallic components and civil structures in the cooling water systems like bridges, intake wells, intake pipes, pump house wells, water boxes, condenser pipes are subjected to severe fouling and corrosion which limits the service life and availability of power plants. The experience with a coastal water cooled power plant at Kalpakkam (MAPS), India, showed that chlorination and screening control macrofouling to a great extend by controlling protozoans, invertebrates, algae and fungi. However 90% of marine bacteria are resistant to such control measures, and they cause microfouling of condenser pipes leading to poor heat transfer and microbially influenced corrosion (MIC) failures. Titanium is used as condenser for Indian nuclear power plants employing sea water cooling, including the PFBR at Kalpakkam. Though titanium is excellent with respect to corrosion behavior under sea water conditions, its biocompatible nature results in biofouling and MIC during service. Therefore innovative antifouling coatings and surface modification techniques for titanium condenser applications in seawater and marine environments are the need of the hour. Extensive investigations were carried out by different methods including nanostructuring of surfaces for making them antibacterial. The microroughness of titanium was produced by repeated pickling and polishing which by itself reduced microbial adhesion. To utilize photocatalytic activity for antibacterial property, anodization of titanium surfaces followed by heat treatment was adopted and this also has controlled microbial fouling. Electroless plating of nanofilm of copper-nickel alloy decreased biofouling of

  16. Multiple sources of boron in urban surface waters and groundwaters

    Energy Technology Data Exchange (ETDEWEB)

    Hasenmueller, Elizabeth A., E-mail: eahasenm@wustl.edu; Criss, Robert E.

    2013-03-01

    Previous studies attribute abnormal boron (B) levels in streams and groundwaters to wastewater and fertilizer inputs. This study shows that municipal drinking water used for lawn irrigation contributes substantial non-point loads of B and other chemicals (S-species, Li, and Cu) to surface waters and shallow groundwaters in the St. Louis, Missouri, area. Background levels and potential B sources were characterized by analysis of lawn and street runoff, streams, rivers, springs, local rainfall, wastewater influent and effluent, and fertilizers. Urban surface waters and groundwaters are highly enriched in B (to 250 μg/L) compared to background levels found in rain and pristine, carbonate-hosted streams and springs (< 25 μg/L), but have similar concentrations (150 to 259 μg/L) compared to municipal drinking waters derived from the Missouri River. Other data including B/SO{sub 4}{sup 2-}−S and B/Li ratios confirm major contributions from this source. Moreover, sequential samples of runoff collected during storms show that B concentrations decrease with increased discharge, proving that elevated B levels are not primarily derived from combined sewer overflows (CSOs) during flooding. Instead, non-point source B exhibits complex behavior depending on land use. In urban settings B is rapidly mobilized from lawns during “first flush” events, likely representing surficial salt residues from drinking water used to irrigate lawns, and is also associated with the baseflow fraction, likely derived from the shallow groundwater reservoir that over time accumulates B from drinking water that percolates into the subsurface. The opposite occurs in small rural watersheds, where B is leached from soils by recent rainfall and covaries with the event water fraction. Highlights: ► Boron sources and loads differ between urban and rural watersheds. ► Wastewaters are not the major boron source in small St. Louis, MO watersheds. ► Municipal drinking water used for lawn

  17. Spatial and temporal variability of surface water pollution in the Mekong Delta, Vietnam.

    Science.gov (United States)

    Wilbers, Gert-Jan; Becker, Mathias; Nga, La Thi; Sebesvari, Zita; Renaud, Fabrice G

    2014-07-01

    Surface water pollution in the Vietnamese Mekong Delta (MD) could threaten human, animal and ecosystem health given the fact that this water source is intensively used for drinking, irrigation and domestic services. We therefore determined the levels of pollution by organic pollutants, salts, metals and microbial indicators by (bi)monthly monitoring of canals between November 2011 and July 2012 at 32 sampling locations, representing fresh and saline/brackish environments. The results were compared with national water quality guidelines, between the studied regions and with water quality data from main waterways. Key factors explaining the observed levels of pollution in surface water were identified through principal component analysis (PCA). Temporal variations due to tidal regime and seasonality were also assessed. Based on regression models, the spatial variability of five water quality parameters was visualized using GIS based maps. Results indicate that pH (max. 8.6), turbidity (max. 461 FTU), maximum concentrations of ammonium (14.7 mg L(-1)), arsenic (44.1 μg L(-1)), barium (157.5 μg L(-1)), chromium (84.7 μg L(-1)), mercury (45.5 μg L(-1)), manganese (1659.7 μg L(-1)), aluminum (14.5 mg L(-1)), iron (17.0 mg L(-1)) and the number of Escherichia coli (87,000 CFU 100 mL(-1)) and total coliforms (2,500,000 CFU 100 mL(-1)) in canals exceed the thresholds set by Vietnamese quality guidelines for drinking and domestic purposes. The PCA showed that i) urbanization; ii) metal leaching from soils; iii) aquaculture; and iv) tidal regime explain 85% of the variance of surface water quality attributes. Significant differences in water quality were found due to daily tidal regime and as a result of seasonality. Surface water quality maps for dissolved oxygen, ammonium, ortho-phosphate, manganese and total coliforms were developed to highlight hot-spot areas of pollution. The results of this study can assist policy makers in developing water management strategies

