Particle dry deposition to water surfaces: Processes and consequences

DEFF Research Database (Denmark)

Pryor, S.C.; Barthelmie, R.J.

2000-01-01

flux to coastal waters, atmosphere-surface exchange represents a significant component of the total flux and may be particularly critical during the summertime when both the riverine input and ambient nutrient concentrations are often at a minimum. In this chapter, we present an overview...... of the physical and chemical processes which dictate the quantity (and direction) of atmosphere-surface fluxes of trace chemicals to (and above) water surfaces with particular emphasis on the role of particles. Dry deposition (transfer to the surface in the absence of precipitation) of particles is determined...... efforts to simulate and measure fluxes close to the coastline. These arise in part from the complexity of atmospheric flow in this region where energy and chemical fluxes are highly inhomogeneous in space and time and thermally generated atmospheric circulations are commonplace. (C) 2000 Elsevier Science...

Surface-water surveillance

Energy Technology Data Exchange (ETDEWEB)

Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

1995-06-01

This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995).

Surface-water surveillance

International Nuclear Information System (INIS)

Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

1995-01-01

This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995)

Surface modification method for reactor incore structural component

International Nuclear Information System (INIS)

Obata, Minoru; Sudo, Akira.

1996-01-01

A large number of metal or ceramic small spheres accelerated by pressurized air are collided against a surface of a reactor incore structures or a welded surface of the structural components, and then finishing is applied by polishing to form compression stresses on the surface. This can change residual stresses into compressive stress without increasing the strength of the surface. Accordingly, stress corrosion crackings of the incore structural components or welded portions thereof can be prevented thereby enabling to extend the working life of equipments. (T.M.)

Water at surfaces with tunable surface chemistries

Science.gov (United States)

Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

2018-03-01

Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

Surface freezing of water

OpenAIRE

P?rez-D?az, J. L.; ?lvarez-Valenzuela, M. A.; Rodr?guez-Celis, F.

2016-01-01

Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered?exclusively?by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on ...

Impact of climate forcing uncertainty and human water use on global and continental water balance components

Directory of Open Access Journals (Sweden)

H. Müller Schmied

2016-10-01

Full Text Available The assessment of water balance components using global hydrological models is subject to climate forcing uncertainty as well as to an increasing intensity of human water use within the 20th century. The uncertainty of five state-of-the-art climate forcings and the resulting range of cell runoff that is simulated by the global hydrological model WaterGAP is presented. On the global land surface, about 62 % of precipitation evapotranspires, whereas 38 % discharges into oceans and inland sinks. During 1971–2000, evapotranspiration due to human water use amounted to almost 1 % of precipitation, while this anthropogenic water flow increased by a factor of approximately 5 between 1901 and 2010. Deviation of estimated global discharge from the ensemble mean due to climate forcing uncertainty is approximately 4 %. Precipitation uncertainty is the most important reason for the uncertainty of discharge and evapotranspiration, followed by shortwave downward radiation. At continental levels, deviations of water balance components due to uncertain climate forcing are higher, with the highest discharge deviations occurring for river discharge in Africa (−6 to 11 % from the ensemble mean. Uncertain climate forcings also affect the estimation of irrigation water use and thus the estimated human impact of river discharge. The uncertainty range of global irrigation water consumption amounts to approximately 50 % of the global sum of water consumption in the other water use sector.

Microclimatic models. Estimation of components of the energy balance over land surfaces

Energy Technology Data Exchange (ETDEWEB)

Heikinheimo, M; Venaelaeinen, A; Tourula, T [Finnish Meteorological Inst., Helsinki (Finland). Air Quality Dept.

1997-12-31

Climates at regional scale are strongly dependent on the interaction between atmosphere and its lower boundary, the oceans and the land surface mosaic. Land surfaces influence climate through their albedo, and the aerodynamic roughness, the processes of the biosphere and many soil hydrological properties; all these factors vary considerably geographically. Land surfaces receive a certain portion of the solar irradiance depending on the cloudiness, atmospheric transparency and surface albedo. Short-wave solar irradiance is the source of the heat energy exchange at the earth`s surface and also regulates many biological processes, e.g. photosynthesis. Methods for estimating solar irradiance, atmospheric transparency and surface albedo were reviewed during the course of this project. The solar energy at earth`s surface is consumed for heating the soil and the lower atmosphere. Where moisture is available, evaporation is one of the key components of the surface energy balance, because the conversion of liquid water into water vapour consumes heat. The evaporation process was studied by carrying out field experiments and testing parameterisation for a cultivated agricultural surface and for lakes. The micrometeorological study over lakes was carried out as part of the international `Northern Hemisphere Climatic Processes Experiment` (NOPEX/BAHC) in Sweden. These studies have been aimed at a better understanding of the energy exchange processes of the earth`s surface-atmosphere boundary for a more accurate and realistic parameterisation of the land surface in atmospheric models

Microclimatic models. Estimation of components of the energy balance over land surfaces

Energy Technology Data Exchange (ETDEWEB)

Heikinheimo, M.; Venaelaeinen, A.; Tourula, T. [Finnish Meteorological Inst., Helsinki (Finland). Air Quality Dept.

1996-12-31

Climates at regional scale are strongly dependent on the interaction between atmosphere and its lower boundary, the oceans and the land surface mosaic. Land surfaces influence climate through their albedo, and the aerodynamic roughness, the processes of the biosphere and many soil hydrological properties; all these factors vary considerably geographically. Land surfaces receive a certain portion of the solar irradiance depending on the cloudiness, atmospheric transparency and surface albedo. Short-wave solar irradiance is the source of the heat energy exchange at the earth`s surface and also regulates many biological processes, e.g. photosynthesis. Methods for estimating solar irradiance, atmospheric transparency and surface albedo were reviewed during the course of this project. The solar energy at earth`s surface is consumed for heating the soil and the lower atmosphere. Where moisture is available, evaporation is one of the key components of the surface energy balance, because the conversion of liquid water into water vapour consumes heat. The evaporation process was studied by carrying out field experiments and testing parameterisation for a cultivated agricultural surface and for lakes. The micrometeorological study over lakes was carried out as part of the international `Northern Hemisphere Climatic Processes Experiment` (NOPEX/BAHC) in Sweden. These studies have been aimed at a better understanding of the energy exchange processes of the earth`s surface-atmosphere boundary for a more accurate and realistic parameterisation of the land surface in atmospheric models

Hydrochemical characteristics of mine waters from abandoned mining sites in Serbia and their impact on surface water quality.

Science.gov (United States)

Atanacković, Nebojša; Dragišić, Veselin; Stojković, Jana; Papić, Petar; Zivanović, Vladimir

2013-11-01

Upon completion of exploration and extraction of mineral resources, many mining sites have been abandoned without previously putting environmental protection measures in place. As a consequence, mine waters originating from such sites are discharged freely into surface water. Regional scale analyses were conducted to determine the hydrochemical characteristics of mine waters from abandoned sites featuring metal (Cu, Pb-Zn, Au, Fe, Sb, Mo, Bi, Hg) deposits, non-metallic minerals (coal, Mg, F, B) and uranium. The study included 80 mine water samples from 59 abandoned mining sites. Their cation composition was dominated by Ca2+, while the most common anions were found to be SO4(2-) and HCO3-. Strong correlations were established between the pH level and metal (Fe, Mn, Zn, Cu) concentrations in the mine waters. Hierarchical cluster analysis was applied to parameters generally indicative of pollution, such as pH, TDS, SO4(2-), Fe total, and As total. Following this approach, mine water samples were grouped into three main clusters and six subclusters, depending on their potential environmental impact. Principal component analysis was used to group together variables that share the same variance. The extracted principal components indicated that sulfide oxidation and weathering of silicate and carbonate rocks were the primary processes, while pH buffering, adsorption and ion exchange were secondary drivers of the chemical composition of the analyzed mine waters. Surface waters, which received the mine waters, were examined. Analysis showed increases of sulfate and metal concentrations and general degradation of surface water quality.

Welding residual stress improvement in internal components by water jet peening

International Nuclear Information System (INIS)

Enomoto, K.; Hirano, K.; Hayashi, M.; Hayashi, E.

1996-01-01

Cavitations are generated when highly pressurized water is jetted in water. Surface residual stress is improved remarkably due to the peening effect of extremely high pressure caused by the collapse of cavitation bubbles. This technique is called water jet peening (WJP). WJP is expected to be an effective maintenance technique for the prevention of stress corrosion cracking caused by residual stress in various components of power generating plants. Various kinds of specimens were water jet peened to evaluate the fundamental characteristics of WJP and to select the most appropriate conditions for the residual stress improvement. Test results showed that WJP markedly improved the tensile residual stress caused by welding and grinding to the high compressive residual stress and seems to prevent the stress corrosion cracking

A regional coupled surface water/groundwater model of the Okavango Delta, Botswana

DEFF Research Database (Denmark)

Bauer-Gottwein, Peter; Gumbricht, T.; Kinzelbach, W.

2006-01-01

In the endorheic Okavango River system in southern Africa a balance between human and environmental water demands has to be achieved. The runoff generated in the humid tropical highlands of Angola flows through arid Namibia and Botswana before forming a large inland delta and eventually being...... of a surface water flow component based on the diffusive wave approximation of the Saint- Venant equations, a groundwater component, and a relatively simple vadose zone component for calculating the net water exchange between land and atmosphere. The numerical scheme is based on the groundwater simulation......, spectacular wildlife, and a first- class tourism infrastructure, depend on the combined effect of the highly seasonal runoff in the Okavango River and variable local climate. The annual fluctuations in the inflow are transformed into vast areas of seasonally inundated floodplains. Water abstraction...

Surface freezing of water.

Science.gov (United States)

Pérez-Díaz, J L; Álvarez-Valenzuela, M A; Rodríguez-Celis, F

2016-01-01

Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered-exclusively-by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on humidity, presenting at least three different types of surface crystals. Humidity triggers surface freezing as soon as it overpasses a defined value for a given temperature, generating a plurality of nucleation nodes. An evidence of simultaneous nucleation of surface ice crystals is also provided.

Heterogeneous Ice Nucleation: Interplay of Surface Properties and Their Impact on Water Orientations.

Science.gov (United States)

Glatz, Brittany; Sarupria, Sapna

2018-01-23

Ice is ubiquitous in nature, and heterogeneous ice nucleation is the most common pathway of ice formation. How surface properties affect the propensity to observe ice nucleation on that surface remains an open question. We present results of molecular dynamics studies of heterogeneous ice nucleation on model surfaces. The models surfaces considered emulate the chemistry of kaolinite, an abundant component of mineral dust. We investigate the interplay of surface lattice and hydrogen bonding properties in affecting ice nucleation. We find that lattice matching and hydrogen bonding are necessary but not sufficient conditions for observing ice nucleation at these surfaces. We correlate this behavior to the orientations sampled by the metastable supercooled water in contact with the surfaces. We find that ice is observed in cases where water molecules not only sample orientations favorable for bilayer formation but also do not sample unfavorable orientations. This distribution depends on both surface-water and water-water interactions and can change with subtle modifications to the surface properties. Our results provide insights into the diverse behavior of ice nucleation observed at different surfaces and highlight the complexity in elucidating heterogeneous ice nucleation.

Environmetric data interpretation to assess surface water quality

International Nuclear Information System (INIS)

Simeonova, P.; Papazova, P.; Lovchinov, V.

2013-01-01

Two multivariate statistical methods (Cluster analysis /CA/ and Principal components analysis /PCA/) were applied for model assessment of the water quality of Maritsa River and Tundja River on Bulgarian territory. The study used long-term monitoring data from many sampling sites characterized by various surface water quality indicators. The application of CA to the indicators results in formation of clusters showing the impact of biological, anthropogenic and eutrophication sources. For further assessment of the monitoring data, PCA was implemented, which identified, again, latent factors confirming, in principle, the clustering output. Their identification coincide correctly to the location of real pollution sources along the rivers catchments. The linkage of the sampling sites along the river flow by CA identified several special patterns separated by specific tracers levels. The apportionment models of the pollution determined the contribution of each one of identified pollution factors to the total concentration of each one of the water quality parameters. Thus, a better risk management of the surface water quality is achieved both on local and national level

Calculation of the surface water pollution index in the evaluation of environmental component of product life cycle

Directory of Open Access Journals (Sweden)

Олег Аскольдович Проскурнин

2015-05-01

Full Text Available The assessment feasibility of the combined effect of the product life cycle on the environment is grounded. As an example, the pollution of surface waters at the production stage is considered in the article. A mechanism of ranking indicators of surface water pollution according to their importance is proposed. An algorithm for checking the consistency of the statistical expert judgment in determining weight coefficient for the indicators of pollution, based on the use of the concordance coefficient, is given

Sustaining dry surfaces under water

DEFF Research Database (Denmark)

Jones, Paul R.; Hao, Xiuqing; Cruz-Chu, Eduardo R.

2015-01-01

Rough surfaces immersed under water remain practically dry if the liquid-solid contact is on roughness peaks, while the roughness valleys are filled with gas. Mechanisms that prevent water from invading the valleys are well studied. However, to remain practically dry under water, additional...... mechanisms need consideration. This is because trapped gas (e.g. air) in the roughness valleys can dissolve into the water pool, leading to invasion. Additionally, water vapor can also occupy the roughness valleys of immersed surfaces. If water vapor condenses, that too leads to invasion. These effects have...... not been investigated, and are critically important to maintain surfaces dry under water.In this work, we identify the critical roughness scale, below which it is possible to sustain the vapor phase of water and/or trapped gases in roughness valleys – thus keeping the immersed surface dry. Theoretical...

Assessment of the dynamics of the radioactivity contents in surface waters in contaminated areas

International Nuclear Information System (INIS)

Komissarov, F.D.; Datskevich, P.I.; Golikov, Y.N.; Basharina, L.P.; Churack, T.N.; Khvaley, O.D.

1997-01-01

In the connection with Chernobyl APS accident, since 1988 a network of sites was established for radioecological monitoring of surface water systems, mainly, small rivers on all Belarus territory. Small rivers are the principal way of radionuclides run off in liquid and solid discharges during rains and high-floods and their re-distribution in landscapes. The components of water systems radio-monitoring were water and water suspensions, area water-collection, bottom deposits and biota. In the paper the data are cited of radioecological studies of water systems components. Their analysis is done and some conclusions made which may be used for the development of radioecological prognosis and for taking environmental measures

Water quality responses to the interaction between surface water and groundwater along the Songhua River, NE China

Science.gov (United States)

Teng, Yanguo; Hu, Bin; Zheng, Jieqiong; Wang, Jinsheng; Zhai, Yuanzheng; Zhu, Chen

2018-03-01

Investigation of surface water and groundwater interaction (SW-GW interaction) provides basic information for regional water-resource protection, management, and development. In this survey of a 10-km-wide area along both sides of the Songhua River, northeast China, the hydrogeochemical responses to different SW-GW interactions were studied. Three types of SW-GW interactions were identified—"recharge", "discharge", and "flow-through"—according to the hydraulic connection between the surface water and groundwater. The single factor index, principal component analysis, and hierarchical cluster analysis of the hydrogeochemistry and pollutant data illuminated the hydrogeochemical response to the various SW-GW interactions. Clear SW-GW interactions along the Songhua River were revealed: (1) upstream in the study area, groundwater usually discharges into the surface water, (2) groundwater is recharged by surface water downstream, and (3) discharge and flow-through coexist in between. Statistical analysis indicated that the degree of hydrogeochemical response in different types of hydraulic connection varied, being clear in recharge and flow-through modes, and less obvious in discharge mode. During the interaction process, dilution, adsorption, redox reactions, nitrification, denitrification, and biodegradation contributed to the pollutant concentration and affected hydrogeochemical response in the hyporheic zone.

Regional patterns of pesticide concentrations in surface waters of New York in 1997

Science.gov (United States)

Phillips, P.J.; Eckhardt, D.A.; Freehafer, D.A.; Wall, G.R.; Ingleston, H.H.

2002-01-01

The predominant mixtures of pesticides found in New York surface waters consist of five principal components. First, herbicides commonly used on corn (atrazine, metolachlor, alachlor, cyanazine) and a herbicide degradate (deethylatrazine) were positively correlated to a corn-herbicide component, and watersheds with the highest corn-herbicide component scores were those in which large amounts of row crops are grown. Second, two insecticides (diazinon and carbaryl) and one herbicide (prometon) widely used in urban and residential settings were positively correlated to an urban/residential component. Watersheds with the highest urban/residential component scores were those with large amounts of urban and residential land use. A third component was related to two herbicides (EPTC and cyanazine) used on dry beans and corn, the fourth to an herbicide (simazine) and an insecticide (carbaryl) commonly used in orchards and vineyards, and the fifth to an herbicide (DCPA). Results of this study indicate that this approach can be used to: (1) identify common mixtures of pesticides in surface waters, (2) relate these mixtures to land use and pesticide applications, and (3) indicate regions where these mixtures of pesticides are commonly found.

Surface Water in Hawaii

Science.gov (United States)

Oki, Delwyn S.

2003-01-01

Surface water in Hawaii is a valued resource as well as a potential threat to human lives and property. The surface-water resources of Hawaii are of significant economic, ecologic, cultural, and aesthetic importance. Streams supply more than 50 percent of the irrigation water in Hawaii, and although streams supply only a few percent of the drinking water statewide, surface water is the main source of drinking water in some places. Streams also are a source of hydroelectric power, provide important riparian and instream habitats for many unique native species, support traditional and customary Hawaiian gathering rights and the practice of taro cultivation, and possess valued aesthetic qualities. Streams affect the physical, chemical, and aesthetic quality of receiving waters, such as estuaries, bays, and nearshore waters, which are critical to the tourism-based economy of the islands. Streams in Hawaii pose a danger because of their flashy nature; a stream's stage, or water level, can rise several feet in less than an hour during periods of intense rainfall. Streams in Hawaii are flashy because rainfall is intense, drainage basins are small, basins and streams are steep, and channel storage is limited. Streamflow generated during periods of heavy rainfall has led to loss of property and human lives in Hawaii. Most Hawaiian streams originate in the mountainous interiors of the islands and terminate at the coast. Streams are significant sculptors of the Hawaiian landscape because of the erosive power of the water they convey. In geologically young areas, such as much of the southern part of the island of Hawaii, well-defined stream channels have not developed because the permeability of the surface rocks generally is so high that rainfall infiltrates before flowing for significant distances on the surface. In geologically older areas that have received significant rainfall, streams and mass wasting have carved out large valleys.

Modeling decadal timescale interactions between surface water and ground water in the central Everglades, Florida, USA

Science.gov (United States)

Harvey, Judson W.; Newlin, Jessica T.; Krupa, Steven L.

2006-04-01

calculated recharge and discharge) is much less sensitive to vertical mixing compared with residence time alone. We conclude that a small but potentially significant component of flow through the Everglades is recharged to the aquifer and stored there for years to decades before discharged back to surface water. Long-term storage of water and solutes in the ground-water system beneath the wetlands has implications for restoration of Everglades water quality.

The hydrochemistry of glacial Ebba River (Petunia Bay, Central Spitsbergen): Groundwater influence on surface water chemistry

Science.gov (United States)

Dragon, Krzysztof; Marciniak, Marek; Szpikowski, Józef; Szpikowska, Grażyna; Wawrzyniak, Tomasz

2015-10-01

The article presents the investigation of surface water chemistry changes of the glacial Ebba River (Central Spitsbergen) during three melting seasons of 2008, 2009 and 2010. The twice daily water chemistry analyses allow recognition of the surface water chemistry differentiation. The surface water chemistry changes are related to the river discharge and changes in the influence of different water balance components during each melting season. One of the most important process that influence river water component concentration increase is groundwater inflow from active layer occurring on the valley area. The significance of this process is the most important at the end of the melting season when temperatures below 0 °C occur on glaciers (resulting in a slowdown of melting of ice and snow and a smaller recharge of the river by the water from the glaciers) while the flow of groundwater is still active, causing a relatively higher contribution of groundwater to the total river discharge. The findings presented in this paper show that groundwater contribution to the total polar river water balance is more important than previously thought and its recognition allow a better understanding of the hydrological processes occurring in a polar environment.

Salinization and arsenic contamination of surface water in southwest Bangladesh.

Science.gov (United States)

Ayers, John C; George, Gregory; Fry, David; Benneyworth, Laura; Wilson, Carol; Auerbach, Leslie; Roy, Kushal; Karim, Md Rezaul; Akter, Farjana; Goodbred, Steven

2017-09-11

concentrations show that all surface water types lie on mixing lines between dry season tidal channel water and rainwater, i.e., all are related by varying degrees of salinization. High As concentrations in dry season tidal channel water and shrimp ponds likely result from groundwater exfiltration and upstream irrigation in the dry season. Arsenic is transferred from tidal channels to rice paddies through irrigation. Including groundwater samples from the same area (Ayers et al. in Geochem Trans 17:1-22, 2016), principal components analysis and correlation analysis reveal that salinization explains most variation in surface water compositions, whereas progressive reduction of buried surface water by dissolved organic carbon is responsible for the nonconservative behavior of S, Fe, and As and changes in Eh and alkalinity of groundwater.

Water on a Hydrophobic surface

Science.gov (United States)

Scruggs, Ryan; Zhu, Mengjue; Poynor, Adele

2012-02-01

Hydrophobicity, meaning literally fear of water, is exhibited on the surfaces of non-stick cooking pans and water resistant clothing, on the leaves of the lotus plan, or even during the protein folding process in our bodies. Hydrophobicity is directly measured by determining a contact angle between water and an objects surface. Associated with a hydrophobic surface is the depletion layer, a low density region approximately 0.2 nm thick. We study this region by comparing data found in lab using surface plasmon resonance techniques to theoretical calculations. Experiments use gold slides coated in ODT and Mercapto solutions to model both hydrophobic and hydrophilic surfaces respectively.

Biological methods used to assess surface water quality

Directory of Open Access Journals (Sweden)

Szczerbiñska Natalia

2015-12-01

Full Text Available In accordance with the guidelines of the Water Framework Directive 2000/60 (WFD, both ecological and chemical statuses determine the assessment of surface waters. The profile of ecological status is based on the analysis of various biological components, and physicochemical and hydromorphological indicators complement this assessment. The aim of this article is to present the biological methods used in the assessment of water status with a special focus on bioassay, as well as to provide a review of methods of monitoring water status. Biological test methods include both biomonitoring and bioanalytics. Water biomonitoring is used to assess and forecast the status of water. These studies aim to collect data on water pollution and forecast its impact. Biomonitoring uses organisms which are characterized by particular vulnerability to contaminants. Bioindicator organisms are algae, fungi, bacteria, larval invertebrates, cyanobacteria, macroinvertebrates, and fish. Bioanalytics is based on the receptors of contaminants that can be biologically active substances. In bioanalytics, biosensors such as viruses, bacteria, antibodies, enzymes, and biotests are used to assess degrees of pollution.

Utilization of satellite remote sensing data on land surface characteristics in water and heat balance component modeling for vegetation covered territories

Science.gov (United States)

Muzylev, Eugene; Uspensky, Alexander; Startseva, Zoya; Volkova, Elena; Kukharsky, Alexander; Uspensky, Sergey

2010-05-01

The model of vertical water and heat transfer in the "soil-vegetation-atmosphere" system (SVAT) for vegetation covered territory has been developed, allowing assimilating satellite remote sensing data on land surface condition as well as accounting for heterogeneities of vegetation and meteorological characteristics. The model provides the calculation of water and heat balance components (such as evapotranspiration Ev, soil water content W, sensible and latent heat fluxes and others ) as well as vertical soil moisture and temperature distributions, temperatures of soil surface and foliage, land surface brightness temperature for any time interval within vegetation season. To describe the landscape diversity soil constants and leaf area index LAI, vegetation cover fraction B, and other vegetation characteristics are used. All these values are considered to be the model parameters. Territory of Kursk region with square about 15 thousands km2 situated in the Black Earth zone of Central Russia was chosen for investigation. Satellite-derived estimates of land surface characteristics have been constructed under cloud-free condition basing AVHRR/NOAA, MODIS/EOS Terra and EOS Aqua, SEVIRI/Meteosat-8, -9 data. The developed technologies of AVHRR data thematic processing have been refined providing the retrieval of surface skin brightness temperature Tsg, air foliage temperature Ta, efficient surface temperature Ts.eff and emissivity E, as well as derivation of vegetation index NDVI, B, and LAI. The linear regression estimators for Tsg, Ta and LAI have been built using representative training samples for 2003-2009 vegetation seasons. The updated software package has been applied for AVHRR data thematic processing to generate named remote sensing products for various dates of the above vegetation seasons. The error statistics of Ta, Ts.eff and Тsg derivation has been investigated for various samples using comparison with in-situ measurements that has given RMS errors in the

Effect of the ODS-4 surfactant and its components on the efficiency of decontamination of solid surfaces

International Nuclear Information System (INIS)

Dvorak, J.; Duris, P.

1994-01-01

The efficiency was examined of the desorption of carrier-free traces of 147 Pm adsorbed from an acid aqueous solution at pH 2.6 in static conditions on a paint routinely applied to military facilities. The desorption was performed by using the ODS-4 decontamination and deactivation mixture and its components at various concentrations. It is concluded that the surfactant is not very well suited to the decontamination of solid surfaces contaminated with radionuclides which form the water-soluble component of radioactive contamination (in dependence on pH). This is due to the composition and the associated high alkalinity of the ODS-4 agent, which, however, is necessary if detoxication of toxic agents is required. In practice, however, the efficiency of decontamination will be appreciably higher because the military decontamination procedures involve dynamic (mechanical) treatment of the surfaces using brushes with flowing liquid, pressure application of the surfactant and water, moving baths, etc. (P.A.). 7 tabs., 2 figs., 10 refs

Assessment of drinking water quality using principal component ...

African Journals Online (AJOL)

Assessment of drinking water quality using principal component analysis and partial least square discriminant analysis: a case study at water treatment plants, ... water and to detect the source of pollution for the most revealing parameters.

Understanding the Impact of Intensive Horticulture Land-Use Practices on Surface Water Quality in Central Kenya

Directory of Open Access Journals (Sweden)

Faith K. Muriithi

2015-11-01

Full Text Available Rapid expansion of commercial horticulture production and related activities contribute to declining surface water quality. The study sought to understand the impacts on select rivers in Laikipia and Meru, production hotspots. The specific aims were (1 to identify prevailing surface water quality by examining variations of 14 physico-chemical parameters, and (2 to categorize measured surface water quality parameters into land use types highlighting potential pollutant source processes. Water samples were collected in July and August 2013 along 14 rivers in the study area. The data were analyzed using principal component analysis (PCA and discriminant analysis (DA. Principal components (PCs explained 70% of the observed total variability of water quality, indicating a prevalence of heavy metal traces (cadmium, phosphate, and zinc. These were linked to the rigorous use of phosphate fertilizers and copper-based agrochemicals in intensive farming. DA provided four significant (p < 0.05 discriminant functions, with 89.5% correct assignment enabling the association of land use with observed water quality. Concentrations of dissolved solids, electro-conductivity, and salinity spiked at locations with intensive small-scale and large-scale horticulture. Understanding the impacts of intensive commercial horticulture and land use practices on water quality is critical to formulating ecologically sound watershed management and pollution abatement plans.

Residual stress improving method for reactor structural component and residual stress improving device therefor

Energy Technology Data Exchange (ETDEWEB)

Enomoto, Kunio; Otaka, Masahiro; Kurosawa, Koichi; Saito, Hideyo; Tsujimura, Hiroshi; Tamai, Yasukata; Urashiro, Keiichi; Mochizuki, Masato

1996-09-03

The present invention is applied to a BWR type reactor, in which a high speed jetting flow incorporating cavities is collided against the surface of reactor structural components to form residual compression stresses on the surface layer of the reactor structural components thereby improving the stresses on the surface. Namely, a water jetting means is inserted into the reactor container filled with reactor water. Purified water is pressurized by a pump and introduced to the water jetting means. The purified water jetted from the water jetting means and entraining cavities is abutted against the surface of the reactor structural components. With such procedures, since the purified water is introduced to the water jetting means by the pump, the pump is free from contamination of radioactive materials. As a result, maintenance and inspection for the pump can be facilitated. Further, since the purified water injection flow entraining cavities is abutted against the surface of the reactor structural components being in contact with reactor water, residual compression stresses are exerted on the surface of the reactor structural components. As a result, occurrence of stress corrosion crackings of reactor structural components is suppressed. (I.S.)

Residual stress improving method for reactor structural component and residual stress improving device therefor

International Nuclear Information System (INIS)

Enomoto, Kunio; Otaka, Masahiro; Kurosawa, Koichi; Saito, Hideyo; Tsujimura, Hiroshi; Tamai, Yasukata; Urashiro, Keiichi; Mochizuki, Masato.

1996-01-01

The present invention is applied to a BWR type reactor, in which a high speed jetting flow incorporating cavities is collided against the surface of reactor structural components to form residual compression stresses on the surface layer of the reactor structural components thereby improving the stresses on the surface. Namely, a water jetting means is inserted into the reactor container filled with reactor water. Purified water is pressurized by a pump and introduced to the water jetting means. The purified water jetted from the water jetting means and entraining cavities is abutted against the surface of the reactor structural components. With such procedures, since the purified water is introduced to the water jetting means by the pump, the pump is free from contamination of radioactive materials. As a result, maintenance and inspection for the pump can be facilitated. Further, since the purified water injection flow entraining cavities is abutted against the surface of the reactor structural components being in contact with reactor water, residual compression stresses are exerted on the surface of the reactor structural components. As a result, occurrence of stress corrosion crackings of reactor structural components is suppressed. (I.S.)

Amoco-US Environmental Protection Agency, pollution prevention project, Yorktown, Virginia: Surface water data

International Nuclear Information System (INIS)

Baloo, S.

1991-08-01

The report summarizes the surface water sampling program at the Amoco Refinery at Yorktown, Virginia. This was undertaken as a part of the joint project between Amoco Corporation and the United States Environmental Protection Agency to review pollution prevention alternatives at a petroleum refinery. The surface water data provides a snapshot of surface water pollutant generation and discharge from the refinery. Different process units contribute to the total wastewater flow of 460 GPM in the refinery. Water in the ditch system, which is non-process water, is free of organic contamination. Oil and grease, phenols, ammonia and sulfides are the significant components measured in the process wastewater. The concentrations of organics in most water streams leaving the individual process units are relatively low, in the 1-5 parts per million (ppm) range. A few individual streams such as the crude desalter brine and tank water draws have high pollutant loadings. Concentrations of metals in the refinery wastewater are very low. The wastewater treatment plant is very effective in reducing the pollutant loading in the water with overall removal efficiencies greater than 99% for most organics and inorganics

Effect of surface modification on the corrosion resistivity in supercritical water

International Nuclear Information System (INIS)

Penttila, S.; Horvath, A.; Toivonen, A.; Zolnai, Z.

2011-01-01

This paper summarizes the results of high temperature corrosion studies of the candidate austenitic alloys at relevant operating conditions for SCWR. The high temperature and pressure above the thermodynamic critical point of water result in higher oxidation rate which might be critical for thin-wall components like fuel cladding. The goal of this work was to study the effect of surface preparation on the oxidation rate on Ti-stabilized austenitic alloy 1.4970. Surfaces were prepared with ion implantation using He"+- and N"+-ions. Samples were immersed in supercritical water at 650"oC/25 MPa, for up to 2000 hours. Added to this, conventional surface treatments were conducted for austenitic alloy 316L tube samples in order to study the effect of cold work in sample surface on corrosion resistance. The corrosion rate was evaluated by measuring the weight change of the samples. The compositions of the oxide layers were analyzed using scanning electron microscope (SEM) in conjunction with Energy Dispersive Spectroscopy (EDS). (author)

Radioecological state of some surface water systems of contaminated areas of both Gomel and Mogilev Regions

International Nuclear Information System (INIS)

Datskevich, P. I.; Komissariv, F. D.; Khvale', O. D.; Basharina, L. P.; Lobach, I. L.

1997-01-01

The radioecological situation of different ecosystems of Belarus and their components has been analysed. Such components of the surface water ecosystems as water, suspensions, sediments and soils of water-collection areas were used for the investigation of the content of cesium 137 and strontium 90. The received data were given since 1990. The content of cesium 137 and strontium 90 in the components of water ecosystems was counted in the laboratory conditions by means of standard methods of beta radiometry, semiconductor gamma spectrometry and radiochemistry. The error of measurement of radioactivity was not higher than 25 and 35% for cesium 137 and strontium 90 accordingly. Water ecosystems were distinguished by the state of contamination of water-collection areas and hydrological parameters. These and some other reasons considered in the article influence on the character of cesium 137 and strontium 90 behaviour in water ecosystems

Application of SWAT99.2 to sensitivity analysis of water balance components in unique plots in a hilly region

Directory of Open Access Journals (Sweden)

Jun-feng Dai

2017-07-01

Full Text Available Although many sensitivity analyses using the soil and water assessment tool (SWAT in a complex watershed have been conducted, little attention has been paid to the application potential of the model in unique plots. In addition, sensitivity analysis of percolation and evapotranspiration with SWAT has seldom been undertaken. In this study, SWAT99.2 was calibrated to simulate water balance components for unique plots in Southern China from 2000 to 2001, which included surface runoff, percolation, and evapotranspiration. Twenty-one parameters classified into four categories, including meteorological conditions, topographical characteristics, soil properties, and vegetation attributes, were used for sensitivity analysis through one-at-a-time (OAT sampling to identify the factor that contributed most to the variance in water balance components. The results were shown to be different for different plots, with parameter sensitivity indices and ranks varying for different water balance components. Water balance components in the broad-leaved forest and natural grass plots were most sensitive to meteorological conditions, less sensitive to vegetation attributes and soil properties, and least sensitive to topographical characteristics. Compared to those in the natural grass plot, water balance components in the broad-leaved forest plot demonstrated higher sensitivity to the maximum stomatal conductance (GSI and maximum leaf area index (BLAI.

Corrugated metal surface with pillars for terahertz surface plasmon polariton waveguide components

KAUST Repository

Yuehong, Xu; Yanfeng, Li; Chunxiu, Tian; Jiaguang, Han; Quan, Xu; Xueqian, Zhang; Xixiang, Zhang; Ying, Zhang; Weili, Zhang

2018-01-01

In the terahertz regime, due to perfect conductivity of most metals, it is hard to realize a strong confinement of Surface plasmon polaritons (SPPs) although a propagation loss could be sufficiently low. We experimentally demonstrated a structure with periodic pillars arranged on a thin metal surface that supports bound modes of spoof SPPs at terahertz (THz) frequencies. By using scanning near-field THz microscopy, the electric field distribution above the metal surface within a distance of 130 μm was mapped. The results proved that this structure could guide spoof SPPs propagating along subwavelength waveguides, and at the same time reduce field expansion into free space. Further, for the development of integrated optical circuits, several components including straight waveguide, S-bend, Y-splitter and directional couplers were designed and characterized by the same method. We believe that the waveguide components proposed here will pave a new way for the development of flexible, wideband and compact photonic circuits operating at THz frequencies.

Corrugated metal surface with pillars for terahertz surface plasmon polariton waveguide components

KAUST Repository

Yuehong, Xu

2018-01-12

In the terahertz regime, due to perfect conductivity of most metals, it is hard to realize a strong confinement of Surface plasmon polaritons (SPPs) although a propagation loss could be sufficiently low. We experimentally demonstrated a structure with periodic pillars arranged on a thin metal surface that supports bound modes of spoof SPPs at terahertz (THz) frequencies. By using scanning near-field THz microscopy, the electric field distribution above the metal surface within a distance of 130 μm was mapped. The results proved that this structure could guide spoof SPPs propagating along subwavelength waveguides, and at the same time reduce field expansion into free space. Further, for the development of integrated optical circuits, several components including straight waveguide, S-bend, Y-splitter and directional couplers were designed and characterized by the same method. We believe that the waveguide components proposed here will pave a new way for the development of flexible, wideband and compact photonic circuits operating at THz frequencies.

Spreading of oil films on water in the surface tension regime

Energy Technology Data Exchange (ETDEWEB)

Camp, D.W.

1985-01-01

Surface tension forces will cause an oil to spread over water if the tension of the oil film (the summed surface and interfacial tensions for bulk oil films, or the equilibrium spreading tension for monomolecular films) is less than the surface tension of water. For oil films spreading in a 40 cm long channel, measurements are made of leading edge position and lateral profiles of film thickness, velocity, and tension as a function of time. Measurements of the tension profiles, important for evaluating proposed theories, is made possible by the development of a new technique based on the Wilhelmy method. The oils studied were silicones, fatty acids and alcohols, and mixtures of surfactants in otherwise nonspreading oils. The single-component oils show an acceleration zone connecting a slow-moving inner region with a fast-moving leading monolayer. The dependence of film tension on film thickness for spreading single-component oils often differs from that at equilibrium. The mixtures show a bulk oil film configuration which extends to the leading edge and have velocity profiles which increase smoothly. The theoretical framework, similarity transformation, and asymptotic solutions of Foda and Cox for single-component oils were shown to be valid. An analysis of spreading surfactant-oil mixtures is developed which allows them to be treated under this framework. An easily-used semi-empirical model is proposed which allows them to be treated under this framework. An easily-used semi-empirical model is proposed which allows accurate prediction of detailed spreading behavior for any spreading oil.

Assessing Variation in Water Balance Components in Mountainous Inland River Basin Experiencing Climate Change

Directory of Open Access Journals (Sweden)

Zhenliang Yin

2016-10-01

Full Text Available Quantification of the changes of water balance components is significant for water resource assessment and management. This paper employed the Soil and Water Assessment Tool (SWAT model to estimate the water balance in a mountainous watershed in northwest China at different spatial scales over the past half century. The results showed that both Nash-Sutcliffe efficiency (NSE and determination coefficient (R2 were over 0.90 for the calibration and validation periods. The water balance components presented rising trends at the watershed scale, and the total runoff increased by 30.5% during 1964 to 2013 period. Rising surface runoff and rising groundwater flow contributed 42.7% and 57.3% of the total rising runoff, respectively. The runoff coefficient was sensitive to increasing precipitation and was not significant to the increase of temperature. The alpine meadow was the main landscape which occupied 51.1% of the watershed and contributed 55.5% of the total runoff. Grass land, forest land, bare land, and glacier covered 14.2%, 18.8%, 15.4%, and 0.5% of the watershed and contributed 8.5%, 16.9%, 15.9%, and 3.2% of the total runoff, respectively. The elevation zone from 3500 to 4500 m occupied 66.5% of the watershed area, and contributed the majority of the total runoff (70.7%. The runoff coefficients in the elevation zone from 1637 to 2800 m, 2800 to 3500 m, 3500 to 4000 m, 4000 to 4500 m, and 4500 to 5062 m were 0.20, 0.27, 0.32, 0.43, and 0.78, respectively, which tend to be larger along with the elevation increase. The quantities and change trends of the water balance components at the watershed scale were calculated by the results of the sub-watersheds. Furthermore, we characterized the spatial distribution of quantities and changes in trends of water balance components at the sub-watershed scale analysis. This study provides some references for water resource management and planning in inland river basins.

The influence of the surface composition of mixed monolayer films on the evaporation coefficient of water.

Science.gov (United States)

Miles, Rachael E H; Davies, James F; Reid, Jonathan P

2016-07-20

We explore the dependence of the evaporation coefficient of water from aqueous droplets on the composition of a surface film, considering in particular the influence of monolayer mixed component films on the evaporative mass flux. Measurements with binary component films formed from long chain alcohols, specifically tridecanol (C13H27OH) and pentadecanol (C15H31OH), and tetradecanol (C14H29OH) and hexadecanol (C16H33OH), show that the evaporation coefficient is dependent on the mole fractions of the two components forming the monolayer film. Immediately at the point of film formation and commensurate reduction in droplet evaporation rate, the evaporation coefficient is equal to a mole fraction weighted average of the evaporation coefficients through the equivalent single component films. As a droplet continues to diminish in surface area with continued loss of water, the more-soluble, shorter alkyl chain component preferentially partitions into the droplet bulk with the evaporation coefficient tending towards that through a single component film formed simply from the less-soluble, longer chain alcohol. We also show that the addition of a long chain alcohol to an aqueous-sucrose droplet can facilitate control over the degree of dehydration achieved during evaporation. After undergoing rapid gas-phase diffusion limited water evaporation, binary aqueous-sucrose droplets show a continued slow evaporative flux that is limited by slow diffusional mass transport within the particle bulk due to the rapidly increasing particle viscosity and strong concentration gradients that are established. The addition of a long chain alcohol to the droplet is shown to slow the initial rate of water loss, leading to a droplet composition that remains more homogeneous for a longer period of time. When the sucrose concentration has achieved a sufficiently high value, and the diffusion constant of water has decreased accordingly so that bulk phase diffusion arrest occurs in the monolayer

Turbine component having surface cooling channels and method of forming same

Science.gov (United States)

Miranda, Carlos Miguel; Trimmer, Andrew Lee; Kottilingam, Srikanth Chandrudu

2017-09-05

A component for a turbine engine includes a substrate that includes a first surface, and an insert coupled to the substrate proximate the substrate first surface. The component also includes a channel. The channel is defined by a first channel wall formed in the substrate and a second channel wall formed by at least one coating disposed on the substrate first surface. The component further includes an inlet opening defined in flow communication with the channel. The inlet opening is defined by a first inlet wall formed in the substrate and a second inlet wall defined by the insert.

Residual stress improved by water jet peening using cavitation for small-diameter pipe inner surfaces

International Nuclear Information System (INIS)

Yasuo, Nakamura; Toshizo, Ohya; Koji, Okimura

2001-01-01

As one of degradation conditions on components used in water, the overlapping effect of environment, material and stress might cause stress corrosion cracking (SCC). Especially, for the tensile residual stress produced by welding, it is particularly effective to reduce the tensile residual stress on the material surface to prevent SCC. In this paper, the residual stress improvement method using cavitation impact generated by a water jet, called Water Jet Peening (WJP), has been developed as the maintenance technology for the inner surfaces of small-diameter Ni-Cr-Fe alloy (Alloy 600) pipes. As the results, by WJP for the inner surface of Alloy 600 pipe (inner diameter; approximately 10-15 mm), we confirmed that the compressive stress generated within the range from the surface to the inner part about 0.5 mm deep and took a maximum value about 350 MPa on the surface. (author)

Experimental study on fouling in the heat exchangers of surface water heat pumps

International Nuclear Information System (INIS)

Bai, Xuelian; Luo, Te; Cheng, Kehui; Chai, Feng

2014-01-01

Fouling in the heat exchangers plays a key role on the performance of surface water heat pumps. It is also the basement for the system design criteria and operation energy efficiency. In this paper, experimental measurements are performed both in the field and the laboratory with different water qualities, temperatures and velocities. The research will focus on the dynamic growth characteristics of fouling and its main components. By studying the variation rules of fouling resistance, the fouling resistance allowance for certain water condition is recommended. Furthermore, a fouling prediction model in surface water heat pump will be developed and validated based on elaborating with fouling principle under specified water conditions. - Highlights: • Field and laboratory experiments are taken to measure the fouling variation. • Fouling growth process can be divided into four stages. • We recommend fouling resistance allowances for certain conditions. • A fouling prdiction model is developed and validated

Estimation of available water capacity components of two-layered soils using crop model inversion: Effect of crop type and water regime

Science.gov (United States)

Sreelash, K.; Buis, Samuel; Sekhar, M.; Ruiz, Laurent; Kumar Tomer, Sat; Guérif, Martine

2017-03-01

Characterization of the soil water reservoir is critical for understanding the interactions between crops and their environment and the impacts of land use and environmental changes on the hydrology of agricultural catchments especially in tropical context. Recent studies have shown that inversion of crop models is a powerful tool for retrieving information on root zone properties. Increasing availability of remotely sensed soil and vegetation observations makes it well suited for large scale applications. The potential of this methodology has however never been properly evaluated on extensive experimental datasets and previous studies suggested that the quality of estimation of soil hydraulic properties may vary depending on agro-environmental situations. The objective of this study was to evaluate this approach on an extensive field experiment. The dataset covered four crops (sunflower, sorghum, turmeric, maize) grown on different soils and several years in South India. The components of AWC (available water capacity) namely soil water content at field capacity and wilting point, and soil depth of two-layered soils were estimated by inversion of the crop model STICS with the GLUE (generalized likelihood uncertainty estimation) approach using observations of surface soil moisture (SSM; typically from 0 to 10 cm deep) and leaf area index (LAI), which are attainable from radar remote sensing in tropical regions with frequent cloudy conditions. The results showed that the quality of parameter estimation largely depends on the hydric regime and its interaction with crop type. A mean relative absolute error of 5% for field capacity of surface layer, 10% for field capacity of root zone, 15% for wilting point of surface layer and root zone, and 20% for soil depth can be obtained in favorable conditions. A few observations of SSM (during wet and dry soil moisture periods) and LAI (within water stress periods) were sufficient to significantly improve the estimation of AWC

Adsorption-Driven Surface Segregation of the Less Reactive Alloy Component

DEFF Research Database (Denmark)

Andersson, Klas Jerker; Calle Vallejo, Federico; Rossmeisl, Jan

2009-01-01

Counterintuitive to expectations and all prior observations of adsorbate-induced surface segregation of the more reactive alloy component (the one forming the stronger bond with the adsorbate), we show that CO adsorption at elevated pressures and temperatures pulls the less reactive Cu to the sur......Counterintuitive to expectations and all prior observations of adsorbate-induced surface segregation of the more reactive alloy component (the one forming the stronger bond with the adsorbate), we show that CO adsorption at elevated pressures and temperatures pulls the less reactive Cu...... to the surface of a CuPt near-surface alloy. The Cu surface segregation is driven by the formation of a stable self-organized CO/CuPt surface alloy structure and is rationalized in terms of the radically stronger Pt−CO bond when Cu is present in the first surface layer of Pt. The results, which are expected...

Near-Surface Profiles of Water Stable Isotope Components and Indicated Transitional History of Ice-Wedge Polygons Near Barrow

Science.gov (United States)

Iwahana, G.; Wilson, C.; Newman, B. D.; Heikoop, J. M.; Busey, R.

2017-12-01

Wetlands associated with ice-wedge polygons are commonly distributed across the Arctic Coastal Plain of northern Alaska, a region underlain by continuous permafrost. Micro-topography of the ice-wedge polygons controls local hydrology, and the micro-topography could be altered due to factors such like surface vegetation, wetness, freeze-thaw cycles, and permafrost degradation/aggradation under climate change. Understanding status of the wetlands in the near future is important because it determines biogeochemical cycle, which drives release of greenhouse gases from the ground. However, transitional regime of the ice-wedge polygons under the changing climate is not fully understood. In this study, we analyzed geochemistry of water extracted from frozen soil cores sampled down to about 1m depth in 2014 March at NGEE-Arctic sites in the Barrow Environmental Observatory. The cores were sampled from troughs/rims/centers of five different low-centered or flat-centered polygons. The frozen cores are divided into 5-10cm cores for each location, thawed in sealed plastic bags, and then extracted water was stored in vials. Comparison between the profiles of geochemistry indicated connection of soil water in the active layer at different location in a polygon, while it revealed that distinctly different water has been stored in permafrost layer at troughs/rims/centers of some polygons. Profiles of volumetric water content (VWC) showed clear signals of freeze-up desiccation in the middle of saturated active layers as low VWC anomalies at most sampling points. Water in the active layer and near-surface permafrost was classified into four categories: ice wedge / fresh meteoric / transitional / highly fractionated water. The overall results suggested prolonged separation of water in the active layer at the center of low-centered polygons without lateral connection in water path in the past.

Integrated Modeling of Groundwater and Surface Water Interactions in a Manmade Wetland

Directory of Open Access Journals (Sweden)

Guobiao Huang Gour-Tsyh Yeh

2012-01-01

Full Text Available A manmade pilot wetland in south Florida, the Everglades Nutrient Removal (ENR project, was modeled with a physics-based integrated approach using WASH123D (Yeh et al. 2006. Storm water is routed into the treatment wetland for phosphorus removal by plant and sediment uptake. It overlies a highly permeable surficial groundwater aquifer. Strong surface water and groundwater interactions are a key component of the hydrologic processes. The site has extensive field measurement and monitoring tools that provide point scale and distributed data on surface water levels, groundwater levels, and the physical range of hydraulic parameters and hydrologic fluxes. Previous hydrologic and hydrodynamic modeling studies have treated seepage losses empirically by some simple regression equations and, only surface water flows are modeled in detail. Several years of operational data are available and were used in model historical matching and validation. The validity of a diffusion wave approximation for two-dimensional overland flow (in the region with very flat topography was also tested. The uniqueness of this modeling study is notable for (1 the point scale and distributed comparison of model results with observed data; (2 model parameters based on available field test data; and (3 water flows in the study area include two-dimensional overland flow, hydraulic structures/levees, three-dimensional subsurface flow and one-dimensional canal flow and their interactions. This study demonstrates the need and the utility of a physics-based modeling approach for strong surface water and groundwater interactions.

Controllability of Surface Water Networks

Science.gov (United States)

Riasi, M. Sadegh; Yeghiazarian, Lilit

2017-12-01

To sustainably manage water resources, we must understand how to control complex networked systems. In this paper, we study surface water networks from the perspective of structural controllability, a concept that integrates classical control theory with graph-theoretic formalism. We present structural controllability theory and compute four metrics: full and target controllability, control centrality and control profile (FTCP) that collectively determine the structural boundaries of the system's control space. We use these metrics to answer the following questions: How does the structure of a surface water network affect its controllability? How to efficiently control a preselected subset of the network? Which nodes have the highest control power? What types of topological structures dominate controllability? Finally, we demonstrate the structural controllability theory in the analysis of a wide range of surface water networks, such as tributary, deltaic, and braided river systems.

Understanding surface-water availability in the Central Valley as a means to projecting future groundwater storage with climate variability

Science.gov (United States)

Goodrich, J. P.; Cayan, D. R.

2017-12-01

California's Central Valley (CV) relies heavily on diverted surface water and groundwater pumping to supply irrigated agriculture. However, understanding the spatiotemporal character of water availability in the CV is difficult because of the number of individual farms and local, state, and federal agencies involved in using and managing water. Here we use the Central Valley Hydrologic Model (CVHM), developed by the USGS, to understand the relationships between climatic variability, surface water inputs, and resulting groundwater use over the historical period 1970-2013. We analyzed monthly surface water diversion data from >500 CV locations. Principle components analyses were applied to drivers constructed from meteorological data, surface reservoir storage, ET, land use cover, and upstream inflows, to feed multiple regressions and identify factors most important in predicting surface water diversions. Two thirds of the diversion locations ( 80% of total diverted water) can be predicted to within 15%. Along with monthly inputs, representations of cumulative precipitation over the previous 3 to 36 months can explain an additional 10% of variance, depending on location, compared to results that excluded this information. Diversions in the southern CV are highly sensitive to inter-annual variability in precipitation (R2 = 0.8), whereby more surface water is used during wet years. Until recently, this was not the case in the northern and mid-CV, where diversions were relatively constant annually, suggesting relative insensitivity to drought. In contrast, this has important implications for drought response in southern regions (eg. Tulare Basin) where extended dry conditions can severely limit surface water supplies and lead to excess groundwater pumping, storage loss, and subsidence. In addition to fueling our understanding of spatiotemporal variability in diversions, our ability to predict these water balance components allows us to update CVHM predictions before

Groundwater–Surface Water Exchange

DEFF Research Database (Denmark)

Karan, Sachin

The exchange of groundwater-surface water has been invetigated in the western part of Denmark. Holtum AA provides the framework for all the performed investigations. Several methods are used, primarily eld based measurements ombined with numerical models to achieve insight to the governing...... processes of interaction between groundwater and surface water. By using heat as a tracer it has been possible to use temperature directly as calibrationtargets in a groundwater and heat transport model. Thus, it is possible to use heat investigate the change in groundwater discharge in dynamic conditions...... by using simple temperature devices along a stream to delineate the areas of interest in regard to GW{SW exchange. Thus, at several locations in a stream a temperature data logger was placed in the water column and right at the streambed-water interface. By looking at the correlation of streambed...

Concentration Dependences of the Surface Tension and Density of Solutions of Acetone-Ethanol-Water Systems at 293 K

Science.gov (United States)

Dadashev, R. Kh.; Dzhambulatov, R. S.; Mezhidov, V. Kh.; Elimkhanov, D. Z.

2018-05-01

Concentration dependences of the surface tension and density of solutions of three-component acetone-ethanol-water systems and the bounding binary systems at 273 K are studied. The molar volume, adsorption, and composition of surface layers are calculated. Experimental data and calculations show that three-component solutions are close to ideal ones. The surface tensions of these solutions are calculated using semi-empirical and theoretical equations. Theoretical equations qualitatively convey the concentration dependence of surface tension. A semi-empirical method based on the Köhler equation allows us to predict the concentration dependence of surface tension within the experimental error.

Impact of Water Withdrawals from Groundwater and Surface Water on Continental Water Storage Variations

Science.gov (United States)

Doell, Petra; Hoffmann-Dobrev, Heike; Portmann, Felix T.; Siebert, Stefan; Eicker, Annette; Rodell, Matthew; Strassberg, Gil

2011-01-01

Humans have strongly impacted the global water cycle, not only water flows but also water storage. We have performed a first global-scale analysis of the impact of water withdrawals on water storage variations, using the global water resources and use model WaterGAP. This required estimation of fractions of total water withdrawals from groundwater, considering five water use sectors. According to our assessment, the source of 35% of the water withdrawn worldwide (4300 cubic km/yr during 1998-2002) is groundwater. Groundwater contributes 42%, 36% and 27% of water used for irrigation, households and manufacturing, respectively, while we assume that only surface water is used for livestock and for cooling of thermal power plants. Consumptive water use was 1400 cubic km/yr during 1998-2002. It is the sum of the net abstraction of 250 cubic km/yr of groundwater (taking into account evapotranspiration and return flows of withdrawn surface water and groundwater) and the net abstraction of 1150 km3/yr of surface water. Computed net abstractions indicate, for the first time at the global scale, where and when human water withdrawals decrease or increase groundwater or surface water storage. In regions with extensive surface water irrigation, such as Southern China, net abstractions from groundwater are negative, i.e. groundwater is recharged by irrigation. The opposite is true for areas dominated by groundwater irrigation, such as in the High Plains aquifer of the central USA, where net abstraction of surface water is negative because return flow of withdrawn groundwater recharges the surface water compartments. In intensively irrigated areas, the amplitude of seasonal total water storage variations is generally increased due to human water use; however, in some areas, it is decreased. For the High Plains aquifer and the whole Mississippi basin, modeled groundwater and total water storage variations were compared with estimates of groundwater storage variations based on

Surface composition and surface properties of water hyacinth ...

African Journals Online (AJOL)

Surface composition and surface properties of water hyacinth ( Eichhornia ... (2/1, v/v) followed by ethanol, using Fourier Transform Infra-red (FT-IR) spectroscopy, ... polar organic solvents and non-polar n-alkane hydrocarbons is discussed.

Infiltration of pesticides in surface water into nearby drinking water supply wells

DEFF Research Database (Denmark)

Malaguerra, Flavio; Albrechtsen, Hans-Jørgen; Binning, Philip John

Drinking water wells are often placed near streams because streams often overly permeable sediments and the water table is near the surface in valleys, and so pumping costs are reduced. The lowering of the water table by pumping wells can reverse the natural flow from the groundwater to the stream......, inducing infiltration of surface water to groundwater and consequently to the drinking water well. Many attenuation processes can take place in the riparian zone, mainly due to mixing, biodegradation and sorption. However, if the water travel time from the surface water to the pumping well is too short......, or if the compounds are poorly degradable, contaminants can reach the drinking water well at high concentrations, jeopardizing drinking water quality. Here we developed a reactive transport model to evaluate the risk of contamination of drinking water wells by surface water pollution. The model was validated using...

Waste water treatment in surface mines

Energy Technology Data Exchange (ETDEWEB)

Navasardyants, M A; Esipov, V Z; Ryzhkov, Yu A

1981-01-01

This paper evaluates problems associated with waste water from coal surface mines of the Kemerovougol' association in the Kuzbass. Waste water treatment in the Kuzbass is of major importance as the region is supplied with water from only one river, the Tom river. Water influx to Kemerovougol' surface mines in a year amounts to 136 million m/sup 3/. The water is used during technological processes, for fire fighting, and spraying to prevent dusting; the rest, about 82.1 million m/sup 3/, is discharged into surface waters. Of this amount, 25.1 million m/sup 3/ is heavily polluted water, 46.6 million m3 are polluted but within limits, and 10.4 million m/sup 3/ are characterized as relatively clean. Waste water is polluted with: suspended matters, oils and oil products, nitrates, nitrides and chlorides. Suspended matter content sometimes reaches 4,000 and 5,000 mg/l, and oil product content in water amounts to 2.17 mg/l. Water treatment in surface mines is two-staged: sumps and sedimentation tanks are used. Water with suspended matter content of 50 to 100 mg/l in winter and summer, and 200 to 250 mg/l in spring and autumn is reduced in sumps to 25 to 30 mg/l in summer and winter and to 40 to 50 mg/l in autumn and spring. During the first stage water treatment efficiency ranges from 50 to 80%. During the second stage water is collected in sedimentation tanks. It is noted that so-called secondary pollution is one of the causes of the relatively high level of suspended matter in discharged water. Water discharged from sedimentation tanks carries clay and loam particles from the bottom and walls of water tanks and channels.

Independent principal component analysis for simulation of soil water content and bulk density in a Canadian Watershed

Directory of Open Access Journals (Sweden)

Alaba Boluwade

2016-09-01

Full Text Available Accurate characterization of soil properties such as soil water content (SWC and bulk density (BD is vital for hydrologic processes and thus, it is importance to estimate θ (water content and ρ (soil bulk density among other soil surface parameters involved in water retention and infiltration, runoff generation and water erosion, etc. The spatial estimation of these soil properties are important in guiding agricultural management decisions. These soil properties vary both in space and time and are correlated. Therefore, it is important to find an efficient and robust technique to simulate spatially correlated variables. Methods such as principal component analysis (PCA and independent component analysis (ICA can be used for the joint simulations of spatially correlated variables, but they are not without their flaws. This study applied a variant of PCA called independent principal component analysis (IPCA that combines the strengths of both PCA and ICA for spatial simulation of SWC and BD using the soil data set from an 11 km2 Castor watershed in southern Quebec, Canada. Diagnostic checks using the histograms and cumulative distribution function (cdf both raw and back transformed simulations show good agreement. Therefore, the results from this study has potential in characterization of water content variability and bulk density variation for precision agriculture.

Performance of Water Recirculation Loop Maintentance Components for the Advanced Spacesuit Water Membrane Evaporator

Science.gov (United States)

Rector, Tony; Peyton, Barbara; Steele, John W.; Bue, Grant C.; Campbell, Colin; Makinen, Janice

2014-01-01

Water loop maintenance components to maintain the water quality of the Advanced Spacesuit Water Membrane Evaporation (SWME) water recirculation loop have undergone a comparative performance evaluation with a second SWME water recirculation loop with no water quality maintenance. Results show the benefits of periodic water maintenance. The SWME is a heat rejection device under development at the NASA Johnson Space Center to perform thermal control for advanced spacesuits. One advantage to this technology is the potential for a significantly greater degree of tolerance to contamination when compared to the existing Sublimator technology. The driver for the evaluation of water recirculation maintenance components was to further enhance this advantage through the leveraging of fluid loop management lessonslearned from the International Space Station (ISS). A bed design that was developed for a UTAS military application, and considered for a potential ISS application with the Urine Processor Assembly, provided a low pressure drop means for water maintenance in a recirculation loop. The bed design is coupled with high capacity ion exchange resins, organic adsorbents, and a cyclic methodology developed for the Extravehicular Mobility Unit (EMU) Transport Water loop. The maintenance cycle included the use of a biocide delivery component developed for ISS to introduce a biocide in a microgravity-compatible manner for the Internal Active Thermal Control System (IATCS). The leveraging of these water maintenance technologies to the SWME recirculation loop is a unique demonstration of applying the valuable lessons learned on the ISS to the next generation of manned spaceflight Environmental Control and Life Support System (ECLSS) hardware.

Performance of Water Recirculation Loop Maintenance Components for the Advanced Spacesuit Water Membrane Evaporator

Science.gov (United States)

Rector, Tony; Peyton, Barbara M.; Steele, John W.; Makinen, Janice; Bue, Grant C.; Campbell, Colin

2014-01-01

Water loop maintenance components to maintain the water quality of the Advanced Spacesuit Water Membrane Evaporation (SWME) water recirculation loop have undergone a comparative performance evaluation with a second SWME water recirculation loop with no water quality maintenance. Results show the benefits of periodic water maintenance. The SWME is a heat rejection device under development at the NASA Johnson Space Center to perform thermal control for advanced spacesuits. One advantage to this technology is the potential for a significantly greater degree of tolerance to contamination when compared to the existing Sublimator technology. The driver for the evaluation of water recirculation maintenance components was to further enhance this advantage through the leveraging of fluid loop management lessons learned from the International Space Station (ISS). A bed design that was developed for a UTAS military application, and considered for a potential ISS application with the Urine Processor Assembly, provided a low pressure drop means for water maintenance in a recirculation loop. The bed design is coupled with high capacity ion exchange resins, organic adsorbents, and a cyclic methodology developed for the Extravehicular Mobility Unit (EMU) Transport Water loop. The maintenance cycle included the use of a biocide delivery component developed for ISS to introduce a biocide in a microgravity compatible manner for the Internal Active Thermal Control System (IATCS). The leveraging of these water maintenance technologies to the SWME recirculation loop is a unique demonstration of applying the valuable lessons learned on the ISS to the next generation of manned spaceflight Environmental Control and Life Support System (ECLSS) hardware.

The conservative behavior of dissolved organic carbon in surface waters of the southern Chukchi Sea, Arctic Ocean, during early summer.

Science.gov (United States)

Tanaka, Kazuki; Takesue, Nobuyuki; Nishioka, Jun; Kondo, Yoshiko; Ooki, Atsushi; Kuma, Kenshi; Hirawake, Toru; Yamashita, Youhei

2016-09-23

The spatial distribution of dissolved organic carbon (DOC) concentrations and the optical properties of dissolved organic matter (DOM) determined by ultraviolet-visible absorbance and fluorescence spectroscopy were measured in surface waters of the southern Chukchi Sea, western Arctic Ocean, during the early summer of 2013. Neither the DOC concentration nor the optical parameters of the DOM correlated with salinity. Principal component analysis using the DOM optical parameters clearly separated the DOM sources. A significant linear relationship was evident between the DOC and the principal component score for specific water masses, indicating that a high DOC level was related to a terrigenous source, whereas a low DOC level was related to a marine source. Relationships between the DOC and the principal component scores of the surface waters of the southern Chukchi Sea implied that the major factor controlling the distribution of DOC concentrations was the mixing of plural water masses rather than local production and degradation.

Indices of quality surface water bodies in the planning of water resources

Directory of Open Access Journals (Sweden)

Rodríguez-Miranda, Juan Pablo

2016-12-01

Full Text Available This paper considers a review of the literature major and significant methods of quality indices of water applied in surface water bodies, used and proposed for assessing the significance of parameters of water quality in the assessment of surface water currents and they are usually used in making decisions for intervention and strategic prevention measures for those responsible for the conservation and preservation of watersheds where these water bodies belong. An exploratory methodology was applied to realize the conceptualization of each water quality index. As a result, it is observed that there are several important methods for determining the water quality index applied in surface water bodies.

Insight into Chemistry on Cloud/Aerosol Water Surfaces.

Science.gov (United States)

Zhong, Jie; Kumar, Manoj; Francisco, Joseph S; Zeng, Xiao Cheng

2018-05-15

Cloud/aerosol water surfaces exert significant influence over atmospheric chemical processes. Atmospheric processes at the water surface are observed to follow mechanisms that are quite different from those in the gas phase. This Account summarizes our recent findings of new reaction pathways on the water surface. We have studied these surface reactions using Born-Oppenheimer molecular dynamics simulations. These studies provide useful information on the reaction time scale, the underlying mechanism of surface reactions, and the dynamic behavior of the product formed on the aqueous surface. According to these studies, the aerosol water surfaces confine the atmospheric species into a specific orientation depending on the hydrophilicity of atmospheric species or the hydrogen-bonding interactions between atmospheric species and interfacial water. As a result, atmospheric species are activated toward a particular reaction on the aerosol water surface. For example, the simplest Criegee intermediate (CH 2 OO) exhibits high reactivity toward the interfacial water and hydrogen sulfide, with the reaction times being a few picoseconds, 2-3 orders of magnitude faster than that in the gas phase. The presence of interfacial water molecules induces proton-transfer-based stepwise pathways for these reactions, which are not possible in the gas phase. The strong hydrophobicity of methyl substituents in larger Criegee intermediates (>C1), such as CH 3 CHOO and (CH 3 ) 2 COO, blocks the formation of the necessary prereaction complexes for the Criegee-water reaction to occur at the water droplet surface, which lowers their proton-transfer ability and hampers the reaction. The aerosol water surface provides a solvent medium for acids (e.g., HNO 3 and HCOOH) to participate in reactions via mechanisms that are different from those in the gas and bulk aqueous phases. For example, the anti-CH 3 CHOO-HNO 3 reaction in the gas phase follows a direct reaction between anti-CH 3 CHOO and HNO 3

Performance of materials in the component cooling water systems of pressurized water reactors

International Nuclear Information System (INIS)

Lee, B.S.

1993-01-01

The component cooling water (CCW) system provides cooling water to several important loads throughout the plant under all operating conditions. An aging assessment CCW systems in pressurized water reactors (PWRs) was conducted as part of Nuclear Plant Aging Research Program (NPAR) instituted by the US Nuclear Regulatory Commission. This paper presents some of the results on the performances of materials in respect of their application in CCW Systems. All the CCW system failures reported to the Nuclear Plant Reliability Data System (NPRDS) from January 1988 to June 1990 were reviewed; it is concluded that three of the main contributors to CCW system failures are valves, pumps, and heat exchangers. This study identified the modes and causes of failure for these components; most of the causes for the aging-related failures could be related to the performance of materials. Also, in this paper the materials used for these components are reviewed, and there aging mechanisms under CCW system conditions are discussed

Convergent surface water distributions in U.S. cities

Science.gov (United States)

M.K. Steele; J.B. Heffernan; N. Bettez; J. Cavender-Bares; P.M. Groffman; J.M. Grove; S. Hall; S.E. Hobbie; K. Larson; J.L. Morse; C. Neill; K.C. Nelson; J. O' Neil-Dunne; L. Ogden; D.E. Pataki; C. Polsky; R. Roy Chowdhury

2014-01-01

Earth's surface is rapidly urbanizing, resulting in dramatic changes in the abundance, distribution and character of surface water features in urban landscapes. However, the scope and consequences of surface water redistribution at broad spatial scales are not well understood. We hypothesized that urbanization would lead to convergent surface water abundance and...

Monitoring of Water and Contaminant Migration at the Groundwater-Surface Water Interface

Science.gov (United States)

2008-08-01

seepage is occurring in a freshwater lake environment and to map the lateral extent of any subsurface contamination at the groundwater –surface water ...and Contaminant Migration at the Groundwater -Surface Water Interface August 2008 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public...4. TITLE AND SUBTITLE Monitoring of Water and Contaminant Migration at the Groundwater -Surface Water Interface 5a. CONTRACT NUMBER 5b. GRANT NUMBER

Innovative coatings and surface modification of titanium for sea water condenser applications

International Nuclear Information System (INIS)

George, R.P.; Anandkumar, B.; Vanithakumari, S.C.; Kamachi Mudali, U.

2016-01-01

Effectiveness of cooling water systems in various power plants to maintain highest electrical energy output per tonne of fuel is important as part of good energy management. Cooling water systems of nuclear power plants using seawater for cooling comes under constant attack from the marine and sea water environment. Many metallic components and civil structures in the cooling water systems like bridges, intake wells, intake pipes, pump house wells, water boxes, condenser pipes are subjected to severe fouling and corrosion which limits the service life and availability of power plants. The experience with a coastal water cooled power plant at Kalpakkam (MAPS), India, showed that chlorination and screening control macrofouling to a great extend by controlling protozoans, invertebrates, algae and fungi. However 90% of marine bacteria are resistant to such control measures, and they cause microfouling of condenser pipes leading to poor heat transfer and microbially influenced corrosion (MIC) failures. Titanium is used as condenser for Indian nuclear power plants employing sea water cooling, including the PFBR at Kalpakkam. Though titanium is excellent with respect to corrosion behavior under sea water conditions, its biocompatible nature results in biofouling and MIC during service. Therefore innovative antifouling coatings and surface modification techniques for titanium condenser applications in seawater and marine environments are the need of the hour. Extensive investigations were carried out by different methods including nanostructuring of surfaces for making them antibacterial. The microroughness of titanium was produced by repeated pickling and polishing which by itself reduced microbial adhesion. To utilize photocatalytic activity for antibacterial property, anodization of titanium surfaces followed by heat treatment was adopted and this also has controlled microbial fouling. Electroless plating of nanofilm of copper-nickel alloy decreased biofouling of

Underground coal mine subsidence impacts on surface water

International Nuclear Information System (INIS)

Stump, D.E. Jr.

1992-01-01

This paper reports that subsidence from underground coal mining alters surface water discharge and availability. The magnitude and areal extent of these impacts are dependent on many factors, including the amount of subsidence, topography, geology, climate, surface water - ground water interactions, and fractures in the overburden. There alterations may have positive and/or negative impacts. One of the most significant surface water impacts occurred in July 1957 near West Pittston, Pennsylvania. Subsidence in the Knox Mine under the Coxton Yards of the Lehigh Valley Railroad allowed part of the discharge in the Susquehanna River to flow into the mine and create a crater 200 feet in diameter and 300 feet deep. Fourteen railroad gondola cars fell into the hole which was eventually filled with rock, sand, and gravel. Other surface water impacts from subsidence may include the loss of water to the ground water system, the gaining of water from the ground water system, the creation of flooded subsidence troughs, the increasing of impoundment storage capacity, the relocation of water sources (springs), and the alteration of surface drainage patterns

Development of a dynamic model for cleaning ultra filtration membranes fouled by surface water

NARCIS (Netherlands)

Zondervan, Edwin; Betlem, Ben H.L.; Roffel, Brian

2007-01-01

In this paper, a dynamic model for cleaning ultra filtration membranes fouled by surface water is proposed. A model that captures the dynamics well is valuable for the optimization of the cleaning process. The proposed model is based on component balances and contains three parameters that can be

Surface roughness characterization of cast components using 3D optical methods

DEFF Research Database (Denmark)

Nwaogu, Ugochukwu Chibuzoh; Tiedje, Niels Skat; Hansen, Hans Nørgaard

scanning probe image processor (SPIP) software and the results of the surface roughness parameters obtained were subjected to statistical analyses. The bearing area ratio was introduced and applied to the surface roughness analysis. From the results, the surface quality of the standard comparators...... is successfully characterised and it was established that the areal parameters are more informative for sand cast components. The roughness values of the standard visual comparators can serve as a control for the cast components and for order specifications in the foundry industry. A series of iron castings were...... made in green sand moulds and the surface roughness parameter (Sa) values were compared with those of the standards. Sa parameter suffices for the evaluation of casting surface texture. The S series comparators showed a better description of the surface of castings after shot blasting than the A series...

Spatial diversity of bacterioplankton communities in surface water of northern South China Sea.

Science.gov (United States)

Li, Jialin; Li, Nan; Li, Fuchao; Zou, Tao; Yu, Shuxian; Wang, Yinchu; Qin, Song; Wang, Guangyi

2014-01-01

The South China Sea is one of the largest marginal seas, with relatively frequent passage of eddies and featuring distinct spatial variation in the western tropical Pacific Ocean. Here, we report a phylogenetic study of bacterial community structures in surface seawater of the northern South China Sea (nSCS). Samples collected from 31 sites across large environmental gradients were used to construct clone libraries and yielded 2,443 sequences grouped into 170 OTUs. Phylogenetic analysis revealed 23 bacterial classes with major components α-, β- and γ-Proteobacteria, as well as Cyanobacteria. At class and genus taxon levels, community structure of coastal waters was distinctively different from that of deep-sea waters and displayed a higher diversity index. Redundancy analyses revealed that bacterial community structures displayed a significant correlation with the water depth of individual sampling sites. Members of α-Proteobacteria were the principal component contributing to the differences of the clone libraries. Furthermore, the bacterial communities exhibited heterogeneity within zones of upwelling and anticyclonic eddies. Our results suggested that surface bacterial communities in nSCS had two-level patterns of spatial distribution structured by ecological types (coastal VS. oceanic zones) and mesoscale physical processes, and also provided evidence for bacterial phylogenetic phyla shaped by ecological preferences.

Spatial diversity of bacterioplankton communities in surface water of northern South China Sea.

Directory of Open Access Journals (Sweden)

Jialin Li

Full Text Available The South China Sea is one of the largest marginal seas, with relatively frequent passage of eddies and featuring distinct spatial variation in the western tropical Pacific Ocean. Here, we report a phylogenetic study of bacterial community structures in surface seawater of the northern South China Sea (nSCS. Samples collected from 31 sites across large environmental gradients were used to construct clone libraries and yielded 2,443 sequences grouped into 170 OTUs. Phylogenetic analysis revealed 23 bacterial classes with major components α-, β- and γ-Proteobacteria, as well as Cyanobacteria. At class and genus taxon levels, community structure of coastal waters was distinctively different from that of deep-sea waters and displayed a higher diversity index. Redundancy analyses revealed that bacterial community structures displayed a significant correlation with the water depth of individual sampling sites. Members of α-Proteobacteria were the principal component contributing to the differences of the clone libraries. Furthermore, the bacterial communities exhibited heterogeneity within zones of upwelling and anticyclonic eddies. Our results suggested that surface bacterial communities in nSCS had two-level patterns of spatial distribution structured by ecological types (coastal VS. oceanic zones and mesoscale physical processes, and also provided evidence for bacterial phylogenetic phyla shaped by ecological preferences.

Export of nutrient rich Northern Component Water preceded early Oligocene Antarctic glaciation

Science.gov (United States)

Coxall, Helen K.; Huck, Claire E.; Huber, Matthew; Lear, Caroline H.; Legarda-Lisarri, Alba; O'Regan, Matt; Sliwinska, Kasia K.; van de Flierdt, Tina; de Boer, Agatha M.; Zachos, James C.; Backman, Jan

2018-03-01

The onset of the North Atlantic Deep Water formation is thought to have coincided with Antarctic ice-sheet growth about 34 million years ago (Ma). However, this timing is debated, in part due to questions over the geochemical signature of the ancient Northern Component Water (NCW) formed in the deep North Atlantic. Here we present detailed geochemical records from North Atlantic sediment cores located close to sites of deep-water formation. We find that prior to 36 Ma, the northwestern Atlantic was stratified, with nutrient-rich, low-salinity bottom waters. This restricted basin transitioned into a conduit for NCW that began flowing southwards approximately one million years before the initial Antarctic glaciation. The probable trigger was tectonic adjustments in subarctic seas that enabled an increased exchange across the Greenland-Scotland Ridge. The increasing surface salinity and density strengthened the production of NCW. The late Eocene deep-water mass differed in its carbon isotopic signature from modern values as a result of the leakage of fossil carbon from the Arctic Ocean. Export of this nutrient-laden water provided a transient pulse of CO2 to the Earth system, which perhaps caused short-term warming, whereas the long-term effect of enhanced NCW formation was a greater northward heat transport that cooled Antarctica.

A multivariate analysis of intrinsic soil components influencing the mean-weight diameter of water-stable aggregates

International Nuclear Information System (INIS)

Mbagwu, J.S.C.; Chukwu, W.I.E.

1994-06-01

A knowledge of the soil properties influencing the water-stability of soil aggregates is needed for selecting those more easily-determined properties that would be useful in areas where lack of facilities makes its direct determination impossible. In this laboratory study we evaluated the main soil physical, chemical and mineralogical properties influencing the stability of macro aggregates of some Italian surface soils in water. The objective is to select a subset of soil properties which predict optimally, soil aggregate stability. The index of stability used is the mean weight diameter of water-stable aggregates whereas the method of evaluation is the principal component analysis (PCA). The range in coefficients of variation (CV) among the properties was least in the physical (12.0-61.0%), medium in the mineralogical (28.0-116.2%) and highest in the chemical (8.2-110.8%) properties. The wider the range in CV in each subset of properties, the greater the number of components extracted by the PCA. The component defining variables, i.e. those with the highest loadings on each component and therefore, provide the best relationship between the variables and aggregate stability, revealed the ratio of total sand/clay and plastic limit as the significant physical properties. The significant chemical properties are Al 2 O 3 , FeO, MgO and MnO which contribute positively to aggregate stability. Feldspar, quartz and muscovite are the significant mineralogical properties each of which is negatively related to aggregate stability. These soil components are useful for developing empirical models for estimating the stability of aggregates of these soils in water. (author). 38 refs, 7 tabs

Oxide/water interfaces: how the surface chemistry modifies interfacial water properties

International Nuclear Information System (INIS)

Gaigeot, Marie-Pierre; Sprik, Michiel; Sulpizi, Marialore

2012-01-01

The organization of water at the interface with silica and alumina oxides is analysed using density functional theory-based molecular dynamics simulation (DFT-MD). The interfacial hydrogen bonding is investigated in detail and related to the chemistry of the oxide surfaces by computing the surface charge density and acidity. We find that water molecules hydrogen-bonded to the surface have different orientations depending on the strength of the hydrogen bonds and use this observation to explain the features in the surface vibrational spectra measured by sum frequency generation spectroscopy. In particular, ‘ice-like’ and ‘liquid-like’ features in these spectra are interpreted as the result of hydrogen bonds of different strengths between surface silanols/aluminols and water. (paper)

An ontology design pattern for surface water features

Science.gov (United States)

Sinha, Gaurav; Mark, David; Kolas, Dave; Varanka, Dalia; Romero, Boleslo E.; Feng, Chen-Chieh; Usery, E. Lynn; Liebermann, Joshua; Sorokine, Alexandre

2014-01-01

Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities exist due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology for other more context-dependent ontologies. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex or specialized surface water ontologies. A fundamental distinction is made in this ontology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is implemented in OWL, but Description Logic axioms and a detailed explanation is provided in this paper. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. Also provided is a discussion of why there is a need to complement the pattern with other ontologies, especially the previously developed Surface Network pattern. Finally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through an annotated geospatial dataset and sample queries using the classes of the Surface Water pattern.

Surface water management: a user's guide to calculate a water balance using the CREAMS model

International Nuclear Information System (INIS)

Lane, L.J.

1984-11-01

The hydrologic component of the CREAMS model is described and discussed in terms of calculating a surface water balance for shallow land burial systems used for waste disposal. Parameter estimates and estimation procedures are presented in detail in the form of a user's guide. Use of the model is illustrated with three examples based on analysis of data from Los Alamos, New Mexico and Rock Valley, Nevada. Use of the model in design of trench caps for shallow land burial systems is illustrated with the example applications at Los Alamos

Forming chemical composition of surface waters in the Arctic as "water - rock" interaction. Case study of lake Inari and river Paz

Science.gov (United States)

Mazukhina, Svetlana; Sandimirov, Sergey; Pozhilenko, Vladimir; Ivanov, Stanislav; Maksimova, Viktoriia

2017-04-01

Due to the depletion of fresh water supplies and the deterioration of their quality as a result of anthropogenic impact on the Arctic ecosystems, the research questions of forming surface and ground waters, their interactions with the rocks, development of the foundations for their rational use and protection are of great fundamental and practical importance. The aim of the work is to evaluate the influence of the chemical composition of rocks of the northern part of the Fennoscandian (Baltic) shield on forming surface waters chemical composition (Lake Inari, river Paz) using physical-chemical modeling (Chudnenko, 2010, Selector software package). River Paz (Paatsjoki) is the largest river in North Fennoscandia and flows through the territory of three countries - Finland, Russia and Norway. It originates from Lake Inari, which a large number of streams and rivers flow into, coming from the mountain range of the northern Finland (Maanselkä hill). Within the catchment of inflows feeding the lake Inari and river Paz in its upper flow there are mainly diverse early Precambrian metamorphic and intrusive rocks of the Lapland granulite belt and its framing, and to a lesser extent - various gneisses and migmatites with relicts of amphibolites, granitic gneisses, plagioclase and plagio- and plagiomicrocline granites, and quartz diorites of Inari terrane (Meriläinen, 1976, fig 1; Hörmann et al, 1980, fig 1; Geologicalmap, 2001). Basing on the techniques developed earlier (Mazukhina, 2012), and the data of monitoring of the chemical composition of surface waters and investigation of the chemical composition of the rocks, physical-chemical modeling (FCM) (Selector software package) was carried out. FCM includes 34 independent components (Al-B-Br-Ar-He-Ne-C-Ca-Cl-F-Fe-K-Mg-Mn-N-Na-P-S-Si-Sr-Cu-Zn-Ni-Pb-V-Ba-Co-Cr-Hg-As-Cd-H-O-e), 996 dependent components, of them 369 in aqueous solution, 76 in the gas phase, 111 liquid hydrocarbons, and 440 solid phases, organic and mineral

Water quality of the Chhoti Gandak River using principal component ...

Indian Academy of Sciences (India)

; therefore water samples were collected to analyse its quality along the entire length of Chhoti Gandak. River. The principal components of water quality are controlled by lithology, gentle slope gradient, poor drainage, long residence of water, ...

How to repel hot water from a superhydrophobic surface?

KAUST Repository

Yu, Zhejun

2014-01-01

Superhydrophobic surfaces, with water contact angles greater than 150° and slide angles less than 10°, have attracted a great deal of attention due to their self-cleaning ability and excellent water-repellency. It is commonly accepted that a superhydrophobic surface loses its superhydrophobicity in contact with water hotter than 50 °C. Such a phenomenon was recently demonstrated by Liu et al. [J. Mater. Chem., 2009, 19, 5602], using both natural lotus leaf and artificial leaf-like surfaces. However, our work has shown that superhydrophobic surfaces maintained their superhydrophobicity, even in water at 80 °C, provided that the leaf temperature is greater than that of the water droplet. In this paper, we report on the wettability of water droplets on superhydrophobic thin films, as a function of both their temperatures. The results have shown that both the water contact and slide angles on the surfaces will remain unchanged when the temperature of the water droplet is greater than that of the surface. The water contact angle, or the slide angle, will decrease or increase, however, with droplet temperatures increasingly greater than that of the surfaces. We propose that, in such cases, the loss of superhydrophobicity of the surfaces is caused by evaporation of the hot water molecules and their condensation on the cooler surface. © 2014 the Partner Organisations.

Water and oil wettability of anodized 6016 aluminum alloy surface

Science.gov (United States)

Rodrigues, S. P.; Alves, C. F. Almeida; Cavaleiro, A.; Carvalho, S.

2017-11-01

This paper reports on the control of wettability behaviour of a 6000 series aluminum (Al) alloy surface (Al6016-T4), which is widely used in the automotive and aerospace industries. In order to induce the surface micro-nanostructuring of the surface, a combination of prior mechanical polishing steps followed by anodization process with different conditions was used. The surface polishing with sandpaper grit size 1000 promoted aligned grooves on the surface leading to static water contact angle (WCA) of 91° and oil (α-bromonaphthalene) contact angle (OCA) of 32°, indicating a slightly hydrophobic and oleophilic character. H2SO4 and H3PO4 acid electrolytes were used to grow aluminum oxide layers (Al2O3) by anodization, working at 15 V/18° C and 100 V/0 °C, respectively, in one or two-steps configuration. Overall, the anodization results showed that the structured Al surfaces were hydrophilic and oleophilic-like with both WCA and OCA below 90°. The one-step configuration led to a dimple-shaped Al alloy surface with small diameter of around 31 nm, in case of H2SO4, and with larger diameters of around 223 nm in case of H3PO4. The larger dimples achieved with H3PO4 electrolyte allowed to reach a slight hydrophobic surface. The thicker porous Al oxide layers, produced by anodization in two-step configuration, revealed that the liquids can penetrate easily inside the non-ordered porous structures and, thus, the surface wettability tended to superhydrophilic and superoleophilic character (CA OCA. This inversion in favour of the hydrophilic-oleophobic surface behaviour is of great interest either for lubrication of mechanical components or in water-oil separation process.

Application of Tank Model for Predicting Water Balance and Flow Discharge Components of Cisadane Upper Catchment

Directory of Open Access Journals (Sweden)

Nana Mulyana Arifjaya

2012-01-01

Full Text Available The concept of hydrological tank model was well described into four compartments (tanks. The first tank (tank A comprised of one vertical (qA0 and two lateral (qA1 and qA2 water flow components and tank B comprised of one vertical (qB0 and one lateral (qB1 water flow components. Tank C comprised of one vertical (qC0 and one lateral (qC1 water flow components, whereas tank D comprised of one lateral water flow component (qD1.  These vertical water flows would also contribute to the depletion of water flow in the related tanks but would replenish tanks in the deeper layers. It was assumed that at all lateral water flow components would finally accumulate in one stream, summing-up of the lateral water flow, much or less, should be equal to the water discharge (Qo at specified time concerns. Tank A received precipitation (R and evapo-transpiration (ET which was its gradientof (R-ET over time would become the driving force for the changes of water stored in the soil profiles and thosewater flows leaving the soil layer.  Thus tank model could describe th vertical and horizontal water flow withinthe watershed. The research site was Cisadane Upper Catchment, located at Pasir Buncir Village of CaringinSub-District within the Regency of Bogor in West Java Province.  The elevations ranged 512 –2,235 m above sealevel, with a total drainage area of 1,811.5 ha and total length of main stream of 14,340.7 m.  The land cover wasdominated by  forest  with a total of 1,044.6 ha (57.67%,  upland agriculture with a total of 477.96 ha (26.38%,mixed garden with a total of 92.85 ha(5.13% and semitechnical irigated rice field with a total of 196.09 ha (10,8%.  The soil was classified as hydraquent (96.6% and distropept (3.4%.  Based on the calibration of tank model application in the study area, the resulting coefficient of determination (R2 was 0.72 with model efficiency (NSEof= 0.75, thus tank model could well illustrate the water flow distribution of

Evaluating the hydrological consistency of satellite based water cycle components

KAUST Repository

Lopez Valencia, Oliver Miguel

2016-06-15

Advances in multi-satellite based observations of the earth system have provided the capacity to retrieve information across a wide-range of land surface hydrological components and provided an opportunity to characterize terrestrial processes from a completely new perspective. Given the spatial advantage that space-based observations offer, several regional-to-global scale products have been developed, offering insights into the multi-scale behaviour and variability of hydrological states and fluxes. However, one of the key challenges in the use of satellite-based products is characterizing the degree to which they provide realistic and representative estimates of the underlying retrieval: that is, how accurate are the hydrological components derived from satellite observations? The challenge is intrinsically linked to issues of scale, since the availability of high-quality in-situ data is limited, and even where it does exist, is generally not commensurate to the resolution of the satellite observation. Basin-scale studies have shown considerable variability in achieving water budget closure with any degree of accuracy using satellite estimates of the water cycle. In order to assess the suitability of this type of approach for evaluating hydrological observations, it makes sense to first test it over environments with restricted hydrological inputs, before applying it to more hydrological complex basins. Here we explore the concept of hydrological consistency, i.e. the physical considerations that the water budget impose on the hydrologic fluxes and states to be temporally and spatially linked, to evaluate the reproduction of a set of large-scale evaporation (E) products by using a combination of satellite rainfall (P) and Gravity Recovery and Climate Experiment (GRACE) observations of storage change, focusing on arid and semi-arid environments, where the hydrological flows can be more realistically described. Our results indicate no persistent hydrological

Adsorption of surface functionalized silica nanoparticles onto mineral surfaces and decane/water interface

International Nuclear Information System (INIS)

Metin, Cigdem O.; Baran, Jimmie R.; Nguyen, Quoc P.

2012-01-01

The adsorption of silica nanoparticles onto representative mineral surfaces and at the decane/water interface was studied. The effects of particle size (the mean diameters from 5 to 75 nm), concentration and surface type on the adsorption were studied in detail. Silica nanoparticles with four different surfaces [unmodified, surface modified with anionic (sulfonate), cationic (quaternary ammonium (quat)) or nonionic (polyethylene glycol (PEG)) surfactant] were used. The zeta potential of these silica nanoparticles ranges from −79.8 to 15.3 mV. The shape of silica particles examined by a Hitachi-S5500 scanning transmission electron microscope (STEM) is quite spherical. The adsorption of all the nanoparticles (unmodified or surface modified) on quartz and calcite surfaces was found to be insignificant. We used interfacial tension (IFT) measurements to investigate the adsorption of silica nanoparticles at the decane/water interface. Unmodified nanoparticles or surface modified ones with sulfonate or quat do not significantly affect the IFT of the decane/water interface. It also does not appear that the particle size or concentration influences the IFT. However, the presence of PEG as a surface modifying material significantly reduces the IFT. The PEG surface modifier alone in an aqueous solution, without the nanoparticles, yields the same IFT reduction for an equivalent PEG concentration as that used for modifying the surface of nanoparticles. Contact angle measurements of a decane droplet on quartz or calcite plate immersed in water (or aqueous nanoparticle dispersion) showed a slight change in the contact angle in the presence of the studied nanoparticles. The results of contact angle measurements are in good agreement with experiments of adsorption of nanoparticles on mineral surfaces or decane/water interface. This study brings new insights into the understanding and modeling of the adsorption of surface-modified silica nanoparticles onto mineral surfaces and

Radioactivity in surface waters and its effects

International Nuclear Information System (INIS)

Stoeber, I.