  18. Methane oxidation and methane fluxes in the ocean surface layer and deep anoxic waters

    Science.gov (United States)

    Ward, B. B.; Kilpatrick, K. A.; Novelli, P. C.; Scranton, M. I.

    1987-01-01

    Measured biological oxidation rates of methane in near-surface waters of the Cariaco Basin are compared with the diffusional fluxes computed from concentration gradients of methane in the surface layer. Methane fluxes and oxidation rates were investigated in surface waters, at the oxic/anoxic interface, and in deep anoxic waters. It is shown that the surface-waters oxidation of methane is a mechanism which modulates the flux of methane from marine waters to the atmosphere.

  19. Agricultural insecticides threaten surface waters at the global scale.

    Science.gov (United States)

    Stehle, Sebastian; Schulz, Ralf

    2015-05-05

    Compared with nutrient levels and habitat degradation, the importance of agricultural pesticides in surface water may have been underestimated due to a lack of comprehensive quantitative analysis. Increasing pesticide contamination results in decreasing regional aquatic biodiversity, i.e., macroinvertebrate family richness is reduced by ∼30% at pesticide concentrations equaling the legally accepted regulatory threshold levels (RTLs). This study provides a comprehensive metaanalysis of 838 peer-reviewed studies (>2,500 sites in 73 countries) that evaluates, for the first time to our knowledge on a global scale, the exposure of surface waters to particularly toxic agricultural insecticides. We tested whether measured insecticide concentrations (MICs; i.e., quantified insecticide concentrations) exceed their RTLs and how risks depend on insecticide development over time and stringency of environmental regulation. Our analysis reveals that MICs occur rarely (i.e., an estimated 97.4% of analyses conducted found no MICs) and there is a complete lack of scientific monitoring data for ∼90% of global cropland. Most importantly, of the 11,300 MICs, 52.4% (5,915 cases; 68.5% of the sites) exceeded the RTL for either surface water (RTLSW) or sediments. Thus, the biological integrity of global water resources is at a substantial risk. RTLSW exceedances depend on the catchment size, sampling regime, and sampling date; are significantly higher for newer-generation insecticides (i.e., pyrethroids); and are high even in countries with stringent environmental regulations. These results suggest the need for worldwide improvements to current pesticide regulations and agricultural pesticide application practices and for intensified research efforts on the presence and effects of pesticides under real-world conditions.

  20. Dissolution of organic solvents from painted surfaces into water

    International Nuclear Information System (INIS)

    Wren, J.C.; Jobe, D.J.; Sanipelli, G.G.; Ball, J.M.

    2000-01-01

    The presence of volatile iodine in containment buildings is one of the major safety concerns in the potential event of nuclear reactor accidents. Organic impurities in containment water, originating from various painted structural surfaces and organic materials, could have a significant impact on iodine volatility following an accident. To determine the source and magnitude of organic impurities and their effects on time-dependent iodine volatility, the dissolution for organic constituents from paints used in reactor buildings has been studied under postulated accident conditions. The studies of the organic dissolution from carbon steel coupons coated with zinc-primed vinyl, epoxy-primed polyurethane or epoxy paints over the temperature range 25-90 deg C are reported. Relatively large activation energies were measured for the release of the principal organic compounds from painted surfaces, suggesting it is the release of the solvents from the paint matrix rather than their diffusion through the solution that is the rate determining step for the dissolution mechanism. The similarities in the values of activation energies for the dissolution of different organic compounds from the paints suggest the release rate is independent of the nature of the painted surface or the type of organic being released from the surface. These two observations indicate that it may be possible to write a generalized rate expression for the release of organic compounds from painted surfaces in containment following an accident. The possible implications of these results for predicting iodine volatility in containment are also discussed. (author)

  1. Distribution coefficients for chemical components of a coal-oil/water system

    Energy Technology Data Exchange (ETDEWEB)