1987-01-01

In consequence of the reactor accident in Chernobyl, the State Office for Water and Waste Disposal of North-Rhine Westphalia implemented immediate programmes for monitoring radioactivity in surface waters, including their sediments and organisms. Of the initially-measured radionuclides, only cesium-137, with its long half-life of 30 years, is of interest. Only trace amounts of the almost equally long-lived strontium 90 (half-life 28 years) were present in rainfall. Cs-137 is a non-natural-radionuclide, occurring solely as a by-product of nuclear installations and atomic bomb tests. Following the ban on surface testing of nuclear weapons, the Cs-137 content of surface waters had fallen significantly up to April 1986. The load due to the reactor disaster is of the same order of magnitude as that produced by atomic testing at the end of the nineteen-sixties. The paper surveys radioactive pollution of surface waters in North-Rhine Westphalia and its effects on water use, especially in regard to potable water supplies and the fish population. (orig./HSCH) [de

Surface-Water Data, Georgia, Water Year 1999

Science.gov (United States)

Alhadeff, S. Jack; Landers, Mark N.; McCallum, Brian E.

1999-01-01

Water resources data for the 1999 water year for Georgia consists of records of stage, discharge, and water quality of streams; and the stage and contents of lakes and reservoirs published in one volume in a digital format on a CD-ROM. This volume contains discharge records of 121 gaging stations; stage for 13 gaging stations; stage and contents for 18 lakes and reservoirs; continuous water quality records for 10 stations; and the annual peak stage and annual peak discharge for 75 crest-stage partial-record stations. These data represent that part of the National Water Data System collected by the U.S. Geological Survey and cooperating State and Federal agencies in Georgia. Records of discharge and stage of streams, and contents or stage of lakes and reservoirs were first published in a series of U.S. Geological water-supply papers entitled, 'Surface-Water Supply of the United States.' Through September 30, 1960, these water-supply papers were in an annual series and then in a 5-year series for 1961-65 and 1966-70. Records of chemical quality, water temperature, and suspended sediment were published from 1941 to 1970 in an annual series of water-supply papers entitled, 'Quality of Surface Waters of the United States.' Records of ground-water levels were published from 1935 to 1974 in a series of water-supply papers entitled, 'Ground-Water Levels in the United States.' Water-supply papers may be consulted in the libraries of the principal cities in the United States or may be purchased from the U.S. Geological Survey, Branch of Information Services, Federal Center, Box 25286, Denver, CO 80225. For water years 1961 through 1970, streamflow data were released by the U.S. Geological Survey in annual reports on a State-boundary basis prior to the two 5-year series water-supply papers, which cover this period. The data contained in the water-supply papers are considered the official record. Water-quality records for water years 1964 through 1970 were similarly released

Assessment of radioecological state of surface waters in the Gomel and Mogilev regions

International Nuclear Information System (INIS)

Khvaley, O.D.; Datskevich, P.I.; Komissarov, F.D.; Levosechko, S.I.

2000-01-01

Article states that aplication of the republican Admissible Levels (RAL-96) in practice and their juxtaposition with the obtained results of analyses are not always justified because water of the studied systems is excluded from economic water supply to population in resettlement zone. The radioecological criteria of quality of surface waters were developed in 1993 by Ukrainian hydrobiologists O.P.Oksiyuk, V.N.Zhukinsky and others contain six levels (classes) of radioecological pollution of water: 1 - non-polluted, 2 - lowly polluted, 3 - moderately polluted, 4 - highly polluted, 5 - very high pollution, 6 - utmost pollution; three classes of water quality and six categories of water quality. It is believed that according to this complex clasification of quality of surface terrestrial waters, water of the studied systems of Gomel and Mogilev regions very often has exceeded the RAL-96 for 90Sr. According to the proposed complex classification of quality of surface terrestrial waters, water of the studied systems belongs mainly - for 137Cs and 90Sr - to the quality categories: 3b ''lowly polluted'' and 4a ''moderately polluted'' independent on sampling period. On some sites of 30...10 km zone, water quality corresponds to categories 5a ''very high pollution'' and 5b ''utmost pollution'' for 90Sr (rivers Slovechna, Nesvich and Pogonyansky channel). Thus, in the studied water systems, in radioecological relation, there is not a single one with water quality corresponding to indices 3a, i.e.sufficiently clean. 90Sr has high migration ability and is able to participate in different migration cycles including biological (food chains). The cases of exceeding the RAL indices for 90Sr in water indicate the necessity to study also other components of water systems of Belarus relating to this isotope

Lithium content in potable water, surface water, ground water, and mineral water on the territory of Republic of Macedonia

OpenAIRE

Kostik, Vesna; Bauer, Biljana; Kavrakovski, Zoran

2014-01-01

The aim of this study was to determine lithium concentration in potable water, surface water, ground, and mineral water on the territory of the Republic of Macedonia. Water samples were collected from water bodies such as multiple public water supply systems located in 13 cities, wells boreholes located in 12 areas, lakes and rivers located in three different areas. Determination of lithium concentration in potable water, surface water was performed by the technique of inductively coupl...

Presence and risk assessment of pharmaceuticals in surface water and drinking water

DEFF Research Database (Denmark)

Sanderson, Hans

2011-01-01

Trace amounts of pharmaceuticals have been detected in surface waters in the nano- to microgram per liter range, and in drinking water in the nanogram/L range. The environmental risks of pharmaceuticals in surface waters have been evaluated and generally found to be low if the wastewater is treated...

Anomalous water dynamics at surfaces and interfaces: synergistic effects of confinement and surface interactions

Science.gov (United States)

Biswas, Rajib; Bagchi, Biman

2018-01-01

In nature, water is often found in contact with surfaces that are extended on the scale of molecule size but small on a macroscopic scale. Examples include lipid bilayers and reverse micelles as well as biomolecules like proteins, DNA and zeolites, to name a few. While the presence of surfaces and interfaces interrupts the continuous hydrogen bond network of liquid water, confinement on a mesoscopic scale introduces new features. Even when extended on a molecular scale, natural and biological surfaces often have features (like charge, hydrophobicity) that vary on the scale of the molecular diameter of water. As a result, many new and exotic features, which are not seen in the bulk, appear in the dynamics of water close to the surface. These different behaviors bear the signature of both water-surface interactions and of confinement. In other words, the altered properties are the result of the synergistic effects of surface-water interactions and confinement. Ultrafast spectroscopy, theoretical modeling and computer simulations together form powerful synergistic approaches towards an understanding of the properties of confined water in such systems as nanocavities, reverse micelles (RMs), water inside and outside biomolecules like proteins and DNA, and also between two hydrophobic walls. We shall review the experimental results and place them in the context of theory and simulations. For water confined within RMs, we discuss the possible interference effects propagating from opposite surfaces. Similar interference is found to give rise to an effective attractive force between two hydrophobic surfaces immersed and kept fixed at a separation of d, with the force showing an exponential dependence on this distance. For protein and DNA hydration, we shall examine a multitude of timescales that arise from frustration effects due to the inherent heterogeneity of these surfaces. We pay particular attention to the role of orientational correlations and modification of the

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

40 CFR 257.3-3 - Surface water.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Surface water. 257.3-3 Section 257.3-3... and Practices § 257.3-3 Surface water. (a) For purposes of section 4004(a) of the Act, a facility... Water Act, as amended. (b) For purposes of section 4004(a) of the Act, a facility shall not cause a...

Adherence of extracellular matrix components to modified surfaces of titanium alloys

International Nuclear Information System (INIS)

Stelzer, C; Uhlmann, E; Meinke, M; Lademann, J; Hansen, U

2009-01-01

The adherence of biological materials on metal surfaces is of special importance in biology and medicine. The underlying interactions between surface and biological materials (e.g. extracellular matrix components or cells) are responsible for the application as a medical device. Numerous products are made of pure titanium and titanium alloys. This paper shows the influence of a laser production technology on machined surfaces of TiAl 6 V 4 and the resulting adherence of biological material on the basis of the surface characterisation. In this study, different machined TiAl 6 V 4 surfaces were used for coatings with extracellular matrix components. For this process, different coating with collagen I monomers and a complex mixture of extracellular matrix proteins derived from the dermal-epidermal basement membrane zone were analysed. The efficiency of the coating was analysed by different methods and the results are presented in this paper

Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

KAUST Repository

Jin, Yong

2017-06-23

Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH) to elucidate their roles on water mass collection efficiency. The experimental results indicate that a hydrophilic surface promotes nucleation and individual droplets growth, and a surface with a low CAH tends to let a smaller droplet to slide down, but the overall water mass collection efficiency is independent of both surface contact angle and CAH. The experimental results agree well with our theoretical calculations. During water condensation, a balance has to be struck between single droplet growth and droplet density on a surface so as to maintain a constant water droplet surface coverage ratio, which renders the role of both surface wettability and hysteresis insignificant to the ultimate water mass collection. Moreover, water droplets on the edges of a surface grow much faster than those on the non-edge areas and thus dominate the contribution to the water mass collection by the entire surface, directly pointing out the very important role of edge effect on water condensation and collection.

Components of the environment

International Nuclear Information System (INIS)

Klinda, J.; Lieskovska, Z.

1998-01-01

This report of the Ministry of the Environment of the Slovak Republic deals with the components of the environment. The results of monitoring of air (emission situation), ambient air quality, atmospheric precipitation, tropospheric ozone, water (surface water, groundwater resources, waste water and drinking water), geological factors (geothermal energy, fuel deposits, ore deposits, non-metallic ore deposits), soil (area statistics, soil contamination. soil reaction and active extractable aluminium, soil erosion), flora and fauna (national strategy of biodiversity protection) are presented

Modelling global fresh surface water temperature

NARCIS (Netherlands)

Beek, L.P.H. van; Eikelboom, T.; Vliet, M.T.H. van; Bierkens, M.F.P.

2011-01-01

Temperature directly determines a range of water physical properties including vapour pressure, surface tension, density and viscosity, and the solubility of oxygen and other gases. Indirectly water temperature acts as a strong control on fresh water biogeochemistry, influencing sediment

GC/MS analysis of pesticides in the Ferrara area (Italy) surface water: a chemometric study.

Science.gov (United States)

Pasti, Luisa; Nava, Elisabetta; Morelli, Marco; Bignami, Silvia; Dondi, Francesco

2007-01-01

The development of a network to monitor surface waters is a critical element in the assessment, restoration and protection of water quality. In this study, concentrations of 42 pesticides--determined by GC-MS on samples from 11 points along the Ferrara area rivers--have been analyzed by chemometric tools. The data were collected over a three-year period (2002-2004). Principal component analysis of the detected pesticides was carried out in order to define the best spatial locations for the sampling points. The results obtained have been interpreted in view of agricultural land use. Time series data regarding pesticide contents in surface waters has been analyzed using the Autocorrelation function. This chemometric tool allows for seasonal trends and makes it possible to optimize sampling frequency in order to detect the effective maximum pesticide content.

GC/MS Analysis of Pesticides in the Ferrara Area (Italy) Surface Water: A Chemometric Study

International Nuclear Information System (INIS)

Pasti, L.; Dondi, F.; Nava, E.; Morelli, M.; Bignami, S.

2007-01-01

The development of a network to monitor surface waters is a critical element in the assessment, restoration and protection of water quality. In this study, concentrations of 42 pesticides - determined by GC-MS on samples from 11 points along the Ferrara area rivers - have been analyzed by chemometric tools. The data were collected over a three-year period (2002-2004). Principal component analysis of the detected pesticides was carried out in order to define the best spatial locations for the sampling points. The results obtained have been interpreted in view of agricultural land use. Time series data regarding pesticide contents in surface waters has been analyzed using the Autocorrelation function. This chemometric tool allows for seasonal trends and makes it possible to optimize sampling frequency in order to detect the effective maximum pesticide content

An Ontology Design Pattern for Surface Water Features

Energy Technology Data Exchange (ETDEWEB)

Sinha, Gaurav [Ohio University; Mark, David [University at Buffalo (SUNY); Kolas, Dave [Raytheon BBN Technologies; Varanka, Dalia [U.S. Geological Survey, Rolla, MO; Romero, Boleslo E [University of California, Santa Barbara; Feng, Chen-Chieh [National University of Singapore; Usery, Lynn [U.S. Geological Survey, Rolla, MO; Liebermann, Joshua [Tumbling Walls, LLC; Sorokine, Alexandre [ORNL

2014-01-01

Surface water is a primary concept of human experience but concepts are captured in cultures and languages in many different ways. Still, many commonalities can be found due to the physical basis of many of the properties and categories. An abstract ontology of surface water features based only on those physical properties of landscape features has the best potential for serving as a foundational domain ontology. It can then be used to systematically incor-porate concepts that are specific to a culture, language, or scientific domain. The Surface Water ontology design pattern was developed both for domain knowledge distillation and to serve as a conceptual building-block for more complex surface water ontologies. A fundamental distinction is made in this on-tology between landscape features that act as containers (e.g., stream channels, basins) and the bodies of water (e.g., rivers, lakes) that occupy those containers. Concave (container) landforms semantics are specified in a Dry module and the semantics of contained bodies of water in a Wet module. The pattern is imple-mented in OWL, but Description Logic axioms and a detailed explanation is provided. The OWL ontology will be an important contribution to Semantic Web vocabulary for annotating surface water feature datasets. A discussion about why there is a need to complement the pattern with other ontologies, es-pecially the previously developed Surface Network pattern is also provided. Fi-nally, the practical value of the pattern in semantic querying of surface water datasets is illustrated through a few queries and annotated geospatial datasets.

Water reuse systems: A review of the principal components

Science.gov (United States)

Lucchetti, G.; Gray, G.A.

1988-01-01

Principal components of water reuse systems include ammonia removal, disease control, temperature control, aeration, and particulate filtration. Effective ammonia removal techniques include air stripping, ion exchange, and biofiltration. Selection of a particular technique largely depends on site-specific requirements (e.g., space, existing water quality, and fish densities). Disease control, although often overlooked, is a major problem in reuse systems. Pathogens can be controlled most effectively with ultraviolet radiation, ozone, or chlorine. Simple and inexpensive methods are available to increase oxygen concentration and eliminate gas supersaturation, these include commercial aerators, air injectors, and packed columns. Temperature control is a major advantage of reuse systems, but the equipment required can be expensive, particularly if water temperature must be rigidly controlled and ambient air temperature fluctuates. Filtration can be readily accomplished with a hydrocyclone or sand filter that increases overall system efficiency. Based on criteria of adaptability, efficiency, and reasonable cost, we recommend components for a small water reuse system.

Transport of plutonium in surface and sub-surface waters from the Arctic shelf to the North Pole via the Lomonosov Ridge

International Nuclear Information System (INIS)

Leon Vintro, L.; McMahon, C.A.; Mitchell, P.I.; Josefsson, D.; Holm, E.; Roos, P.

2002-01-01

New data on the levels and long-range transport of plutonium in the Arctic Ocean, recorded in the course of two expeditions to this zone in 1994 and 1996, are discussed in this paper. Specifically, approximately 100 plutonium measurements in surface and sub-surface water sampled at 58 separate stations throughout the Kara, Laptev and East Siberian Seas, as well as along latitudinal transects across the Lomonosov Ridge, are reported and interpreted in terms of the circulation pathways responsible for the transport of this element from the North Atlantic to the Arctic Shelf and into the Arctic interior. In addition, the behaviour of plutonium in its transit through the vast Arctic shelf seas to open waters under extreme environmental conditions is discussed in terms of the partitioning of plutonium between filtered (<0.45 μm) seawater and suspended particulate, and its association with colloidal matter. Finally, limited evidence of the presence of a colloidal plutonium component in Arctic waters subject to direct riverine input is adduced

Surface-Water Conditions in Georgia, Water Year 2005

Science.gov (United States)

Painter, Jaime A.; Landers, Mark N.

2007-01-01

INTRODUCTION The U.S. Geological Survey (USGS) Georgia Water Science Center-in cooperation with Federal, State, and local agencies-collected surface-water streamflow, water-quality, and ecological data during the 2005 Water Year (October 1, 2004-September 30, 2005). These data were compiled into layers of an interactive ArcReaderTM published map document (pmf). ArcReaderTM is a product of Environmental Systems Research Institute, Inc (ESRI?). Datasets represented on the interactive map are * continuous daily mean streamflow * continuous daily mean water levels * continuous daily total precipitation * continuous daily water quality (water temperature, specific conductance dissolved oxygen, pH, and turbidity) * noncontinuous peak streamflow * miscellaneous streamflow measurements * lake or reservoir elevation * periodic surface-water quality * periodic ecological data * historical continuous daily mean streamflow discontinued prior to the 2005 water year The map interface provides the ability to identify a station in spatial reference to the political boundaries of the State of Georgia and other features-such as major streams, major roads, and other collection stations. Each station is hyperlinked to a station summary showing seasonal and annual stream characteristics for the current year and for the period of record. For continuous discharge stations, the station summary includes a one page graphical summary page containing five graphs, a station map, and a photograph of the station. The graphs provide a quick overview of the current and period-of-record hydrologic conditions of the station by providing a daily mean discharge graph for the water year, monthly statistics graph for the water year and period of record, an annual mean streamflow graph for the period of record, an annual minimum 7-day average streamflow graph for the period of record, and an annual peak streamflow graph for the period of record. Additionally, data can be accessed through the layer's link

Water-cooled beam line components at LAMPF

International Nuclear Information System (INIS)

Grisham, D.L.; Lambert, J.E.

1981-01-01

The beam line components that comprise the main experimental beam at the Clinton P. Anderson Meson Physics Facility (LAMPF) have been operating since February 1976. This paper will define the functions of the primary water-cooled elements, their design evolution, and our operating experience to the present time

Ranking of risk significant components for the Davis-Besse Component Cooling Water System

International Nuclear Information System (INIS)

Seniuk, P.J.

1994-01-01

Utilities that run nuclear power plants are responsible for testing pumps and valves, as specified by the American Society of Mechanical Engineers (ASME) that are required for safe shutdown, mitigating the consequences of an accident, and maintaining the plant in a safe condition. These inservice components are tested according to ASME Codes, either the earlier requirements of the ASME Boiler and Pressure Vessel Code, Section XI, or the more recent requirements of the ASME Operation and Maintenance Code, Section IST. These codes dictate test techniques and frequencies regardless of the component failure rate or significance of failure consequences. A probabilistic risk assessment or probabilistic safety assessment may be used to evaluate the component importance for inservice test (IST) risk ranking, which is a combination of failure rate and failure consequences. Resources for component testing during the normal quarterly verification test or postmaintenance test are expensive. Normal quarterly testing may cause component unavailability. Outage testing may increase outage cost with no real benefit. This paper identifies the importance ranking of risk significant components in the Davis-Besse component cooling water system. Identifying the ranking of these risk significant IST components adds technical insight for developing the appropriate test technique and test frequency

Transport and transformation of surface water masses across the ...

African Journals Online (AJOL)

Transport and transformation of surface water masses across the Mascarene Plateau during the Northeast Monsoon season. ... Mixing occurs in the central gap between intermediate water masses (Red Sea Water [RSW] and Antarctic Intermediate Water [AAIW]) as well as in the upper waters (Subtropical Surface Water ...

Surface water quality assessment using factor analysis

African Journals Online (AJOL)

2006-01-16

Jan 16, 2006 ... Surface water, groundwater quality assessment and environ- .... Urbanisation influences the water cycle through changes in flow and water ..... tion of aquatic life, CCME water quality Index 1, 0. User`s ... Water, Air Soil Pollut.

Large Scale Evapotranspiration Estimates: An Important Component in Regional Water Balances to Assess Water Availability

Science.gov (United States)

Garatuza-Payan, J.; Yepez, E. A.; Watts, C.; Rodriguez, J. C.; Valdez-Torres, L. C.; Robles-Morua, A.

2013-05-01

Water security, can be defined as the reliable supply in quantity and quality of water to help sustain future populations and maintaining ecosystem health and productivity. Water security is rapidly declining in many parts of the world due to population growth, drought, climate change, salinity, pollution, land use change, over-allocation and over-utilization, among other issues. Governmental offices (such as the Comision Nacional del Agua in Mexico, CONAGUA) require and conduct studies to estimate reliable water balances at regional or continental scales in order to provide reasonable assessments of the amount of water that can be provided (from surface or ground water sources) to supply all the human needs while maintaining natural vegetation, on an operational basis and, more important, under disturbances, such as droughts. Large scale estimates of evapotranspiration (ET), a critical component of the water cycle, are needed for a better comprehension of the hydrological cycle at large scales, which, in most water balances is left as the residual. For operational purposes, such water balance estimates can not rely on ET measurements since they do not exist, should be simple and require the least ground information possible, information that is often scarce or does not exist at all. Given this limitation, the use of remotely sensed data to estimate ET could supplement the lack of ground information, particularly in remote regions In this study, a simple method, based on the Makkink equation is used to estimate ET for large areas at high spatial resolutions (1 km). The Makkink model used here is forced using three remotely sensed datasets. First, the model uses solar radiation estimates obtained from the Geostationary Operational Environmental Satellite (GOES); Second, the model uses an Enhanced Vegetation Index (EVI) obtained from the Moderate-resolution Imaging Spectroradiometer (MODIS) normalized to get an estimate for vegetation amount and land use which was

Rapid surface-water volume estimations in beaver ponds

Science.gov (United States)

Karran, Daniel J.; Westbrook, Cherie J.; Wheaton, Joseph M.; Johnston, Carol A.; Bedard-Haughn, Angela

2017-02-01

Beaver ponds are surface-water features that are transient through space and time. Such qualities complicate the inclusion of beaver ponds in local and regional water balances, and in hydrological models, as reliable estimates of surface-water storage are difficult to acquire without time- and labour-intensive topographic surveys. A simpler approach to overcome this challenge is needed, given the abundance of the beaver ponds in North America, Eurasia, and southern South America. We investigated whether simple morphometric characteristics derived from readily available aerial imagery or quickly measured field attributes of beaver ponds can be used to approximate surface-water storage among the range of environmental settings in which beaver ponds are found. Studied were a total of 40 beaver ponds from four different sites in North and South America. The simplified volume-area-depth (V-A-h) approach, originally developed for prairie potholes, was tested. With only two measurements of pond depth and corresponding surface area, this method estimated surface-water storage in beaver ponds within 5 % on average. Beaver pond morphometry was characterized by a median basin coefficient of 0.91, and dam length and pond surface area were strongly correlated with beaver pond storage capacity, regardless of geographic setting. These attributes provide a means for coarsely estimating surface-water storage capacity in beaver ponds. Overall, this research demonstrates that reliable estimates of surface-water storage in beaver ponds only requires simple measurements derived from aerial imagery and/or brief visits to the field. Future research efforts should be directed at incorporating these simple methods into both broader beaver-related tools and catchment-scale hydrological models.

Global modelling of Cryptosporidium in surface water

Science.gov (United States)

Vermeulen, Lucie; Hofstra, Nynke

2016-04-01

Introduction Waterborne pathogens that cause diarrhoea, such as Cryptosporidium, pose a health risk all over the world. In many regions quantitative information on pathogens in surface water is unavailable. Our main objective is to model Cryptosporidium concentrations in surface waters worldwide. We present the GloWPa-Crypto model and use the model in a scenario analysis. A first exploration of global Cryptosporidium emissions to surface waters has been published by Hofstra et al. (2013). Further work has focused on modelling emissions of Cryptosporidium and Rotavirus to surface waters from human sources (Vermeulen et al 2015, Kiulia et al 2015). A global waterborne pathogen model can provide valuable insights by (1) providing quantitative information on pathogen levels in data-sparse regions, (2) identifying pathogen hotspots, (3) enabling future projections under global change scenarios and (4) supporting decision making. Material and Methods GloWPa-Crypto runs on a monthly time step and represents conditions for approximately the year 2010. The spatial resolution is a 0.5 x 0.5 degree latitude x longitude grid for the world. We use livestock maps (http://livestock.geo-wiki.org/) combined with literature estimates to calculate spatially explicit livestock Cryptosporidium emissions. For human Cryptosporidium emissions, we use UN population estimates, the WHO/UNICEF JMP sanitation country data and literature estimates of wastewater treatment. We combine our emissions model with a river routing model and data from the VIC hydrological model (http://vic.readthedocs.org/en/master/) to calculate concentrations in surface water. Cryptosporidium survival during transport depends on UV radiation and water temperature. We explore pathogen emissions and concentrations in 2050 with the new Shared Socio-economic Pathways (SSPs) 1 and 3. These scenarios describe plausible future trends in demographics, economic development and the degree of global integration. Results and

Study of the pyritized surfaces of the carbon steel components in heavy water production facilities

International Nuclear Information System (INIS)

Radulescu, Maria; Parvan, Ioana; Lucan, Dumitra; Fulger, Manuela; Dinu, Alice; Blanatui, A.

1998-01-01

The components used in the Girldler Sulfide (GS) process of heavy water production are made of carbon steel covered by iron sulfide layers of different compositions (mackinawite, troilite, pyrrhotite or pyrite) of variable thicknesses. The most protective layers which provide an acceptable corrosion resistance of the subjacent metal are the mixtures of pyrrhotite and pyrite. In the present work, the corrosion resistance of carbon steel samples covered by different types of sulfides was investigated by the following methods: X ray diffraction, metallography and electrochemical methods (potential-dynamical and electrochemical impedance). In order to carry out the electrochemical measurements in the same conditions as those of the operation of carbon steel components in D 2 O production facilities, the experiments were performed with Na 2 S solutions, at pH=4 - 13 and S 2- concentration value between 1 and 1000 mg/l. The dependence of corrosion rate kinetics on pH and S 2- concentration of the testing solution was investigated for sulfide covered samples comparatively with the uncovered ones. Corrosion rates determined gravimetrically were compared with those determined by electrochemical measurements. The uniformity and thickness of the sulfide layers were checked by metallographic methods. The composition of the sulfides formed in various environment conditions was established by X-ray diffraction. Reaction mechanisms specific for sulfide formation environments have been proposed. (authors)

Deconvolution of trace element (As, Cr, Mo, Th, U) sources and pathways to surface waters of a gold mining-influenced watershed.

Science.gov (United States)

Grosbois, C; Schäfer, J; Bril, H; Blanc, G; Bossy, A

2009-03-01

The Upper Isle River (SW France) drains the second most productive gold-mining district of France. A high resolution survey during one hydrological year of As, Cl(-), Cr, Fe, Mn, Mo, SO(4)(2-), Th and U dissolved concentrations in surface water aimed to better understand pathways of trace element export to the river system downstream from the mining district. Dissolved concentrations of As (up to 35000 ng/L) and Mo (up to 292 ng/L) were about 3-fold higher than the regional dissolved background and showed a negative logarithmic relation with discharge. Dissolved concentrations of Cr (up to 483 ng/L), Th (up to 48 ng/L) and U (up to 184 ng/L) increased with discharge. Geochemical relationships between molar ratios in surface water, geochemical background as well as rain- and groundwater data were combined. The contrasting behavior of distinct element groups was explained by a scenario involving three seasonal components: (i) The high flow component is poorly concentrated in As and Mo but highly concentrated in Cr, Th, U. This has been attributed to diffuse sources such as water-soil interactions, atmospheric inputs, bedrock and bed sediment weathering. Although this component probably also includes a contribution by weathering of sulfide veins, this signal is masked by dilution. (ii) One low flow component presents high SO(4)(2-), Fe, As and Mo and moderate Cr, Th and U concentrations. This component has been attributed to point sources such as mine gallery effluents, mining waste weathering and groundwater inputs from natural and/or mining-induced sulfide oxidation in the ore deposit. (iii) A second low flow component showing high As plus Mo concentrations associated with very low SO(4)(2-), Fe, Cr, Th and U concentrations, probably reflects trace element scavenging by ferric oxyhydroxide formation in the adjacent aquifer. This is supported by the decrease of Fe, Cr, Th and U in surface waters. Flux estimates suggest contrasting element-specific impacts on annual

City of Flagstaff Project: Ground Water Resource Evaluation, Remote Sensing Component

Science.gov (United States)

Chavez, Pat S.; Velasco, Miguel G.; Bowell, Jo-Ann; Sides, Stuart C.; Gonzalez, Rosendo R.; Soltesz, Deborah L.

1996-01-01

(that is, vegetation and/or soil type). The spatial information gives the distribution, variation, and topographic relief of the cover types from pixel to pixel. Therefore, the main characteristics that determine a pixel's brightness/reflectance and, consequently, the digital number (DN) assigned to the pixel, are the physical properties of the surface and near surface, the cover type, and the topographic slope. In this application, the ability to detect and map lineaments, especially those related to fractures and faults, is critical. Therefore, the extraction of spatial information from the digital images was of prime interest in this project. The spatial information varies among the different spectral bands available; in particular, a near infrared spectral band is better than a visible band when extracting spatial information in highly vegetated areas. In this study, both visible and near infrared bands were analyzed and used to extract the desired spatial information from the images. The wide swath coverage of remotely sensed satellite digital images makes them ideal for regional analysis and mapping. Since locating and mapping highly fractured and faulted areas is a major requirement for ground water resource evaluation and exploration this aspect of satellite images was considered critical; it allowed us to stand back (actually up about 440 miles), look at, and map the regional structural setting of the area. The main focus of the remote sensing and digital image processing component of this project was to use both remotely sensed digital satellite images and a Digital Elevation Model (DEM) to extract spatial information related to the structural and topographic patterns in the area. The data types used were digital satellite images collected by the United States' Landsat Thematic Mapper (TM) and French Systeme Probatoire d'Observation de laTerre (SPOT) imaging systems, along with a DEM of the Flagstaff region. The USGS Mini Image Processing Sy

Using containment analysis to improve component cooling water heat exchanger limits

International Nuclear Information System (INIS)

Da Silva, H.C.; Tajbakhsh, A.

1995-01-01

The Comanche Peak Steam Electric Station design requires that exit temperatures from the Component Cooling Water Heat Exchanger remain below 330.37 K during the Emergency Core Cooling System recirculation stage, following a hypothetical Loss of Coolant Accident (LOCA). Due to measurements indicating a higher than expected combination of: (a) high fouling factor in the Component Cooling Water Heat Exchanger with (b) high ultimate heat sink temperatures, that might lead to temperatures in excess of the 330.37 K limit, if a LOCA were to occur, TUElectric adjusted key flow rates in the Component Cooling Water network. This solution could only be implemented with improvements to the containment analysis methodology of record. The new method builds upon the CONTEMPT-LT/028 code by: (a) coupling the long term post-LOCA thermohydraulics with a more detailed analytical model for the complex Component Cooling Water Heat Exchanger network and (b) changing the way mass and energy releases are calculated after core reflood and steam generator energy is dumped to the containment. In addition, a simple code to calculate normal cooldowns was developed to confirm RHR design bases were met with the improved limits

Aging assessment and mitigation for major LWR [light water reactor] components

International Nuclear Information System (INIS)

Shah, Y.N.; Ware, A.G.; Conley, D.A.; MacDonald, P.E.; Burns, J.J. Jr.

1989-01-01

This paper summarizes some of the results of the Aging Assessment and Mitigation Project sponsored by the US Nuclear Regulatory Commission (USNRC), Office of Nuclear Regulatory Research. The objective of the project is to develop an understanding of the aging degradation of the major light water reactor (LWR) structures and components and to develop methods for predicting the useful life of these components so that the impact of aging on the safe operation of nuclear power plants can be evaluated and addressed. The research effort consists of integrating, evaluating, and updating the available aging-related information. This paper discusses current accomplishments and summarizes the significant degradation processes active in two major components: pressurized water reactor pressurizer surge and spray lines and nozzles, and light water reactor primary coolant pumps. This paper also evaluates the effectiveness of the current inservice inspection programs and presents conclusions and recommendations related to aging of these two major components. 37 refs., 7 figs., 3 tabs

Surface water change as a significant contributor to global evapotranspiration change

Science.gov (United States)

Zhan, S.; Song, C.

2017-12-01

Water comprises a critical component of global/regional hydrological and biogeochemical cycles and is essential to all organisms including humans. In the past several decades, climate change has intensified the hydrological cycle, with significant implications for ecosystem services and feedback to regional and global climate. Evapotranspiration (ET) as a linking mechanism between land surface and atmosphere is central to the water cycle and an excellent indicator of the intensity of water cycle. Knowledge of the temporal changes of ET is crucial for accurately estimating global or regional water budgets and better understanding climate and hydrological interactions. While studies have examined changes in global ET, they were conducted using a constant land and surface water (SW) area. However, as many studies have found that global SW is very dynamic and their surface areas have generally been increasing since the 1980s. The conversion from land to water and vice versa significantly changes the local ET since water bodies evaporate at a rate that can be much higher than that of the land. Here, we quantify the global changes in ET caused by such land-water conversion using remotely-sensed SW area and various ET and potential ET products. New SW and lost SW between circa-1985 and circa-2015 were derived from remote sensing and were used to modify the local ET estimates. We found an increase in ET in all continents as consistent with the net increase in SW area. The increasing SW area lead to a global increase in ET by 30.38 ± 5.28 km3/yr. This is a significant contribution when compared to the 92.95 km3/yr/yr increase in ET between 1982-1997 and 103.43 km3/yr/yr decrease between 1998-2008 by Jung et al., (2010) assuming a constant SW. The results enhance our understanding of the water fluxes between the land and atmosphere and supplement land water budget estimates. We conclude that changes in SW lead to a significant change in global ET that cannot be neglected in

Principal Component Surface (2011) for Fish Bay, St. John

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Fish Bay, St. John in the U.S. Virgin Islands (USVI). It was...

Principal Component Surface (2011) for Coral Bay, St. John

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Coral Bay, St. John in the U.S. Virgin Islands (USVI). It was...

The sign, magnitude and potential drivers of change in surface water extent in Canadian tundra

Science.gov (United States)

Carroll, Mark L.; Loboda, Tatiana V.

2018-04-01

The accelerated rate of warming in the Arctic has considerable implications for all components of ecosystem functioning in the High Northern Latitudes. Changes to hydrological cycle in the Arctic are particularly complex as the observed and projected warming directly impacts permafrost and leads to variable responses in surface water extent which is currently poorly characterized at the regional scale. In this study we take advantage of the 30 plus years of medium resolution (30 m) Landsat data to quantify the spatial patterns of change in the extent of water bodies in the Arctic tundra in Nunavut, Canada. Our results show a divergent pattern of change—growing surface water extent in the north-west and shrinking in the south-east—which is not a function of the overall distribution of surface water in the region. The observed changes cannot be explained by latitudinal stratification, nor is it explained by available temperature and precipitation records. However, the sign of change appears to be consistent within the boundaries of individual watersheds defined by the Canada National Hydro Network based on the random forest analysis. Using land cover maps as a proxy for ecological function we were able to link shrinking tundra water bodies to substrates with shallow soil layers (i.e. bedrock and barren landscapes) with a moderate correlation (R 2 = 0.46, p evaporation as an important driver of surface water decrease in these cases.

Desert Beetle-Inspired Superwettable Patterned Surfaces for Water Harvesting.

Science.gov (United States)

Yu, Zhenwei; Yun, Frank F; Wang, Yanqin; Yao, Li; Dou, Shixue; Liu, Kesong; Jiang, Lei; Wang, Xiaolin

2017-09-01

With the impacts of climate change and impending crisis of clean drinking water, designing functional materials for water harvesting from fog with large water capacity has received much attention in recent years. Nature has evolved different strategies for surviving dry, arid, and xeric conditions. Nature is a school for human beings. In this contribution, inspired by the Stenocara beetle, superhydrophilic/superhydrophobic patterned surfaces are fabricated on the silica poly(dimethylsiloxane) (PDMS)-coated superhydrophobic surfaces using a pulsed laser deposition approach with masks. The resultant samples with patterned wettability demonstrate water-harvesting efficiency in comparison with the silica PDMS-coated superhydrophobic surface and the Pt nanoparticles-coated superhydrophilic surface. The maximum water-harvesting efficiency can reach about 5.3 g cm -2 h -1 . Both the size and the percentage of the Pt-coated superhydrophilic square regions on the patterned surface affect the condensation and coalescence of the water droplet, as well as the final water-harvesting efficiency. The present water-harvesting strategy should provide an avenue to alleviate the water crisis facing mankind in certain arid regions of the world. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

chemical and microbiological assessment of surface water samples

African Journals Online (AJOL)

PROF EKWUEME

concentrations and bacteriological content. Evaluation of the results ... and Aninri local government areas of Enugu state. Surface water ... surface water bodies are prone to impacts from ... Coal Measures (Akamigbo, 1987). The geologic map ...

Water footprint components required to address the water-energy-food nexus, with the recent Urban Water Atlas for Europe as an example

Science.gov (United States)

Vanham, Davy

2017-04-01

The first part of this presentation analyses which water footprint (WF) components are necessary in WF accounting to provide relevant information to address the Sustainable Development Goals (SDG's) water security (SDG 6), food security (SDG 2) and energy security (SDG 7) in a nexus setting. It is strongly based on the publication Vanham (2016) http://dx.doi.org/10.1016/j.ecoser.2015.08.003. First, the nexus links between (1) the planetary boundary freshwater resources (green and blue water resources) and (2) food, energy and blue water security are discussed. Second, it is shown which water uses are mostly represented in WF accounting. General water management and WF studies only account for the water uses agriculture, industry and domestic water. Important water uses are however mostly not identified as separate entities or even included, i.e. green and blue water resources for aquaculture, wild foods, biofuels, hydroelectric cooling, hydropower, recreation/tourism, forestry (for energy and other biomass uses) and navigation. Third, therefore a list of essential separate components to be included within WF accounting is presented. The latter would be more coherent with the water-food-energy-ecosystem nexus. The second part of the presentation gives a brief overview of the recently published Urban Water Atlas for Europe. It shows for a selected city which WF components are represented and which not. As such, it also identifies research gaps.

Describing the Components of the Water Transport in the Martian Atmosphere

Science.gov (United States)

Montmessin, F.; Haberle, R. M.; forget, F.; Rannou, P.; Cabane, M.

2003-01-01

In this paper, we examine the meteorological components driving water transport in the Martian atmosphere. A particular emphasis is given to the role of residual mean circulation and water ice clouds in determining the geographical partitioning of water vapor and frost.

Spatial and temporal variability of surface water pollution in the Mekong Delta, Vietnam.

Science.gov (United States)

Wilbers, Gert-Jan; Becker, Mathias; Nga, La Thi; Sebesvari, Zita; Renaud, Fabrice G

2014-07-01

Surface water pollution in the Vietnamese Mekong Delta (MD) could threaten human, animal and ecosystem health given the fact that this water source is intensively used for drinking, irrigation and domestic services. We therefore determined the levels of pollution by organic pollutants, salts, metals and microbial indicators by (bi)monthly monitoring of canals between November 2011 and July 2012 at 32 sampling locations, representing fresh and saline/brackish environments. The results were compared with national water quality guidelines, between the studied regions and with water quality data from main waterways. Key factors explaining the observed levels of pollution in surface water were identified through principal component analysis (PCA). Temporal variations due to tidal regime and seasonality were also assessed. Based on regression models, the spatial variability of five water quality parameters was visualized using GIS based maps. Results indicate that pH (max. 8.6), turbidity (max. 461 FTU), maximum concentrations of ammonium (14.7 mg L(-1)), arsenic (44.1 μg L(-1)), barium (157.5 μg L(-1)), chromium (84.7 μg L(-1)), mercury (45.5 μg L(-1)), manganese (1659.7 μg L(-1)), aluminum (14.5 mg L(-1)), iron (17.0 mg L(-1)) and the number of Escherichia coli (87,000 CFU 100 mL(-1)) and total coliforms (2,500,000 CFU 100 mL(-1)) in canals exceed the thresholds set by Vietnamese quality guidelines for drinking and domestic purposes. The PCA showed that i) urbanization; ii) metal leaching from soils; iii) aquaculture; and iv) tidal regime explain 85% of the variance of surface water quality attributes. Significant differences in water quality were found due to daily tidal regime and as a result of seasonality. Surface water quality maps for dissolved oxygen, ammonium, ortho-phosphate, manganese and total coliforms were developed to highlight hot-spot areas of pollution. The results of this study can assist policy makers in developing water management strategies

A deformable surface model for real-time water drop animation.

Science.gov (United States)

Zhang, Yizhong; Wang, Huamin; Wang, Shuai; Tong, Yiying; Zhou, Kun

2012-08-01

A water drop behaves differently from a large water body because of its strong viscosity and surface tension under the small scale. Surface tension causes the motion of a water drop to be largely determined by its boundary surface. Meanwhile, viscosity makes the interior of a water drop less relevant to its motion, as the smooth velocity field can be well approximated by an interpolation of the velocity on the boundary. Consequently, we propose a fast deformable surface model to realistically animate water drops and their flowing behaviors on solid surfaces. Our system efficiently simulates water drop motions in a Lagrangian fashion, by reducing 3D fluid dynamics over the whole liquid volume to a deformable surface model. In each time step, the model uses an implicit mean curvature flow operator to produce surface tension effects, a contact angle operator to change droplet shapes on solid surfaces, and a set of mesh connectivity updates to handle topological changes and improve mesh quality over time. Our numerical experiments demonstrate a variety of physically plausible water drop phenomena at a real-time rate, including capillary waves when water drops collide, pinch-off of water jets, and droplets flowing over solid materials. The whole system performs orders-of-magnitude faster than existing simulation approaches that generate comparable water drop effects.

Cosine components in water levels at Yucca Mountain

International Nuclear Information System (INIS)

Rice, J.; Lehman, L.; Keen, K.

1990-01-01

Water-level records from wells at Yucca Mountain, Nevada are analyzed periodically to determine if they contain periodic (cosine) components. Water-level data from selected wells are input to an iterative numerical procedure that determines a best fitting cosine function. The available water-level data, with coverage of up to 5 years, appear to be representative of the natural water-level changes. From our analysis of 9 water-level records, it appears that there may be periodic components (periods of 2-3 years) in the groundwater-level fluctuations at Yucca Mountain, Nevada, although some records are fit better than others by cosine functions. It also appears that the periodic behavior has a spatial distribution. Wells west of Yucca Mountain have different periods and phase shifts from wells on and east of Yucca Mountain. Interestingly, a similar spatial distribution of groundwater chemistry at Yucca Mountain is reported by Matuska (1988). This suggests a physical cause may underlie the different physical and chemical groundwater conditions. Although a variety of natural processes could cause water-level fluctuations, hydrologic processes are the most likely, because the periodicities are only a few years. A possible cause could be periodic recharge related to a periodicity in precipitation. It is interesting that Cochran et al., (1988), show a crude two-year cycle of precipitation for 1961 to 1970 in southern Nevada. Why periods and phase shifts may differ across Yucca Mountain is unknown. Different phase shifts could indicate different lag times of response to hydrologic stimuli. Difference in periods could mean that the geologic media is heterogeneous and displays heterogeneous response to a single stimulus, or that stimuli differ in certain regions, or that a hydraulic barrier separates the groundwater system into two regions having different water chemistry and recharge areas. 13 refs., 5 figs., 1 tab

Wetlands inform how climate extremes influence surface water expansion and contraction

Science.gov (United States)

Vanderhoof, Melanie K.; Lane, Charles R.; McManus, Michael G.; Alexander, Laurie C.; Christensen, Jay R.

2018-03-01

Effective monitoring and prediction of flood and drought events requires an improved understanding of how and why surface water expansion and contraction in response to climate varies across space. This paper sought to (1) quantify how interannual patterns of surface water expansion and contraction vary spatially across the Prairie Pothole Region (PPR) and adjacent Northern Prairie (NP) in the United States, and (2) explore how landscape characteristics influence the relationship between climate inputs and surface water dynamics. Due to differences in glacial history, the PPR and NP show distinct patterns in regards to drainage development and wetland density, together providing a diversity of conditions to examine surface water dynamics. We used Landsat imagery to characterize variability in surface water extent across 11 Landsat path/rows representing the PPR and NP (images spanned 1985-2015). The PPR not only experienced a 2.6-fold greater surface water extent under median conditions relative to the NP, but also showed a 3.4-fold greater change in surface water extent between drought and deluge conditions. The relationship between surface water extent and accumulated water availability (precipitation minus potential evapotranspiration) was quantified per watershed and statistically related to variables representing hydrology-related landscape characteristics (e.g., infiltration capacity, surface storage capacity, stream density). To investigate the influence stream connectivity has on the rate at which surface water leaves a given location, we modeled stream-connected and stream-disconnected surface water separately. Stream-connected surface water showed a greater expansion with wetter climatic conditions in landscapes with greater total wetland area, but lower total wetland density. Disconnected surface water showed a greater expansion with wetter climatic conditions in landscapes with higher wetland density, lower infiltration and less anthropogenic drainage

Wetlands inform how climate extremes influence surface water expansion and contraction

Science.gov (United States)

Vanderhoof, Melanie; Lane, Charles R.; McManus, Michael L.; Alexander, Laurie C.; Christensen, Jay R.

2018-01-01

Effective monitoring and prediction of flood and drought events requires an improved understanding of how and why surface water expansion and contraction in response to climate varies across space. This paper sought to (1) quantify how interannual patterns of surface water expansion and contraction vary spatially across the Prairie Pothole Region (PPR) and adjacent Northern Prairie (NP) in the United States, and (2) explore how landscape characteristics influence the relationship between climate inputs and surface water dynamics. Due to differences in glacial history, the PPR and NP show distinct patterns in regards to drainage development and wetland density, together providing a diversity of conditions to examine surface water dynamics. We used Landsat imagery to characterize variability in surface water extent across 11 Landsat path/rows representing the PPR and NP (images spanned 1985–2015). The PPR not only experienced a 2.6-fold greater surface water extent under median conditions relative to the NP, but also showed a 3.4-fold greater change in surface water extent between drought and deluge conditions. The relationship between surface water extent and accumulated water availability (precipitation minus potential evapotranspiration) was quantified per watershed and statistically related to variables representing hydrology-related landscape characteristics (e.g., infiltration capacity, surface storage capacity, stream density). To investigate the influence stream connectivity has on the rate at which surface water leaves a given location, we modeled stream-connected and stream-disconnected surface water separately. Stream-connected surface water showed a greater expansion with wetter climatic conditions in landscapes with greater total wetland area, but lower total wetland density. Disconnected surface water showed a greater expansion with wetter climatic conditions in landscapes with higher wetland density, lower infiltration and less anthropogenic

Wetlands inform how climate extremes influence surface water expansion and contraction

Directory of Open Access Journals (Sweden)

M. K. Vanderhoof

2018-03-01

Full Text Available Effective monitoring and prediction of flood and drought events requires an improved understanding of how and why surface water expansion and contraction in response to climate varies across space. This paper sought to (1 quantify how interannual patterns of surface water expansion and contraction vary spatially across the Prairie Pothole Region (PPR and adjacent Northern Prairie (NP in the United States, and (2 explore how landscape characteristics influence the relationship between climate inputs and surface water dynamics. Due to differences in glacial history, the PPR and NP show distinct patterns in regards to drainage development and wetland density, together providing a diversity of conditions to examine surface water dynamics. We used Landsat imagery to characterize variability in surface water extent across 11 Landsat path/rows representing the PPR and NP (images spanned 1985–2015. The PPR not only experienced a 2.6-fold greater surface water extent under median conditions relative to the NP, but also showed a 3.4-fold greater change in surface water extent between drought and deluge conditions. The relationship between surface water extent and accumulated water availability (precipitation minus potential evapotranspiration was quantified per watershed and statistically related to variables representing hydrology-related landscape characteristics (e.g., infiltration capacity, surface storage capacity, stream density. To investigate the influence stream connectivity has on the rate at which surface water leaves a given location, we modeled stream-connected and stream-disconnected surface water separately. Stream-connected surface water showed a greater expansion with wetter climatic conditions in landscapes with greater total wetland area, but lower total wetland density. Disconnected surface water showed a greater expansion with wetter climatic conditions in landscapes with higher wetland density, lower infiltration and less

Potentially hazardous substances in surface waters. II. Cholinesterase inhibitors in Dutch surface waters

NARCIS (Netherlands)

Greve, P.A.; Freudenthal, J.; Wit, S.L.

1972-01-01

Several analytical methods were employed to determine the concentrations of cholinesterase inhibitors in several Dutch surface waters. An Auto-Analyzer method was used for screening purposes; thin-layer chromatography and gas-liquid chromatography-mass spectrometry were used for identification and

Two-component injection moulding simulation of ABS-POM micro structured surfaces

DEFF Research Database (Denmark)

Tosello, Guido; Hansen, Hans Nørgaard; Islam, Aminul

2013-01-01

Multi-component micro injection moulding (μIM) processes such as two-component (2k) μIM are the key technologies for the mass fabrication of multi-material micro products. 2k-μIM experiments involving a miniaturized test component with micro features in the sub-mm dimensional range and moulding...... a pair of thermoplastic materials (ABS and POM) were conducted. Three dimensional process simulations based on the finite element method have been performed to explore the capability of predicting filling pattern shape at component-level and surface micro feature-level in a polymer/polymer overmoulding...

Cooperativity in Surface Bonding and Hydrogen Bonding of Water and Hydroxyl at Metal Surfaces

DEFF Research Database (Denmark)

Schiros, T.; Ogasawara, H.; Naslund, L. A.

2010-01-01

of the mixed phase at metal surfaces. The surface bonding can be considered to be similar to accepting a hydrogen bond, and we can thereby apply general cooperativity rules developed for hydrogen-bonded systems. This provides a simple understanding of why water molecules become more strongly bonded...... to the surface upon hydrogen bonding to OH and why the OH surface bonding is instead weakened through hydrogen bonding to water. We extend the application of this simple model to other observed cooperativity effects for pure water adsorption systems and H3O+ on metal surfaces.......We examine the balance of surface bonding and hydrogen bonding in the mixed OH + H2O overlayer on Pt(111), Cu(111), and Cu(110) via density functional theory calculations. We find that there is a cooperativity effect between surface bonding and hydrogen bonding that underlies the stability...

Satellite-based estimates of surface water dynamics in the Congo River Basin

Science.gov (United States)

Becker, M.; Papa, F.; Frappart, F.; Alsdorf, D.; Calmant, S.; da Silva, J. Santos; Prigent, C.; Seyler, F.

2018-04-01

In the Congo River Basin (CRB), due to the lack of contemporary in situ observations, there is a limited understanding of the large-scale variability of its present-day hydrologic components and their link with climate. In this context, remote sensing observations provide a unique opportunity to better characterize those dynamics. Analyzing the Global Inundation Extent Multi-Satellite (GIEMS) time series, we first show that surface water extent (SWE) exhibits marked seasonal patterns, well distributed along the major rivers and their tributaries, and with two annual maxima located: i) in the lakes region of the Lwalaba sub-basin and ii) in the "Cuvette Centrale", including Tumba and Mai-Ndombe Lakes. At an interannual time scale, we show that SWE variability is influenced by ENSO and the Indian Ocean dipole events. We then estimate water level maps and surface water storage (SWS) in floodplains, lakes, rivers and wetlands of the CRB, over the period 2003-2007, using a multi-satellite approach, which combines the GIEMS dataset with the water level measurements derived from the ENVISAT altimeter heights. The mean annual variation in SWS in the CRB is 81 ± 24 km3 and contributes to 19 ± 5% of the annual variations of GRACE-derived terrestrial water storage (33 ± 7% in the Middle Congo). It represents also ∼6 ± 2% of the annual water volume that flows from the Congo River into the Atlantic Ocean.

Modeling Groundwater-Surface Water Interaction and Contaminant Transport of Chlorinated Solvent Contaminated Site

Science.gov (United States)

Yimer Ebrahim, Girma; Jonoski, Andreja; van Griensven, Ann; Dujardin, Juliette; Baetelaan, Okke; Bronders, Jan

2010-05-01

Chlorinated-solvent form one of the largest groups of environmental chemicals. Their use and misuse in industry have lead to a large entry of these chemicals into the environment, resulting in widespread dissemination and oftentimes environmental contamination. Chlorinated solvent contamination of groundwater resources has been widely reported. For instance, there has been much interest in the assessment of these contaminant levels and their evolutions with time in the groundwater body below the Vilvoorde-Machelen industrial area (Belgium). The long industrial history of the area has lead to complex patterns of pollution from multiple sources and the site has been polluted to the extent that individual plumes are not definable any more. Understanding of groundwater/surface water interaction is a critical component for determining the fate of contaminant both in streams and ground water due to the fact that groundwater and surface water are in continuous dynamic interaction in the hydrologic cycle. The interaction has practical consequences in the quantity and quality of water in either system in the sense that depletion and/or contamination of one of the system will eventually affect the other one. The transition zone between a stream and its adjacent aquifer referred to as the hyporheic zone plays a critical role in governing contaminant exchange and transformation during water exchange between the two water bodies. The hyporheic zone of Zenne River ( the main receptor ) is further complicated due to the fact that the river banks are artificially trained with sheet piles along its reach extending some 12 m below the surface. This study demonstrates the use of MODFLOW, a widely used modular three-dimensional block-centred finite difference, saturated flow model for simulating the flow and direction of movement of groundwater through aquifer and stream-aquifer interaction and the use of transport model RT3D, a three-dimensional multi-species reactive transport model

Reactor materials program process water component failure probability

International Nuclear Information System (INIS)

Daugherty, W. L.

1988-01-01

The maximum rate loss of coolant accident for the Savannah River Production Reactors is presently specified as the abrupt double-ended guillotine break (DEGB) of a large process water pipe. This accident is not considered credible in light of the low applied stresses and the inherent ductility of the piping materials. The Reactor Materials Program was initiated to provide the technical basis for an alternate, credible maximum rate LOCA. The major thrust of this program is to develop an alternate worst case accident scenario by deterministic means. In addition, the probability of a DEGB is also being determined; to show that in addition to being mechanistically incredible, it is also highly improbable. The probability of a DEGB of the process water piping is evaluated in two parts: failure by direct means, and indirectly-induced failure. These two areas have been discussed in other reports. In addition, the frequency of a large bread (equivalent to a DEGB) in other process water system components is assessed. This report reviews the large break frequency for each component as well as the overall large break frequency for the reactor system

Surface wastewater in Samara and their impact on water basins as water supply sources

Science.gov (United States)

Strelkov, Alexander; Shuvalov, Mikhail; Gridneva, Marina

2017-10-01

The paper gives an overview of surface wastewater outlets in Samara through the rainwater sewer system into the Saratov water reservoir and the Samara river. The rainwater sewer system in Samara is designed and executed according to a separate scheme, except for the old part of the city, where surface run-off is dumped into the sewer system through siphoned drain. The rainwater system disposes of surface, drainage, industrial clean-contamined waters, emergency and technology discharges from the city’s heat supply and water supply systems. The effluent discharge is carried out by means of separate wastewater outlets into ravines or directly into the Samara river and the Saratov water reservoir without cleaning. The effluent discharge is carried out through the rainwater sewer system with 17 wastewater outlets into the Saratov water reservoir. In the Samara river, surface runoff drainage and clean-contamined water of industrial enterprises is carried out through 14 wastewater outlets. This study emphasizes the demand to arrange effluent discharge and construction of sewage treatment plants to prevent contamination of water objects by surface run-off from residential areas and industrial territories.

Characterization of uranium in surface-waters collected at the Rocky Flats Facility

International Nuclear Information System (INIS)

Efurd, D.W.; Rokop, D.J.; Aguilar, R.D.; Roensch, F.R.; Perrin, R.E.; Banar, J.C.

1994-01-01

The Rocky Flats Plant (RFP) is a Department of Energy (DOE) facility where plutonium and uranium components were manufactured for nuclear weapons. During plant operations radioactivity was inadvertently released into the environment. This study was initiated to characterize the uranium present in surface-waters at RFP. Three drainage basins and natural ephemeral streams transverse RFP. The Woman Creek drainage basin traverses and drains the southern portion of the site. The Rock Creek drainage basin drains the northwestern portion of the plant complex. The Walnut Creek drainage basin traverses the western, northern, and northeastern portions of the RFP site. Dams, detention ponds, diversion structures, and ditches have been constructed at RFP to control the release of plant discharges and surface (storm water) runoff. The ponds located downstream of the plant complex on North Walnut Creek are designated A-1 through A-4. Ponds on South Walnut Creek are designated B-1 through B-5. The ponds in the Woman Creek drainage basin are designated C-1 and C-2. Water samples were collected from each pond and the uranium was characterized by TIMS measurement techniques

Escape jumping by three age-classes of water striders from smooth, wavy and bubbling water surfaces.

Science.gov (United States)

Ortega-Jimenez, Victor Manuel; von Rabenau, Lisa; Dudley, Robert

2017-08-01

Surface roughness is a ubiquitous phenomenon in both oceanic and terrestrial waters. For insects that live at the air-water interface, such as water striders, non-linear and multi-scale perturbations produce dynamic surface deformations which may impair locomotion. We studied escape jumps of adults, juveniles and first-instar larvae of the water strider Aquarius remigis on smooth, wave-dominated and bubble-dominated water surfaces. Effects of substrate on takeoff jumps were substantial, with significant reductions in takeoff angles, peak translational speeds, attained heights and power expenditure on more perturbed water surfaces. Age effects were similarly pronounced, with the first-instar larvae experiencing the greatest degradation in performance; age-by-treatment effects were also significant for many kinematic variables. Although commonplace in nature, perturbed water surfaces thus have significant and age-dependent effects on water strider locomotion, and on behavior more generally of surface-dwelling insects. © 2017. Published by The Company of Biologists Ltd.

Partitioning of water between surface and mantle on terrestrial exoplanets: effect of surface-mantle water exchange parameterizations on ocean depth

Science.gov (United States)

Komacek, T. D.; Abbot, D. S.

2016-12-01

Terrestrial exoplanets in the canonical habitable zone may have a variety of initial water fractions due to their volatile delivery rate via planetesimals. If the total planetary water complement is high, the entire surface may be covered in water, forming a "waterworld". The habitable zone for waterworlds is likely smaller than that for planets with partial land coverage because waterworlds lack the stabilizing silicate-weathering feedback. On a planet with active tectonics, competing mechanisms act to regulate the abundance of water on the surface by determining the partitioning of water between interior and surface. We have explored how the incorporation of different mechanisms for the outgassing and regassing of water changes the volatile evolution of a planet. Specifically, we have examined three models for volatile cycling: a model with degassing and regassing both determined by the seafloor pressure, one with mantle temperature-dependent degassing and regassing rates, and a hybrid model that has the degassing rate driven by seafloor pressure and the regassing rate determined by the mantle temperature. We find that the volatile cycling in all three of these scenarios reaches a steady-state after a few billion years. Using these steady-states, we can make predictions from each model for how much water is needed to flood the surface and make a waterworld. We find that if volatile cycling is either solely temperature-dependent or pressure-dependent, exoplanets require a high abundance (more than 0.3% by mass) of water to have fully inundated surfaces. This is because the waterworld boundary for these models is regulated by how much water can be stuffed into the mantle. However, if degassing is more dependent on the seafloor pressure and regassing mainly dependent on mantle temperature, super-Earth mass planets with a total water fraction similar to that of the Earth (approximately 0.05% by mass) can become waterworlds. As a result, further understanding of the

Assessment of Surface Water Quality in the Malaysian Coastal Waters by Using Multivariate Analyses

International Nuclear Information System (INIS)

Yap, C.K.; Chee, M.W.; Shamarina, S.; Edward, F.B.; Chew, W.; Tan, S.G.

2011-01-01

Coastal water samples were collected from 20 sampling sites in the southern part of Peninsular Malaysia. Seven physico-chemical parameters were measured directly in-situ while water samples were collected and analysed for 6 dissolved trace metal concentrations. The surface water (0-20 cm) physico-chemical parameters including temperature, salinity, dissolved oxygen (DO), pH, total dissolved solids (TDS), specific conductance (SpC) and turbidity while the dissolved trace metals were Cd, Cu, Fe, Ni, Pb and Zn. The ranges for the physico-chemical parameters were 28.07-35.6 degree Celsius for temperature, 0.18-32.42 ppt for salinity, 2.20-12.03 mg/ L for DO, 5.50-8.53 for pH, 0.24-31.65 mg/ L for TDS, 368-49452 μS/ cm for SpC and 0-262 NTU for turbidity while the dissolved metals (mg/ L) were 0.013-0.147 for Cd, 0.024-0.143 for Cu, 0.266-2.873 for Fe, 0.027-0.651 for Ni, 0.018-0.377 for Pb and 0.032-0.099 for Zn. Based on multivariate analysis (including correlation, cluster and principal component analyses), the polluted sites were found at Kg. Pasir Puteh and Tg. Kupang while Ni and Pb were identified as two major dissolved metals of high variation in the coastal waters. Therefore, water quality monitoring and control of release of untreated anthropogenic wastes into rivers and coastal waters are strongly needed. (author)

Combining hydraulic model, hydrogeomorphological observations and chemical analyses of surface waters to improve knowledge on karst flash floods genesis

Directory of Open Access Journals (Sweden)

F. Raynaud

2015-06-01

Full Text Available During a flood event over a karst watershed, the connections between surface and ground waters appear to be complex ones. The karst may attenuate surface floods by absorbing water or contribute to the surface flood by direct contribution of karst waters in the rivers (perennial and overflowing springs and by diffuse resurgence along the hillslopes. If it is possible to monitor each known outlet of a karst system, the diffuse contribution is yet difficult to assess. Furthermore, all these connections vary over time according to several factors such as the water content of the soil and underground, the rainfall characteristics, the runoff pathways. Therefore, the contribution of each compartment is generally difficult to assess, and flood dynamics are not fully understood. To face these misunderstandings and difficulties, we analysed surface waters during six recent flood events in the Lirou watershed (a karst tributary of the Lez, in South of France. Because of the specific chemical signature of karst waters, chemical analyses can supply information about water pathways and flood dynamics. Then, we used the dilution law to combine chemical results, flow data and field observations to assess the dynamics of the karst component of the flood. To end, we discussed the surface or karst origin of the waters responsible for the apparent runoff coefficient rise during flash karst flood.

A GPU-based mipmapping method for water surface visualization

Science.gov (United States)

Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan

2018-03-01

Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

Water surface coverage effects on reactivity of plasma oxidized Ti films

International Nuclear Information System (INIS)

Pranevicius, L.; Pranevicius, L.L.; Vilkinis, P.; Baltaragis, S.; Gedvilas, K.

2014-01-01

Highlights: • The reactivity of Ti films immersed in water vapor plasma depends on the surface water coverage. • The adsorbed water monolayers are disintegrated into atomic constituents on the hydrophilic TiO 2 under plasma radiation. • The TiO 2 surface covered by water multilayer loses its ability to split adsorbed water molecules under plasma radiation. - Abstract: The behavior of the adsorbed water on the surface of thin sputter deposited Ti films maintained at room temperature was investigated in dependence on the thickness of the resulting adsorbed water layer, controllably injecting water vapor into plasma. The surface morphology and microstructure were used to characterize the surfaces of plasma treated titanium films. Presented experimental results showed that titanium films immersed in water vapor plasma at pressure of 10–100 Pa promoted the photocatalytic activity of overall water splitting. The surfaces of plasma oxidized titanium covered by an adsorbed hydroxyl-rich island structure water layer and activated by plasma radiation became highly chemically reactive. As water vapor pressure increased up to 300–500 Pa, the formed water multilayer diminished the water oxidation and, consequently, water splitting efficiency decreased. Analysis of the experimental results gave important insights into the role an adsorbed water layer on surface of titanium exposed to water vapor plasma on its chemical activity and plasma activated electrochemical processes, and elucidated the surface reactions that could lead to the split of water molecules

Electric field measurements in nanosecond pulse discharges in air over liquid water surface

Science.gov (United States)

Simeni Simeni, Marien; Baratte, Edmond; Zhang, Cheng; Frederickson, Kraig; Adamovich, Igor V.

2018-01-01

Electric field in nanosecond pulse discharges in ambient air is measured by picosecond four-wave mixing, with absolute calibration by a known electrostatic field. The measurements are done in two geometries, (a) the discharge between two parallel cylinder electrodes placed inside quartz tubes, and (b) the discharge between a razor edge electrode and distilled water surface. In the first case, breakdown field exceeds DC breakdown threshold by approximately a factor of four, 140 ± 10 kV cm-1. In the second case, electric field is measured for both positive and negative pulse polarities, with pulse durations of ˜10 ns and ˜100 ns, respectively. In the short duration, positive polarity pulse, breakdown occurs at 85 kV cm-1, after which the electric field decreases over several ns due to charge separation in the plasma, with no field reversal detected when the applied voltage is reduced. In a long duration, negative polarity pulse, breakdown occurs at a lower electric field, 30 kV cm-1, after which the field decays over several tens of ns and reverses direction when the applied voltage is reduced at the end of the pulse. For both pulse polarities, electric field after the pulse decays on a microsecond time scale, due to residual surface charge neutralization by transport of opposite polarity charges from the plasma. Measurements 1 mm away from the discharge center plane, ˜100 μm from the water surface, show that during the voltage rise, horizontal field component (Ex ) lags in time behind the vertical component (Ey ). After breakdown, Ey is reduced to near zero and reverses direction. Further away from the water surface (≈0.9 mm), Ex is much higher compared to Ey during the entire voltage pulse. The results provide insight into air plasma kinetics and charge transport processes near plasma-liquid interface, over a wide range of time scales.

Surface-Water and Ground-Water Interactions in the Central Everglades, Florida

Science.gov (United States)

Harvey, Judson W.; Newlin, Jessica T.; Krest, James M.; Choi, Jungyill; Nemeth, Eric A.; Krupa, Steven L.

2004-01-01

Recharge and discharge are hydrological processes that cause Everglades surface water to be exchanged for subsurface water in the peat soil and the underlying sand and limestone aquifer. These interactions are thought to be important to water budgets, water quality, and ecology in the Everglades. Nonetheless, relatively few studies of surface water and ground water interactions have been conducted in the Everglades, especially in its vast interior areas. This report is a product of a cooperative investigation conducted by the USGS and the South Florida Water Management District (SFWMD) aimed at developing and testing techniques that would provide reliable estimates of recharge and discharge in interior areas of WCA-2A (Water Conservation Area 2A) and several other sites in the central Everglades. The new techniques quantified flow from surface water to the subsurface (recharge) and the opposite (discharge) using (1) Darcy-flux calculations based on measured vertical gradients in hydraulic head and hydraulic conductivity of peat; (2) modeling transport through peat and decay of the naturally occurring isotopes 224Ra and 223Ra (with half-lives of 4 and 11 days, respectively); and (3) modeling transport and decay of naturally occurring and 'bomb-pulse' tritium (half-life of 12.4 years) in ground water. Advantages and disadvantages of each method for quantifying recharge and discharge were compared. In addition, spatial and temporal variability of recharge and discharge were evaluated and controlling factors identified. A final goal was to develop appropriately simplified (that is, time averaged) expressions of the results that will be useful in addressing a broad range of hydrological and ecological problems in the Everglades. Results were compared with existing information about water budgets from the South Florida Water Management Model (SFWMM), a principal tool used by the South Florida Water Management District to plan many of the hydrological aspects of the

Water vapor retrieval over many surface types

Energy Technology Data Exchange (ETDEWEB)

Borel, C.C.; Clodius, W.C.; Johnson, J.

1996-04-01

In this paper we present a study of of the water vapor retrieval for many natural surface types which would be valuable for multi-spectral instruments using the existing Continuum Interpolated Band Ratio (CIBR) for the 940 nm water vapor absorption feature. An atmospheric code (6S) and 562 spectra were used to compute the top of the atmosphere radiance near the 940 nm water vapor absorption feature in steps of 2.5 nm as a function of precipitable water (PW). We derive a novel technique called ``Atmospheric Pre-corrected Differential Absorption`` (APDA) and show that APDA performs better than the CIBR over many surface types.

Thermodynamic properties of water solvating biomolecular surfaces

Science.gov (United States)

Heyden, Matthias

Changes in the potential energy and entropy of water molecules hydrating biomolecular interfaces play a significant role for biomolecular solubility and association. Free energy perturbation and thermodynamic integration methods allow calculations of free energy differences between two states from simulations. However, these methods are computationally demanding and do not provide insights into individual thermodynamic contributions, i.e. changes in the solvent energy or entropy. Here, we employ methods to spatially resolve distributions of hydration water thermodynamic properties in the vicinity of biomolecular surfaces. This allows direct insights into thermodynamic signatures of the hydration of hydrophobic and hydrophilic solvent accessible sites of proteins and small molecules and comparisons to ideal model surfaces. We correlate dynamic properties of hydration water molecules, i.e. translational and rotational mobility, to their thermodynamics. The latter can be used as a guide to extract thermodynamic information from experimental measurements of site-resolved water dynamics. Further, we study energy-entropy compensations of water at different hydration sites of biomolecular surfaces. This work is supported by the Cluster of Excellence RESOLV (EXC 1069) funded by the Deutsche Forschungsgemeinschaft.

Nanofiltration in Transforming Surface Water into Healthy Water: Comparison with Reverse Osmosis

Directory of Open Access Journals (Sweden)

L. D. Naidu

2015-01-01

Full Text Available The natural surface water, especially available through rivers, is the main source of healthy water for the living beings throughout the world from ancient days as it consists of all essential minerals. With the advent of industrialization, gradually even the most prominent rivers have been polluted in all parts of the world. Although there are lots of technologies, nanofiltration (NF has been chosen to transform river water into healthy water due to its unique advantages of retaining optimum TDS (with essential minerals required for human body, consuming of lower energy, and no usage of any chemicals. The prominent parameters of surface water and macro/microminerals of treated water have been analyzed. It is shown that NF is better in producing healthy water with high flux by consuming low energy.

Stable water isotope and surface heat flux simulation using ISOLSM: Evaluation against in-situ measurements

KAUST Repository

Cai, Mick Y.; Wang, Lixin; Parkes, Stephen; Strauss, Josiah; McCabe, Matthew; Evans, Jason P.; Griffiths, Alan D.

2015-01-01

The stable isotopes of water are useful tracers of water sources and hydrological processes. Stable water isotope-enabled land surface modeling is a relatively new approach for characterizing the hydrological cycle, providing spatial and temporal variability for a number of hydrological processes. At the land surface, the integration of stable water isotopes with other meteorological measurements can assist in constraining surface heat flux estimates and discriminate between evaporation (E) and transpiration (T). However, research in this area has traditionally been limited by a lack of continuous in-situ isotopic observations. Here, the National Centre for Atmospheric Research stable isotope-enabled Land Surface Model (ISOLSM) is used to simulate the water and energy fluxes and stable water isotope variations. The model was run for a period of one month with meteorological data collected from a coastal sub-tropical site near Sydney, Australia. The modeled energy fluxes (latent heat and sensible heat) agreed reasonably well with eddy covariance observations, indicating that ISOLSM has the capacity to reproduce observed flux behavior. Comparison of modeled isotopic compositions of evapotranspiration (ET) against in-situ Fourier Transform Infrared spectroscopy (FTIR) measured bulk water vapor isotopic data (10. m above the ground), however, showed differences in magnitude and temporal patterns. The disparity is due to a small contribution from local ET fluxes to atmospheric boundary layer water vapor (~1% based on calculations using ideal gas law) relative to that advected from the ocean for this particular site. Using ISOLSM simulation, the ET was partitioned into E and T with 70% being T. We also identified that soil water from different soil layers affected T and E differently based on the simulated soil isotopic patterns, which reflects the internal working of ISOLSM. These results highlighted the capacity of using the isotope-enabled models to discriminate

Stable water isotope and surface heat flux simulation using ISOLSM: Evaluation against in-situ measurements

KAUST Repository

Cai, Mick Y.

2015-04-01

The stable isotopes of water are useful tracers of water sources and hydrological processes. Stable water isotope-enabled land surface modeling is a relatively new approach for characterizing the hydrological cycle, providing spatial and temporal variability for a number of hydrological processes. At the land surface, the integration of stable water isotopes with other meteorological measurements can assist in constraining surface heat flux estimates and discriminate between evaporation (E) and transpiration (T). However, research in this area has traditionally been limited by a lack of continuous in-situ isotopic observations. Here, the National Centre for Atmospheric Research stable isotope-enabled Land Surface Model (ISOLSM) is used to simulate the water and energy fluxes and stable water isotope variations. The model was run for a period of one month with meteorological data collected from a coastal sub-tropical site near Sydney, Australia. The modeled energy fluxes (latent heat and sensible heat) agreed reasonably well with eddy covariance observations, indicating that ISOLSM has the capacity to reproduce observed flux behavior. Comparison of modeled isotopic compositions of evapotranspiration (ET) against in-situ Fourier Transform Infrared spectroscopy (FTIR) measured bulk water vapor isotopic data (10. m above the ground), however, showed differences in magnitude and temporal patterns. The disparity is due to a small contribution from local ET fluxes to atmospheric boundary layer water vapor (~1% based on calculations using ideal gas law) relative to that advected from the ocean for this particular site. Using ISOLSM simulation, the ET was partitioned into E and T with 70% being T. We also identified that soil water from different soil layers affected T and E differently based on the simulated soil isotopic patterns, which reflects the internal working of ISOLSM. These results highlighted the capacity of using the isotope-enabled models to discriminate

Dynamics of ice nucleation on water repellent surfaces.

Science.gov (United States)

Alizadeh, Azar; Yamada, Masako; Li, Ri; Shang, Wen; Otta, Shourya; Zhong, Sheng; Ge, Liehui; Dhinojwala, Ali; Conway, Ken R; Bahadur, Vaibhav; Vinciquerra, A Joseph; Stephens, Brian; Blohm, Margaret L

2012-02-14

Prevention of ice accretion and adhesion on surfaces is relevant to many applications, leading to improved operation safety, increased energy efficiency, and cost reduction. Development of passive nonicing coatings is highly desirable, since current antiicing strategies are energy and cost intensive. Superhydrophobicity has been proposed as a lead passive nonicing strategy, yet the exact mechanism of delayed icing on these surfaces is not clearly understood. In this work, we present an in-depth analysis of ice formation dynamics upon water droplet impact on surfaces with different wettabilities. We experimentally demonstrate that ice nucleation under low-humidity conditions can be delayed through control of surface chemistry and texture. Combining infrared (IR) thermometry and high-speed photography, we observe that the reduction of water-surface contact area on superhydrophobic surfaces plays a dual role in delaying nucleation: first by reducing heat transfer and second by reducing the probability of heterogeneous nucleation at the water-substrate interface. This work also includes an analysis (based on classical nucleation theory) to estimate various homogeneous and heterogeneous nucleation rates in icing situations. The key finding is that ice nucleation delay on superhydrophobic surfaces is more prominent at moderate degrees of supercooling, while closer to the homogeneous nucleation temperature, bulk and air-water interface nucleation effects become equally important. The study presented here offers a comprehensive perspective on the efficacy of textured surfaces for nonicing applications.

Spatial aspects of surface water quality in the Jakara Basin, Nigeria using chemometric analysis.

Science.gov (United States)

Mustapha, Adamu; Aris, Ahmad Zaharin

2012-01-01

Multivariate statistical techniques such as hierarchical Agglomerated cluster analysis (HACA), discriminant analysis (DA), principal component analysis (PCA), and factor analysis (FA) were applied to identify the spatial variation and pollution sources of Jakara River, Kano, Nigeria. Thirty surface water samples were collected: 23 along Getsi River and 7 along the main channel of River Jakara. Twenty-three water quality parameters, namely pH, temperature, turbidity, electrical conductivity (EC), dissolved oxygen (DO), 5-day biochemical oxygen demand (BOD(5)), Faecal coliform, total solids (TS), nitrates (NO(3)(-)), phosphates (PO(4)(3-)), cobalt (Co), iron (Fe), nickel (Ni), manganese (Mn), copper (Cu), sodium (Na), potassium (K), mercury (Hg), chromium (Cr), cadmium (Cd), lead (Pb), magnesium (Mg), and calcium(Ca) were analysed. HACA grouped the sampling points into three clusters based on the similarities of river water quality characteristics: industrial, domestic, and agricultural water pollution sources. Forward and backward DA effectively discriminated 5 and 15 water quality variables, respectively, each assigned with 100% correctness from the original 23 variables. PCA and FA were used to investigate the origin of each water quality parameter due to various land use activities, 7 principal components were obtained with 77.5% total variance, and in addition PCA identified 3 latent pollution sources to support HACA. From this study, one can conclude that the application of multivariate techniques derives meaningful information from water quality data.

Roles of surface water areas for water and solute cycle in Hanoi city, Viet Nam

Science.gov (United States)

Hayashi, Takeshi; Kuroda, Keisuke; Do Thuan, An; Tran Thi Viet, Nga; Takizawa, Satoshi

2013-04-01

Hanoi city, the capital of Viet Nam, has developed beside the Red river. Recent rapid urbanization of this city has reduced a large number of natural water areas such as lakes, ponds and canals not only in the central area but the suburban area. Contrary, the urbanization has increased artificial water areas such as pond for fish cultivation and landscaping. On the other hand, the urbanization has induced the inflow of waste water from households and various kinds of factories to these water areas because of delay of sewerage system development. Inflow of the waste water has induced eutrophication and pollution of these water areas. Also, there is a possibility of groundwater pollution by infiltration of polluted surface water. However, the role of these water areas for water cycle and solute transport is not clarified. Therefore, this study focuses on the interaction between surface water areas and groundwater in Hanoi city to evaluate appropriate land development and groundwater resource management. We are carrying out three approaches: a) understanding of geochemical characteristics of surface water and groundwater, b) monitoring of water levels of pond and groundwater, c) sampling of soil and pond sediment. Correlation between d18O and dD of precipitation (after GNIP), the Red River (after GNIR) and the water samples of this study showed that the groundwater is composed of precipitation, the Red River and surface water that has evaporation process. Contribution of the surface water with evaporation process was widely found in the study area. As for groundwater monitoring, the Holocene aquifers at two sites were in unconfined condition in dry season and the groundwater levels in the aquifer continued to increase through rainy season. The results of isotopic analysis and groundwater level monitoring showed that the surface water areas are one of the major groundwater sources. On the other hand, concentrations of dissolved Arsenic (filtered by 0.45um) in the pore

Documentation of the Santa Clara Valley regional ground-water/surface-water flow model, Santa Clara Valley, California

Science.gov (United States)

Hanson, R.T.; Li, Zhen; Faunt, C.C.

2004-01-01

The Santa Clara Valley is a long, narrow trough extending about 35 miles southeast from the southern end of San Francisco Bay where the regional alluvial-aquifer system has been a major source of water. Intensive agricultural and urban development throughout the 20th century and related ground-water development resulted in ground-water-level declines of more than 200 feet and land subsidence of as much as 12.7 feet between the early 1900s and the mid-1960s. Since the 1960s, Santa Clara Valley Water District has imported surface water to meet growing demands and reduce dependence on ground-water supplies. This importation of water has resulted in a sustained recovery of the ground-water flow system. To help support effective management of the ground-water resources, a regional ground-water/surface-water flow model was developed. This model simulates the flow of ground water and surface water, changes in ground-water storage, and related effects such as land subsidence. A numerical ground-water/surface-water flow model of the Santa Clara Valley subbasin of the Santa Clara Valley was developed as part of a cooperative investigation with the Santa Clara Valley Water District. The model better defines the geohydrologic framework of the regional flow system and better delineates the supply and demand components that affect the inflows to and outflows from the regional ground-water flow system. Development of the model includes revisions to the previous ground-water flow model that upgraded the temporal and spatial discretization, added source-specific inflows and outflows, simulated additional flow features such as land subsidence and multi-aquifer wellbore flow, and extended the period of simulation through September 1999. The transient-state model was calibrated to historical surface-water and ground-water data for the period 197099 and to historical subsidence for the period 198399. The regional ground-water flow system consists of multiple aquifers that are grouped

Delineating groundwater/surface water interaction in a karst watershed: Lower Flint River Basin, southwestern Georgia, USA

Directory of Open Access Journals (Sweden)

Kathleen Rugel

2016-03-01

Full Text Available Study region: Karst watershed in Lower Flint River Basin (LFRB, southwestern Georgia, USA. Study focus: Baseflow discharges in the LFRB have declined for three decades as regional irrigation has increased; yet, the location and nature of connectivity between groundwater and surface water in this karstic region are poorly understood. Because growing water demands will likely be met by further development of regional aquifers, an important management concern is the nature of interactions between groundwater and surface water components under natural and anthropogenic perturbations. We conducted coarse and fine-scale stream sampling on a major tributary of the Lower Flint River (Ichawaynochaway Creek in southwestern Georgia, USA, to identify locations and patterns of enhanced hydrologic connectivity between this stream and the Upper Floridan Aquifer. New hydrological insights for the region: Prior water resource studies in the LFRB were based on regional modeling that neglected local heterogeneities in groundwater/surface water connectivity. Our results demonstrated groundwater inputs were concentrated around five of fifty sampled reaches, evidenced by increases in multiple groundwater indicators at these sites. These five reaches contributed up to 42% of the groundwater detected along the entire 50-km sampling section, with ∼24% entering through one groundwater-dominated tributary, Chickasawhatchee Creek. Intermittent flows occurred in two of these upstream reaches during extreme drought and heavy groundwater pumping, suggesting reach-scale behaviors should be considered in resource management and policy. Keywords: Karst hydrogeology, Hydrologic connectivity, Groundwater/surface water interaction, Upper Floridan Aquifer, Groundwater Irrigation

Total Nitrogen in Surface Water

Data.gov (United States)

U.S. Environmental Protection Agency — Excess nitrogen in surface water can result in eutrophication. TOTALN is reported in kilograms/hectare/year. More information about these resources, including the...

Total Phosphorus in Surface Water

Data.gov (United States)

U.S. Environmental Protection Agency — Excess phosphorus in surface water can result in eutrophication. TOTALP is reported in kilograms/hectare/year. More information about these resources, including the...

Characteristics of pulse corona discharge over water surface

Science.gov (United States)

Fujii, Tomio; Arao, Yasushi; Rea, Massimo

2008-12-01

Production of ozone and OH radical is required to advance the plasma chemical reactions in the NOx removal processes for combustion gas treatment. The corona discharge to the water surface is expected to induce the good conditions for the proceeding of the NO oxidation and the NO2 dissolution removal into water. In order to get the fundamental data of the corona discharge over the water surface, the positive and negative V-I characteristics and the ozone production were measured with the multi needle and the saw-edge type of the discharge electrodes. The pulse corona characteristics were also measured with some different waveforms of the applied pulse voltage. The experiments were carried out under the atmospheric pressure and room temperature. Both the DC and the pulse corona to the water surface showed a stable and almost the same V-I characteristics as to plate electrodes though the surface of water was waved by corona wind. The positive streamer corona showed more ozone production than the negative one both in the DC and in the pulse corona.

Characteristics of pulse corona discharge over water surface

International Nuclear Information System (INIS)

Fujii, Tomio; Arao, Yasushi; Rea, Massimo

2008-01-01

Production of ozone and OH radical is required to advance the plasma chemical reactions in the NOx removal processes for combustion gas treatment. The corona discharge to the water surface is expected to induce the good conditions for the proceeding of the NO oxidation and the NO 2 dissolution removal into water. In order to get the fundamental data of the corona discharge over the water surface, the positive and negative V-I characteristics and the ozone production were measured with the multi needle and the saw-edge type of the discharge electrodes. The pulse corona characteristics were also measured with some different waveforms of the applied pulse voltage. The experiments were carried out under the atmospheric pressure and room temperature. Both the DC and the pulse corona to the water surface showed a stable and almost the same V-I characteristics as to plate electrodes though the surface of water was waved by corona wind. The positive streamer corona showed more ozone production than the negative one both in the DC and in the pulse corona.

Statistical Methods and Sampling Design for Estimating Step Trends in Surface-Water Quality

Science.gov (United States)

Hirsch, Robert M.

1988-01-01

This paper addresses two components of the problem of estimating the magnitude of step trends in surface water quality. The first is finding a robust estimator appropriate to the data characteristics expected in water-quality time series. The J. L. Hodges-E. L. Lehmann class of estimators is found to be robust in comparison to other nonparametric and moment-based estimators. A seasonal Hodges-Lehmann estimator is developed and shown to have desirable properties. Second, the effectiveness of various sampling strategies is examined using Monte Carlo simulation coupled with application of this estimator. The simulation is based on a large set of total phosphorus data from the Potomac River. To assure that the simulated records have realistic properties, the data are modeled in a multiplicative fashion incorporating flow, hysteresis, seasonal, and noise components. The results demonstrate the importance of balancing the length of the two sampling periods and balancing the number of data values between the two periods.

Effects of seawater components on radiolysis of water at elevated temperature

International Nuclear Information System (INIS)

Wada, Yoichi; Tachibana, Masahiko; Ishida, Kazushige; Ota, Nobuyuki; Shigenaka, Naoto; Inagaki, Hiromitsu; Noda, Hiroshi

2014-01-01

Effects of seawater components on radiolysis of water at elevated temperature have been studied with a radiolysis model in order to evaluate influence on integrity of materials used in an ABWR. In 2011, seawater flowed into a wide part of the nuclear power plant system of the Hamaoka Nuclear Power Station Reactor No. 5 owned by Chubu Electric Power Co., Inc. after condenser tubes broke during the plant shutdown operation. The reactor water temperature was 250°C and its maximum Cl − concentration was ca. 450 ppm when seawater was mixed with reactor water. In order to clarify effects of the sea water components on radiolysis of water at elevated temperature, a radiolysis model calculation was conducted with Hitachi's radiolysis analysis code 'SIMFONY'. For the calculation, the temperature range was set from 50 to 250°C with 50°C increments and the gamma dose rate was set at 60 Gys −1 to see the effect of gamma irradiation from fuels under shutdown conditions. Concentrations of radiolytic species were calculated for 10 5 s. Dilution ratio of seawater was changed to see the effects of concentration of seawater components. Reaction rate constants of the Cl − , Br − , HCO 3 − , and SO 4 2− systems were considered. The main radiolytic species were predicted to be hydrogen and oxygen. Hydrogen peroxide of low concentration was produced in seawater-mixed water at elevated temperatures. Compared with these main products, concentrations of radiolytic products originating from chloride ion and other seawater components were found to be rather low. The dominant product among them was ClO 3 − and its concentration was found to be below 0.01ppm at 10 5 s. Then, during the plant shutdown operation, the harmful influence from radiolytic species originating from seawater components on integrity of fuel materials must be smaller than that of chloride ion which is the main ionic species in seawater. (author)

Thermophoretically driven water droplets on graphene and boron nitride surfaces

Science.gov (United States)

Rajegowda, Rakesh; Kannam, Sridhar Kumar; Hartkamp, Remco; Sathian, Sarith P.

2018-05-01

We investigate thermally driven water droplet transport on graphene and hexagonal boron nitride (h-BN) surfaces using molecular dynamics simulations. The two surfaces considered here have different wettabilities with a significant difference in the mode of droplet transport. The water droplet travels along a straighter path on the h-BN sheet than on graphene. The h-BN surface produced a higher driving force on the droplet than the graphene surface. The water droplet is found to move faster on h-BN surface compared to graphene surface. The instantaneous contact angle was monitored as a measure of droplet deformation during thermal transport. The characteristics of the droplet motion on both surfaces is determined through the moment scaling spectrum. The water droplet on h-BN surface showed the attributes of the super-diffusive process, whereas it was sub-diffusive on the graphene surface.

Radionuclide transfer onto ground surface in surface water flow, 1

International Nuclear Information System (INIS)

Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

1991-07-01

Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

Occurrence of Surface Water Contaminations: An Overview

Science.gov (United States)

Shahabudin, M. M.; Musa, S.

2018-04-01

Water is a part of our life and needed by all organisms. As time goes by, the needs by human increased transforming water quality into bad conditions. Surface water contaminated in various ways which is pointed sources and non-pointed sources. Pointed sources means the source are distinguished from the source such from drains or factory but the non-pointed always occurred in mixed of elements of pollutants. This paper is reviewing the occurrence of the contaminations with effects that occurred around us. Pollutant factors from natural or anthropology factors such nutrients, pathogens, and chemical elements contributed to contaminations. Most of the effects from contaminated surface water contributed to the public health effects also to the environments.

Reducing phosphorus loading of surface water using iron-coated sand

NARCIS (Netherlands)

Groenenberg, J.E.; Chardon, W.J.; Koopmans, G.F.