    Picel, K C; Stamoudis, V C; Simmons, M S

    1988-09-01

    Distribution coefficients (K/sub D/) were measured by equilibrating a coal oil comparative reference material (CRM-1) with water and then separating the oil and water phases. Aqueous phase concentrations were determined by direct analysis of this phase, while organic phase concentrations were determined from the original oil composition by difference. The log K/sub D/ values obtained for acidic and basic components were generally <3, while those for the neutral components ranged from 3 to 6. For aromatic hydrocarbons, strong correlations were observed between log K/sub D/ and log S/sub w/ (water solubility), and between log K/sub D/ and log K/sub o//sub w/ (octanol/water partition coefficient). Alkylated benzenes had significantly higher K/sub D/s than did unsubstituted aromatics of similar molecular weight. Examination of homologs revealed an increase of 0.307 log K/sub D/ units per additional carbon atom for polynuclear aromatic hydrocarbons having from 10 to 16 carbons. Alkyl substituent effects determined for various sets of homologs ranged from 0.391 to 0.466 log K/sub d/ units per -CH/sub 2/- group added. 38 refs., 5 figs., 7 tabs.

  2. XHM-1 alloy as a promising structural material for water-cooled fusion reactor components

    International Nuclear Information System (INIS)

    Solonin, M.I.; Alekseev, A.B.; Kazennov, Yu.I.; Khramtsov, V.F.; Kondrat'ev, V.P.; Krasina, T.A.; Rechitsky, V.N.; Stepankov, V.N.; Votinov, S.N.

    1996-01-01

    Experience gained in utilizing austenitic stainless steel components in water-cooled power reactors indicates that the main cause of their failure is the steel's propensity for corrosion cracking. In search of a material immune to this type of corrosion, different types of austenitic steels and chromium-nickel alloys were investigated and tested at VNIINM. This paper presents the results of studying physical and mechanical properties, irradiation and corrosion resistance in a water coolant at <350 C of the alloy XHM-1 as compared with austenitic stainless steels 00Cr16Ni15Mo3Nb, 00Cr20Ni25Nb and alloy 00Cr20Ni40Mo5Nb. Analysis of the results shows that, as distinct from the stainless steels studied, the XHM-1 alloy is completely immune to corrosion cracking (CC). Not a single induced damage was encountered within 50 to 350 C in water containing different amounts of chlorides and oxygen under tensile stresses up to the yield strength of the material. One more distinctive feature of the alloy compared to steels is that no change in the strength or total elongation is encountered in the alloy specimens irradiated to 32 dpa at 350 C. The XHM-1 alloy has adequate fabricability and high weldability characteristics. As far as its properties are concerned, the XHM-1 alloy is very promising as a material for water-cooled fusion reactor components. (orig.)

  3. Geophysical characterisation of the groundwater-surface water interface

    Science.gov (United States)

    McLachlan, P. J.; Chambers, J. E.; Uhlemann, S. S.; Binley, A.

    2017-11-01

    Interactions between groundwater (GW) and surface water (SW) have important implications for water quantity, water quality, and ecological health. The subsurface region proximal to SW bodies, the GW-SW interface, is crucial as it actively regulates the transfer of nutrients, contaminants, and water between GW systems and SW environments. However, geological, hydrological, and biogeochemical heterogeneity in the GW-SW interface makes it difficult to characterise with direct observations. Over the past two decades geophysics has been increasingly used to characterise spatial and temporal variability throughout the GW-SW interface. Geophysics is a powerful tool in evaluating structural heterogeneity, revealing zones of GW discharge, and monitoring hydrological processes. Geophysics should be used alongside traditional hydrological and biogeochemical methods to provide additional information about the subsurface. Further integration of commonly used geophysical techniques, and adoption of emerging techniques, has the potential to improve understanding of the properties and processes of the GW-SW interface, and ultimately the implications for water quality and environmental health.

  4. Control of water infiltration into near surface LLW disposal units

    International Nuclear Information System (INIS)

    Schulz, R.K.; Ridky, R.W.; O'Donnell, E.