2013-01-01

Phosphorus losses from agricultural soils is an important source of P in surface waters leading to surface water quality impairment. In addition to reducing P inputs, mitigation measures are needed to reduce P enrichment of surface waters. Because drainage of agricultural land by pipe drainage is an

Distribution of {sup 129}I in terrestrial surface water environments

Energy Technology Data Exchange (ETDEWEB)

Chen, Xuegao [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Gong, Meng [College of Hydrology and Water Resources, Hohai University, Nanjing (China); Yi, Peng, E-mail: pengyi1915@163.com [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Aldahan, Ala [Department of Earth Sciences, Uppsala University, Uppsala (Sweden); Department of Geology, United Arab Emirates University, Al Ain (United Arab Emirates); Yu, Zhongbo [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China); Possnert, Göran [Tandem Laboratory, Uppsala University, Uppsala (Sweden); Chen, Li [State Key Laboratory of Hydrology-Water Resources and Hydraulic Engineering, Hohai University, Nanjing 210098 (China); College of Hydrology and Water Resources, Hohai University, Nanjing (China)

2015-10-15

The global distribution of the radioactive isotope iodine-129 in surface waters (lakes and rivers) is presented here and compared with the atmospheric deposition and distribution in surface marine waters. The results indicate relatively high concentrations in surface water systems in close vicinity of the anthropogenic release sources as well as in parts of Western Europe, North America and Central Asia. {sup 129}I level is generally higher in the terrestrial surface water of the Northern hemisphere compared to the southern hemisphere. The highest values of {sup 129}I appear around 50°N and 40°S in the northern and southern hemisphere, separately. Direct gaseous and marine atmospheric emissions are the most likely avenues for the transport of {sup 129}I from the sources to the terrestrial surface waters. To apply iodine-129 as process tracer in terrestrial surface water environment, more data are needed on {sup 129}I distribution patterns both locally and globally.

Free Surface Water Tunnel (FSWT)

Data.gov (United States)

Federal Laboratory Consortium — Description: The Free Surface Water Tunnel consists of the intake plenum, the test section and the exit plenum. The intake plenum starts with a perforated pipe that...

Impact of Water Recovery from Wastes on the Lunar Surface Mission Water Balance

Science.gov (United States)

Fisher, John W.; Hogan, John Andrew; Wignarajah, Kanapathipi; Pace, Gregory S.

2010-01-01

Future extended lunar surface missions will require extensive recovery of resources to reduce mission costs and enable self-sufficiency. Water is of particular importance due to its potential use for human consumption and hygiene, general cleaning, clothes washing, radiation shielding, cooling for extravehicular activity suits, and oxygen and hydrogen production. Various water sources are inherently present or are generated in lunar surface missions, and subject to recovery. They include: initial water stores, water contained in food, human and other solid wastes, wastewaters and associated brines, ISRU water, and scavenging from residual propellant in landers. This paper presents the results of an analysis of the contribution of water recovery from life support wastes on the overall water balance for lunar surface missions. Water in human wastes, metabolic activity and survival needs are well characterized and dependable figures are available. A detailed life support waste model was developed that summarizes the composition of life support wastes and their water content. Waste processing technologies were reviewed for their potential to recover that water. The recoverable water in waste is a significant contribution to the overall water balance. The value of this contribution is discussed in the context of the other major sources and loses of water. Combined with other analyses these results provide guidance for research and technology development and down-selection.

Instability of confined water films between elastic surfaces

NARCIS (Netherlands)

de Beer, Sissi; 't Mannetje, Dieter; Zantema, Sietske; Mugele, Friedrich

2010-01-01

We investigated the dynamics of nanometer thin water films at controlled ambient humidity adsorbed onto two atomically smooth mica sheets upon rapidly bringing the surfaces into contact. Using a surface forces apparatus (SFA) in imaging mode, we found that the water films break up into a

Modelling raster-based monthly water balance components for Europe

Energy Technology Data Exchange (ETDEWEB)

Ulmen, C.

2000-11-01

The terrestrial runoff component is a comparatively small but sensitive and thus significant quantity in the global energy and water cycle at the interface between landmass and atmosphere. As opposed to soil moisture and evapotranspiration which critically determine water vapour fluxes and thus water and energy transport, it can be measured as an integrated quantity over a large area, i.e. the river basin. This peculiarity makes terrestrial runoff ideally suited for the calibration, verification and validation of general circulation models (GCMs). Gauging stations are not homogeneously distributed in space. Moreover, time series are not necessarily continuously measured nor do they in general have overlapping time periods. To overcome this problems with regard to regular grid spacing used in GCMs, different methods can be applied to transform irregular data to regular so called gridded runoff fields. The present work aims to directly compute the gridded components of the monthly water balance (including gridded runoff fields) for Europe by application of the well-established raster-based macro-scale water balance model WABIMON used at the Federal Institute of Hydrology, Germany. Model calibration and validation is performed by separated examination of 29 representative European catchments. Results indicate a general applicability of the model delivering reliable overall patterns and integrated quantities on a monthly basis. For time steps less then too weeks further research and structural improvements of the model are suggested. (orig.)

Turbulent flow over an interactive alternating land-water surface

Science.gov (United States)

Van Heerwaarden, C.; Mellado, J. P.

2014-12-01

The alternating land-water surface is a challenging surface to represent accurately in weather and climate models, but it is of great importance for the surface energy balance in polar regions. The complexity of this surface lies in the fact that secondary circulations, which form at the boundary of water and land, interact strongly with the surface energy balance. Due to its large heat capacity, the water temperature adapts slowly to the flow, thus the properties of the atmosphere determine the uptake of energy from the water. In order to study this complex system in a simpler way, retaining only the most essential physics, we have simplified the full surface energy balance including radiation. We have derived a boundary condition that mimics the full balance and can be formulated as a so-called Robin boundary condition: a linear combination of Dirichlet (fixed temperature) and Neumann (fixed temperature gradient) ones. By spatially varying the coefficients, we are able to express land and water using this boundary condition. We have done a series of direct numerical simulations in which we generate artificial land-water patterns from noise created from a Gaussian spectrum centered around a dominant wave number. This method creates realistic random patterns, but we are still in control of the length scales. We show that the system can manifest itself in three regimes: micro-, meso- and macro-scale. In the micro-scale, we find perfect mixing of the near-surface atmosphere that results in identical air properties over water and land. In the meso-scale, secondary circulations alter the heat exchange considerably by advecting air between land and water. In addition, they bring the surface temperature of the land closer to that of the air, thereby modulating the energy loss due to outgoing longwave radiation. In the macro-scale regime, the flow over land and water become independent of each other and only the large scale forcings determine the energy balance.

Documentation of the Surface-Water Routing (SWR1) Process for modeling surface-water flow with the U.S. Geological Survey Modular Ground-Water Model (MODFLOW-2005)

Science.gov (United States)

Hughes, Joseph D.; Langevin, Christian D.; Chartier, Kevin L.; White, Jeremy T.

2012-01-01

A flexible Surface-Water Routing (SWR1) Process that solves the continuity equation for one-dimensional and two-dimensional surface-water flow routing has been developed for the U.S. Geological Survey three-dimensional groundwater model, MODFLOW-2005. Simple level- and tilted-pool reservoir routing and a diffusive-wave approximation of the Saint-Venant equations have been implemented. Both methods can be implemented in the same model and the solution method can be simplified to represent constant-stage elements that are functionally equivalent to the standard MODFLOW River or Drain Package boundary conditions. A generic approach has been used to represent surface-water features (reaches) and allows implementation of a variety of geometric forms. One-dimensional geometric forms include rectangular, trapezoidal, and irregular cross section reaches to simulate one-dimensional surface-water features, such as canals and streams. Two-dimensional geometric forms include reaches defined using specified stage-volume-area-perimeter (SVAP) tables and reaches covering entire finite-difference grid cells to simulate two-dimensional surface-water features, such as wetlands and lakes. Specified SVAP tables can be used to represent reaches that are smaller than the finite-difference grid cell (for example, isolated lakes), or reaches that cannot be represented accurately using the defined top of the model. Specified lateral flows (which can represent point and distributed flows) and stage-dependent rainfall and evaporation can be applied to each reach. The SWR1 Process can be used with the MODFLOW Unsaturated Zone Flow (UZF1) Package to permit dynamic simulation of runoff from the land surface to specified reaches. Surface-water/groundwater interactions in the SWR1 Process are mathematically defined to be a function of the difference between simulated stages and groundwater levels, and the specific form of the reach conductance equation used in each reach. Conductance can be

Analysis of factors controlling soil phosphorus loss with surface runoff in Huihe National Nature Reserve by principal component and path analysis methods.

Science.gov (United States)

He, Jing; Su, Derong; Lv, Shihai; Diao, Zhaoyan; Bu, He; Wo, Qiang

2018-01-01

Phosphorus (P) loss with surface runoff accounts for the P input to and acceleration of eutrophication of the freshwater. Many studies have focused on factors affecting P loss with surface runoff from soils, but rarely on the relationship among these factors. In the present study, rainfall simulation on P loss with surface runoff was conducted in Huihe National Nature Reserve, in Hulunbeier grassland, China, and the relationships between P loss with surface runoff, soil properties, and rainfall conditions were examined. Principal component analysis and path analysis were used to analyze the direct and indirect effects on P loss with surface runoff. The results showed that P loss with surface runoff was closely correlated with soil electrical conductivity, soil pH, soil Olsen P, soil total nitrogen (TN), soil total phosphorus (TP), and soil organic carbon (SOC). The main driving factors which influenced P loss with surface runoff were soil TN, soil pH, soil Olsen P, and soil water content. Path analysis and determination coefficient analysis indicated that the standard multiple regression equation for P loss with surface runoff and each main factor was Y = 7.429 - 0.439 soil TN - 6.834 soil pH + 1.721 soil Olsen-P + 0.183 soil water content (r = 0.487, p runoff. The effect of physical and chemical properties of undisturbed soils on P loss with surface runoff was discussed, and the soil water content and soil Olsen P were strongly positive influences on the P loss with surface runoff.

Analysis of Surface Water Pollution in the Kinta River Using Multivariate Technique

International Nuclear Information System (INIS)

Hamza Ahmad Isiyaka; Hafizan Juahir

2015-01-01

This study aims to investigate the spatial variation in the characteristics of water quality monitoring sites, identify the most significant parameters and the major possible sources of pollution, and apportion the source category in the Kinta River. 31 parameters collected from eight monitoring sites for eight years (2006-2013) were employed. The eight monitoring stations were spatially grouped into three independent clusters in a dendrogram. A drastic reduction in the number of monitored parameters from 31 to eight and nine significant parameters (P<0.05) was achieved using the forward stepwise and backward stepwise discriminate analysis (DA). Principal component analysis (PCA) accounted for more than 76 % in the total variance and attributes the source of pollution to anthropogenic and natural processes. The source apportionment using a combined multiple linear regression and principal component scores indicates that 41 % of the total pollution load is from rock weathering and untreated waste water, 26 % from waste discharge, 24 % from surface runoff and 7 % from faecal waste. This study proposes a reduction in the number of monitoring stations and parameters for a cost effective and time management in the monitoring processes and multivariate technique can provide a simple representation of complex and dynamic water quality characteristics. (author)

Wind effect on water surface of water reservoirs

Directory of Open Access Journals (Sweden)

Petr Pelikán

2013-01-01

Full Text Available The primary research of wind-water interactions was focused on coastal areas along the shores of world oceans and seas because a basic understanding of coastal meteorology is an important component in coastal and offshore design and planning. Over time the research showed the most important meteorological consideration relates to the dominant role of winds in wave generation. The rapid growth of building-up of dams in 20th century caused spreading of the water wave mechanics research to the inland water bodies. The attention was paid to the influence of waterwork on its vicinity, wave regime respectively, due to the shoreline deterioration, predominantly caused by wind waves. Consequently the similar principles of water wave mechanics are considered in conditions of water reservoirs. The paper deals with the fundamental factors associated with initial wind-water interactions resulting in the wave origination and growth. The aim of the paper is thepresentation of utilization of piece of knowledge from a part of sea hydrodynamics and new approach in its application in the conditions of inland water bodies with respect to actual state of the art. The authors compared foreign and national approach to the solved problems and worked out graphical interpretation and overview of related wind-water interaction factors.

Modelling surface-water depression storage in a Prairie Pothole Region

Science.gov (United States)

Hay, Lauren E.; Norton, Parker A.; Viger, Roland; Markstrom, Steven; Regan, R. Steven; Vanderhoof, Melanie

2018-01-01

In this study, the Precipitation-Runoff Modelling System (PRMS) was used to simulate changes in surface-water depression storage in the 1,126-km2 Upper Pipestem Creek basin located within the Prairie Pothole Region of North Dakota, USA. The Prairie Pothole Region is characterized by millions of small water bodies (or surface-water depressions) that provide numerous ecosystem services and are considered an important contribution to the hydrologic cycle. The Upper Pipestem PRMS model was extracted from the U.S. Geological Survey's (USGS) National Hydrologic Model (NHM), developed to support consistent hydrologic modelling across the conterminous United States. The Geospatial Fabric database, created for the USGS NHM, contains hydrologic model parameter values derived from datasets that characterize the physical features of the entire conterminous United States for 109,951 hydrologic response units. Each hydrologic response unit in the Geospatial Fabric was parameterized using aggregated surface-water depression area derived from the National Hydrography Dataset Plus, an integrated suite of application-ready geospatial datasets. This paper presents a calibration strategy for the Upper Pipestem PRMS model that uses normalized lake elevation measurements to calibrate the parameters influencing simulated fractional surface-water depression storage. Results indicate that inclusion of measurements that give an indication of the change in surface-water depression storage in the calibration procedure resulted in accurate changes in surface-water depression storage in the water balance. Regionalized parameterization of the USGS NHM will require a proxy for change in surface-storage to accurately parameterize surface-water depression storage within the USGS NHM.

Seasonal lake surface water temperature trends reflected by heterocyst glycolipid-based molecular thermometers

Science.gov (United States)

Bauersachs, T.; Rochelmeier, J.; Schwark, L.

2015-06-01

It has been demonstrated that the relative distribution of heterocyst glycolipids (HGs) in cultures of N2-fixing heterocystous cyanobacteria is largely controlled by growth temperature, suggesting a potential use of these components in paleoenvironmental studies. Here, we investigated the effect of environmental parameters (e.g., surface water temperatures, oxygen concentrations and pH) on the distribution of HGs in a natural system using water column filtrates collected from Lake Schreventeich (Kiel, Germany) from late July to the end of October 2013. HPLC-ESI/MS (high-performance liquid chromatography coupled to electrospray ionization-mass spectrometry) analysis revealed a dominance of 1-(O-hexose)-3,25-hexacosanediols (HG26 diols) and 1-(O-hexose)-3-keto-25-hexacosanol (HG26 keto-ol) in the solvent-extracted water column filtrates, which were accompanied by minor abundances of 1-(O-hexose)-3,27-octacosanediol (HG28 diol) and 1-(O-hexose)-3-keto-27-octacosanol (HG28 keto-ol) as well as 1-(O-hexose)-3,25,27-octacosanetriol (HG28 triol) and 1-(O-hexose)-3-keto-25,27-octacosanediol (HG28 keto-diol). Fractional abundances of alcoholic and ketonic HGs generally showed strong linear correlations with surface water temperatures and no or only weak linear correlations with both oxygen concentrations and pH. Changes in the distribution of the most abundant diol and keto-ol (e.g., HG26 diol and HG26 keto-ol) were quantitatively expressed as the HDI26 (heterocyst diol index of 26 carbon atoms) with values of this index ranging from 0.89 in mid-August to 0.66 in mid-October. An average HDI26 value of 0.79, which translates into a calculated surface water temperature of 15.8 ± 0.3 °C, was obtained from surface sediments collected from Lake Schreventeich. This temperature - and temperatures obtained from other HG indices (e.g., HDI28 and HTI28) - is similar to the one measured during maximum cyanobacterial productivity in early to mid-September and suggests that HGs

Electrodialysis and nanofiltration of surface water for subsequent use as infiltration water.

Science.gov (United States)

Van der Bruggen, B; Milis, R; Vandecasteele, C; Bielen, P; Van San, E; Huysman, K

2003-09-01

In order to achieve stable groundwater levels, an equilibrium between the use of groundwater for drinking water production and natural or artificial groundwater recharge by infiltration is needed. Local governments usually require that the composition of the water used for artificial recharge is similar to the surface water that is naturally present in the specific recharge area. In this paper, electrodialysis (ED) and nanofiltration were evaluated as possible treatment technologies for surface water from a canal in Flanders, the North of Belgium, in view of infiltration at critical places on heathlands. Both methods were evaluated on the basis of a comparison between the water composition after treatment and the composition of local surface waters. The treatment generally consists of a tuning of pH and the removal of contaminants originating from industrial and agricultural activity, e.g., nitrates and pesticides. Further evaluation of the influence of the composition of the water on the characteristics of the artificial recharge, however, was not envisaged. In a case study of water from the canal Schoten-Dessel, satisfactory concentration reductions of Cl(-), SO(4)(2-), NO(3)(-), HCO(3)(-), Na(+), Mg(2+), K(+) and Ca(2+) were obtained by ultrafiltration pretreatment followed by ED. Nanofiltration with UTC-20, N30F, Desal 51 HL, UTC-60 and Desal 5 DL membranes resulted in an insufficient removal level, especially for the monovalent ions.

Water reactivity with mixed oxide (U,Pu)O2 surfaces

International Nuclear Information System (INIS)

Gaillard, Jeremy

2013-01-01

The interaction of water with actinides oxide surfaces remains poorly understood. The adsorption of water on PuO 2 surface and (U,Pu)O 2 surface leads to hydrogen generation through radiolysis but also surface evolution. The study of water interaction with mixed oxide (U,Pu)O 2 and PuO 2 surfaces requires the implementation of non intrusive techniques. The study of the hydration of CeO 2 surface is used to study the effectiveness of different techniques. The results show that the water adsorption leads to the surface evolution through the formation of a hydroxide superficial layer. The reactivity of water on the surface depends on the calcination temperature of the oxide precursor. The thermal treatment of hydrated surfaces can regenerate the surface. The study on CeO 2 hydration emphasizes the relevancies of these techniques in studying the hydration of surfaces. The hydrogen generation through water radiolysis is studied with an experimental methodology based on constant relative humidity in the radiolysis cell. The hydrogen accumulation is linear for the first hours and then tends to a steady state content. A mechanism of hydrogen consumption is proposed to explain the existence of the steady state of hydrogen content. This mechanism enables to explain also the evolution of the oxide surface during hydrogen generation experiments as shown by the evolution of hydrogen accumulation kinetics. The accumulation kinetics depends on the dose rate, specific surface area and the relative humidity but also on the oxide aging. The plutonium percentage appears to be a crucial parameter in hydrogen accumulation kinetics. (author) [fr

Coastal surface water suitability analysis for irrigation in Bangladesh

Science.gov (United States)

Mahtab, Mohammad Hossain; Zahid, Anwar

2018-03-01

Water with adequate quality and quantity is very important for irrigation to ensure the crop yields. Salinity is common problem in the coastal waters in Bangladesh. The intensity of salinity in the coastal zone in Bangladesh is not same. It fluctuates over the year. Sodium is another hazard which may hamper permeability and ultimately affects the fertility. It can reduce the crop yields. Although surface water is available in the coastal zone of Bangladesh, but its quality for irrigation needs to be monitored over the year. This paper will investigate the overall quality of coastal surface waters. Thirty-three water samples from different rivers were collected both in wet period (October-December) and in dry period (February-April). Different physical and chemical parameters are considered for investigation of the adequacy of water with respect to international irrigation water quality standards and Bangladesh standards. A comparison between the dry and wet period coastal surface water quality in Bangladesh will also be drawn here. The analysis shows that coastal surface water in Bangladesh is overall suitable for irrigation during wet period, while it needs treatment (which will increase the irrigation cost) for using for irrigation during dry period. Adaptation to this situation can improve the scenario. An integrated plan should be taken to increase the water storing capacity in the coastal area to harvest water during wet period.

Surface Water Protection by Productive Buffers

DEFF Research Database (Denmark)

Christen, Benjamin

Vegetated riparian buffer zones are a widely recommended best management practice in agriculture for protecting surface and coastal waters from diffuse nutrient pollution. On the background of the EU funded research project NitroEurope (NEU; www.NitroEurope.eu), this study concentrates...... on the mitigation of nitrogen pollution in surface and groundwater, using riparian buffer zones for biomass production. The objectives are to map suitable areas for buffer implementation across the six NEU study landscapes, model tentative N-loss mitigation, calculate biomass production potential and economic...... designed for local conditions could be a way of protecting water quality attractive to many stakeholders....

Foulant characteristics comparison in recycling cooling water system makeup by municipal reclaimed water and surface water in power plant.

Science.gov (United States)

Ping, Xu; Jing, Wang; Yajun, Zhang; Jie, Wang; Shuai, Si

2015-01-01

Due to water shortage, municipal reclaimed water rather than surface water was replenished into recycling cooling water system in power plants in some cities in China. In order to understand the effects of the measure on carbon steel corrosion, characteristics of two kinds of foulant produced in different systems were studied in the paper. Differences between municipal reclaimed water and surface water were analyzed firstly. Then, the weight and the morphology of two kinds of foulant were compared. Moreover, other characteristics including the total number of bacteria, sulfate reducing bacteria, iron bacteria, extracellular polymeric substance (EPS), protein (PN), and polysaccharide (PS) in foulant were analyzed. Based on results, it could be concluded that microbial and corrosive risk would be increased when the system replenished by municipal reclaimed water instead of surface water.

How well Can We Classify SWOT-derived Water Surface Profiles?

Science.gov (United States)

Frasson, R. P. M.; Wei, R.; Picamilh, C.; Durand, M. T.

2015-12-01

The upcoming Surface Water Ocean Topography (SWOT) mission will detect water bodies and measure water surface elevation throughout the globe. Within its continental high resolution mask, SWOT is expected to deliver measurements of river width, water elevation and slope of rivers wider than ~50 m. The definition of river reaches is an integral step of the computation of discharge based on SWOT's observables. As poorly defined reaches can negatively affect the accuracy of discharge estimations, we seek strategies to break up rivers into physically meaningful sections. In the present work, we investigate how accurately we can classify water surface profiles based on simulated SWOT observations. We assume that most river sections can be classified as either M1 (mild slope, with depth larger than the normal depth), or A1 (adverse slope with depth larger than the critical depth). This assumption allows the classification to be based solely on the second derivative of water surface profiles, with convex profiles being classified as A1 and concave profiles as M1. We consider a HEC-RAS model of the Sacramento River as a representation of the true state of the river. We employ the SWOT instrument simulator to generate a synthetic pass of the river, which includes our best estimates of height measurement noise and geolocation errors. We process the resulting point cloud of water surface heights with the RiverObs package, which delineates the river center line and draws the water surface profile. Next, we identify inflection points in the water surface profile and classify the sections between the inflection points. Finally, we compare our limited classification of simulated SWOT-derived water surface profile to the "exact" classification of the modeled Sacramento River. With this exercise, we expect to determine if SWOT observations can be used to find inflection points in water surface profiles, which would bring knowledge of flow regimes into the definition of river reaches.

Aging management of major light water reactor components

International Nuclear Information System (INIS)

Shah, V.N.; Sinha, U.P.; Ware, A.G.

1992-01-01

Review of technical literature and field experience has identified stress corrosion cracking as one of the major degradation mechanisms for the major light water reactor components. Three of the stress corrosion cracking mechanisms of current concern are (a) primary water stress corrosion cracking (PWSCC) in pressurized water reactors, and (b) intergranular stress corrosion cracking (IGSCC) and (c) irradiation-assisted stress corrosion cracking (IASCC) in boiling water reactors. Effective aging management of stress corrosion cracking mechanisms includes evaluation of interactions between design, materials, stressors, and environment; identification and ranking of susceptible sites; reliable inspection of any damage; assessment of damage rate; mitigation of damage; and repair and replacement using corrosion-resistant materials. Management of PWSCC includes use of lower operating temperatures, reduction in residual tensile stresses, development of reliable inspection techniques, and use of Alloy 690 as replacement material. Management of IGSCC of nozzle and attachment welds includes use of Alloy 82 as weld material, and potential use of hydrogen water chemistry. Management of IASCC also includes potential use of hydrogen water chemistry

Effective use of surface-water management to control saltwater intrusion

Science.gov (United States)

Hughes, J. D.; White, J.

2012-12-01

The Biscayne aquifer in southeast Florida is susceptible to saltwater intrusion and inundation from rising sea-level as a result of high groundwater withdrawal rates and low topographic relief. Groundwater levels in the Biscayne aquifer are managed by an extensive canal system that is designed to control flooding, supply recharge to municipal well fields, and control saltwater intrusion. We present results from an integrated surface-water/groundwater model of a portion of the Biscayne aquifer to evaluate the ability of the existing managed surface-water control network to control saltwater intrusion. Surface-water stage and flow are simulated using a hydrodynamic model that solves the diffusive-wave approximation of the depth-integrated shallow surface-water equations. Variable-density groundwater flow and fluid density are solved using the Oberbeck--Boussinesq approximation of the three-dimensional variable-density groundwater flow equation and a sharp interface approximation, respectively. The surface-water and variable-density groundwater domains are implicitly coupled during each Picard iteration. The Biscayne aquifer is discretized into a multi-layer model having a 500-m square horizontal grid spacing. All primary and secondary surface-water features in the active model domain are discretized into segments using the 500-m square horizontal grid. A 15-year period of time is simulated and the model includes 66 operable surface-water control structures, 127 municipal production wells, and spatially-distributed daily internal and external hydrologic stresses. Numerical results indicate that the existing surface-water system can be effectively used in many locations to control saltwater intrusion in the Biscayne aquifer resulting from increases in groundwater withdrawals or sea-level rise expected to occur over the next 25 years. In other locations, numerical results indicate surface-water control structures and/or operations may need to be modified to control

Identifying apple surface defects using principal components analysis and artifical neural networks

Science.gov (United States)

Artificial neural networks and principal components were used to detect surface defects on apples in near-infrared images. Neural networks were trained and tested on sets of principal components derived from columns of pixels from images of apples acquired at two wavelengths (740 nm and 950 nm). I...

Escherichia coli in the surface waters and in oysters of two cultivations of Guaratuba Bay - Paraná - Brazil

Directory of Open Access Journals (Sweden)

Helenita Catharina Dalla-Lana Forcelini

2013-04-01

Full Text Available The present work aimed to evaluate the contamination of Escherichia coli in the surface waters and oysters from two cultivations of Guaratuba Bay and to analyze the correlation patterns among the concentrations of E. coli in the waters and in the oysters with the local physical-chemical parameters. Samples were collected in the spring of 2007 and summer, autumn and winter of 2008 from two points of the bay (internal point and external point. From each cultivation and sampling period, 18 oysters were collected. The samples of surface water were collected for the measurement of physical-chemical parameters (pH, salinity, temperature, dissolved oxygen, seston, particulate organic matter and quantification of E. coli. The surface water analyzed in the summer presented the largest most probable number of E. coli, (1,659.22 MPN.100 ml-1 and 958,55 MPN.100 ml-1 at external and internal points, respectively. The oysters from the internal point presented more E. coli, except in the winter sampling. The largest contamination was observed in the spring, at the internal point (979,78 MPN.g-1. The Principal Components Analysis showed direct correlation among the amount of E. coli in the oysters and in the surface water.

A study of water hammer phenomena in a one-component two-phase bubbly flow

International Nuclear Information System (INIS)

Fujii, Terushige; Akagawa, Koji

2000-01-01

Water hammer phenomena caused by a rapid valve closure, that is, shock phenomena in two-phase flows, are an important problem for the safety assessment of a hypothetical LOCA. This paper presents the results of experimental and analytical studies of the water hammer phenomena in a one-component tow-phase bubbly flow. In order to clarify the characteristics of water hammer phenomena, experiments for a one-component two-phase flow of Freon R-113 were conducted and a numerical simulation of pressure transients was developed. An overall picture of the water hammer phenomena in a one-component two-phase flow is presented an discussed. (author)

NEXAFS characterization of DNA components and molecular-orientation of surface-bound DNA oligomers

International Nuclear Information System (INIS)

Samuel, Newton T.; Lee, C.-Y.; Gamble, Lara J.; Fischer, Daniel A.; Castner, David G.

2006-01-01

Single stranded DNA oligomers (ssDNA) immobilized onto solid surfaces forms the basis for several biotechnological applications such as DNA microarrays, affinity separations, and biosensors. Surface structure of Surface-bound oligomers is expected to significantly influence their biological activity and interactions with the environment. In this study near-edge X-ray absorption fine structure spectroscopy (NEXAFS) is used to characterize the components of DNA (nucleobases, nucleotides and nucleosides) and the orientation information of surface-bound ssDNA. The K-edges of carbon, nitrogen and oxygen have spectra with features that are characteristic of the different chemical species present in the nucleobases of DNA. The effect of addition of the DNA sugar and phosphate components on the NEXAFS K-edge spectra was also investigated. The polarization-dependent nitrogen K-edge NEXAFS data show significant changes for different orientations of surface bound ssDNA. These results establish NEXAFS as a powerful technique for chemical and structural characterization of surface-bound DNA oligomers

Water Adsorption on Clean and Defective Anatase TiO2 (001) Nanotube Surfaces: A Surface Science Approach.

Science.gov (United States)

Kenmoe, Stephane; Lisovski, Oleg; Piskunov, Sergei; Bocharov, Dmitry; Zhukovskii, Yuri F; Spohr, Eckhard

2018-04-11

We use ab initio molecular dynamics simulations to study the adsorption of thin water films with 1 and 2 ML coverage on anatase TiO 2 (001) nanotubes. The nanotubes are modeled as 2D slabs, which consist of partially constrained and partially relaxed structural motifs from nanotubes. The effect of anion doping on the adsorption is investigated by substituting O atoms with N and S impurities on the nanotube slab surface. Due to strain-induced curvature effects, water adsorbs molecularly on defect-free surfaces via weak bonds on Ti sites and H bonds to surface oxygens. While the introduction of an S atom weakens the interaction of the surface with water, which adsorbs molecularly, the presence of an N impurity renders the surface more reactive to water, with a proton transfer from the water film and the formation of an NH group at the N site. At 2 ML coverage, a further surface-assisted proton transfer takes place in the water film, resulting in the formation of an OH - group and an NH 2 + cationic site on the surface.

Vertical components of surface vibrations induced by mining tremors in the Upper Silesian Coalfield, Poland

International Nuclear Information System (INIS)

Maciag, E.; Kowalski, W.

1997-01-01

Characteristics of vertical components of surface vibration is epicentral zones due to mining tremors in the Upper Silesian Coalfield (USC) are analysed. Both maximum acceleration amplitudes and dominant frequencies of vertical (Z) and horizontal (N-S and E-W) components of vibrations are compared. The role played by the vertical components of vibrations in estimates of hazard for surface structures excited by mining tremors is discussed. 8 refs., 7 figs

Natural uranium and strontium isotope tracers of water sources and surface water-groundwater interactions in arid wetlands: Pahranagat Valley, Nevada, USA

Science.gov (United States)

Paces, James B.; Wurster, Frederic C.

2014-01-01

Near-surface physical and chemical process can strongly affect dissolved-ion concentrations and stable isotope compositions of water in wetland settings, especially under arid climate conditions. In contrast, heavy radiogenic isotopes of strontium (87Sr/86Sr) and uranium (234U/238U) remain largely unaffected and can be used to help identify unique signatures from different sources and quantify end-member mixing that would otherwise be difficult to determine. The utility of combined Sr and U isotopes are demonstrated in this study of wetland habitats on the Pahranagat National Wildlife Refuge, which depend on supply from large-volume springs north of the Refuge, and from small-volume springs and seeps within the Refuge. Water budgets from these sources have not been quantified previously. Evaporation, transpiration, seasonally variable surface flow, and water management practices complicate the use of conventional methods for determining source contributions and mixing relations. In contrast, 87Sr/86Sr and 234U/238U remain unfractionated under these conditions, and compositions at a given site remain constant. Differences in Sr- and U-isotopic signatures between individual sites can be related by simple two- or three-component mixing models. Results indicate that surface flow constituting the Refuge’s irrigation source consists of a 65:25:10 mixture of water from two distinct regionally sourced carbonate aquifer springs, and groundwater from locally sourced volcanic aquifers. Within the Refuge, contributions from the irrigation source and local groundwater are readily determined and depend on proximity to those sources as well as water management practices.

An analytical solution to calculate bulk mole fractions for any number of components in aerosol droplets after considering partitioning to a surface layer

Directory of Open Access Journals (Sweden)

D. Topping

2010-11-01

Full Text Available Calculating the equilibrium composition of atmospheric aerosol particles, using all variations of Köhler theory, has largely assumed that the total solute concentrations define both the water activity and surface tension. Recently however, bulk to surface phase partitioning has been postulated as a process which significantly alters the predicted point of activation. In this paper, an analytical solution to calculate the removal of material from a bulk to a surface layer in aerosol particles has been derived using a well established and validated surface tension framework. The applicability to an unlimited number of components is possible via reliance on data from each binary system. Whilst assumptions regarding behaviour at the surface layer have been made to facilitate derivation, it is proposed that the framework presented can capture the overall impact of bulk-surface partitioning. Demonstrations of the equations for two and five component mixtures are given while comparisons are made with more detailed frameworks capable at modelling ternary systems at higher levels of complexity. Predictions made by the model across a range of surface active properties should be tested against measurements. Indeed, reccomendations are given for experimental validation and to assess sensitivities to accuracy and required level of complexity within large scale frameworks. Importantly, the computational efficiency of using the solution presented in this paper is roughly a factor of 20 less than a similar iterative approach, a comparison with highly coupled approaches not available beyond a 3 component system.

Groundwater and surface water pollution

Energy Technology Data Exchange (ETDEWEB)

Chae, Y.S.; Hamidi, A. [eds.

2000-07-01

This book contains almost all the technical know-how that is required to clean up the water supply. It provides a survey of up-to-date technologies for remediation, as well as a step-by-step guide to pollution assessment for both ground and surface waters. In addition to focusing on causes, effects, and remedies, the book stresses reuse, recycling, and recovery of resources. The authors suggest that through total recycling wastes can become resources.

Characterisation of the inorganic chemistry of surface waters in ...

African Journals Online (AJOL)

The main purpose of this study was to determine a simple inorganic chemistry index that can be used for all surface waters in South Africa, in order to characterise the inorganic chemistry of surface waters. Water quality data collected up until 1999 from all sample monitoring stations (2 068 monitoring stations, 364 659 ...

The geographic distribution of strontium isotopes in Danish surface waters - A base for provenance studies in archaeology, hydrology and agriculture

Energy Technology Data Exchange (ETDEWEB)

Frei, Karin M., E-mail: kmfrei@hum.ku.dk [Danish National Research Foundation Centre for Textile Research, SAXO Institute, University of Copenhagen, Njalsgade 80, DK-2300 Copenhagen (Denmark); Frei, Robert [Institute of Geography and Geology and Nordic Center for Earth Evolution (NordCEE), University of Copenhagen, Oster Voldgade 10, DK-1350 Copenhagen (Denmark)

2011-03-15

Research highlights: {yields} Strontium isotope data of 192 surface waters from Denmark. {yields} Geographic baseline distribution of bio-available fractions. {yields} Applicable for provenance studies within archaeology, geology, agriculture and hydrology. {yields} Proposal of a band of strontium isotope values to characterize 'local' Danish signatures. - Abstract: In this paper Sr isotope signatures are reported for 192 surface water (lakes/ponds and rivers/creeks) samples from within Denmark and an isotope distribution map is presented that may serve as a base for provenance applications, including archaeological migration studies, ground water - surface water - seawater interaction/contamination monitoring, and potentially for agricultural applications, including cases of authenticity proof for particular food products. The Sr isotopic compositions of surface waters range from {sup 87}Sr/{sup 86}Sr = 0.7078 to 0.7125 (average 0.7096 {+-} 0.0016; 2{sigma}). This average value lies above the range of {sup 87}Sr/{sup 86}Sr values between 0.7078 and 0.7082 expected from Late Cretaceous to Early Tertiary (Oligocene) limestones which form the dominant bedrock type in a NW-SE trending belt in Denmark. The elevated {sup 87}Sr/{sup 86}Sr signatures >{approx}0.7095 are explained by additions to the surface waters of radiogenic Sr predominantly derived from the near-surface weathering and wash-out of Quarternary glaciogenic tills and soils deposited and formed during and after the last two ice age stages (Saale and Weichsel). The Sr isotopic compositions and concentrations of the surface waters can, therefore, best be modeled by a two-component mixing involving carbonaceous bedrock and glaciogenic cover sediments as the two predominant Sr sources. A feasibility study for using Sr isotopic compositions of surface waters as a proxy for bio-available Sr signatures was conducted in a representative test area on Zealand (Land of Legends, Lejre) where there is no use

The geographic distribution of strontium isotopes in Danish surface waters - A base for provenance studies in archaeology, hydrology and agriculture

International Nuclear Information System (INIS)

Frei, Karin M.; Frei, Robert

2011-01-01

Research highlights: → Strontium isotope data of 192 surface waters from Denmark. → Geographic baseline distribution of bio-available fractions. → Applicable for provenance studies within archaeology, geology, agriculture and hydrology. → Proposal of a band of strontium isotope values to characterize 'local' Danish signatures. - Abstract: In this paper Sr isotope signatures are reported for 192 surface water (lakes/ponds and rivers/creeks) samples from within Denmark and an isotope distribution map is presented that may serve as a base for provenance applications, including archaeological migration studies, ground water - surface water - seawater interaction/contamination monitoring, and potentially for agricultural applications, including cases of authenticity proof for particular food products. The Sr isotopic compositions of surface waters range from 87 Sr/ 86 Sr = 0.7078 to 0.7125 (average 0.7096 ± 0.0016; 2σ). This average value lies above the range of 87 Sr/ 86 Sr values between 0.7078 and 0.7082 expected from Late Cretaceous to Early Tertiary (Oligocene) limestones which form the dominant bedrock type in a NW-SE trending belt in Denmark. The elevated 87 Sr/ 86 Sr signatures >∼0.7095 are explained by additions to the surface waters of radiogenic Sr predominantly derived from the near-surface weathering and wash-out of Quarternary glaciogenic tills and soils deposited and formed during and after the last two ice age stages (Saale and Weichsel). The Sr isotopic compositions and concentrations of the surface waters can, therefore, best be modeled by a two-component mixing involving carbonaceous bedrock and glaciogenic cover sediments as the two predominant Sr sources. A feasibility study for using Sr isotopic compositions of surface waters as a proxy for bio-available Sr signatures was conducted in a representative test area on Zealand (Land of Legends, Lejre) where there is no use and application of commercial fertilizers. It is demonstrated that

Eco-hydrological process simulations within an integrated surface water-groundwater model

DEFF Research Database (Denmark)

Butts, Michael; Loinaz, Maria Christina; Bauer-Gottwein, Peter

2014-01-01

Integrated water resources management requires tools that can quantify changes in groundwater, surface water, water quality and ecosystem health, as a result of changes in catchment management. To address these requirements we have developed an integrated eco-hydrological modelling framework...... that allows hydrologists and ecologists to represent the complex and dynamic interactions occurring between surface water, ground water, water quality and freshwater ecosystems within a catchment. We demonstrate here the practical application of this tool to two case studies where the interaction of surface...... water and ground water are important for the ecosystem. In the first, simulations are performed to understand the importance of surface water-groundwater interactions for a restored riparian wetland on the Odense River in Denmark as part of a larger investigation of water quality and nitrate retention...

Surface erosion of fusion reactor components due to radiation blistering and neutron sputtering

International Nuclear Information System (INIS)

Das, S.K.; Kaminsky, M.

1975-01-01

Radiation blistering and neutron sputtering can lead to the surface erosion of fusion reactor components exposed to plasma radiations. Recent studies of methods to reduce the surface erosion caused by these processes are discussed

A robust Multi-Band Water Index (MBWI) for automated extraction of surface water from Landsat 8 OLI imagery

Science.gov (United States)

Wang, Xiaobiao; Xie, Shunping; Zhang, Xueliang; Chen, Cheng; Guo, Hao; Du, Jinkang; Duan, Zheng

2018-06-01

Surface water is vital resources for terrestrial life, while the rapid development of urbanization results in diverse changes in sizes, amounts, and quality of surface water. To accurately extract surface water from remote sensing imagery is very important for water environment conservations and water resource management. In this study, a new Multi-Band Water Index (MBWI) for Landsat 8 Operational Land Imager (OLI) images is proposed by maximizing the spectral difference between water and non-water surfaces using pure pixels. Based on the MBWI map, the K-means cluster method is applied to automatically extract surface water. The performance of MBWI is validated and compared with six widely used water indices in 29 sites of China. Results show that our proposed MBWI performs best with the highest accuracy in 26 out of the 29 test sites. Compared with other water indices, the MBWI results in lower mean water total errors by a range of 9.31%-25.99%, and higher mean overall accuracies and kappa coefficients by 0.87%-3.73% and 0.06-0.18, respectively. It is also demonstrated for MBWI in terms of robustly discriminating surface water from confused backgrounds that are usually sources of surface water extraction errors, e.g., mountainous shadows and dark built-up areas. In addition, the new index is validated to be able to mitigate the seasonal and daily influences resulting from the variations of the solar condition. MBWI holds the potential to be a useful surface water extraction technology for water resource studies and applications.

WATER SURFACE RECONSTRUCTION IN AIRBORNE LASER BATHYMETRY FROM REDUNDANT BED OBSERVATIONS

Directory of Open Access Journals (Sweden)

G. Mandlburger

2017-09-01

Full Text Available In airborne laser bathymetry knowledge of exact water level heights is a precondition for applying run-time and refraction correction of the raw laser beam travel path in the medium water. However, due to specular reflection especially at very smooth water surfaces often no echoes from the water surface itself are recorded (drop outs. In this paper, we first discuss the feasibility of reconstructing the water surface from redundant observations of the water bottom in theory. Furthermore, we provide a first practical approach for solving this problem, suitable for static and locally planar water surfaces. It minimizes the bottom surface deviations of point clouds from individual flight strips after refraction correction. Both theoretical estimations and practical results confirm the potential of the presented method to reconstruct water level heights in dm precision. Achieving good results requires enough morphological details in the scene and that the water bottom topography is captured from different directions.

Water chemistry and corrosion control of cladding and primary circuit components. Proceedings of a technical committee meeting

International Nuclear Information System (INIS)

1999-12-01

Corrosion is the principal life limiting degradation mechanism in nuclear steam supply systems, especially taking into account the trends to increase fuel burnup, thermal rate and cycle length. Primary circuit components of water cooled power reactors have an impact on Zr-based alloys behaviour due to crud (primary circuit corrosion products) formation, transport and deposition on heat transfer surfaces. Crud deposits influence water chemistry, radiation and thermal hydraulic conditions near cladding surface, and by this way-Zr-based alloy corrosion. During the last decade, significant improvements were achieved in the reduction of the corrosion and dose rates by changing the cladding material for one more resistant to corrosion or by the improvement of water chemistry conditions. However, taking into account the above mentioned tendency for heavier fuel duties, corrosion and water chemistry, control will remain a serious task to work with for nuclear power plant operators and scientists, as well as development of generally accepted corrosion model of Zr-based alloys in a water environment in a new millennium. Upon the recommendation of the International Working Group on Water Reactor Fuel Performance and Technology, water chemistry and corrosion of cladding and primary circuit components are in the focus of the IAEA activities in the area of fuel technology and performance. At present the IAEA performs two co-ordinated research projects (CRPs): on On-line High Temperature Monitoring of Water Chemistry and Corrosion (WACOL) and on Activity Transport in Primary Circuits. Two CRPs deal with hydrogen and hydride degradation of the Zr-based alloys. A state-of-the-art review entitled: 'Waterside Corrosion of Zirconium Alloys in Nuclear Power Plants' was published in 1998. Technical Committee meetings on the subject were held in 1985 (Cadarache, France), 1989 (Portland, USA), 1993 (Rez, Czech Republic). During the last few years extensive exchange of experience in

The study of dynamic force acted on water strider leg departing from water surface

Science.gov (United States)

Sun, Peiyuan; Zhao, Meirong; Jiang, Jile; Zheng, Yelong

2018-01-01

Water-walking insects such as water striders can skate on the water surface easily with the help of the hierarchical structure on legs. Numerous theoretical and experimental studies show that the hierarchical structure would help water strider in quasi-static case such as load-bearing capacity. However, the advantage of the hierarchical structure in the dynamic stage has not been reported yet. In this paper, the function of super hydrophobicity and the hierarchical structure was investigated by measuring the adhesion force of legs departing from the water surface at different lifting speed by a dynamic force sensor. The results show that the adhesion force decreased with the increase of lifting speed from 0.02 m/s to 0.4 m/s, whose mechanic is investigated by Energy analysis. In addition, it can be found that the needle shape setae on water strider leg can help them depart from water surface easily. Thus, it can serve as a starting point to understand how the hierarchical structure on the legs help water-walking insects to jump upward rapidly to avoid preying by other insects.

Early micromovement of the Articular Surface Replacement (ASR) femoral component

DEFF Research Database (Denmark)

Penny, J O; Ding, M; Varmarken, J E

2012-01-01

Radiostereometric analysis (RSA) can detect early micromovement in unstable implant designs which are likely subsequently to have a high failure rate. In 2010, the Articular Surface Replacement (ASR) was withdrawn because of a high failure rate. In 19 ASR femoral components, the mean micromovement...

Ultrasonic detection technology based on joint robot on composite component with complex surface

Energy Technology Data Exchange (ETDEWEB)

Hao, Juan; Xu, Chunguang; Zhang, Lan [School of Mechanical Engineering, Beijing Institute of Technology, Beijing (China)

2014-02-18

Some components have complex surface, such as the airplane wing and the shell of a pressure vessel etc. The quality of these components determines the reliability and safety of related equipment. Ultrasonic nondestructive detection is one of the main methods used for testing material defects at present. In order to improve the testing precision, the acoustic axis of the ultrasonic transducer should be consistent with the normal direction of the measured points. When we use joint robots, automatic ultrasonic scan along the component surface normal direction can be realized by motion trajectory planning and coordinate transformation etc. In order to express the defects accurately and truly, the robot position and the signal of the ultrasonic transducer should be synchronized.

Water Transport and Removal in PEMFC Gas Flow Channel with Various Water Droplet Locations and Channel Surface Wettability

Directory of Open Access Journals (Sweden)

Yanzhou Qin

2018-04-01

Full Text Available Water transport and removal in the proton exchange membrane fuel cell (PEMFC is critically important to fuel cell performance, stability, and durability. Water emerging locations on the membrane-electrode assembly (MEA surface and the channel surface wettability significantly influence the water transport and removal in PEMFC. In most simulations of water transport and removal in the PEMFC flow channel, liquid water is usually introduced at the center of the MEA surface, which is fortuitous, since water droplet can emerge randomly on the MEA surface in PEMFC. In addition, the commonly used no-slip wall boundary condition greatly confines the water sliding features on hydrophobic MEA/channel surfaces, degrading the simulation accuracy. In this study, water droplet is introduced with various locations along the channel width direction on the MEA surface, and water transport and removal is investigated numerically using an improved model incorporating the sliding flow property by using the shear wall boundary condition. It is found that the water droplet can be driven to the channel sidewall by aerodynamics when the initial water location deviates from the MEA center to a certain amount, forming the water corner flow in the flow channel. The channel surface wettability on the water transport is also studied and is shown to have a significant impact on the water corner flow in the flow channel.

Basin scale management of surface and ground water

International Nuclear Information System (INIS)

Tracy, J.C.; Al-Sharif, M.

1993-01-01

An important element in the economic development of many regions of the Great Plains is the availability of a reliable water supply. Due to the highly variable nature of the climate through out much of the Great Plains region, non-controlled stream flow rates tend to be highly variable from year to year. Thus, the primary water supply has tended towards developing ground water aquifers. However, in regions where shallow ground water is extracted for use, there exists the potential for over drafting aquifers to the point of depleting hydraulically connected stream flows, which could adversely affect the water supply of downstream users. To prevent the potential conflict that can arise when a basin's water supply is being developed or to control the water extractions within a developed basin requires the ability to predict the effect that water extractions in one region will have on water extractions from either surface or ground water supplies else where in the basin. This requires the ability to simulate ground water levels and stream flows on a basin scale as affected by changes in water use, land use practices and climatic changes within the basin. The outline for such a basin scale surface water-ground water model has been presented in Tracy (1991) and Tracy and Koelliker (1992), and the outline for the mathematical programming statement to aid in determining the optimal allocation of water on a basin scale has been presented in Tracy and Al-Sharif (1992). This previous work has been combined into a computer based model with graphical output referred to as the LINOSA model and was developed as a decision support system for basin managers. This paper will present the application of the LINOSA surface-ground water management model to the Rattlesnake watershed basin that resides within Ground Water Management District Number 5 in south central Kansas

Water use and quality of fresh surface-water resources in the Barataria-Terrebonne Basins, Louisiana

Science.gov (United States)

Johnson-Thibaut, Penny M.; Demcheck, Dennis K.; Swarzenski, Christopher M.; Ensminger, Paul A.

1998-01-01

Approximately 170 Mgal/d (million gallons per day) of ground- and surface-water was withdrawn from the Barataria-Terrebonne Basins in 1995. Of this amount, surface water accounted for 64 percent ( 110 MgaVd) of the total withdrawal rates in the basins. The largest surface-water withdrawal rates were from Bayou Lafourche ( 40 Mgal/d), Bayou Boeuf ( 14 MgaVd), and the Gulf Intracoastal Waterway (4.2 Mgal/d). The largest ground-water withdrawal rates were from the Mississippi River alluvial aquifer (29 Mgal/d), the Gonzales-New Orleans aquifer (9.5 Mgal/d), and the Norco aquifer (3.6 MgaVd). The amounts of water withdrawn in the basins in 1995 differed by category of use. Public water suppliers within the basins withdrew 41 Mgal/d of water. The five largest public water suppliers in the basins withdrew 30 Mgal/d of surface water: Terrebonne Waterworks District 1 withdrew the largest amount, almost 15 MgaVd. Industrial facilities withdrew 88 Mgal/d, fossil-fuel plants withdrew 4.7 MgaVd, and commercial facilities withdrew 0.67 MgaVd. Aggregate water-withdrawal rates, compiled by parish for aquaculture (37 Mgal/d), livestock (0.56 Mgal/d), rural domestic (0.44 MgaVd), and irrigation uses (0.54 MgaVd), totaled about 38 MgaVd in the basins. Ninety-five percent of aquaculture withdrawal rates, primarily for crawfish and alligator farming, were from surface-water sources. >br> Total water-withdrawal rates increased 221 percent from 1960–95. Surface-water withdrawal rates have increased by 310 percent, and ground-water withdrawal rates have increased by 133 percent. The projection for the total water-withdrawal rates in 2020 is 220 MgaVd, an increase of 30 percent from 1995. Surface-water withdrawal rates would account for 59 percent of the total, or 130 Mgal/d. Surface-water withdrawal rates are projected to increase by 20 percent from 1995 to 2020. Analysis of water-quality data from the Mississippi River indicates that the main threats to surface water resources are

Environmental protection management by monitoring the surface water quality in Semenic area

Directory of Open Access Journals (Sweden)

Dana SÂMBOTIN

2011-08-01

Full Text Available Environment seems to have been the war against all. In fact recently most people polluted the environment and those few are cared for his cleaning. Today, the relationship evolvedas societies have changed in favour of ensuring environmental protection. With modern technology, performance, monitoring the environment becomes part of human activity ever more necessary, more possible and more efficient. The quality of the environment, its components: air, water, soil, plants, vegetable and animal products, is a condition "sine qua non" for the life of the modern man. The consequences of environmental pollution areso dangerous that modern man cannot afford considering them. Through this paper I will study the environmental quality by monitoring the surfaces waters from the Semenic- Gărâna area.

Liquid Water may Stick on Hydrophobic Surfaces

Indian Academy of Sciences (India)

IAS Admin

Common Perception. A surface can be classified as. > Wetting. > Non-wetting. Depending on the spreading characteristics of a droplet of water that splashes on the surface. The behavior of fluid on a solid surface under static and dynamic ..... color of the number density profile. Ions at the interface tend to form pinning zones ...

Studies Concerning Water-Surface Deposits in Recovery Boilers

Energy Technology Data Exchange (ETDEWEB)

Strandberg, O; Arvesen, J; Dahl, L

1971-11-15

The Feed-water Committee of the Stiftelsen Svensk Cellulosaforskning (Foundation for Swedish Cellulose Research) has initiated research and investigations which aim to increase knowledge about water-surface deposits in boiler tubes, and the resulting risks of gas-surface corrosion in chemical recovery boilers (sulphate pulp industry). The Committee has arranged with AB Atomenergi, Studsvik, for investigations into the water-surface deposits on tubes from six Scandinavian boilers. These investigations have included direct measurements of the thermal conductivity of the deposits, and determinations of their quantity, thickness and structure have been carried out. Previous investigations have shown that gas-surface corrosion can occur at tube temperatures above 330 deg C. The measured values for the thermal conductivity of the deposits indicate that even with small quantities of deposit (c. 1 g/dm2 ) and a moderate boiler pressure (40 atm), certain types of deposit can give rise to the above-mentioned surface temperature, at which the risk of gas-surface corrosion becomes appreciable. For higher boiler pressures the risk is great even with a minimal layer of deposit. The critical deposit thickness can be as low as 0.1 mm

Sampling procedure for lake or stream surface water chemistry

Science.gov (United States)

Robert Musselman

2012-01-01

Surface waters collected in the field for chemical analyses are easily contaminated. This research note presents a step-by-step detailed description of how to avoid sample contamination when field collecting, processing, and transporting surface water samples for laboratory analysis.

Surface tension of normal and heavy water

International Nuclear Information System (INIS)

Straub, J.; Rosner, N.; Grigull, V.

1980-01-01

A Skeleton Table and simple interpolation equation for the surface tension of light water was developed by the Working Group III of the International Association for the Properties of Steam and is recommended as an International Standard. The Skeleton Table is based on all known measurements of the surface tension and individual data were weighted corresponding to the accuracy of the measurements. The form of the interpolation equation is based on a physical concept. It represents an extension of van der Waals-equation, where the exponent conforms to the 'Scaling Laws'. In addition for application purposes simple relations for the Laplace-coefficient and for the density difference between the liquid and gaseous phases of light water are given. The same form of interpolation equation for the surface tension can be used for heavy water, for which the coefficients are given. However, this equation is based only on a single set of data. (orig.) [de

Bulk water freezing dynamics on superhydrophobic surfaces

Science.gov (United States)

Chavan, S.; Carpenter, J.; Nallapaneni, M.; Chen, J. Y.; Miljkovic, N.

2017-01-01

In this study, we elucidate the mechanisms governing the heat-transfer mediated, non-thermodynamic limited, freezing delay on non-wetting surfaces for a variety of characteristic length scales, Lc (volume/surface area, 3 mm commercial superhydrophobic spray coatings, showing a monotonic increase in freezing time with coating thickness. The added thermal resistance of thicker coatings was much larger than that of the nanoscale superhydrophobic features, which reduced the droplet heat transfer and increased the total freezing time. Transient finite element method heat transfer simulations of the water slab freezing process were performed to calculate the overall heat transfer coefficient at the substrate-water/ice interface during freezing, and shown to be in the range of 1-2.5 kW/m2K for these experiments. The results shown here suggest that in order to exploit the heat-transfer mediated freezing delay, thicker superhydrophobic coatings must be deposited on the surface, where the coating resistance is comparable to the bulk water/ice conduction resistance.

Surface water, particulate matter, and sediments of inland waters

International Nuclear Information System (INIS)

Mundschenk, H.

1985-01-01

The Bundesanstalt fuer Gewaesserkunde (BfG) since 1958 runs a system for monitoring the surface water and sediments of Federal German waterways in its capacity as a directing water monitoring centre. The data recorded over the years show that the radioactivity released by the various emission sources leads to radionuclide concentrations in water, particulate matter, or sediments that generally are below the detection limits defined in the relevant legal provisions governing monitoring and surveillance of nuclear facilities effluents. Representative examples of measuring methods and results (as for e.g. for H-3) are given. (DG) [de

The surface water submodel for the assessment of Canada's nuclear fuel waste management concept

International Nuclear Information System (INIS)

Bird, G.A.; Stephenson, M.; Cornett, R.J.

1992-12-01

A requirement in assessing the safety of Canada's nuclear fuel waste management concept is the prediction of radiological doses to humans and other biota, which may occur far in the future as a result of releases of nuclides to the biosphere. A biosphere model has been developed, consisting of four integrated submodels describing surface water, soil, atmosphere, and food-dose components. This report documents the surface water submodel, which is a simple, generic mass balance model of a Canadian Shield lake. Nuclide input to the lake is the time-dependent mass output from the geosphere model. Nuclides enter the lake from compacted sediments. The surface water submodel calculates nuclide concentrations in lake water and sediment. These concentrations are used in the other biosphere submodels to predict the radiological dose to biota. Selection of parameter values for the model is based on the literature, our own data, and conservative assumptions to ensure that doses are not underestimated. MOst parameters are represented by log normal. This probabilistic approach of using distributed parameter values accounts for variability and uncertainty in parameter values, and short-term environmental fluctuations. Long-term environmental changes, such as glaciation, are not considered in the model. Sensitivity analysis indicates that nuclide concentrations in lake water and sediment are governed primarily by hydrological flushing, with lake catchment area being the most important parameter. When catchment area is held constant, as would occur at a specific site, lake area and nuclide transfer rate from water to sediment strongly influence concentrations in both water and sediment. Sediment accumulation rate also strongly influences sediment nuclide concentrations. Validation of model predictions using published studies and other data demonstrates that our model is realistic and suitable for assessing Canada's disposal concept. (Author)

RISK ASSESSMENT OF SURFACE WATERS ASSOCIATED WITH WATER CIRCULATION TECHNOLOGIES ON TROUT FARMS

Directory of Open Access Journals (Sweden)

Marcin Sidoruk

2014-07-01

Full Text Available Dynamic development of aquaculture has led to an increasing impact on the status of surface waters. Fish production generates wastes that, at high concentrations, may present a serious risk to the aquatic environment. Studies on the assessment of the impact of water management technologies in trout production on the quality of surface waters were conducted in 2011. Six farms were selected for the studies and were divided into two groups based on water management solutions (n = 3: farms with a flow through system (FTS and farms with a recirculation aquaculture system (RAS. On all farms, water measurement points were set and they depicted the quality of inflow water, the quality of water in ponds and the quality of outflow water. The studies did not demonstrate any impact of applied technology on electrolyte conductivity or calcium and magnesium concentrations in outflow water from a trout operation. In addition, it was found that the use of water for production purposes resulted in a slight increase in phosphorus and total nitrogen concentrations in waste waters.

A Facile All-Solution-Processed Surface with High Water Contact Angle and High Water Adhesive Force.

Science.gov (United States)

Chen, Mei; Hu, Wei; Liang, Xiao; Zou, Cheng; Li, Fasheng; Zhang, Lanying; Chen, Feiwu; Yang, Huai

2017-07-12

A series of sticky superhydrophobicity surfaces with high water contact angle and high water adhesive force is facilely prepared via an all-solution-processed method based on polymerization-induced phase separation between liquid crystals (LCs) and epoxy resin, which produces layers of epoxy microspheres (EMSs) with nanofolds on the surface of a substrate. The morphologies and size distributions of EMSs are confirmed by scanning electron microscopy. Results reveal that the obtained EMS coated-surface exhibits high apparent contact angle of 152.0° and high water adhesive force up to 117.6 μN. By varying the composition of the sample or preparing conditions, the sizes of the produced EMSs can be artificially regulated and, thus, control the wetting properties and water adhesive behaviors. Also, the sticky superhydrophobic surface exhibits excellent chemical stability, as well as long-term durability. Water droplet transportation experiments further prove that the as-made surface can be effectively used as a mechanical hand for water transportation applications. Based on this, it is believed that the simple method proposed in this paper will pave a new way for producing a sticky superhydrophobic surface and obtain a wide range of use.

The Rheology of a Three Component System: COAL/WATER/#4 Oil Emulsions.

Science.gov (United States)

Gilmartin, Barbara Jean

The purpose of this investigation was to study the rheology of a three component system, coal/water/#4 oil emulsions (COW), in which the third component, water, was present in a significant concentration, and to determine the applicability of existing theories from suspension rheology to the three component system studied. In a coal/water/oil emulsion, free coal particles adhere to the surface of the water droplets, preventing their coagulation, while the larger coal particles reside in the matrix of stabilized water droplets. The use of liquid fuels containing coal is a means of utilizing our nation's coal reserves while conserving oil. These fuels can be burned in conventional oil-fired furnaces. In this investigation, a high sulfur, high ash, bituminous coal was used, along with a heavy #4 oil to prepare the emulsions. The coal was ground to a log-normal distribution with an average particle size of 62 microns. A Haake RV3 concentric cylinder viscometer, with a ribbed measuring system, was used to determine the viscosity of the emulsions. A physical pendulum settling device measured the shift in center of mass of the COW as a function of time. The flow behavior of the fuel in pipes was also tested. In interpreting the data from the viscometer and the pipe flow experiments, a power law analysis was used in the region from 30 s('-1) to 200 s('-1). Extrapolation methods were used to obtain the low and high shear behavior of the emulsions. In the shear rate region found in boiler feed systems, COW are shear thinning with a flow behavior index of 0.7. The temperature dependent characteristic of the emulsions studied were similar and followed an Arrhenius type relationship. The viscosity of the COW decreases with increasing coal average particle size and is also a function of the width of the size distribution used. The type of coal used strongly influences the rheology of the fuel. The volatile content and the atomic oxygen to nitrogen ratio of the coal are the most

Occurrence of estrogenic activities in second-grade surface water and ground water in the Yangtze River Delta, China

International Nuclear Information System (INIS)

Shi, Wei; Hu, Guanjiu; Chen, Sulan; Wei, Si; Cai, Xi; Chen, Bo; Feng, Jianfang; Hu, Xinxin; Wang, Xinru; Yu, Hongxia

2013-01-01

Second-grade surface water and ground water are considered as the commonly used cleanest water in the Yangtze River Delta, which supplies centralized drinking water and contains rare species. However, some synthetic chemicals with estrogenic disrupting activities are detectable. Estrogenic activities in the second-grade surface water and ground water were surveyed by a green monkey kidney fibroblast (CV-1) cell line based ER reporter gene assay. Qualitative and quantitative analysis were further conducted to identify the responsible compounds. Estrogen receptor (ER) agonist activities were present in 7 out of 16 surface water and all the ground water samples. Huaihe River and Yangtze River posed the highest toxicity potential. The highest equivalent (2.2 ng E 2 /L) is higher than the predicted no-effect-concentration (PNEC). Bisphenol A (BPA) contributes to greater than 50% of the total derived equivalents in surface water, and the risk potential in this region deserves more attention and further research. -- Highlights: •Estrogenic activities were present in second-grade surface water and ground water. •Most of the detected equivalents were higher than the predicted no-effect-concentration of E 2 . •ER-EQ 20–80 ranges showed that samples in Huaihe River and Yangtze River posed the highest toxicity. •Bisphenol A contributes to most of the instrumentally derived equivalents in surface water. -- Estrogenic activities were observed in second-grade surface water and ground water in Yangtze River Delta, and BPA was the responsible contaminant

Water Reclamation Using a Ceramic Nanofiltration Membrane and Surface Flushing with Ozonated Water

Science.gov (United States)

Hoang, Anh T.; Okuda, Tetsuji; Takeuchi, Haruka; Tanaka, Hiroaki; Nghiem, Long D.

2018-01-01

A new membrane fouling control technique using ozonated water flushing was evaluated for direct nanofiltration (NF) of secondary wastewater effluent using a ceramic NF membrane. Experiments were conducted at a permeate flux of 44 L/m2h to evaluate the ozonated water flushing technique for fouling mitigation. Surface flushing with clean water did not effectively remove foulants from the NF membrane. In contrast, surface flushing with ozonated water (4 mg/L dissolved ozone) could effectively remove most foulants to restore the membrane permeability. This surface flushing technique using ozonated water was able to limit the progression of fouling to 35% in transmembrane pressure increase over five filtration cycles. Results from this study also heighten the need for further development of ceramic NF membrane to ensure adequate removal of pharmaceuticals and personal care products (PPCPs) for water recycling applications. The ceramic NF membrane used in this study showed approximately 40% TOC rejection, and the rejection of PPCPs was generally low and highly variable. It is expected that the fouling mitigation technique developed here is even more important for ceramic NF membranes with smaller pore size and thus better PPCP rejection. PMID:29671797

Water Reclamation Using a Ceramic Nanofiltration Membrane and Surface Flushing with Ozonated Water

Directory of Open Access Journals (Sweden)

Takahiro Fujioka

2018-04-01

Full Text Available A new membrane fouling control technique using ozonated water flushing was evaluated for direct nanofiltration (NF of secondary wastewater effluent using a ceramic NF membrane. Experiments were conducted at a permeate flux of 44 L/m2h to evaluate the ozonated water flushing technique for fouling mitigation. Surface flushing with clean water did not effectively remove foulants from the NF membrane. In contrast, surface flushing with ozonated water (4 mg/L dissolved ozone could effectively remove most foulants to restore the membrane permeability. This surface flushing technique using ozonated water was able to limit the progression of fouling to 35% in transmembrane pressure increase over five filtration cycles. Results from this study also heighten the need for further development of ceramic NF membrane to ensure adequate removal of pharmaceuticals and personal care products (PPCPs for water recycling applications. The ceramic NF membrane used in this study showed approximately 40% TOC rejection, and the rejection of PPCPs was generally low and highly variable. It is expected that the fouling mitigation technique developed here is even more important for ceramic NF membranes with smaller pore size and thus better PPCP rejection.

Experimental and numerical modelling of surface water-groundwater flow and pollution interactions under tidal forcing

Science.gov (United States)

Spanoudaki, Katerina; Bockelmann-Evans, Bettina; Schaefer, Florian; Kampanis, Nikolaos; Nanou-Giannarou, Aikaterini; Stamou, Anastasios; Falconer, Roger

2015-04-01

Surface water and groundwater are integral components of the hydrologic continuum and the interaction between them affects both their quantity and quality. However, surface water and groundwater are often considered as two separate systems and are analysed independently. This separation is partly due to the different time scales, which apply in surface water and groundwater flows and partly due to the difficulties in measuring and modelling their interactions (Winter et al., 1998). Coastal areas in particular are a difficult hydrologic environment to represent with a mathematical model due to the large number of contributing hydrologic processes. Accurate prediction of interactions between coastal waters, groundwater and neighbouring wetlands, for example, requires the use of integrated surface water-groundwater models. In the past few decades a large number of mathematical models and field methods have been developed in order to quantify the interaction between groundwater and hydraulically connected surface water bodies. Field studies may provide the best data (Hughes, 1995) but are usually expensive and involve too many parameters. In addition, the interpretation of field measurements and linking with modelling tools often proves to be difficult. In contrast, experimental studies are less expensive and provide controlled data. However, experimental studies of surface water-groundwater interaction are less frequently encountered in the literature than filed studies (e.g. Ebrahimi et al., 2007; Kuan et al., 2012; Sparks et al., 2013). To this end, an experimental model has been constructed at the Hyder Hydraulics Laboratory at Cardiff University to enable measurements to be made of groundwater transport through a sand embankment between a tidal water body such as an estuary and a non-tidal water body such as a wetland. The transport behaviour of a conservative tracer was studied for a constant water level on the wetland side of the embankment, while running a

Evaporation of tiny water aggregation on solid surfaces with different wetting properties.

Science.gov (United States)

Wang, Shen; Tu, Yusong; Wan, Rongzheng; Fang, Haiping

2012-11-29

The evaporation of a tiny amount of water on the solid surface with different wettabilities has been studied by molecular dynamics simulations. From nonequilibrium MD simulations, we found that, as the surface changed from hydrophobic to hydrophilic, the evaporation speed did not show a monotonic decrease as intuitively expected, but increased first, and then decreased after it reached a maximum value. The analysis of the simulation trajectory and calculation of the surface water interaction illustrate that the competition between the number of water molecules on the water-gas surface from where the water molecules can evaporate and the potential barrier to prevent those water molecules from evaporating results in the unexpected behavior of the evaporation. This finding is helpful in understanding the evaporation on biological surfaces, designing artificial surfaces of ultrafast water evaporating, or preserving water in soil.

Stormwater Priority Pollutants Versus Surface Water Quality Criteria

DEFF Research Database (Denmark)

Eriksson, Eva; Ledin, Anna; Baun, Anders

2011-01-01

Stormwater in urban areas comprises of a substantial part of the urban water cycle, dominating the flow in many small urban streams, and the pollution levels are sizeable. No stormwater quality criteria were found here and no European or national emission limit values exist. Stormwater pollutants...... however are present in levels exceeding most of the regulated surface water quality criteria and environmental quality standards. Therefore catchment characterisation is needed to chose suitable treatment prior to discharge into receiving surface waters, as the mixing may be insufficient in small streams....

Water Balance in the Amazon Basin from a Land Surface Model Ensemble

Science.gov (United States)

Getirana, Augusto C. V.; Dutra, Emanuel; Guimberteau, Matthieu; Kam, Jonghun; Li, Hong-Yi; Decharme, Bertrand; Zhang, Zhengqiu; Ducharne, Agnes; Boone, Aaron; Balsamo, Gianpaolo;

Lipid composition of water and surface sediments in Takapoto atoll lagoon (French Polynesia)

Science.gov (United States)

Saliot, A.; Bouloubassi, I.; Lorre-Boireau, A.; Trichet, J.; Poupet, P.; Charpy, L.

1994-11-01

Dissolved, particulate and sedimentary lipid compounds were analyzed in samples collected in May 1988 at three sites in the lagoon of the closed atoll of Takapoto (Tuamotu archipelago, French Polynesia). The study provides background information dealing with water quality and the nature and concentration of lipids. Non-aromatic hydrocarbons and fatty acids were isolated from lipids and analyzed by gas chromatography/mass spectrometry. Non-aromatic hydrocarbon concentrations did not exceed 1000 ng l-1 in water, and 2300 ng g-1 in surface sediments and are among the lowest encountered in pristine marine environments. No noticeable petroleum pollution was evidenced in the lagoon. Nevertheless, traces of petroleum-derived compounds were detected at the central site for both surface and deep water. Total fatty acid concentrations varied in the range 6.3 14.4 μg l-1 for the particulate phase and in the range 0.5 3.2 μg l-1 for the dissolved phase. The molecular fingerprints of fatty acids and hydrocarbons evidenced a predominant algal, and to a lesser extent microbial, origin of the organic matter present in water and sediments. Mono- and polyunsaturated fatty acids, which are essential components for animal metabolism, were identified in noticeable amounts in suspended matter (1.8 4.6 μg l-1), and at highly variable levels in the dissolved phase (0.08 1.21 μg l-1).

Radiolysis of water in the vicinity of passive surfaces

International Nuclear Information System (INIS)

Moreau, S.; Fenart, M.; Renault, J.P.

2014-01-01

Highlights: • HO° production through water radiolysis is enhanced near metal surfaces. • Hastelloy and Stainless steel surfaces can also produce HO° radicals through hydrogen peroxide activation. • There is a deficit in solvated electron production compared to hydroxyl radicals near metal surfaces. - Abstract: Porous metals were used to describe the water radiolysis in the vicinity of metal surfaces. The hydroxyl radical production under gamma irradiation was measured by benzoate scavenging in water confined in a 200 nm porous Ni base alloy or in Stainless steel. The presence of the metallic surfaces changed drastically the HO° production level and lifetime. The solvated electron production was measured via glycylglycine scavenging for Stainless steel and was found to be significantly smaller than hydroxyl production. These observations imply that interfacial radiolysis may deeply impact the corrosion behavior of the SS and Ni based alloys

The study of dynamic force acted on water strider leg departing from water surface

Directory of Open Access Journals (Sweden)

Peiyuan Sun

2018-01-01

Full Text Available Water-walking insects such as water striders can skate on the water surface easily with the help of the hierarchical structure on legs. Numerous theoretical and experimental studies show that the hierarchical structure would help water strider in quasi-static case such as load-bearing capacity. However, the advantage of the hierarchical structure in the dynamic stage has not been reported yet. In this paper, the function of super hydrophobicity and the hierarchical structure was investigated by measuring the adhesion force of legs departing from the water surface at different lifting speed by a dynamic force sensor. The results show that the adhesion force decreased with the increase of lifting speed from 0.02 m/s to 0.4 m/s, whose mechanic is investigated by Energy analysis. In addition, it can be found that the needle shape setae on water strider leg can help them depart from water surface easily. Thus, it can serve as a starting point to understand how the hierarchical structure on the legs help water-walking insects to jump upward rapidly to avoid preying by other insects.

The water vapor nitrogen process for removing sodium from LMFBR components

Energy Technology Data Exchange (ETDEWEB)

Crippen, M D; Funk, C W; Lutton, J M [Hanford Engineering Development Laboratory, Richland (United States)

1978-08-01

Application and operation of the Water Vapor-Nitrogen Process for removing sodium from LMFBR components is reviewed. Emphasis is placed on recent efforts to verify the technological bases of the process, to refine the values of process parameters and to ensure the utility of the process for cleaning and requalifying components. (author)

Chlorine stress mediates microbial surface attachment in drinking water systems.

Science.gov (United States)

Liu, Li; Le, Yang; Jin, Juliang; Zhou, Yuliang; Chen, Guowei

2015-03-01

Microbial attachment to drinking water pipe surfaces facilitates pathogen survival and deteriorates disinfection performance, directly threatening the safety of drinking water. Notwithstanding that the formation of biofilm has been studied for decades, the underlying mechanisms for the origins of microbial surface attachment in biofilm development in drinking water pipelines remain largely elusive. We combined experimental and mathematical methods to investigate the role of environmental stress-mediated cell motility on microbial surface attachment in chlorination-stressed drinking water distribution systems. Results show that at low levels of disinfectant (0.0-1.0 mg/L), the presence of chlorine promotes initiation of microbial surface attachment, while higher amounts of disinfectant (>1.0 mg/L) inhibit microbial attachment. The proposed mathematical model further demonstrates that chlorination stress (0.0-5.0 mg/L)-mediated microbial cell motility regulates the frequency of cell-wall collision and thereby controls initial microbial surface attachment. The results reveal that transport processes and decay patterns of chlorine in drinking water pipelines regulate microbial cell motility and, thus, control initial surface cell attachment. It provides a mechanistic understanding of microbial attachment shaped by environmental disinfection stress and leads to new insights into microbial safety protocols in water distribution systems.

A Probabilistic Analysis of Surface Water Flood Risk in London.

Science.gov (United States)

Jenkins, Katie; Hall, Jim; Glenis, Vassilis; Kilsby, Chris

2017-10-30

Flooding in urban areas during heavy rainfall, often characterized by short duration and high-intensity events, is known as "surface water flooding." Analyzing surface water flood risk is complex as it requires understanding of biophysical and human factors, such as the localized scale and nature of heavy precipitation events, characteristics of the urban area affected (including detailed topography and drainage networks), and the spatial distribution of economic and social vulnerability. Climate change is recognized as having the potential to enhance the intensity and frequency of heavy rainfall events. This study develops a methodology to link high spatial resolution probabilistic projections of hourly precipitation with detailed surface water flood depth maps and characterization of urban vulnerability to estimate surface water flood risk. It incorporates probabilistic information on the range of uncertainties in future precipitation in a changing climate. The method is applied to a case study of Greater London and highlights that both the frequency and spatial extent of surface water flood events are set to increase under future climate change. The expected annual damage from surface water flooding is estimated to be to be £171 million, £343 million, and £390 million/year under the baseline, 2030 high, and 2050 high climate change scenarios, respectively. © 2017 Society for Risk Analysis.

Characterizing interactions between surface water and groundwater in the Jialu River basin using major ion chemistry and stable isotopes

Directory of Open Access Journals (Sweden)

L. Yang

2012-11-01

Full Text Available The Jialu River, a secondary tributary of the Huaihe River, has been severely contaminated from major contaminant sources, such as a number of untreated or lightly treated sewage waste in some cities. Groundwater along the river is not an isolated component of the hydrologic system, but is instead connected with the surface water. This study aims to investigate temporal and spatial variations in water chemistry affected by humans and to characterize the relationships between surface water (e.g. reservoirs, lakes and rivers and groundwater near the river in the shallow Quaternary aquifer. Concentration of Cl⁻ in north Zhengzhou City increased prominently due to the discharge of a large amount of domestic water. Nitrate and potassium show maximum concentrations in groundwater in Fugou County. These high levels can be attributed to the use of a large quantity of fertilizer over this region. Most surface water appeared to be continuously recharged from the surrounding groundwater (regional wells based on comparison surface water with groundwater levels, stable-isotopes and major ion signatures. However, the groundwater of a transitional well (location SY3 seemed to be recharged by river water via bank infiltration in September 2010. Fractional contributions of river water to the groundwater were calculated based on isotopic and chemical data using a mass-balance approach. Results show that the groundwater was approximately composed of 60–70% river water. These findings should be useful for a better understanding of hydrogeological processes at the river-aquifer interface and ultimately benefit water management in the future.

Separation and Fixation of Toxic Components in Salt Brines Using a Water-Based Process

International Nuclear Information System (INIS)

Franks, Carrie J.; Quach, Anh P.; Birnie, Dunbar P.; Ela, Wendell P.; Saez, Avelino E.; Zelinski, Brian J.; Smith, Harry D.; Smith, Gary Lynn L.

2004-01-01

Efforts to implement new water quality standards, increase water reuse and reclamation, and minimize the cost of waste storage motivate the development of new processes for stabilizing waste water residuals that minimize waste volume, water content and the long-term environmental risk from related by products. This work explores the use of an aqueous-based emulsion process to create an epoxy/rubber matrix for separating and encapsulating waste components from salt laden, arsenic contaminated, amorphous iron hydrate sludges. Such sludges are generated from conventional water purification precipitation/adsorption processes, used to convert aqueous brine streams to semi-solid waste streams, such as ion exchange/membrane separation, and from other precipitative heavy metal removal operations. In this study, epoxy and polystyrene butadiene (PSB) rubber emulsions are mixed together and then combined with a surrogate sludge. The surrogate sludge consists of amorphous iron hydrate with 1 part arsenic fixed to the surface of the hydrate per 10 parts iron mixed with sodium nitrate and chloride salts and water. The resulting emulsion is cured and dried at 80 C to remove water. Microstructure characterization by electron microscopy confirms that the epoxy/PSB matrix surrounds and encapsulates the arsenic laden amorphous iron hydrate phase while allowing the salt to migrate to internal and external surfaces of the sample. Salt extraction studies indicate that the porous nature of the resulting matrix promotes the separation and removal of as much as 90% of the original salt content in only one hours time. Long term leaching studies based on the use of the infinite slab diffusion model reveal no evidence of iron migration or, by inference, arsenic migration, and demonstrate that the diffusion coefficients of the unextracted salt yield leachability indices within regulations for non-hazardous landfill disposal. Because salt is the most mobile species, it is inferred that arsenic

Monthly version of HadISST sea surface temperature state-space components

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — State-Space Decomposition of Monthly version of HadISST sea surface temperature component (1-degree). See Rayner, N. A., Parker, D. E., Horton, E. B., Folland, C....

Flow Components in a NaK Test Loop Designed to Simulate Conditions in a Nuclear Surface Power Reactor

Science.gov (United States)

Polzin, Kurt A.; Godfroy, Thomas J.

2008-01-01

A test loop using NaK as the working fluid is presently in use to study material compatibility effects on various components that comprise a possible nuclear reactor design for use on the lunar surface. A DC electromagnetic (EM) pump has been designed and implemented as a means of actively controlling the NaK flow rate through the system and an EM flow sensor is employed to monitor the developed flow rate. These components allow for the matching of the flow rate conditions in test loops with those that would be found in a full-scale surface-power reactor. The design and operating characteristics of the EM pump and flow sensor are presented. In the EM pump, current is applied to a set of electrodes to produce a Lorentz body force in the fluid. A measurement of the induced voltage (back-EMF) in the flow sensor provides the means of monitoring flow rate. Both components are compact, employing high magnetic field strength neodymium magnets thermally coupled to a water-cooled housing. A vacuum gap limits the heat transferred from the high temperature NaK tube to the magnets and a magnetically-permeable material completes the magnetic circuit. The pump is designed to produce a pressure rise of 5 psi, and the flow sensor's predicted output is roughly 20 mV at the loop's nominal flow rate of 0.5 GPM.

Zeolites for nitrosamine and pharmaceutical removal from demineralised and surface water: Mechanisms and efficacy

KAUST Repository

De Ridder, David J.

2012-03-01

Zeolites with a high Si/Al ratio can be used as selective adsorbents in water treatment, targeting organic micropollutants which are removed poorly with activated carbon. Due to size exclusion, many Natural Organic Matter (NOM) components cannot access the pores, thus limiting adsorption competition between organic micropollutant and NOM. Furthermore, zeolite channel diameters are close to molecule diameters, which results in strong van der Waals interaction. MOR200 and ZSM5, the two most hydrophobic zeolites, showed the highest removal of neutral nitrosamines in demineralised water, with higher efficacy than activated carbon. DAY and MOR30, which were relatively hydrophilic zeolites, did not show appreciable removal of any of the nitrosamines. When nitrosamines were adsorbed from surface water, there was no influence of competition with, or pore blockage by, NOM components on nitrosamine removal for ZSM5 zeolite, in contrast to activated carbon. Repulsion of negatively charged pharmaceuticals was significant for ZSM5, which had a Si/Al ratio of 80. MOR200 had a Si/Al ratio of 200, indicating a lower Al content than ZSM5 and, as such, a lower negative surface charge. Charge effects were not observed for MOR200. A relationship was found between the Stokes diameter of the pharmaceuticals and nitrosamines, and their removal by ZSM5 and MOR200, indicating that a "close fit" adsorption mechanism is more likely than hydrophobic interaction in these zeolites. Due to their selective nature, adsorption on zeolites should only be considered as an additional treatment step to existing processes, dedicated for the removal of specific organic micropollutants. Less specific treatment techniques, such as activated carbon filtration, are still required to ensure a broad barrier for organic micropollutants in water treatment. © 2012 Elsevier B.V. All rights reserved.

IMPROVING CYANOBACTERIA AND CYANOTOXIN MONITORING IN SURFACE WATERS FOR DRINKING WATER SUPPLY

Directory of Open Access Journals (Sweden)

Jing Li

2017-06-01

Full Text Available Cyanobacteria in fresh water can cause serious threats to drinking water supplies. Managing cyanobacterial blooms particularly at small drinking water treatment plants is challenging. Because large amount of cyanobacteria may cause clogging in the treatment process and various cyanotoxins are hard to remove, while they may cause severe health problems. There is lack of instructions of what cyanobacteria/toxin amount should trigger what kind of actions for drinking water management except for Microcystins. This demands a Cyanobacteria Management Tool (CMT to help regulators/operators to improve cyanobacteria/cyanotoxin monitoring in surface waters for drinking water supply. This project proposes a CMT tool, including selecting proper indicators for quick cyanobacteria monitoring and verifying quick analysis methods for cyanobacteria and cyanotoxin. This tool is suggested for raw water management regarding cyanobacteria monitoring in lakes, especially in boreal forest climate. In addition, it applies to regions that apply international WHO standards for water management. In Swedish context, drinking water producers which use raw water from lakes that experience cyanobacterial blooms, need to create a monitoring routine for cyanobacteria/cyanotoxin and to monitor beyond such as Anatoxins, Cylindrospermopsins and Saxitoxins. Using the proposed CMT tool will increase water safety at surface water treatment plants substantially by introducing three alerting points for actions. CMT design for each local condition should integrate adaptive monitoring program.

Part 2: Surface water quality

International Nuclear Information System (INIS)

1997-01-01

In 1996 the surface water quality measurements were performed, according to the Agreement, at 8 profiles on the Hungarian territory and at 15 profiles on the Slovak territory. Basic physical and chemical parameters (as water temperature, pH values, conductivity, suspended solids, cations and anions (nitrates, ammonium ion, nitrites, total nitrogen, phosphates, total phosphorus, oxygen and organic carbon regime parameters), metals (iron, manganese and heavy metals), biological and microbiological parameters (coliform bacteria, chlorophyll-a, saprobity index and other biological parameters) and quality of sediment were measured

Some remarks on the solid surface tension determination from contact angle measurements

Energy Technology Data Exchange (ETDEWEB)

Zdziennicka, Anna; Szymczyk, Katarzyna; Krawczyk, Joanna; Jańczuk, Bronisław, E-mail: bronislaw.janczuk@poczta.umcs.lublin.pl

2017-05-31

Graphical abstract: Surface tension of PE, nylon 6 and quartz from different approaches to the interface tension. - Highlights: • New values of water and formamide surface tension components were established. • Quartz surface tension depends on its crystal face. • Usefulness of different approaches for solid surface tension determination was tested. - Abstract: The measurements of water, formamide and diiodomethane contact angle (θ) on polytetrafluoroethylene (PTFE), polyethylene (PE), polymethyl methacrylate (PMMA), nylon 6, quartz and silica were performed. Based on the θ values of these liquids obtained on PTFE, the Lifshitz-van der Waals and acid-base and/or dispersion and polar components of their surface tension (ST) were determined. In turn, the θ values for water, formamide and diiodomethane on PMMA were applied to calculate the electron-acceptor and electron-donor parameters of the Lewis acid-base component of the formamide ST. For this calculation the same values of the electron-acceptor and electron-donor parameters for water ST were used. Taking into account the values of components and parameters of water, formamide and diiodomethane ST obtained by us, van Oss et al. and from the water(formamide)-n-alkane and water-diiodomethane interface tension, the components and parameters of studied solids ST were calculated. To this end different approaches to the interface tension were considered. The obtained values were compared with those in the literature. It was concluded that for determination of solid ST components and parameters, those of water, formamide and diiodomethane ST obtained from the θ measurements on the model solids should be used.

Antibacterial performance of polypropylene nonwoven fabric wound dressing surfaces containing passive and active components

Energy Technology Data Exchange (ETDEWEB)

Xin, Zhirong, E-mail: xinzhirong2012@126.com [School of Chemistry and Chemical Engineering, Yantai University, Yantai 264005 (China); Du, Shanshan; Zhao, Chunyu; Chen, Hao; Sun, Miao [School of Chemistry and Chemical Engineering, Yantai University, Yantai 264005 (China); Yan, Shunjie [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Luan, Shifang, E-mail: sfluan@ciac.ac.cn [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Yin, Jinghua [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

2016-03-01

Graphical abstract: - Highlights: • PNVP and PHMG components were covalently immobilized on PP{sub NWF} surface. • PP{sub NWF}-g-PNVP-PHMG possessed bacterial adhesion-resistant and bactericidal capabilities. • PP{sub NWF}-g-PNVP-PHMG obviously suppressed platelet and red blood cell adhesion. - Abstract: A growing number of wound dressing-related nosocomial infections necessitate the development of novel antibacterial strategies. Herein, polypropylene non-woven fabric (PP{sub NWF}) was facilely modified with passive and active antibacterial components, namely photografting polymerization both N-Vinyl-2-pyrrolidone (NVP) and glycidyl methacrylate (GMA) monomers, and the introduction of guanidine polymer through the reaction between active amino groups and epoxy groups. The modified samples were confirmed by attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR), X-ray photoelectron spectroscopy (XPS), respectively. Water contact angle measurement, antibacterial test, platelet and red blood cell adhesion were used to evaluate the hydrophilicity, antibacterial properties and hemocompatibility of the samples. It was found that the antibacterial properties were obviously enhanced, meanwhile significantly suppressing platelet and red blood cell adhesion after the above modification. This PP{sub NWF} samples that possess antifouling and antimicrobial properties, have great potential in wound dressing applications.

Electrolysis of water on (oxidized) metal surfaces

DEFF Research Database (Denmark)

Rossmeisl, Jan; Logadottir, Ashildur; Nørskov, Jens Kehlet

2005-01-01

Density functional theory calculations are used as the basis for an analysis of the electrochemical process, where by water is split to form molecular oxygen and hydrogen. We develop a method for obtaining the thermochemistry of the electrochemical water splitting process as a function of the bias...... directly from the electronic structure calculations. We consider electrodes of Pt(111) and Au(111) in detail and then discuss trends for a series of different metals. We show that the difficult step in the water splitting process is the formation of superoxy-type (OOH) species on the surface...... by the splitting of a water molecule on top an adsorbed oxygen atom. One conclusion is that this is only possible on metal surfaces that are (partly) oxidized. We show that the binding energies of the different intermediates are linearly correlated for a number of metals. In a simple analysis, where the linear...

Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

NARCIS (Netherlands)

van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

2014-01-01

Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in

Drivers and Effects of Groundwater-Surface Water Interaction in the Karstic Lower Flint River Basin, Southwestern Georgia, USA

Science.gov (United States)

Rugel, K.; Golladay, S. W.; Jackson, C. R.; Rasmussen, T. C.; Dowd, J. F.; Mcdowell, R. J.