    1992-10-01

    The project objective is to assess means for controlling waste infiltration through waste disposal unit covers in humid regions. Experimental work is being performed in large scale lysimeters (70inch x 45inch x lOinch) at Beltsville, MD and results of the assessment are applicable to disposal of LLW, uranium mill tailings, hazardous waste, and sanitary landfills. Three concepts are under investigation: (1) resistive layer barrier, (2) conductive layer barrier, and bioengineering water management. The resistive layer barrier consists of compacted earth (clay). The conductive layer barrier is a special case of the capillary barrier and it requires a flow layer (e.g. fine sandy loam) over a capillary break. As long as unsaturated conditions am maintained water is conducted by the flow layer to below the waste. This barrier is most efficient at low flow rates and is thus best placed below a resistive layer barrier. Such a combination of the resistive layer over the conductive layer barrier promises to be highly effective provided there is no appreciable subsidence. Bioengineering water management is a surface cover that is designed to accommodate subsidence. It consists of impermeable panels which enhance run-off and limit infiltration. Vegetation is planted in narrow openings between panels to transpire water from below the panels. TWs system has successfully dewatered two lysimeters thus demonstrating that this procedure could be used for remedial action (''drying out'') existing water-logged disposal sites at low cost

  5. RIVER-RAD, Radionuclide Transport in Surface Waters

    International Nuclear Information System (INIS)

    1996-01-01

    1 - Description of program or function: RIVER-RAD assesses the potential fate of radionuclides released to rivers. The model is simplified in nature and is intended to provide guidance in determining the potential importance of the surface water pathway, relevant transport mechanisms, and key radionuclides in estimating radiological dose to man. 2 - Method of solution: A compartmental linear transfer model is used in RIVER-RAD. The river system model in the code is divided into reaches (compartments) of equal size, each with a sediment compartment below it. The movement of radionuclides is represented by a series of transfers between the reaches, and between the water and sediment compartments of each reach. Within each reach (for both the water and sediment compartments), the radionuclides are assumed to be uniformly mixed. Upward volatilization is allowed from the water compartment, and the transfer of radionuclides between the reaches is determined by the flow rate of the river. Settling and resuspension velocities determine the transfer of absorbed radionuclides between the water and sediment compartments. Radioactive decay and decay-product buildup are incorporated into all transport calculations for all radionuclide chains specified by the user. Each nuclide may have unique input and removal rates. Volatilization and radiological decay are considered as linear rate constants in the model. 3 - Restrictions on the complexity of the problem: None noted

  6. Cleaning the feed-water pipeline internal surfaces

    International Nuclear Information System (INIS)

    Podkopaev, V.A.

    1984-01-01

    The procedure of cleaning the feed-water pipeline internal surfaces at the Chernobylsk-4 power unit is described. Cleaning was conducted in five stages. Pipelines were cleaned from mechanical impurities at the first stage. At the second stage the pipelines were washing by water heated up to 80 deg C. At the third stage nitric acid was added to 95-100 deg C water the acid concentration in the circuit = 60 mg/l, purification period = 14 h. At the fourth stage hydrogen peroxide was added to the circuit at 95-100 deg C (the solution concentration was equal to 5-6 mg/l, the solution stayed in the circuit for 1 h 20 min). At the fifth stage sodium nitrite concentrated to 20 mg/l was introduced to the circuit in 75 minutes; this promoted strengthening of the oxide layer in the circuit on the base of nitric acid and hydrogen peroxide. Data on the water acidity in the circuit, water electric conductivity and iron concentration after the fourth stage and on completion of the circuit cleaning are presented. The described method of cleaning enables to save scarce reagents and use cheaper ones

  7. Cleaning the feed-water pipeline internal surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Podkopaev, V.A.

    1984-12-01

    The procedure of cleaning the feed-water pipeline internal surfaces at the Chernobylsk-4 power unit is described. Cleaning was conducted in five stages. Pipelines were cleaned from mechanical impurities at the first stage. At the second stage the pipelines were washed by water heated up to 80 deg C. At the third stage nitric acid was added to 95-100 deg C water with the acid concentration in the circuit = 60 mg/l, purification period = 14 h. At the fourth stage hydrogen peroxide was added to the circuit at 95-100 deg C (the solution concentration was equal to 5-6 mg/l, the solution stayed in the circuit for 1 h 20 min). At the fifth stage sodium nitrite concentrated to 20 mg/l was introduced to the circuit in 75 minutes; this promoted strengthening of the oxide layer in the circuit on the base of nitric acid and hydrogen peroxide. Data on the water acidity in the circuit, water electric conductivity and iron concentration after the fourth stage and on completion of the circuit cleaning are presented. The described method of cleaning enables to save scarce reagents and use cheaper ones.

  8. Introduction. [usefulness of modern remote sensing techniques for studying components of California water resources

    Science.gov (United States)

    Colwell, R. N.