2017-12-01

Groundwater provides the majority of global water resources for domestic and agricultural usage while contributing vital surface water baseflows which support healthy aquatic ecosystems. Understanding the extent and magnitude of hydrologic connectivity between groundwater and surface water components in karst watersheds is essential to the prudent management of these hydraulically-interactive systems. We examined groundwater and surface water connectivity between the Upper Floridan Aquifer (UFA) and streams in the Lower Flint River Basin (LFRB) in southwestern Georgia where development of agricultural irrigation intensified over the past 30 years. An analysis of USGS streamflow data for the pre- and post-irrigation period showed summer baseflows in some Lower Flint River tributaries were reduced by an order of magnitude in the post-irrigation period, reiterating the strong hydraulic connection between these streams and the underlying aquifer. Large and fine-scale monitoring of calcium, nitrate, specific conductance and stable isotopes (δ18O and δD) on 50 km of Ichawaynochaway Creek, a major tributary of the Lower Flint, detected discrete groundwater-surface water flow paths which accounted for 42% of total groundwater contributions in the 50 km study reach. This presentation will highlight a new analysis using the metadata EPA Reach File (1) and comparing stream reach and instream bedrock joint azimuths with stream geochemical results from previous field study. Our findings suggested that reaches with NNW bearing may be more likely to display enhanced groundwater-surface water connectivity. Our results show that local heterogeneity can significantly affect water budgets and quality within these watersheds, making the use of geomorphological stream attributes a valuable tool to water resource management for the prediction and protection of vulnerable regions of hydrologic connectivity in karst catchments.

Hydraulics and drones: observations of water level, bathymetry and water surface velocity from Unmanned Aerial Vehicles

DEFF Research Database (Denmark)

Bandini, Filippo

-navigable rivers and overpass obstacles (e.g. river structures). Computer vision, autopilot system and beyond visual line-of-sight (BVLOS) flights will ensure the possibility to retrieve hyper-spatial observations of water depth, without requiring the operator to access the area. Surface water speed can......The planet faces several water-related threats, including water scarcity, floods, and pollution. Satellite and airborne sensing technology is rapidly evolving to improve the observation and prediction of surface water and thus prevent natural disasters. While technological developments require....... Although UAV-borne measurements of surface water speed have already been documented in the literature, a novel approach was developed to avoid GCPs. This research is the first demonstration that orthometric water level can be measured from UAVs with a radar system and a GNSS (Global Navigation Satellite...

A geo-informatics approach for estimating water resources management components and their interrelationships

KAUST Repository

Liaqat, Umar Waqas

2016-09-21

A remote sensing based geo-informatics approach was developed to estimate water resources management (WRM) components across a large irrigation scheme in the Indus Basin of Pakistan. The approach provides a generalized framework for estimating a range of key water management variables and provides a management tool for the sustainable operation of similar schemes globally. A focus on the use of satellite data allowed for the quantification of relationships across a range of spatial and temporal scales. Variables including actual and crop evapotranspiration, net and gross irrigation, net and gross groundwater use, groundwater recharge, net groundwater recharge, were estimated and then their interrelationships explored across the Hakra Canal command area. Spatially distributed remotely sensed estimates of actual evapotranspiration (ETa) rates were determined using the Surface Energy Balance System (SEBS) model and evaluated against ground-based evaporation calculated from the advection-aridity method. Analysis of ETa simulations across two cropping season, referred to as Kharif and Rabi, yielded Pearson correlation (R) values of 0.69 and 0.84, Nash-Sutcliffe criterion (NSE) of 0.28 and 0.63, percentage bias of −3.85% and 10.6% and root mean squared error (RMSE) of 10.6 mm and 12.21 mm for each season, respectively. For the period of study between 2008 and 2014, it was estimated that an average of 0.63 mm day−1 water was supplied through canal irrigation against a crop water demand of 3.81 mm day−1. Approximately 1.86 mm day−1 groundwater abstraction was estimated in the region, which contributed to fulfil the gap between crop water demand and canal water supply. Importantly, the combined canal, groundwater and rainfall sources of water only met 70% of the crop water requirements. As such, the difference between recharge and discharge showed that groundwater depletion was around −115 mm year−1 during the six year study period. Analysis indicated that

Effect of solid waste landfill on underground and surface water ...

African Journals Online (AJOL)

Effect of solid waste landfill on underground and surface water quality at ring road, Ibadan, Nigeria. ... parameters showed increased concentrations over those from control sites. ... Keywords: Landfill, groundwater, surface-water, pollution.

Removal of pollutants from surface water and groundwater by nanofiltration: overview of possible applications in the drinking water industry

International Nuclear Information System (INIS)

Bruggen, Bart van der; Vandecasteele, Carlo

2003-01-01

The nanofiltration system has many potential uses in removing chemical and biological contaminants from water. - During the last decade, nanofiltration (NF) made a breakthrough in drinking water production for the removal of pollutants. The combination of new standards for drinking water quality and the steady improvement of the nanofiltration process have led to new insights, possible applications and new projects on lab-scale, pilot scale and industrial scale. This paper offers an overview of the applications in the drinking water industry that have already been realised or that are suggested on the basis of lab-scale research. Applications can be found in the treatment of surface water as well as groundwater. The possibility of using NF for the removal of hardness, natural organic material (NOM), micropollutants such as pesticides and VOCs, viruses and bacteria, salinity, nitrates, and arsenic will be discussed. Some of these applications have proven to be reliable and can be considered as known techniques; other applications are still studied on laboratory scale. Modelling is difficult due to effects of fouling and interaction between different components. The current insight in the separation mechanisms will be briefly discussed

Surface water classification and monitoring using polarimetric synthetic aperture radar

Science.gov (United States)

Irwin, Katherine Elizabeth

Surface water classification using synthetic aperture radar (SAR) is an established practice for monitoring flood hazards due to the high temporal and spatial resolution it provides. Surface water change is a dynamic process that varies both spatially and temporally, and can occur on various scales resulting in significant impacts on affected areas. Small-scale flooding hazards, caused by beaver dam failure, is an example of surface water change, which can impact nearby infrastructure and ecosystems. Assessing these hazards is essential to transportation and infrastructure maintenance. With current satellite missions operating in multiple polarizations, spatio-temporal resolutions, and frequencies, a comprehensive comparison between SAR products for surface water monitoring is necessary. In this thesis, surface water extent models derived from high resolution single-polarization TerraSAR-X (TSX) data, medium resolution dual-polarization TSX data and low resolution quad-polarization RADARSAT-2 (RS-2) data are compared. There exists a compromise between acquiring SAR data with a high resolution or high information content. Multi-polarization data provides additional phase and intensity information, which makes it possible to better classify areas of flooded vegetation and wetlands. These locations are often where fluctuations in surface water occur and are essential for understanding dynamic underlying processes. However, often multi-polarized data is acquired at a low resolution, which cannot image these zones effectively. High spatial resolution, single-polarization TSX data provides the best model of open water. However, these single-polarization observations have limited information content and are affected by shadow and layover errors. This often hinders the classification of other land cover types. The dual-polarization TSX data allows for the classification of flooded vegetation, but classification is less accurate compared to the quad-polarization RS-2 data

Water slip and friction at a solid surface

Energy Technology Data Exchange (ETDEWEB)

Brigo, L; Pierno, M; Mammano, F; Sada, C; Fois, G; Pozzato, A; Zilio, S dal; Mistura, G [Dipartimento di Fisica G Galilei, Universita degli Studi di Padova, via Marzolo 8, 35131 Padova (Italy); Natali, M [Istituto di Chimica Inorganica e delle Superfici (ICIS), CNR, Corso Stati Uniti 4, 35127 Padova (Italy); Tormen, M [TASC-INFM, CNR, S S 14 km 163.5 Area Science Park, 34012 Basovizza, Trieste (Italy)], E-mail: mistura@padova.infm.it

2008-09-03

A versatile micro-particle imaging velocimetry ({mu}-PIV) recording system is described, which allows us to make fluid velocity measurements in a wide range of flow conditions both inside microchannels and at liquid-solid interfaces by using epifluorescence and total internal reflection fluorescence excitation. This set-up has been applied to study the slippage of water over flat surfaces characterized by different degrees of hydrophobicity and the effects that a grooved surface has on the fluid flow inside a microchannel. Preliminary measurements of the slip length of water past various flat surfaces show no significant dependence on the contact angle.

Context of surveillance of underground and surface waters

International Nuclear Information System (INIS)

2010-01-01

This document briefly describes the evolutions of regulations on site liquid effluents and of guideline values concerning radioactive wastes, briefly presents the surveillance of underground and surface waters of CEA sites, comments the guideline values of the radiological quality of waters aimed at human consumption, and gives an overview of information which are brought to public's attention. Then, for different CEA sites (Cadarache, Marcoule, Saclay, Grenoble, Fontenay-aux-Roses, Valduc, DIF), this document proposes a presentation of the hydrological context, regulatory context, the surface and underground water surveillance process and values, the storing zones of old wastes

The Proposed Surface Water and Ocean Topography (SWOT) Mission

Science.gov (United States)

Fu, Lee-Lueng; Alsdorf, Douglas; Rodriguez, Ernesto; Morrow, Rosemary; Mognard, Nelly; Vaze, Parag; Lafon, Thierry

2012-01-01

A new space mission concept called Surface Water and Ocean Topography (SWOT) is being developed jointly by a collaborative effort of the international oceanographic and hydrological communities for making high-resolution measurement of the water elevation of both the ocean and land surface water to answer the questions about the oceanic submesoscale processes and the storage and discharge of land surface water. The key instrument payload would be a Ka-band radar interferometer capable of making high-resolution wide-swath altimetry measurement. This paper describes the proposed science objectives and requirements as well as the measurement approach of SWOT, which is baselined to be launched in 2019. SWOT would demonstrate this new approach to advancing both oceanography and land hydrology and set a standard for future altimetry missions.

Application of Multivariate Statistical Analysis in Evaluation of Surface River Water Quality of a Tropical River

Directory of Open Access Journals (Sweden)

Teck-Yee Ling

2017-01-01

Full Text Available The present study evaluated the spatial variations of surface water quality in a tropical river using multivariate statistical techniques, including cluster analysis (CA and principal component analysis (PCA. Twenty physicochemical parameters were measured at 30 stations along the Batang Baram and its tributaries. The water quality of the Batang Baram was categorized as “slightly polluted” where the chemical oxygen demand and total suspended solids were the most deteriorated parameters. The CA grouped the 30 stations into four clusters which shared similar characteristics within the same cluster, representing the upstream, middle, and downstream regions of the main river and the tributaries from the middle to downstream regions of the river. The PCA has determined a reduced number of six principal components that explained 83.6% of the data set variance. The first PC indicated that the total suspended solids, turbidity, and hydrogen sulphide were the dominant polluting factors which is attributed to the logging activities, followed by the five-day biochemical oxygen demand, total phosphorus, organic nitrogen, and nitrate-nitrogen in the second PC which are related to the discharges from domestic wastewater. The components also imply that logging activities are the major anthropogenic activities responsible for water quality variations in the Batang Baram when compared to the domestic wastewater discharge.

Presence of active pharmaceutical ingredients in the continuum of surface and ground water used in drinking water production.

Science.gov (United States)

Ahkola, Heidi; Tuominen, Sirkku; Karlsson, Sanja; Perkola, Noora; Huttula, Timo; Saraperä, Sami; Artimo, Aki; Korpiharju, Taina; Äystö, Lauri; Fjäder, Päivi; Assmuth, Timo; Rosendahl, Kirsi; Nysten, Taina

2017-12-01

Anthropogenic chemicals in surface water and groundwater cause concern especially when the water is used in drinking water production. Due to their continuous release or spill-over at waste water treatment plants, active pharmaceutical ingredients (APIs) are constantly present in aquatic environment and despite their low concentrations, APIs can still cause effects on the organisms. In the present study, Chemcatcher passive sampling was applied in surface water, surface water intake site, and groundwater observation wells to estimate whether the selected APIs are able to end up in drinking water supply through an artificial groundwater recharge system. The API concentrations measured in conventional wastewater, surface water, and groundwater grab samples were assessed with the results obtained with passive samplers. Out of the 25 APIs studied with passive sampling, four were observed in groundwater and 21 in surface water. This suggests that many anthropogenic APIs released to waste water proceed downstream and can be detectable in groundwater recharge. Chemcatcher passive samplers have previously been used in monitoring several harmful chemicals in surface and wastewaters, but the path of chemicals to groundwater has not been studied. This study provides novel information on the suitability of the Chemcatcher passive samplers for detecting APIs in groundwater wells.

Surface Waters Information Management System (SWIMS)

Data.gov (United States)

Kansas Data Access and Support Center — The Surface Waters Information Management System (SWIMS) has been designed to meet multi-agency hydrologic database needs for Kansas. The SWIMS project was supported...

Fabrication of Superhydrophobic Surfaces with Controllable Electrical Conductivity and Water Adhesion.

Science.gov (United States)

Ye, Lijun; Guan, Jipeng; Li, Zhixiang; Zhao, Jingxin; Ye, Cuicui; You, Jichun; Li, Yongjin

2017-02-14

A facile and versatile strategy for fabricating superhydrophobic surfaces with controllable electrical conductivity and water adhesion is reported. "Vine-on-fence"-structured and cerebral cortex-like superhydrophobic surfaces are constructed by filtering a suspension of multiwalled carbon nanotubes (MWCNTs), using polyoxymethylene nonwovens as the filter paper. The nonwovens with micro- and nanoporous two-tier structures act as the skeleton, introducing a microscale structure. The MWCNTs act as nanoscale structures, creating hierarchical surface roughness. The surface topography and the electrical conductivity of the superhydrophobic surfaces are controlled by varying the MWCNT loading. The vine-on-fence-structured surfaces exhibit "sticky" superhydrophobicity with high water adhesion. The cerebral cortex-like surfaces exhibit self-cleaning properties with low water adhesion. The as-prepared superhydrophobic surfaces are chemically resistant to acidic and alkaline environments of pH 2-12. They therefore have potential in applications such as droplet-based microreactors and thin-film microextraction. These findings aid our understanding of the role that surface topography plays in the design and fabrication of superhydrophobic surfaces with different water-adhesion properties.

Characterization of Surface Water and Groundwater Quality in the Lower Tano River Basin Using Statistical and Isotopic Approach.

Science.gov (United States)

Edjah, Adwoba; Stenni, Barbara; Cozzi, Giulio; Turetta, Clara; Dreossi, Giuliano; Tetteh Akiti, Thomas; Yidana, Sandow

2017-04-01

Adwoba Kua- Manza Edjaha, Barbara Stennib,c,Giuliano Dreossib, Giulio Cozzic, Clara Turetta c,T.T Akitid ,Sandow Yidanae a,eDepartment of Earth Science, University of Ghana Legon, Ghana West Africa bDepartment of Enviromental Sciences, Informatics and Statistics, Ca Foscari University of Venice, Italy cInstitute for the Dynamics of Environmental Processes, CNR, Venice, Italy dDepartment of Nuclear Application and Techniques, Graduate School of Nuclear and Allied Sciences University of Ghana Legon This research is part of a PhD research work "Hydrogeological Assessment of the Lower Tano river basin for sustainable economic usage, Ghana, West - Africa". In this study, the researcher investigated surface water and groundwater quality in the Lower Tano river basin. This assessment was based on some selected sampling sites associated with mining activities, and the development of oil and gas. Statistical approach was applied to characterize the quality of surface water and groundwater. Also, water stable isotopes, which is a natural tracer of the hydrological cycle was used to investigate the origin of groundwater recharge in the basin. The study revealed that Pb and Ni values of the surface water and groundwater samples exceeded the WHO standards for drinking water. In addition, water quality index (WQI), based on physicochemical parameters(EC, TDS, pH) and major ions(Ca2+, Na+, Mg2+, HCO3-,NO3-, CL-, SO42-, K+) exhibited good quality water for 60% of the sampled surface water and groundwater. Other statistical techniques, such as Heavy metal pollution index (HPI), degree of contamination (Cd), and heavy metal evaluation index (HEI), based on trace element parameters in the water samples, reveal that 90% of the surface water and groundwater samples belong to high level of pollution. Principal component analysis (PCA) also suggests that the water quality in the basin is likely affected by rock - water interaction and anthropogenic activities (sea water intrusion). This

The significant surface-water connectivity of "geographically isolated wetlands"

Science.gov (United States)

Calhoun, Aram J.K.; Mushet, David M.; Alexander, Laurie C.; DeKeyser, Edward S.; Fowler, Laurie; Lane, Charles R.; Lang, Megan W.; Rains, Mark C.; Richter, Stephen; Walls, Susan

2017-01-01

We evaluated the current literature, coupled with our collective research expertise, on surface-water connectivity of wetlands considered to be “geographically isolated” (sensu Tiner Wetlands 23:494–516, 2003a) to critically assess the scientific foundation of grouping wetlands based on the singular condition of being surrounded by uplands. The most recent research on wetlands considered to be “geographically isolated” shows the difficulties in grouping an ecological resource that does not reliably indicate lack of surface water connectivity in order to meet legal, regulatory, or scientific needs. Additionally, the practice of identifying “geographically isolated wetlands” based on distance from a stream can result in gross overestimates of the number of wetlands lacking ecologically important surface-water connections. Our findings do not support use of the overly simplistic label of “geographically isolated wetlands”. Wetlands surrounded by uplands vary in function and surface-water connections based on wetland landscape setting, context, climate, and geographic region and should be evaluated as such. We found that the “geographically isolated” grouping does not reflect our understanding of the hydrologic variability of these wetlands and hence does not benefit conservation of the Nation’s diverse wetland resources. Therefore, we strongly discourage use of categorizations that provide overly simplistic views of surface-water connectivity of wetlands fully embedded in upland landscapes.

Quality-control design for surface-water sampling in the National Water-Quality Network

Science.gov (United States)

Riskin, Melissa L.; Reutter, David C.; Martin, Jeffrey D.; Mueller, David K.

2018-04-10

The data-quality objectives for samples collected at surface-water sites in the National Water-Quality Network include estimating the extent to which contamination, matrix effects, and measurement variability affect interpretation of environmental conditions. Quality-control samples provide insight into how well the samples collected at surface-water sites represent the true environmental conditions. Quality-control samples used in this program include field blanks, replicates, and field matrix spikes. This report describes the design for collection of these quality-control samples and the data management needed to properly identify these samples in the U.S. Geological Survey’s national database.

Strategic Evaluation Tool for Surface Water Quality Management Remedies in Drinking Water Catchments

Directory of Open Access Journals (Sweden)

Huda Almaaofi

2017-09-01

Full Text Available Drinking water catchments (DWC are under pressure from point and nonpoint source pollution due to the growing human activities. This worldwide challenge is causing number of adverse effects, such as degradation in water quality, ecosystem health, and other economic and social pressures. Different evaluation tools have been developed to achieve sustainable and healthy drinking water catchments. However, a holistic and strategic framework is still required to adequately consider the uncertainty associated with feasible management remedies of surface water quality in drinking water catchments. A strategic framework was developed to adequately consider the uncertainty associated with management remedies for surface water quality in drinking water catchments. A Fuzzy Multiple Criteria Decision Analysis (FMCDA approach was embedded into a strategic decision support framework to evaluate and rank water quality remediation options within a typical fixed budget constraint faced by bulk water providers. The evaluation framework consists of four core aspects; namely, water quality, environmental, economic and social, and number of associated quantitative and qualitative criteria and sub-criteria. Final remediation strategy ranking was achieved through the application of the Euclidean Distance by the In-center of Centroids (EDIC.

Manufacturing and characterisation of water repellent surfaces

DEFF Research Database (Denmark)

De Grave, Arnaud; Botija, Pablo; Hansen, Hans Nørgaard

2006-01-01

design criteria for such surfaces. The problem of adapting this behaviour to artificially roughened surfaces is addressed by providing design criteria for superhydrophobic, water-repellent and self-cleaning surfaces according to the concrete performance desired for them. Different kind of manufacturing...... techniques are investigated and the production of patterned micro structured surfaces following two different manufacturing techniques is reported. The first is a combination of laser manufacturing and hot embossing on polystyrene. To compare geometry and functionality a non-silicon based lithography...

Surface composition of biomedical components by ion beam analysis

International Nuclear Information System (INIS)

Kenny, M.J.; Wielunski, L.S.; Baxter, G.R.

1991-01-01

Materials used for replacement body parts must satisfy a number of requirements such as biocompatibility and mechanical ability to handle the task with regard to strength, wear and durability. When using a CVD coated carbon fibre reinforced carbon ball, the surface must be ion implanted with uniform dose of nitrogen ions in order to make it wear resistant. The mechanism by which the wear resistance is improved is one of radiation damage and the required dose of about 10 16 cm -2 can have a tolerance of about 20%. To implant a spherical surface requires manipulation of the sample within the beam and control system (either computer or manually operated) to enable uniform dose all the way from polar to equatorial regions on the surface. A manipulator has been designed and built for this purpose. In order to establish whether the dose is uniform, nuclear reaction analysis using the reaction 14 N(d,α) 12 C is an ideal method of profiling. By taking measurements at a number of points on the surface, the uniformity of nitrogen dose can be ascertained. It is concluded that both Rutherford Backscattering and Nuclear Reaction Analysis can be used for rapid analysis of surface composition of carbon based materials used for replacement body components. 2 refs., 2 figs

Near-field Oblique Remote Sensing of Stream Water-surface Elevation, Slope, and Surface Velocity

Science.gov (United States)

Minear, J. T.; Kinzel, P. J.; Nelson, J. M.; McDonald, R.; Wright, S. A.

2014-12-01

A major challenge for estimating discharges during flood events or in steep channels is the difficulty and hazard inherent in obtaining in-stream measurements. One possible solution is to use near-field remote sensing to obtain simultaneous water-surface elevations, slope, and surface velocities. In this test case, we utilized Terrestrial Laser Scanning (TLS) to remotely measure water-surface elevations and slope in combination with surface velocities estimated from particle image velocimetry (PIV) obtained by video-camera and/or infrared camera. We tested this method at several sites in New Mexico and Colorado using independent validation data consisting of in-channel measurements from survey-grade GPS and Acoustic Doppler Current Profiler (ADCP) instruments. Preliminary results indicate that for relatively turbid or steep streams, TLS collects tens of thousands of water-surface elevations and slopes in minutes, much faster than conventional means and at relatively high precision, at least as good as continuous survey-grade GPS measurements. Estimated surface velocities from this technique are within 15% of measured velocity magnitudes and within 10 degrees from the measured velocity direction (using extrapolation from the shallowest bin of the ADCP measurements). Accurately aligning the PIV results into Cartesian coordinates appears to be one of the main sources of error, primarily due to the sensitivity at these shallow oblique look angles and the low numbers of stationary objects for rectification. Combining remotely-sensed water-surface elevations, slope, and surface velocities produces simultaneous velocity measurements from a large number of locations in the channel and is more spatially extensive than traditional velocity measurements. These factors make this technique useful for improving estimates of flow measurements during flood flows and in steep channels while also decreasing the difficulty and hazard associated with making measurements in these

Water evaporation from substrate tooth surface during dentin treatments.

Science.gov (United States)

Kusunoki, Mizuho; Itoh, Kazuo; Gokan, Yuka; Nagai, Yoshitaka; Tani, Chihiro; Hisamitsu, Hisashi

2011-01-01

The purpose of this study was to evaluate changes in the quantity of water evaporation from tooth surfaces. The amount of water evaporation was measured using Multi probe adapter MPA5 and Tewameter TM300 (Courage+Khazaka Electric GmbH, Köln, Germany) after acid etching and GM priming of enamel; and after EDTA conditioning and GM priming of dentin. The results indicated that the amount of water evaporation from the enamel surface was significantly less than that from the dentin. Acid etching did not affect the water evaporation from enamel, though GM priming significantly decreased the evaporation (83.48 ± 15.14% of that before priming). The evaporation from dentin was significantly increased by EDTA conditioning (131.38 ± 42.08% of that before conditioning) and significantly reduced by GM priming (80.26 ± 7.43% of that before priming). It was concluded that dentin priming reduced water evaporation from the dentin surface.

Evaluation of water quality in surface water and shallow groundwater: a case study of a rare earth mining area in southern Jiangxi Province, China.

Science.gov (United States)

Hao, Xiuzhen; Wang, Dengjun; Wang, Peiran; Wang, Yuxia; Zhou, Dongmei

2016-01-01

This study was conducted to evaluate the quality of surface water and shallow groundwater near a rare earth mining area in southern Jiangxi Province, China. Water samples from paddy fields, ponds, streams, wells, and springs were collected and analyzed. The results showed that water bodies were characterized by low pH and high concentrations of total nitrogen (total N), ammonium nitrogen (NH4 (+)-N), manganese (Mn), and rare earth elements (REEs), which was likely due to residual chemicals in the soil after mining activity. A comparison with the surface water standard (State Environmental Protection Administration & General Administration of Quality Supervision, Inspection and Quarantine of China GB3838, 2002) and drinking water sanitary standard (Ministry of Health & National Standardization Management Committee of China GB5749, 2006) of China revealed that 88 % of pond and stream water samples investigated were unsuitable for agricultural use and aquaculture water supply, and 50 % of well and spring water samples were unsuitable for drinking water. Moreover, significant cerium (Ce) negative and heavy REEs enrichment was observed after the data were normalized to the Post-Archean Australian Shales (PAAS). Principal component analysis indicated that the mining activity had a more significant impact on local water quality than terrace field farming and poultry breeding activities. Moreover, greater risk of water pollution and adverse effects on local residents' health was observed with closer proximity to mining sites. Overall, these findings indicate that effective measures to prevent contamination of surrounding water bodies from the effects of mining activity are needed.

Lake Chad Total Surface Water Area as Derived from Land Surface Temperature and Radar Remote Sensing Data

Directory of Open Access Journals (Sweden)

Frederick Policelli

2018-02-01

Full Text Available Lake Chad, located in the middle of the African Sahel belt, underwent dramatic decreases in the 1970s and 1980s leaving less than ten percent of its 1960s surface water extent as open water. In this paper, we present an extended record (dry seasons 1988–2016 of the total surface water area of the lake (including both open water and flooded vegetation derived using Land Surface Temperature (LST data (dry seasons 2000–2016 from the NASA Terra MODIS sensor and EUMETSAT Meteosat-based LST measurements (dry seasons 1988–2001 from an earlier study. We also examine the total surface water area for Lake Chad using radar data (dry seasons 2015–2016 from the ESA Sentinel-1a mission. For the limited number of radar data sets available to us (18 data sets, we find on average a close match between the estimates from these data and the corresponding estimates from LST, though we find spatial differences in the estimates using the two types of data. We use these spatial differences to adjust the record (dry seasons 2000–2016 from MODIS LST. Then we use the adjusted record to remove the bias of the existing LST record (dry seasons 1988–2001 derived from Meteosat measurements and combine the two records. From this composite, extended record, we plot the total surface water area of the lake for the dry seasons of 1988–1989 through 2016–2017. We find for the dry seasons of 1988–1989 to 2016–2017 that the maximum total surface water area of the lake was approximately 16,800 sq. km (February and May, 2000, the minimum total surface water area of the lake was approximately 6400 sq. km (November, 1990, and the average was approximately 12,700 sq. km. Further, we find the total surface water area of the lake to be highly variable during this period, with an average rate of increase of approximately 143 km2 per year.

Shallow Water Measurements Using a Single Green Laser Corrected by Building a Near Water Surface Penetration Model

Directory of Open Access Journals (Sweden)

Jianhu Zhao

2017-04-01

Full Text Available To reduce the size and cost of an integrated infrared (IR and green airborne LiDAR bathymetry (ALB system, and improve the accuracy of the green ALB system, this study proposes a method to accurately determine water surface and water bottom heights using a single green laser corrected by the near water surface penetration (NWSP model. The factors that influence the NWSP of green laser are likewise analyzed. In addition, an NWSP modeling method is proposed to determine the relationship between NWSP and the suspended sediment concentration (SSC of the surface layer, scanning angle of a laser beam and sensor height. The water surface and water bottom height models are deduced by considering NWSP and using only green laser based on the measurement principle of the IR laser and green laser, as well as employing the relationship between NWSP and the time delay of the surface return of the green laser. Lastly, these methods and models are applied to a practical ALB measurement. Standard deviations of 3.0, 5.3, and 1.3 cm are obtained by the NWSP, water-surface height, and water-bottom height models, respectively. Several beneficial conclusions and recommendations are drawn through the experiments and discussions.

Fine and coarse components in surface sediments from Bikini Lagoon

Energy Technology Data Exchange (ETDEWEB)

Noshkin, V. E., LLNL

1997-01-01

In 1979, 21 years after the moratorium on nuclear testing in the Marshall Islands, surface sediment samples (to depths of 2 and 4 cm) were collected from 87 locations in the lagoon of Bikini Atoll, one of the two sites in the Marshall Islands used by the United States to test nuclear devices from 1946 through 1958. The main purpose for the collections was to map the distribution of long-lived man-made radionuclides associated with the bottom material. In addition the samples were processed to estimate the fraction of fine and coarse components to show, by comparison, what modifications occurred in the composition since the sediments were first described in samples collected before testing in 1946. Nuclear testing produced more finely divided material that is now found in the surface sediment layer over large areas of the lagoon and especially in regions of the lagoon and reef adjacent to test sites. The 5 cratering events alone at Bikini Atoll redistributed sufficient material to account for the higher inventory of fine material found over the surface 4 cm of the sediment of the lagoon. Although the fraction of fine material in the bottom sediments was altered by the nuclear events, the combined processes of formation, transport and deposition were not sufficiently dynamic to greatly change the general geographical features of the major sedimentary components over most of the lagoon floor.

Analysis of water microdroplet condensation on silicon surfaces

Science.gov (United States)

Honda, Takuya; Fujimoto, Kenya; Yoshimoto, Yuta; Mogi, Katsuo; Kinefuchi, Ikuya; Sugii, Yasuhiko; Takagi, Shu; Univ. of Tokyo Team; Tokyo Inst. of Tech. Team

2016-11-01

We observed the condensation process of water microdroplets on flat silicon (100) surfaces by means of the sequential visualization of the droplets using an environmental scanning electron microscope. As previously reported for nanostructured surfaces, the condensation process of water microdroplets on the flat silicon surfaces also exhibits two modes: the constant base (CB) area mode and the constant contact angle (CCA) mode. In the CB mode, the contact angle increases with time while the base diameter is constant. Subsequently, in the CCA mode, the base diameter increases with time while the contact angle remains constant. The dropwise condensation model regulated by subcooling temperature does not reproduce the experimental results. Because the subcooling temperature is not constant in the case of a slow condensation rate, this model is not applicable to the condensation of the long time scale ( several tens of minutes). The contact angle of water microdroplets ( several μm) tended to be smaller than the macro contact angle. Two hypotheses are proposed as the cause of small contact angles: electrowetting and the coalescence of sub- μm water droplets.

Non-equilibrium Thermodynamic Dissolution Theory for Multi-Component Solid/Liquid Surfaces Involving Surface Adsorption and Radiolysis Kinetics

International Nuclear Information System (INIS)

Stout, R B

2001-01-01

A theoretical expression is developed for the dissolution rate response for multi-component radioactive materials that have surface adsorption kinetics and radiolysis kinetics when wetted by a multi-component aqueous solution. An application for this type of dissolution response is the performance evaluation of multi-component spent nuclear fuels (SNFs) for long term interim storage and for geological disposition. Typically, SNF compositions depend on initial composition, uranium oxide and metal alloys being most common, and on reactor burnup which results in a wide range of fission product and actinide concentrations that decay by alpha, beta, and gamma radiation. These compositional/burnup ranges of SNFs, whether placed in interim storage or emplaced in a geologic repository, will potentially be wetted by multi-component aqueous solutions, and these solutions may be further altered by radiolytic aqueous species due to three radiation fields. The solid states of the SNFs are not thermodynamically stable when wetted and will dissolve, with or without radiolysis. The following development of a dissolution theory is based on a non-equilibrium thermodynamic analysis of energy reactions and energy transport across a solid-liquid phase change discontinuity that propagates at a quasi-steady, dissolution velocity. The integral form of the energy balance equation is used for this spatial surface discontinuity analysis. The integral formulation contains internal energy functional of classical thermodynamics for both the SNFs' solid state and surface adsorption species, and the adjacent liquid state, which includes radiolytic chemical species. The steady-state concentrations of radiolytic chemical species are expressed by an approximate analysis of the decay radiation transport equation. For purposes of illustration a modified Temkin adsorption isotherm was assumed for the surface adsorption kinetics on an arbitrary, finite area of the solid-liquid dissolution interface. For

Modification of surface properties of LLDPE by water plasma discharge

International Nuclear Information System (INIS)

Chantara Thevy Ratnam; Hill, D.J.T.; Firas Rasoul; Whittaker, A.K.; Imelda Keen

2007-01-01

Linear low density polyethylene (LLDPE) surface was modified by water plasma treatment. The LLDPE surface was treated at 10 and 20 W discharge power at various exposure times. A laboratory scale Megatherm radio frequency (RF) plasma apparatus that operates at 27 MHz was used to generate the water plasmas. The changes in chemical structure of the LLDPE polymeric chain upon plasma treatment were characterized by FTIR and XPS techniques. The selectivity of trifluoroacetic anhydride (TFAA) toward hydroxyl groups is used to quantify the hydroxyl groups formed on the polymer surface upon plasma treatment. After exposition to the plasma discharge a decline in water contact angle were observed. FTIR and XPS measurements indicate an oxidation of degraded polymeric chains and creation of hydroxyl, carbonyl, ether, ester and carboxyl groups. Chemical derivatization with TFAA of water plasma treated polymer surfaces has shown that under the conditions employed, a very small (less than 5%) of the oxygen introduced by the water plasma treatment was present as hydroxyl group. (Author)

The influence of lithology on surface water sources | Science ...

Science.gov (United States)

Understanding the temporal and spatial variability of surface water sources within a basin is vital to our ability to manage the impacts of climate variability and land cover change. Water stable isotopes can be used as a tool to determine geographic and seasonal sources of water at the basin scale. Previous studies in the Coastal Range of Oregon reported that the variation in the isotopic signatures of surface water does not conform to the commonly observed “rainout effect”, which exhibits a trend of increasing isotopic depletion with rising elevation. The primary purpose of this research is to investigate the mechanisms governing seasonal and spatial variations in the isotopic signature of surface waters within the Marys River Basin, located in the leeward side of the Oregon Coastal Range. Surface water and precipitation samples were collected every 2-3 weeks for isotopic analysis of δ18O and δ2H for one year. Results indicate a significant difference in isotopic signature between watersheds underlain by basalt and sandstone. The degree of separation was the most distinct during the summer when low flows reflect deeper groundwater sources, whereas isotopic signatures during the rainy season (fall and winter) showed a greater degree of similarity between the two lithologies. This indicates that baseflow within streams drained by sandstone versus basalt is being supplied from two distinctly separate water sources. In addition, Marys River flow at the outle

Contamination levels of human pharmaceutical compounds in French surface and drinking water.

Science.gov (United States)

Mompelat, S; Thomas, O; Le Bot, B

2011-10-01

The occurrence of 20 human pharmaceutical compounds and metabolites from 10 representative therapeutic classes was analysed from resource and drinking water in two catchment basins located in north-west France. 98 samples were analysed from 63 stations (surface water and drinking water produced from surface water). Of the 20 human pharmaceutical compounds selected, 16 were quantified in both the surface water and drinking water, with 22% of the values above the limit of quantification for surface water and 14% for drinking water). Psychostimulants, non-steroidal anti-inflammatory drugs, iodinated contrast media and anxiolytic drugs were the main therapeutic classes of human pharmaceutical compounds detected in the surface water and drinking water. The results for surface water were close to results from previous studies in spite of differences in prescription rates of human pharmaceutical compounds in different countries. The removal rate of human pharmaceutical compounds at 11 water treatment units was also determined. Only caffeine proved to be resistant to drinking water treatment processes (with a minimum rate of 5%). Other human pharmaceutical compounds seemed to be removed more efficiently (average elimination rate of over 50%) by adsorption onto activated carbon and oxidation/disinfection with ozone or chlorine (not taking account of the disinfection by-products). These results add to the increasing evidence of the occurrence of human pharmaceutical compounds in drinking water that may represent a threat to human beings exposed to a cocktail of human pharmaceutical compounds and related metabolites and by-products in drinking water.

Lawrence Livermore National Laboratory Surface Water Protection: A Watershed Approach

Energy Technology Data Exchange (ETDEWEB)

Coty, J

2009-03-16

This surface water protection plan (plan) provides an overview of the management efforts implemented at Lawrence Livermore National Laboratory (LLNL) that support a watershed approach to protect surface water. This plan fulfills a requirement in the Department of Energy (DOE) Order 450.1A to demonstrate a watershed approach for surface water protection that protects the environment and public health. This plan describes the use of a watershed approach within which the Laboratory's current surface water management and protections efforts have been structured and coordinated. With more than 800 million acres of land in the U.S. under federal management and stewardship, a unified approach across agencies provides enhanced resource protection and cost-effectiveness. The DOE adopted, along with other federal agencies, the Unified Federal Policy for a Watershed Approach to Federal Land and Resource Management (UFP) with a goal to protect water quality and aquatic ecosystems on federal lands. This policy intends to prevent and/or reduce water pollution from federal activities while fostering a cost-effective watershed approach to federal land and resource management. The UFP also intends to enhance the implementation of existing laws (e.g., the Clean Water Act [CWA] and National Environmental Policy Act [NEPA]) and regulations. In addition, this provides an opportunity for the federal government to serve as a model for water quality stewardship using a watershed approach for federal land and resource activities that potentially impact surface water and its uses. As a federal land manager, the Laboratory is responsible for a small but important part of those 800 million acres of land. Diverse land uses are required to support the Laboratory's mission and provide an appropriate work environment for its staff. The Laboratory comprises two sites: its main site in Livermore, California, and the Experimental Test Site (Site 300), near Tracy, California. The main site

Surface Water Connectivity, Flow Pathways and Water Level Fluctuation in a Cold Region Deltaic Ecosystem

Science.gov (United States)

Peters, D. L.; Niemann, O.; Skelly, R.; Monk, W. A.; Baird, D. J.

2017-12-01

The Peace-Athabasca Delta (PAD) is a 6000 km2 deltaic floodplain ecosystem of international importance (Wood Buffalo National Park, Ramsar Convention, UNESCO World Heritage, and SWOT satellite water level calibration/validation site). The low-relief floodplain formed at the confluence of the Peace, Athabasca and Birch rivers with Lake Athabasca. More than 1000 wetland and lake basins have varying degrees of connectivity to the main flow system. Hydroperiod and water storage is influenced by ice-jam and open-water inundations and prevailing semi-arid climate that control water drawdown. Prior studies have identified pathways of river-to-wetland floodwater connection and historical water level fluctuation/trends as a key knowledge gaps, limiting our knowledge of deltaic ecosystem status and potential hydroecological responses to climate change and upstream water alterations to flow contributions. To address this knowledge gap, surface elevation mapping of the PAD has been conducted since 2012 using aerial remote sensing Light Detection and Ranging (LiDAR), plus thousands of ground based surface and bathymetric survey points tied to Global Positioning System (GPS) were obtained. The elevation information was used to develop a high resolution digital terrain model to simulate and investigate surface water connectivity. Importantly, the surveyed areas contain a set of wetland monitoring sites where ground-based surface water connectivity, water level/depth, water quality, and aquatic ecology (eg, vegetation, macroinvertebrate and muskrat) have been examined. The goal of this presentation is to present an assessment of: i) surface water fluctuation and connectivity for PAD wetland sites; ii) 40+ year inter-annual hydroperiod reconstruction for a perched basin using a combination of field measurements, remote sensing estimates, and historical documents; and iii) outline an approach to integrate newly available hydro-bio-geophysical information into a novel, multi

Drinking Water Sources with Surface Intakes from LDHH source data, Geographic NAD83, LOSCO (1999) [drinking_water_surface_intakes_LDHH_1999

Data.gov (United States)

Louisiana Geographic Information Center — This is a point dataset for 87 public drinking water sources with surface intakes. It was derived from a larger statewide general drinking water source dataset...

The interaction between surface water and groundwater and its ...

Indian Academy of Sciences (India)

Surface water; groundwater; stable isotopes; water quality; Second Songhua River basin. .... The total dissolved solid (TDS) was calculated by the con- centrations of major ions in ...... evaluating water quality management effectiveness; J.

Surface Water Data at Los Alamos National Laboratory 2006 Water Year

Energy Technology Data Exchange (ETDEWEB)

R.P. Romero, D. Ortiz, G. Kuyumjian

2007-08-01

The principal investigators collected and computed surface water discharge data from 44 stream-gaging stations that cover most of Los Alamos National Laboratory and one at Bandelier National Monument. Also included are discharge data from three springs--two that flow into Canon de Valle and one that flows into Water Canyon--and peak flow data for 44 stations.

Safety analysis of water cooled components inside the JET thermonuclear fusion tokamak

International Nuclear Information System (INIS)

Ageladarakis, P.; O'Dowd, N.; Papastergiou, S.

1998-04-01

The transient thermal behaviour of a number of components, installed in the vessel of the world's largest Fusion Tokamak (JET) has been examined with a theoretical model, which simulated normal operational conditions and abnormal scenarios namely: Loss of Coolant Flow; Loss of Torus Vacuum; and combinations. A number of theoretical results related to water and cryogenically cooled devices have been validated by a comprehensive experimental campaign conducted both inside the JET plasma chamber and in a test rig. The performance of water cooled components which may be subjected to boiling or freeze-up risks in case of a Loss of Water Flow event has also been analysed. Time constants of transient temperature changes were determined by the model while protective actions were prescribed in order to safeguard the equipment against associated risks. A completely automatic safety protection system has been designed on the basis of these analyses and implemented in the routine JET operation. During operation of JET the safety code reacted several times within the specified time limits and protected the relevant components during real off-normal events. (author)

Impinging Water Droplets on Inclined Glass Surfaces

Energy Technology Data Exchange (ETDEWEB)

Armijo, Kenneth Miguel [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lance, Blake [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ho, Clifford K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2017-09-01

Multiphase computational models and tests of falling water droplets on inclined glass surfaces were developed to investigate the physics of impingement and potential of these droplets to self-clean glass surfaces for photovoltaic modules and heliostats. A multiphase volume-of-fluid model was developed in ANSYS Fluent to simulate the impinging droplets. The simulations considered different droplet sizes (1 mm and 3 mm), tilt angles (0°, 10°, and 45°), droplet velocities (1 m/s and 3 m/s), and wetting characteristics (wetting=47° contact angle and non-wetting = 93° contact angle). Results showed that the spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) decreased with increasing inclination angle due to the reduced normal force on the surface. The hydrophilic surface yielded greater spread factors than the hydrophobic surface in all cases. With regard to impact forces, the greater surface tilt angles yielded lower normal forces, but higher shear forces. Experiments showed that the experimentally observed spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) was significantly larger than the simulated spread factor. Observed spread factors were on the order of 5 - 6 for droplet velocities of ~3 m/s, whereas the simulated spread factors were on the order of 2. Droplets were observed to be mobile following impact only for the cases with 45° tilt angle, which matched the simulations. An interesting phenomenon that was observed was that shortly after being released from the nozzle, the water droplet oscillated (like a trampoline) due to the "snapback" caused by the surface tension of the water droplet being released from the nozzle. This oscillation impacted the velocity immediately after the release. Future work should evaluate the impact of parameters such as tilt angle and surface wettability on the impact of particle/soiling uptake and removal to investigate ways that

Molecular dynamics study of room temperature ionic liquids with water at mica surface

Directory of Open Access Journals (Sweden)

Huanhuan Zhang

2018-04-01

Full Text Available Water in room temperature ionic liquids (RTILs could impose significant effects on their interfacial properties at a charged surface. Although the interfaces between RTILs and mica surfaces exhibit rich microstructure, the influence of water content on such interfaces is little understood, in particular, considering the fact that RTILs are always associated with water due to their hygroscopicity. In this work, we studied how different types of RTILs and different amounts of water molecules affect the RTIL-mica interfaces, especially the water distribution at mica surfaces, using molecular dynamics (MD simulation. MD results showed that (1 there is more water and a thicker water layer adsorbed on the mica surface as the water content increases, and correspondingly the average location of K+ ions is farther from mica surface; (2 more water accumulated at the interface with the hydrophobic [Emim][TFSI] than in case of the hydrophilic [Emim][BF4] due to the respective RTIL hydrophobicity and ion size. A similar trend was also observed in the hydrogen bonds formed between water molecules. Moreover, the 2D number density map of adsorbed water revealed that the high-density areas of water seem to be related to K+ ions and silicon/aluminum atoms on mica surface. These results are of great importance to understand the effects of hydrophobicity/hydrophicility of RTIL and water on the interfacial microstructure at electrified surfaces. Keywords: Room temperature ionic liquids, Hydrophobicity/hydrophicility, Water content, Electrical double layer, Mica surface

Graded changes in enamel component volumes resulted from a short tooth bleaching procedure.