    1973-01-01

    Since May 1970, personnel on several campuses of the University of California have been conducting investigations which seek to determine the usefulness of modern remote sensing techniques for studying various components of California's earth resources complex. Emphasis has been given to California's water resources as exemplified by the Feather River project and other aspects of the California Water Plan. This study is designed to consider in detail the supply, demand, and impact relationships. The specific geographic areas studied are the Feather River drainage in northern California, the Chino-Riverside Basin and Imperial Valley areas in southern California, and selected portions of the west side of San Joaquin Valley in central California. An analysis is also given on how an effective benefit-cost study of remote sensing in relation to California's water resources might best be made.

  9. Water Reclamation Using a Ceramic Nanofiltration Membrane and Surface Flushing with Ozonated Water

    Science.gov (United States)

    Hoang, Anh T.; Okuda, Tetsuji; Takeuchi, Haruka; Tanaka, Hiroaki; Nghiem, Long D.

    2018-01-01

    A new membrane fouling control technique using ozonated water flushing was evaluated for direct nanofiltration (NF) of secondary wastewater effluent using a ceramic NF membrane. Experiments were conducted at a permeate flux of 44 L/m2h to evaluate the ozonated water flushing technique for fouling mitigation. Surface flushing with clean water did not effectively remove foulants from the NF membrane. In contrast, surface flushing with ozonated water (4 mg/L dissolved ozone) could effectively remove most foulants to restore the membrane permeability. This surface flushing technique using ozonated water was able to limit the progression of fouling to 35% in transmembrane pressure increase over five filtration cycles. Results from this study also heighten the need for further development of ceramic NF membrane to ensure adequate removal of pharmaceuticals and personal care products (PPCPs) for water recycling applications. The ceramic NF membrane used in this study showed approximately 40% TOC rejection, and the rejection of PPCPs was generally low and highly variable. It is expected that the fouling mitigation technique developed here is even more important for ceramic NF membranes with smaller pore size and thus better PPCP rejection. PMID:29671797

  10. Water Reclamation Using a Ceramic Nanofiltration Membrane and Surface Flushing with Ozonated Water

    Directory of Open Access Journals (Sweden)

    Takahiro Fujioka

    2018-04-01

    Full Text Available A new membrane fouling control technique using ozonated water flushing was evaluated for direct nanofiltration (NF of secondary wastewater effluent using a ceramic NF membrane. Experiments were conducted at a permeate flux of 44 L/m2h to evaluate the ozonated water flushing technique for fouling mitigation. Surface flushing with clean water did not effectively remove foulants from the NF membrane. In contrast, surface flushing with ozonated water (4 mg/L dissolved ozone could effectively remove most foulants to restore the membrane permeability. This surface flushing technique using ozonated water was able to limit the progression of fouling to 35% in transmembrane pressure increase over five filtration cycles. Results from this study also heighten the need for further development of ceramic NF membrane to ensure adequate removal of pharmaceuticals and personal care products (PPCPs for water recycling applications. The ceramic NF membrane used in this study showed approximately 40% TOC rejection, and the rejection of PPCPs was generally low and highly variable. It is expected that the fouling mitigation technique developed here is even more important for ceramic NF membranes with smaller pore size and thus better PPCP rejection.

  11. Water response to ganglioside GM1 surface remodelling.

    Science.gov (United States)

    Brocca, P; Rondelli, V; Mallamace, F; Di Bari, M T; Deriu, A; Lohstroh, W; Del Favero, E; Corti, M; Cantu', L

    2017-01-01

    Gangliosides are biological glycolipids participating in rafts, structural and functional domains of cell membranes. Their headgroups are able to assume different conformations when packed on the surface of an aggregate, more lying or standing. Switching between different conformations is possible, and is a collective event. Switching can be induced, in model systems, by concentration or temperature increase, then possibly involving ganglioside-water interaction. In the present paper, the effect of GM1 ganglioside headgroup conformation on the water structuring and interactions is addressed. Depolarized Rayleigh Scattering, Raman Scattering, Quasielastic Neutron Scattering and NMR measurements were performed on GM1 ganglioside solutions, focusing on solvent properties. All used techniques agree in evidencing differences in the structure and dynamics of solvent water on different time-and-length scales in the presence of either GM1 headgroup conformations. In general, all results indicate that both the structural properties of solvent water and its interactions with the sugar headgroups of GM1 respond to surface remodelling. The extent of this modification is much higher than expected and, interestingly, ganglioside headgroups seem to turn from cosmotropes to chaotropes upon collective rearrangement from the standing- to the lying-conformation. In a biological perspective, water structure modulation could be one of the physico-chemical elements contributing to the raft strategy, both for rafts formation and persistence and for their functional aspects. In particular, the interaction with approaching bodies could be favoured or inhibited or triggered by complex-sugar-sequence conformational switch. This article is part of a Special Issue entitled "Science for Life" Guest Editor: Dr. Austen Angell, Dr. Salvatore Magazù and Dr. Federica Migliardo. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Surface Water Connectivity, Flow Pathways and Water Level Fluctuation in a Cold Region Deltaic Ecosystem

    Science.gov (United States)

    Peters, D. L.; Niemann, O.; Skelly, R.; Monk, W. A.; Baird, D. J.

    2017-12-01

    The Peace-Athabasca Delta (PAD) is a 6000 km2 deltaic floodplain ecosystem of international importance (Wood Buffalo National Park, Ramsar Convention, UNESCO World Heritage, and SWOT satellite water level calibration/validation site). The low-relief floodplain formed at the confluence of the Peace, Athabasca and Birch rivers with Lake Athabasca. More than 1000 wetland and lake basins have varying degrees of connectivity to the main flow system. Hydroperiod and water storage is influenced by ice-jam and open-water inundations and prevailing semi-arid climate that control water drawdown. Prior studies have identified pathways of river-to-wetland floodwater connection and historical water level fluctuation/trends as a key knowledge gaps, limiting our knowledge of deltaic ecosystem status and potential hydroecological responses to climate change and upstream water alterations to flow contributions. To address this knowledge gap, surface elevation mapping of the PAD has been conducted since 2012 using aerial remote sensing Light Detection and Ranging (LiDAR), plus thousands of ground based surface and bathymetric survey points tied to Global Positioning System (GPS) were obtained. The elevation information was used to develop a high resolution digital terrain model to simulate and investigate surface water connectivity. Importantly, the surveyed areas contain a set of wetland monitoring sites where ground-based surface water connectivity, water level/depth, water quality, and aquatic ecology (eg, vegetation, macroinvertebrate and muskrat) have been examined. The goal of this presentation is to present an assessment of: i) surface water fluctuation and connectivity for PAD wetland sites; ii) 40+ year inter-annual hydroperiod reconstruction for a perched basin using a combination of field measurements, remote sensing estimates, and historical documents; and iii) outline an approach to integrate newly available hydro-bio-geophysical information into a novel, multi

  13. First Derivative UV Spectra of Surface Water as a Monitor of Chlorination in Drinking Water Treatment

    Directory of Open Access Journals (Sweden)

    V. Zitko

    2001-01-01

    Full Text Available Many countries require the presence of free chlorine at about 0.1 mg/l in their drinking water supplies. For various reasons, such as cast-iron pipes or long residence times in the distribution system, free chlorine may decrease below detection limits. In such cases it is important to know whether or not the water was chlorinated or if nonchlorinated water entered the system by accident. Changes in UV spectra of natural organic matter in lakewater were used to assess qualitatively the degree of chlorination in the treatment to produce drinking water. The changes were more obvious in the first derivative spectra. In lakewater, the derivative spectra have a maximum at about 280 nm. This maximum shifts to longer wavelengths by up to 10 nm, decreases, and eventually disappears with an increasing dose of chlorine. The water treatment system was monitored by this technique for over 1 year and changes in the UV spectra of water samples were compared with experimental samples treated with known amounts of chlorine. The changes of the UV spectra with the concentration of added chlorine are presented. On several occasions, water, which received very little or no chlorination, may have entered the drinking water system. The results show that first derivative spectra are potentially a tool to determine, in the absence of residual chlorine, whether or not surface water was chlorinated during the treatment to produce potable water.

  14. Engineering Extreme Hydrophobic and Super Slippery Water Shedding Surfaces

    Science.gov (United States)

    McHale, Glen

    2017-04-01

    The intrinsic water repellency of a material is fundamentally determined by its surface chemistry, but alone this does not determine the ability of a surface to shed water. Physical factors such as the surface texture/topography, rigidity/flexibility, granularity/porosity combined with the intrinsic wetting properties of the liquid with the surface and whether it is infused by a lubricating liquid are equally important. In this talk I will outline fundamental, but simple, ideas on the topographic enhancement of surface chemistry to create superhydrophobicity, the adhesion of particles to liquid-air interfaces to create liquid marbles, elastocapillarity to create droplet wrapping, and lubricant impregnated surfaces to create completely mobile droplets [1-3]. I will discuss how these ideas have their origins in natural systems and surfaces, such as Lotus leaves, galling aphids and the Nepenthes pitcher plant. I will show how we have applied these concepts to study the wetting of granular systems, such as sand, to understand extreme soil water repellency. I will argue that relaxing the assumption that a solid substrate is fixed in shape and arrangement, can lead to the formation of liquid marbles, whereby a droplet self-coats in a hydrophobic powder/grains. I will show that the concepts of wetting and porosity blur as liquids penetrate into a porous or granular substrate. I will also discuss how lubricant impregnated super slippery surfaces can be used to study a pure constant contact angle mode of droplet evaporation [4]. Finally, I will show dewetting of a surface is not simply a video reversal of wetting [5], and I will give an example of the use of perfect hydrophobicity using the Leidenfrost effect to create a new type of low friction mechanical and hear engine [6]. References: [1] Shirtcliffe, N. J., et al., An introduction to superhydrophobicity. Advances in Colloid and Interface Science, vol. 161, pp.124-138 (2010). [2] McHale, G. & Newton, M. I. Liquid

  15. The Impact of Urbanization on the Precipitation Component of the Water Cycle: A New Perspective

    Science.gov (United States)

    Shephard, J. Marshal

    2002-01-01

    It is estimated that by the year 2025, 60% of the world s population will live in cities (UNFP, 1999). As cities continue to grow, urban sprawl (e.g., the expansion of urban surfaces outward into rural surroundings) creates unique problems related to land use, transportation, agriculture, housing, pollution, and development. Urban expansion also has measurable impacts on environmental processes. Urban areas modify boundary layer processes through the creation of an urban heat island (UHI). The literature indicates that the signature of the urban heat island effect may be resolvable in rainfall patterns over and downwind of metropolitan areas. However, a recent U.S. Weather Research Program panel concluded that more observational and modeling research is needed in this area (Dabberdt et al. 2000). NASA and other agencies initiated programs such as the Atlanta Land-use Analysis: Temperature and Air Quality Project (ATLANTA) (Quattrochi et al. 1998) which aimed to identify and understand how urban heat islands impact the environment. However, a comprehensive assessment of the role of urban-induced rainfall in the global water and energy cycle (GWEC) and cycling of freshwater was not a primary focus of these efforts. NASA's Earth Science Enterprise (ESE) seeks to develop a scientific understanding of the Earth system and its response to natural or human-induced changes to enable improved prediction capability for climate, weather, and natural hazards (NASA, 2000). Within this mission, the ESE has three basic thrusts: science research to increase Earth system knowledge; an applications program to transfer science knowledge to practical use in society; and a technology program to enable new, better, and cheaper capabilities for observing the earth. Within this framework, a research program is underway to further address the co-relationship between land cover use and change (e.g. urban development) and its impact on key components of the GWEC (e.g., precipitation). This

  16. Horizon effects with surface waves on moving water

    Energy Technology Data Exchange (ETDEWEB)

    Rousseaux, Germain; Maissa, Philippe; Mathis, Christian; Coullet, Pierre [Universite de Nice-Sophia Antipolis, Laboratoire J-A Dieudonne, UMR CNRS-UNS 6621, Parc Valrose, 06108 Nice Cedex 02 (France); Philbin, Thomas G; Leonhardt, Ulf, E-mail: Germain.Rousseaux@unice.f [School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews KY16 9SS (United Kingdom)

    2010-09-15

    Surface waves on a stationary flow of water are considered in a linear model that includes the surface tension of the fluid. The resulting gravity-capillary waves experience a rich array of horizon effects when propagating against the flow. In some cases, three horizons (points where the group velocity of the wave reverses) exist for waves with a single laboratory frequency. Some of these effects are familiar in fluid mechanics under the name of wave blocking, but other aspects, in particular waves with negative co-moving frequency and the Hawking effect, were overlooked until surface waves were investigated as examples of analogue gravity (Schuetzhold R and Unruh W G 2002 Phys. Rev. D 66 044019). A comprehensive presentation of the various horizon effects for gravity-capillary waves is given, with emphasis on the deep water/ short wavelength case kh>>1, where many analytical results can be derived. A similarity of the state space of the waves to that of a thermodynamic system is pointed out.

  17. A Review of Heterogeneous Photocatalysis for Water and Surface Disinfection

    Directory of Open Access Journals (Sweden)

    John Anthony Byrne

    2015-03-01

    Full Text Available Photo-excitation of certain semiconductors can lead to the production of reactive oxygen species that can inactivate microorganisms. The mechanisms involved are reviewed, along with two important applications. The first is the use of photocatalysis to enhance the solar disinfection of water. It is estimated that 750 million people do not have accessed to an improved source for drinking and many more rely on sources that are not safe. If one can utilize photocatalysis to enhance the solar disinfection of water and provide an inexpensive, simple method of water disinfection, then it could help reduce the risk of waterborne disease. The second application is the use of photocatalytic coatings to combat healthcare associated infections. Two challenges are considered, i.e., the use of photocatalytic coatings to give “self-disinfecting” surfaces to reduce the risk of transmission of infection via environmental surfaces, and the use of photocatalytic coatings for the decontamination and disinfection of medical devices. In the final section, the development of novel photocatalytic materials for use in disinfection applications is reviewed, taking account of materials, developed for other photocatalytic applications, but which may be transferable for disinfection purposes.

  18. Eutrophication management in surface waters using lanthanum modified bentonite

    DEFF Research Database (Denmark)

    Copetti, Diego; Finsterle, Karin; Marziali, Laura

    2016-01-01

    This paper reviews the scientific knowledge on the use of a lanthanum modified bentonite (LMB) to manage eutrophication in surface water. The LMB has been applied in around 200 environments worldwide and it has undergone extensive testing at laboratory, mesocosm, and whole lake scales. The availa......This paper reviews the scientific knowledge on the use of a lanthanum modified bentonite (LMB) to manage eutrophication in surface water. The LMB has been applied in around 200 environments worldwide and it has undergone extensive testing at laboratory, mesocosm, and whole lake scales....... The available data underline a high efficiency for phosphorus binding. This efficiency can be limited by the presence of humic substances and competing oxyanions. Lanthanum concentrations detected during a LMB application are generally below acute toxicological threshold of different organisms, except in low...... alkalinity waters. To date there are no indications for long-term negative effects on LMB treated ecosystems, but issues related to La accumulation, increase of suspended solids and drastic resources depletion still need to be explored, in particular for sediment dwelling organisms. Application of LMB...

  19. WATER ICE AT THE SURFACE OF THE HD 100546 DISK

    Energy Technology Data Exchange (ETDEWEB)

    Honda, M. [Department of Physics, Kurume University School of Medicine, 67 Asahi-machi, Kurume, Fukuoka, 830-0011 (Japan); Kudo, T.; Terada, H.; Takato, N. [Subaru Telescope, National Astronomical Observatory of Japan, 650 North A’ohoku Place, Hilo, Hawaii 96720 (United States); Takatsuki, S.; Nakamoto, T. [Department of Earth and Planetary Sciences, Tokyo Institute of Technology, Meguro, Tokyo 152-8551 (Japan); Inoue, A. K. [College of General Education, Osaka Sangyo University, Daito, Osaka 574-8530 (Japan); Fukagawa, M.; Tamura, M. [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan)

    2016-04-10

    We made near-infrared multicolor imaging observations of a disk around Herbig Be star HD 100546 using Gemini/NICI. K (2.2 μm), H{sub 2}O ice (3.06 μm), and L′ (3.8 μm) disk images were obtained and we found a 3.1 μm absorption feature in the scattered light spectrum, likely due to water ice grains at the disk surface. We compared the observed depth of the ice absorption feature with the disk model based on Oka et al., including the water ice photodesorption effect by stellar UV photons. The observed absorption depth can be explained by both the disk models with and without the photodesorption effect within the measurement accuracy, but the model with photodesorption effects is slightly more favored, implying that the UV photons play an important role in the survival/destruction of ice grains at the Herbig Ae/Be disk surface. Further improvement to the accuracy of the observations of the water ice absorption depth is needed to constrain the disk models.

  20. Soil and water characteristics of a young surface mine wetland

    Science.gov (United States)

    Andrew Cole, C.; Lefebvre, Eugene A.

    1991-05-01

    Coal companies are reluctant to include wetland development in reclamation plans partly due to a lack of information on the resulting characteristics of such sites. It is easier for coal companies to recreate terrestrial habitats than to attempt experimental methods and possibly face significant regulatory disapproval. Therefore, we studied a young (10 years) wetland on a reclaimed surface coal mine in southern Illinois so as to ascertain soil and water characteristics such that the site might serve as a model for wetland development on surface mines. Water pH was not measured because of equipment problems, but evidence (plant life, fish, herpetofauna) suggests suitable pH levels. Other water parameters (conductivity, salinity, alkalinity, chloride, copper, total hardness, iron, manganese, nitrate, nitrite, phosphate, and sulfate) were measured, and only copper was seen in potentially high concentrations (but with no obvious toxic effects). Soil variables measured included pH, nitrate, nitrite, ammonia, potassium, calcium, magnesium, manganese, aluminum, iron, sulfate, chloride, and percent organic matter. Soils were slightly alkaline and most parameters fell within levels reported for other studies on both natural and manmade wetlands. Aluminum was high, but this might be indicative more of large amounts complexed with soils and therefore unavailable, than amounts actually accessible to plants. Organic matter was moderate, somewhat surprising given the age of the system.