Science.gov (United States)

Ferreira, Artemisa Fernanda Moura; Perez, Flávia Maria de Moraes Ramos; Limeira Júnior, Francisco de Assis; de Moura, Mirella de Fátima Liberato; de Sousa, Frederico Barbosa

2016-05-01

To test the hypothesis that changes in enamel component volumes (mineral, organic, and water volumes, and permeability) are graded from outer to inner enamel after a short bleaching procedure. Extracted unerupted human third molars had half of their crowns bleached (single bleaching session, 3 × 15 min), and tooth shade changes in bleached parts were analyzed with a spectrophotometer. Ground sections were prepared, component volumes and permeability were quantified at histological points located at varying distances from the enamel surface (n=10 points/location), representing conditions before and after bleaching. Tooth shade changes were significant (pbleaching, except at the outer layers. Multiple analysis of covariances revealed that most of the variance of the change in enamel composition after bleaching was explained by the combination of the set of types of component volume (in decreasing order of relevance: mineral loss, organic gain, water gain, and decrease in permeability) with the set of distances from the enamel surface (graded from the enamel surface inward) (canonical R(2)=0.97; p99%). Changes in enamel composition after a short bleaching procedure followed a gradient within component volumes (mineral loss>organic gain>water gain>decrease in permeability) and decreased from the enamel surface inward. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

Energy Technology Data Exchange (ETDEWEB)

Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

2016-05-15

Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

Surface WAter Scenario Help (SWASH) version 5.3 : technical description

NARCIS (Netherlands)

Roller, te J.A.; Berg, van den F.; Adriaanse, P.I.; Jong, de A.; Beltman, W.H.J.

2015-01-01

The user-friendly shell SWASH, acronym for Surface WAter Scenarios Help, assists the user in calculating pesticide exposure concentrations in the EU FOCUS surface water scenarios. SWASH encompasses five separate tools and models: (i) FOCUS Drift Calculator, calculating pesticide entries through

Boron content of South African surface waters: prelimenary assessment for irrigation

International Nuclear Information System (INIS)

Reid, P.C.; Davies, E.

1989-01-01

Boron, a naturally occuring constituent of surface and ground water, is an essential plant nutrient. However, at relatively low concentrations, boron becomes toxic to plant growth. In order to assess the boron status in South African surface waters, the Department of Water Affairs launched a long-term boron water quality assessment programme in 1985, encompassing the analysis of water samples taken at 91 sites throughout South Africa. Results to date indicate that the boron concentration in South African surface waters varies between 0,02 to 0,33 mg l -1 . At these concentrations even the most boron sensitive crops can be grown without fear of boron toxicity. 3 refs., 1 fig., 2 tabs

Radionuclide transfer onto ground surface in surface water flow. 2. Undisturbed tuff rock

International Nuclear Information System (INIS)

Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu

1994-09-01

Radionuclide migration with ground surface water flow is considered to be one of path ways in the scenario for environmental migration of the radionuclide leaked from LLRW depository. To study the radionuclide migration demonstratively, a ground surface radionuclide migration test was carried out by simulating radioactive solution flowing on the sloped tuff rock surface. Tuff rock sample of 240 cm in length taken from the Shimokita district was used to test the transfer of 60 Co, 85 Sr and 137 Cs onto the sample surface from the flowing radioactive solution under restricted infiltration condition at flow rates of 25, 80, 160ml/min and duration of 56h. The concentration change of the radionuclides in effluent was nearly constant as a function of elapsed time during the experimental period, but decreased with lower flow rates. Among the three radionuclides, 137 Cs was greatly decreased its concentration to 30% of the inflow. Adsorbed distribution of the radionuclides concentration on the ground surface decreased gradually with the distance from the inlet, and showed greater gradient at lower flow rate. Analyzing the result by the migration model, where a vertical advection distribution and two-dimensional diffusion in surface water are adopted with a first order adsorption reaction, value of migration parameters was obtained relating to the radionuclide adsorption and the surface water flow, and the measured distribution could be well simulated by adopting the value to the model. By comparing the values with the case of loamy soil layer, all values of the migration parameters showed not so great difference between two samples for 60 Co and 85 Sr. For 137 Cs, reflecting a few larger value of adsorption to the tuff rock, larger ability to reduce the concentration of flowing radioactive solution could be indicated than that to the loamy soil surface by estimation for long flowed distance. (author)

Hydrologic Science and Satellite Measurements of Surface Water (Invited)

Science.gov (United States)

Alsdorf, D. E.; Mognard, N. M.; Lettenmaier, D. P.

2010-12-01

While significant advances continue to be made for satellite measurements of surface waters, important science and application opportunities remain. Examples include the following: (1) Our current methods of measuring floodwater dynamics are either sparsely distributed or temporally inadequate. As an example, flood depths are measured by using high water marks, which capture only the peak of the flood wave, not its temporal variability. (2) Discharge is well measured at individual points along stream networks using in-situ gauges, but these do not capture within-reach hydraulic variability such as the water surface slope changes on the rising and falling limbs of flood waves. (3) Just a 1.0 mm/day error in ET over the Congo Basin translates to a 35,000 m3/s discharge error. Knowing the discharge of the Congo River and its many tributaries should significantly improve our understanding of the water balance throughout the basin. The Congo is exemplary of many other basins around the globe. (4) Arctic hydrology is punctuated by millions of unmeasured lakes. Globally, there might be as many as 30 million lakes larger than a hectare. Storage changes in these lakes are nearly unknown, but in the Arctic such changes are likely an indication of global warming. (5) Well over 100 rivers cross international boundaries, yet the sharing of water data is poor. Overcoming this helps to better manage the entire river basin while also providing a better assessment of potential water related disasters. The Surface Water and Ocean Topography (SWOT, http://swot.jpl.nasa.gov/) mission is designed to meet these needs by providing global measurements of surface water hydrodynamics. SWOT will allow estimates of discharge in rivers wider than 100m (50m goal) and storage changes in water bodies larger than 250m by 250m (and likely as small as one hectare).

Small-Scale Morphological Features on a Solid Surface Processed by High-Pressure Abrasive Water Jet

Directory of Open Access Journals (Sweden)

Can Kang

2013-08-01

Full Text Available Being subjected to a high-pressure abrasive water jet, solid samples will experience an essential variation of both internal stress and physical characteristics, which is closely associated with the kinetic energy attached to the abrasive particles involved in the jet stream. Here, experiments were performed, with particular emphasis being placed on the kinetic energy attenuation and turbulent features in the jet stream. At jet pressure of 260 MPa, mean velocity and root-mean-square (RMS velocity on two jet-stream sections were acquired by utilizing the phase Doppler anemometry (PDA technique. A jet-cutting experiment was then carried out with Al-Mg alloy samples being cut by an abrasive water jet. Morphological features and roughness on the cut surface were quantitatively examined through scanning electron microscopy (SEM and optical profiling techniques. The results indicate that the high-pressure water jet is characterized by remarkably high mean flow velocities and distinct velocity fluctuations. Those irregular pits and grooves on the cut surfaces indicate both the energy attenuation and the development of radial velocity components in the jet stream. When the sample is positioned with different distances from the nozzle outlet, the obtained quantitative surface roughness varies accordingly. A descriptive model highlighting the behaviors of abrasive particles in jet-cutting process is established in light of the experimental results and correlation analysis.

Small-Scale Morphological Features on a Solid Surface Processed by High-Pressure Abrasive Water Jet.

Science.gov (United States)

Kang, Can; Liu, Haixia

2013-08-14

Being subjected to a high-pressure abrasive water jet, solid samples will experience an essential variation of both internal stress and physical characteristics, which is closely associated with the kinetic energy attached to the abrasive particles involved in the jet stream. Here, experiments were performed, with particular emphasis being placed on the kinetic energy attenuation and turbulent features in the jet stream. At jet pressure of 260 MPa, mean velocity and root-mean-square (RMS) velocity on two jet-stream sections were acquired by utilizing the phase Doppler anemometry (PDA) technique. A jet-cutting experiment was then carried out with Al-Mg alloy samples being cut by an abrasive water jet. Morphological features and roughness on the cut surface were quantitatively examined through scanning electron microscopy (SEM) and optical profiling techniques. The results indicate that the high-pressure water jet is characterized by remarkably high mean flow velocities and distinct velocity fluctuations. Those irregular pits and grooves on the cut surfaces indicate both the energy attenuation and the development of radial velocity components in the jet stream. When the sample is positioned with different distances from the nozzle outlet, the obtained quantitative surface roughness varies accordingly. A descriptive model highlighting the behaviors of abrasive particles in jet-cutting process is established in light of the experimental results and correlation analysis.

Systems Reliability Framework for Surface Water Sustainability and Risk Management

Science.gov (United States)

Myers, J. R.; Yeghiazarian, L.

2016-12-01

framework will significantly improve the efficiency and precision of sustainable watershed management strategies through providing a better understanding of how watershed characteristics and environmental parameters affect surface water quality and sustainability. With microbial contamination posing a serious threat to the availability of clean water across the world, it is necessary to develop a framework that evaluates the safety and sustainability of water systems in respect to non-point source fecal microbial contamination. The concept of water safety is closely related to the concept of failure in reliability theory. In water quality problems, the event of failure can be defined as the concentration of microbial contamination exceeding a certain standard for usability of water. It is pertinent in watershed management to know the likelihood of such an event of failure occurring at a particular point in space and time. Microbial fate and transport are driven by environmental processes taking place in complex, multi-component, interdependent environmental systems that are dynamic and spatially heterogeneous, which means these processes and therefore their influences upon microbial transport must be considered stochastic and variable through space and time. A physics-based stochastic model of microbial dynamics is presented that propagates uncertainty using a unique sampling method based on artificial neural networks to produce a correlation between watershed characteristics and spatial-temporal probabilistic patterns of microbial contamination. These results are used to address the question of water safety through several sustainability metrics: reliability, vulnerability, resilience and a composite sustainability index. System reliability is described uniquely though the temporal evolution of risk along watershed points or pathways. Probabilistic resilience describes how long the system is above a certain probability of failure, and the vulnerability metric describes how

Observation of dynamic water microadsorption on Au surface

Energy Technology Data Exchange (ETDEWEB)

Huang, Xiaokang, E-mail: xiaokang.huang@tqs.com; Gupta, Gaurav; Gao, Weixiang; Tran, Van; Nguyen, Bang; McCormick, Eric; Cui, Yongjie; Yang, Yinbao; Hall, Craig; Isom, Harold [TriQuint Semiconductor, Inc., 500 W Renner Road, Richardson, Texas 75080 (United States)

2014-05-15

Experimental and theoretical research on water wettability, adsorption, and condensation on solid surfaces has been ongoing for many decades because of the availability of new materials, new detection and measurement techniques, novel applications, and different scales of dimensions. Au is a metal of special interest because it is chemically inert, has a high surface energy, is highly conductive, and has a relatively high melting point. It has wide applications in semiconductor integrated circuitry, microelectromechanical systems, microfluidics, biochips, jewelry, coinage, and even dental restoration. Therefore, its surface condition, wettability, wear resistance, lubrication, and friction attract a lot of attention from both scientists and engineers. In this paper, the authors experimentally investigated Au{sub 2}O{sub 3} growth, wettability, roughness, and adsorption utilizing atomic force microscopy, scanning electron microscopy, reflectance spectrometry, and contact angle measurement. Samples were made using a GaAs substrate. Utilizing a super-hydrophilic Au surface and the proper surface conditions of the surrounding GaAs, dynamic microadsorption of water on the Au surface was observed in a clean room environment. The Au surface area can be as small as 12 μm{sup 2}. The adsorbed water was collected by the GaAs groove structure and then redistributed around the structure. A model was developed to qualitatively describe the dynamic microadsorption process. The effective adsorption rate was estimated by modeling and experimental data. Devices for moisture collection and a liquid channel can be made by properly arranging the wettabilities or contact angles of different materials. These novel devices will be very useful in microfluid applications or biochips.

Economic Impacts of Surface Mining on Household Drinking Water Supplies

Science.gov (United States)

This report provides information on the economic and social impacts of contaminated surface and ground water supplies on residents and households near surface mining operations. The focus is on coal slurry contamination of water supplies in Mingo County, West Virginia, and descr...

Effect of Surface-mantle Water Exchange Parameterizations on Exoplanet Ocean Depths

Science.gov (United States)

Komacek, Thaddeus D.; Abbot, Dorian S.

2016-11-01

Terrestrial exoplanets in the canonical habitable zone may have a variety of initial water fractions due to random volatile delivery by planetesimals. If the total planetary water complement is high, the entire surface may be covered in water, forming a “waterworld.” On a planet with active tectonics, competing mechanisms act to regulate the abundance of water on the surface by determining the partitioning of water between interior and surface. Here we explore how the incorporation of different mechanisms for the degassing and regassing of water changes the volatile evolution of a planet. For all of the models considered, volatile cycling reaches an approximate steady state after ∼ 2 {Gyr}. Using these steady states, we find that if volatile cycling is either solely dependent on temperature or seafloor pressure, exoplanets require a high abundance (≳ 0.3 % of total mass) of water to have fully inundated surfaces. However, if degassing is more dependent on seafloor pressure and regassing mainly dependent on mantle temperature, the degassing rate is relatively large at late times and a steady state between degassing and regassing is reached with a substantial surface water fraction. If this hybrid model is physical, super-Earths with a total water fraction similar to that of the Earth can become waterworlds. As a result, further understanding of the processes that drive volatile cycling on terrestrial planets is needed to determine the water fraction at which they are likely to become waterworlds.

Water on graphene surfaces

Energy Technology Data Exchange (ETDEWEB)

Gordillo, M C [Departamento de Sistemas Fisicos, Quimicos y Naturales, Facultad de Ciencias Experimentales, Universidad Pablo de Olavide, Carretera de Utrera, km 1, E-41013 Sevilla (Spain); Marti, J, E-mail: cgorbar@upo.e, E-mail: jordi.marti@upc.ed [Departament de Fisica i Enginyeria Nuclear, Universitat Politecnica de Catalunya, B4-B5 Campus Nord, E-08034 Barcelona, Catalonia (Spain)

2010-07-21

In this paper, we summarize the main results obtained in our group about the behavior of water confined inside or close to different graphene surfaces by means of molecular dynamics simulations. These include the inside and outside of carbon nanotubes, and the confinement inside a slit pore or a single graphene sheet. We paid special attention to some thermodynamical (binding energies), structural (hydrogen-bond distributions) and dynamic (infrared spectra) properties, and their comparison to their bulk counterparts.

Concentration data for anthropogenic organic compounds in ground water, surface water, and finished water of selected community water systems in the United States, 2002-05

Science.gov (United States)

Carter, Janet M.; Delzer, Gregory C.; Kingsbury, James A.; Hopple, Jessica A.

2007-01-01

The National Water-Quality Assessment Program of the U.S. Geological Survey began implementing Source Water-Quality Assessments (SWQAs) in 2001 that focus on characterizing the quality of source water and finished water of aquifers and major rivers used by some of the larger community water systems (CWSs) in the United States. As used for SWQA studies, source water is the raw (ambient) water collected at the supply well prior to water treatment (for ground water) or the raw (ambient) water collected from the river near the intake (for surface water), and finished water is the water that is treated and ready to be delivered to consumers. Finished water is collected before entering the distribution system. SWQA studies are conducted in two phases, and the objectives of SWQA studies are twofold: (1) to determine the occurrence and, for rivers, seasonal changes in concentrations of a broad list of anthropogenic organic compounds (AOCs) in aquifers and rivers that have some of the largest withdrawals for drinking-water supply (phase 1), and (2) for those AOCs found to occur most frequently in source water, characterize the extent to which these compounds are present in finished water (phase 2). These objectives were met for SWQA studies by collecting ground-water and surface-water (source) samples and analyzing these samples for 258 AOCs during phase 1. Samples from a subset of wells and surface-water sites located in areas with substantial agricultural production in the watershed were analyzed for 19 additional AOCs, for a total of 277 compounds analyzed for SWQA studies. The 277 compounds were classified according to the following 13 primary use or source groups: (1) disinfection by-products; (2) fumigant-related compounds; (3) fungicides; (4) gasoline hydrocarbons, oxygenates, and oxygenate degradates; (5) herbicides and herbicide degradates; (6) insecticides and insecticide degradates; (7) manufacturing additives; (8) organic synthesis compounds; (9) pavement- and

Spatially telescoping measurements for improved characterization of groundwater-surface water interactions

Science.gov (United States)

Kikuchi, Colin; Ferre, Ty P.A.; Welker, Jeffery M.

2012-01-01

The suite of measurement methods available to characterize fluxes between groundwater and surface water is rapidly growing. However, there are few studies that examine approaches to design of field investigations that include multiple methods. We propose that performing field measurements in a spatially telescoping sequence improves measurement flexibility and accounts for nested heterogeneities while still allowing for parsimonious experimental design. We applied this spatially telescoping approach in a study of ground water-surface water (GW-SW) interaction during baseflow conditions along Lucile Creek, located near Wasilla, Alaska. Catchment-scale data, including channel geomorphic indices and hydrogeologic transects, were used to screen areas of potentially significant GW-SW exchange. Specifically, these data indicated increasing groundwater contribution from a deeper regional aquifer along the middle to lower reaches of the stream. This initial assessment was tested using reach-scale estimates of groundwater contribution during baseflow conditions, including differential discharge measurements and the use of chemical tracers analyzed in a three-component mixing model. The reach-scale measurements indicated a large increase in discharge along the middle reaches of the stream accompanied by a shift in chemical composition towards a regional groundwater end member. Finally, point measurements of vertical water fluxes -- obtained using seepage meters as well as temperature-based methods -- were used to evaluate spatial and temporal variability of GW-SW exchange within representative reaches. The spatial variability of upward fluxes, estimated using streambed temperature mapping at the sub-reach scale, was observed to vary in relation to both streambed composition and the magnitude of groundwater contribution from differential discharge measurements. The spatially telescoping approach improved the efficiency of this field investigation. Beginning our assessment

Reprint of "How do components of real cloud water affect aqueous pyruvate oxidation?"

Science.gov (United States)

Boris, Alexandra J.; Desyaterik, Yury; Collett, Jeffrey L.

2015-01-01

Chemical oxidation of dissolved volatile or semi-volatile organic compounds within fog and cloud droplets in the atmosphere could be a major pathway for secondary organic aerosol (SOA) formation. This proposed pathway consists of: (1) dissolution of organic chemicals from the gas phase into a droplet; (2) reaction with an aqueous phase oxidant to yield low volatility products; and (3) formation of particle phase organic matter as the droplet evaporates. The common approach to simulating aqueous SOA (aqSOA) reactions is photo-oxidation of laboratory standards in pure water. Reactions leading to aqSOA formation should be studied within real cloud and fog water to determine whether additional competing processes might alter apparent rates of reaction as indicated by rates of reactant loss or product formation. To evaluate and identify the origin of any cloud water matrix effects on one example of observed aqSOA production, pyruvate oxidation experiments simulating aqSOA formation were monitored within pure water, real cloud water samples, and an aqueous solution of inorganic salts. Two analysis methods were used: online electrospray ionization high-resolution time-of-flight mass spectrometry (ESI-HR-ToF-MS), and offline anion exchange chromatography (IC) with quantitative conductivity and qualitative ESI-HR-ToF-MS detection. The apparent rate of oxidation of pyruvate was slowed in cloud water matrices: overall measured degradation rates of pyruvate were lower than in pure water. This can be at least partially accounted for by the observed formation of pyruvate from reactions of other cloud water components. Organic constituents of cloud water also compete for oxidants and/or UV light, contributing to the observed slowed degradation rates of pyruvate. The oxidation of pyruvate was not significantly affected by the presence of inorganic anions (nitrate and sulfate) at cloud-relevant concentrations. Future bulk studies of aqSOA formation reactions using simplified

Method of providing extended life expectancy for components of boiling water reactors

International Nuclear Information System (INIS)

Niedrach, L.W.

1992-01-01

This patent describes a containment for a boiling water nuclear reactor, a stainless steel containment, the containment having a deposit of a metal of the platinum group of metals on the surfaces thereof exposed to high temperature, high pressure water of the boiling water nuclear reactor

Perfluoroalkyl substances in the Maltese Environment - (I) Surface water and rain water

NARCIS (Netherlands)

Sammut, G.; Sinagra, E.; Helmus, R.; de Voogt, P.

2017-01-01

The presence of perfluoroalkyl substances (PFASs) in rain water on the Maltese Islands is reported here for the first time and an extensive survey of these substances in surface water also reported. The Maltese archipelago lies at the centre of the Mediterranean Sea and consists of three main

Distribution coefficients for chemical components of a coal-oil/water system

Energy Technology Data Exchange (ETDEWEB)

Picel, K C; Stamoudis, V C; Simmons, M S

1988-09-01

Distribution coefficients (K/sub D/) were measured by equilibrating a coal oil comparative reference material (CRM-1) with water and then separating the oil and water phases. Aqueous phase concentrations were determined by direct analysis of this phase, while organic phase concentrations were determined from the original oil composition by difference. The log K/sub D/ values obtained for acidic and basic components were generally <3, while those for the neutral components ranged from 3 to 6. For aromatic hydrocarbons, strong correlations were observed between log K/sub D/ and log S/sub w/ (water solubility), and between log K/sub D/ and log K/sub o//sub w/ (octanol/water partition coefficient). Alkylated benzenes had significantly higher K/sub D/s than did unsubstituted aromatics of similar molecular weight. Examination of homologs revealed an increase of 0.307 log K/sub D/ units per additional carbon atom for polynuclear aromatic hydrocarbons having from 10 to 16 carbons. Alkyl substituent effects determined for various sets of homologs ranged from 0.391 to 0.466 log K/sub d/ units per -CH/sub 2/- group added. 38 refs., 5 figs., 7 tabs.

Novel Americium Treatment Process for Surface Water and Dust Suppression Water

International Nuclear Information System (INIS)

Tiepel, E.W.; Pigeon, P.; Nesta, S.; Anderson, J.

2006-01-01

The Rocky Flats Environmental Technology Site (RFETS), a former nuclear weapons production plant, has been remediated under CERCLA and decommissioned to become a National Wildlife Refuge. The site conducted this cleanup effort under the Rocky Flats Cleanup Agreement (RFCA) that established limits for the discharge of surface and process waters from the site. At the end of 2004, while a number of process buildings were undergoing decommissioning, routine monitoring of a discharge pond (Pond A-4) containing approximately 28 million gallons of water was discovered to have been contaminated with a trace amount of Americium-241 (Am-241). While the amount of Am-241 in the pond waters was very low (0.5 - 0.7 pCi/l), it was above the established Colorado stream standard of 0.15 pCi/l for release to off site drainage waters. The rapid successful treatment of these waters to the regulatory limit was important to the site for two reasons. The first was that the pond was approaching its hold-up limit. Without rapid treatment and release of the Pond A-4 water, typical spring run-off would require water management actions to other drainages onsite or a mass shuttling of water for disposal. The second reason was that this type of contaminated water had not been treated to the stringent stream standard at Rocky Flats before. Technical challenges in treatment could translate to impacts on water and secondary waste management, and ultimately, cost impacts. All of the technical challenges and specific site criteria led to the conclusion that a different approach to the treatment of this problem was necessary and a crash treatability program to identify applicable treatment techniques was undertaken. The goal of this program was to develop treatment options that could be implemented very quickly and would result in the generation of no high volume secondary waste that would be costly to dispose. A novel chemical treatment system was developed and implemented at the RFETS to treat Am

Enhanced load-carrying capacity of hairy surfaces floating on water.

Science.gov (United States)

Xue, Yahui; Yuan, Huijing; Su, Weidong; Shi, Yipeng; Duan, Huiling

2014-05-08

Water repellency of hairy surfaces depends on the geometric arrangement of these hairs and enables different applications in both nature and engineering. We investigate the mechanism and optimization of a hairy surface floating on water to obtain its maximum load-carrying capacity by the free energy and force analyses. It is demonstrated that there is an optimum cylinder spacing, as a result of the compromise between the vertical capillary force and the gravity, so that the hairy surface has both high load-carrying capacity and mechanical stability. Our analysis makes it clear that the setae on water striders' legs or some insects' wings are in such an optimized geometry. Moreover, it is shown that surface hydrophobicity can further increase the capacity of a hairy surface with thick cylinders, while the influence is negligible when the cylinders are thin.

Antibacterial performance of polypropylene nonwoven fabric wound dressing surfaces containing passive and active components

International Nuclear Information System (INIS)

Xin, Zhirong; Du, Shanshan; Zhao, Chunyu; Chen, Hao; Sun, Miao; Yan, Shunjie; Luan, Shifang; Yin, Jinghua

2016-01-01

Graphical abstract: - Highlights: • PNVP and PHMG components were covalently immobilized on PP_N_W_F surface. • PP_N_W_F-g-PNVP-PHMG possessed bacterial adhesion-resistant and bactericidal capabilities. • PP_N_W_F-g-PNVP-PHMG obviously suppressed platelet and red blood cell adhesion. - Abstract: A growing number of wound dressing-related nosocomial infections necessitate the development of novel antibacterial strategies. Herein, polypropylene non-woven fabric (PP_N_W_F) was facilely modified with passive and active antibacterial components, namely photografting polymerization both N-Vinyl-2-pyrrolidone (NVP) and glycidyl methacrylate (GMA) monomers, and the introduction of guanidine polymer through the reaction between active amino groups and epoxy groups. The modified samples were confirmed by attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR), X-ray photoelectron spectroscopy (XPS), respectively. Water contact angle measurement, antibacterial test, platelet and red blood cell adhesion were used to evaluate the hydrophilicity, antibacterial properties and hemocompatibility of the samples. It was found that the antibacterial properties were obviously enhanced, meanwhile significantly suppressing platelet and red blood cell adhesion after the above modification. This PP_N_W_F samples that possess antifouling and antimicrobial properties, have great potential in wound dressing applications.

Simulation of the Regional Ground-Water-Flow System and Ground-Water/Surface-Water Interaction in the Rock River Basin, Wisconsin

Science.gov (United States)

Juckem, Paul F.

2009-01-01

A regional, two-dimensional, areal ground-water-flow model was developed to simulate the ground-water-flow system and ground-water/surface-water interaction in the Rock River Basin. The model was developed by the U.S. Geological Survey (USGS), in cooperation with the Rock River Coalition. The objectives of the regional model were to improve understanding of the ground-water-flow system and to develop a tool suitable for evaluating the effects of potential regional water-management programs. The computer code GFLOW was used because of the ease with which the model can simulate ground-water/surface-water interactions, provide a framework for simulating regional ground-water-flow systems, and be refined in a stepwise fashion to incorporate new data and simulate ground-water-flow patterns at multiple scales. The ground-water-flow model described in this report simulates the major hydrogeologic features of the modeled area, including bedrock and surficial aquifers, ground-water/surface-water interactions, and ground-water withdrawals from high-capacity wells. The steady-state model treats the ground-water-flow system as a single layer with hydraulic conductivity and base elevation zones that reflect the distribution of lithologic groups above the Precambrian bedrock and a regionally significant confining unit, the Maquoketa Formation. In the eastern part of the Basin where the shale-rich Maquoketa Formation is present, deep ground-water flow in the sandstone aquifer below the Maquoketa Formation was not simulated directly, but flow into this aquifer was incorporated into the GFLOW model from previous work in southeastern Wisconsin. Recharge was constrained primarily by stream base-flow estimates and was applied uniformly within zones guided by regional infiltration estimates for soils. The model includes average ground-water withdrawals from 1997 to 2006 for municipal wells and from 1997 to 2005 for high-capacity irrigation, industrial, and commercial wells. In addition

Polyfluorinated chemicals in European surface waters, ground- and drinking waters

NARCIS (Netherlands)

Eschauzier, C.; de Voogt, P.; Brauch, H.-J.; Lange, F.T.; Knepper, T.P.; Lange, F.T.

2012-01-01

Polyfluorinated chemicals (PFCs), especially short chain fluorinated alkyl sulfonates and carboxylates, are ubiquitously found in the environment. This chapter aims at giving an overview of PFC concentrations found in European surface, ground- and drinking waters and their behavior during

Effect of high-extraction coal mining on surface and ground waters

International Nuclear Information System (INIS)

Kendorski, F.S.

1993-01-01

Since first quantified around 1979, much new data have become available. In examining the sources of data and the methods and intents of the researchers of over 65 case histories, it became apparent that the strata behaviors were being confused with overlapping vertical extents reported for the fractured zones and aquiclude zones depending on whether the researcher was interested in water intrusion into the mine or in water loss from surface or ground waters. These more recent data, and critical examination of existing data, have led to the realization that the former Aquiclude Zone defined for its ability to prevent or minimize the intrusion of ground or surface waters into mines has another important character in increasing storage of surface and shallow ground waters in response to mining with no permanent loss of waters. This zone is here named the Dilated Zone. Surface and ground waters can drain into this zone, but seldom into the mine, and can eventually be recovered through closing of dilations by mine subsidence progression away from the area, or filling of the additional void space created, or both. A revised model has been developed which accommodates the available data, by modifying the zones as follows: collapse and disaggregation extending 6 to 10 times the mined thickness above the panel; continuous fracturing extending approximately 24 times the mined thickness above the panel, allowing temporary drainage of intersected surface and ground waters; development of a zone of dilated, increased storativity, and leaky strata with little enhanced vertical permeability from 24 to 60 times the mined thickness above the panel above the continuous fracturing zone, and below the constrained or surface effects zones; maintenance of a constrained but leaky zone above the dilated zone and below the surface effects zone; and limited surface fracturing in areas of extension extending up to 50 ft or so beneath the ground surface. 119 ref., 5 figs., 2 tabs

Prediction of radionuclide accumulation in main ecosystem components of NPP cooling water reservoirs and assessment of acceptable radionuclide disposal into water reservoir

International Nuclear Information System (INIS)

Egorov, Yu.A.; Kazakov, S.V.

1987-01-01

The problems of prediction of radionuclide accumulation in ecosystem main components of NPP cooling water-reservoirs (CWR) and assessment of radionuclide acceptable disposal into water reservoir are considered. Two models are nessecary for the calculation technique: model of radionuclide migration and accumulation in CWR ecosystem components and calculation model of population dose commitment due to water consumption (at the public health approach to the normalization of the NPP radioactive effect on CWC) or calculation model of dose commitment on hydrocenosis components (at the ecological approach to the normalization). Analytical calculations and numerical calculation results in the model CWC, located in the USSR middle region, are presented

Using IR Imaging of Water Surfaces for Estimating Piston Velocities

Science.gov (United States)

Gålfalk, M.; Bastviken, D.; Arneborg, L.

2013-12-01

The transport of gasses dissolved in surface waters across the water-atmosphere interface is controlled by the piston velocity (k). This coefficient has large implications for, e.g., greenhouse gas fluxes but is challenging to quantify in situ. At present, empirical k-wind speed relationships from a small number of studies and systems are often extrapolated without knowledge of model performance. It is therefore of interest to search for new methods for estimating k, and to compare the pros and cons of existing and new methods. Wind speeds in such models are often measured at a height of 10 meters. In smaller bodies of water such as lakes, wind speeds can vary dramatically across the surface through varying degrees of wind shadow from e.g. trees at the shoreline. More local measurements of the water surface, through wave heights or surface motion mapping, could give improved k-estimates over a surface, also taking into account wind fetch. At thermal infrared (IR) wavelengths water has very low reflectivity (depending on viewing angle) than can go below 1%, meaning that more than 99% is heat radiation giving a direct measurement of surface temperature variations. Using an IR camera at about 100 frames/s one could map surface temperature structures at a fraction of a mm depth even with waves present. In this presentation I will focus on IR imaging as a possible tool for estimating piston velocities. Results will be presented from IR field measurements, relating the motions of surface temperature structures to k calculated from other simultaneous measurements (flux chamber and ADV-Based Dissipation Rate), but also attempting to calculate k directly from the IR surface divergence. A relation between wave height and k will also be presented.

Polarization Patterns of Transmitted Celestial Light under Wavy Water Surfaces

Directory of Open Access Journals (Sweden)

Guanhua Zhou

2017-03-01

Full Text Available This paper presents a model to describe the polarization patterns of celestial light, which includes sunlight and skylight, when refracted by wavy water surfaces. The polarization patterns and intensity distribution of refracted light through the wave water surface were calculated. The model was validated by underwater experimental measurements. The experimental and theoretical values agree well qualitatively. This work provides a quantitative description of the repolarization and transmittance of celestial light transmitted through wave water surfaces. The effects of wind speed and incident sources on the underwater refraction polarization patterns are discussed. Scattering skylight dominates the polarization patterns while direct solar light is the dominant source of the intensity of the underwater light field. Wind speed has an influence on disturbing the patterns under water.

Calcium carbonate nucleation in an alkaline lake surface water, Pyramid Lake, Nevada, USA

Science.gov (United States)

Reddy, Michael M.; Hoch, Anthony

2012-01-01

Calcium concentration and calcite supersaturation (Ω) needed for calcium carbonate nucleation and crystal growth in Pyramid Lake (PL) surface water were determined during August of 1997, 2000, and 2001. PL surface water has Ω values of 10-16. Notwithstanding high Ω, calcium carbonate growth did not occur on aragonite single crystals suspended PL surface water for several months. However, calcium solution addition to PL surface-water samples caused reproducible calcium carbonate mineral nucleation and crystal growth. Mean PL surface-water calcium concentration at nucleation was 2.33 mM (n = 10), a value about nine times higher than the ambient PL surface-water calcium concentration (0.26 mM); mean Ω at nucleation (109 with a standard deviation of 8) is about eight times the PL surface-water Ω. Calcium concentration and Ω regulated the calcium carbonate formation in PL nucleation experiments and surface water. Unfiltered samples nucleated at lower Ω than filtered samples. Calcium concentration and Ω at nucleation for experiments in the presence of added particles were within one standard deviation of the mean for all samples. Calcium carbonate formation rates followed a simple rate expression of the form, rate (mM/min) = A (Ω) + B. The best fit rate equation "Rate (Δ mM/Δ min) = -0.0026 Ω + 0.0175 (r = 0.904, n = 10)" was statistically significant at greater than the 0.01 confidence level and gives, after rearrangement, Ω at zero rate of 6.7. Nucleation in PL surface water and morphology of calcium carbonate particles formed in PL nucleation experiments and in PL surface-water samples suggest crystal growth inhibition by multiple substances present in PL surface water mediates PL calcium carbonate formation, but there is insufficient information to determine the chemical nature of all inhibitors.

Accelerator system for producing two-component beams for studies of interactive surface effects

International Nuclear Information System (INIS)

Kaminsky, M.; Das, S.K.; Ekern, R.; Hess, D.C.

1977-01-01

For studies of interactive surface effects caused by the simultaneous bombardment of targets by both chemically active and inactive ion species (e.g., D + and He + , respectively) a two beam component accelerator facility was placed in operation. One component, consisting of light ions (e.g., H, D, He) is accelerated by a 2-MV Van de Graaff accelerator which provides a mass analyzed and focussed beam for the energy range from approximately 100-keV to 2-MeV (for singly charged ions). The other component is a beam of light ions in the energy range from approximately 10-keV to 100-keV. This is furnished by a 100-kV dc accelerator system which provides a mass analyzed focussed beam. This beam is guided into the beam line of the Van de Graaff accelerator electrostatically, and with the aid of beam steerers it is made to be co-axial with the Van de Graaff generated beam. The angle of incidence becomes hereby a free parameter for the interaction of the mixed beams with a surface. For each beam component, current densities of 650 μA cm -2 on target can readily be obtained. In order to reduce carbon contamination of the irradiated targets significantly, stainless steel beam lines have been used together with a combination of turbomolecular pumps and ion-sublimation pumps.A total pressure of 2 to 3 x 10 -8 torr in the beam lines and of 2 x 10 -9 torr in the target chamber can be obtained readily. Experimental results on the surface damage of Ni bombarded simultaneously with He + and D + ions are presented. The importance of such studies of interactive surface effects for the controlled thermonuclear fusion program are discussed

The impact of uncontrolled waste disposal on surface water quality ...

African Journals Online (AJOL)

The main threat to the surface water quality in Addis Ababa is environmental pollution derived from domestic and industrial activities. Due to the inadequacy of controlled waste management strategies and waste treatment plants, people are forced to discharge wastes both on open surface and within water bodies.

On-line component ratio measurement of oil/gas/water mixtures using an admittance sensor

Energy Technology Data Exchange (ETDEWEB)

Andersen, J A

1984-01-01

The operator of a production platform is primarily interested in which types of fluids a well is producing and how quickly these different components are being produced. The component ratio and production rate of a well vary during the life of a field. To optimize production, measurement of each well's output is thus desirable. Current designs for subsea production systems lack means of continuously measuring three-component flows. A new method of component ratio measurement is described. The fraction of oil, gas and water flowing between two insulated electrode plates is determined by measuring both the electrical conductance and suseptance across the sensor. A preliminary evaluation of the new measurement system has been performed using a process oil/ water/air mixture. The method is not limited to small pipe diameters. The only possible limitation is that for low velocities in very large pipe diameters an in-line mixer may be required. Advantages of this new system are that real-time measurement of void fraction and water content is possible if a non-intrusive rugged sensor is used, and there are no range limitations, as each component may be measured for any given concentration. 4 references.

Water surface deformation in strong electrical fields and its influence on electrical breakdown in a metal pin-water electrode system

International Nuclear Information System (INIS)

Bruggeman, Peter; Graham, Leigh; Groote, Joris de; Vierendeels, Jan; Leys, Christophe

2007-01-01

Electrical breakdown and water surface deformation in a metal pin-water electrode system with dc applied voltages is studied for small inter-electrode distances (2-12 mm). The radius of curvature of the metal pin is 0.5 cm to exclude corona before breakdown at these small inter-electrode spacings. Calculations of the water surface deformation as a function of the applied voltage and initial inter-electrode spacing are compared with measurements of the water elevation. For distances smaller than 7 mm the calculated stability limit of the water surface corresponds with the experimentally obtained breakdown voltage. It is proved with fast CCD images and calculations of the electrical field distribution that the water surface instability triggers the electrical breakdown in this case. The images show that at breakdown the water surface has a Taylor cone-like shape. At inter-electrode distance of 7 mm and larger the breakdown voltage is well below the water stability limit and the conductive channel at breakdown is formed between the pin electrode and the static water surface. Both cases are discussed and compared

A global, 30-m resolution land-surface water body dataset for 2000

Science.gov (United States)

Feng, M.; Sexton, J. O.; Huang, C.; Song, D. X.; Song, X. P.; Channan, S.; Townshend, J. R.

2014-12-01

Inland surface water is essential to terrestrial ecosystems and human civilization. The distribution of surface water in space and its change over time are related to many agricultural, environmental and ecological issues, and are important factors that must be considered in human socioeconomic development. Accurate mapping of surface water is essential for both scientific research and policy-driven applications. Satellite-based remote sensing provides snapshots of Earth's surface and can be used as the main input for water mapping, especially in large areas. Global water areas have been mapped with coarse resolution remotely sensed data (e.g., the Moderate Resolution Imaging Spectroradiometer (MODIS)). However, most inland rivers and water bodies, as well as their changes, are too small to map at such coarse resolutions. Landsat TM (Thematic Mapper) and ETM+ (Enhanced Thematic Mapper Plus) imagery has a 30m spatial resolution and provides decades of records (~40 years). Since 2008, the opening of the Landsat archive, coupled with relatively lower costs associated with computing and data storage, has made comprehensive study of the dynamic changes of surface water over large even global areas more feasible. Although Landsat images have been used for regional and even global water mapping, the method can hardly be automated due to the difficulties on distinguishing inland surface water with variant degrees of impurities and mixing of soil background with only Landsat data. The spectral similarities to other land cover types, e.g., shadow and glacier remnants, also cause misidentification. We have developed a probabilistic based automatic approach for mapping inland surface water bodies. Landsat surface reflectance in multiple bands, derived water indices, and data from other sources are integrated to maximize the ability of identifying water without human interference. The approach has been implemented with open-source libraries to facilitate processing large

Water redistribution at the soil surface : ponding and surface runoff in flat areas

NARCIS (Netherlands)

Appels, W.M.

2013-01-01

In The Netherlands, one of the most important targets for the improvement of surface water quality as aimed for in the European Water Framework Directive, is the reduction of nutrient concentrations (both nitrogen and phosphorus). To identify the most suitable and effective measures for reducing the

UV sensitivity of planktonic net community production in ocean surface waters

OpenAIRE

Regaudie de Gioux, Aurore; Agustí, Susana; Duarte, Carlos M.

2014-01-01

The net plankton community metabolism of oceanic surface waters is particularly important as it more directly affects the partial pressure of CO2 in surface waters and thus the air-sea fluxes of CO2. Plankton communities in surface waters are exposed to high irradiance that includes significant ultraviolet blue (UVB, 280-315 nm) radiation. UVB radiation affects both photosynthetic and respiration rates, increase plankton mortality rates, and other metabolic and chemical processes. Here we tes...

Surface Water Quality Assessment and Prioritize the Factors Pollute This Water Using Topsis Fuzzy Hierarchical Analysis

Directory of Open Access Journals (Sweden)

Mehdi Komasi

2017-03-01

Full Text Available Background & Objective: Nowadays, according to growth of industry and increasing population, water resources are seriousely shortened. This lack of water resources will require special management to be considered in industry and agriculture. Among the various sources of water, surface waters are more susceptible to infection. The most important of these sources of pollution are industrial pollution, detergent, pesticides, radioactive materials, heat and salt concentration.  Materials & methods: In this article, at first the importance of each pollutant will be evaluated base on the effects and its results and then quality evaluation of surface water will be studied. In order to assess the relative importance of these pollutants primarily using TOPSIS software, prioritize these factors as one of the hierarchical analysis and then is modeled with decision tree method using Weka software, the importance of each factor is evaluated and if it does not meet the minimal importance of the decision tree will be removed. Results: The results obtained from the Topsis fuzzy analysis indicate that surface water and groundwater are exposed to pollution about 74% and 26% respectively among the six pollutants examined in this study. In addition, results obtaned from the hierarchical tree in software Weka has shown that the heat factor, soluble salts and industrial pollutants give impac factor or purity about 0.1338, 0.0523 and 1.2694 respectively. Conclusion: Surface water is at greater risk of being polluted compared with groundwater. The heat factor and low concentration of dissolved salts have the low impact and industrial pollutants are considered as the most influential factors in surface water pollution.

Surface layer scintillometry for estimating the sensible heat flux component of the surface energy balance

Directory of Open Access Journals (Sweden)

M. J. Savage

2010-01-01

Full Text Available The relatively recently developed scintillometry method, with a focus on the dual-beam surface layer scintillometer (SLS, allows boundary layer atmospheric turbulence, surface sensible heat and momentum flux to be estimated in real-time. Much of the previous research using the scintillometer method has involved the large aperture scintillometer method, with only a few studies using the SLS method. The SLS method has been mainly used by agrometeorologists, hydrologists and micrometeorologists for atmospheric stability and surface energy balance studies to obtain estimates of sensible heat from which evaporation estimates representing areas of one hectare or larger are possible. Other applications include the use of the SLS method in obtaining crucial input parameters for atmospheric dispersion and turbulence models. The SLS method relies upon optical scintillation of a horizontal laser beam between transmitter and receiver for a separation distance typically between 50 and 250 m caused by refractive index inhomogeneities in the atmosphere that arise from turbulence fluctuations in air temperature and to a much lesser extent the fluctuations in water vapour pressure. Measurements of SLS beam transmission allow turbulence of the atmosphere to be determined, from which sub-hourly, real-time and in situ path-weighted fluxes of sensible heat and momentum may be calculated by application of the Monin-Obukhov similarity theory. Unlike the eddy covariance (EC method for which corrections for flow distortion and coordinate rotation are applied, no corrections to the SLS measurements, apart from a correction for water vapour pressure, are applied. Also, path-weighted SLS estimates over the propagation path are obtained. The SLS method also offers high temporal measurement resolution and usually greater spatial coverage compared to EC, Bowen ratio energy balance, surface renewal and other sensible heat measurement methods. Applying the shortened surface

A new reference evapotranspiration surface for the National Water Census community

Science.gov (United States)

Verdin, J. P.; Hobbins, M. T.; Senay, G. B.

2012-12-01

To meet its congressional mandate to provide water managers with accurate, up-to-date, scientifically defensible reporting on the national water cycle—the National Water Census—the USGS has developed a framework for ongoing estimation of actual evapotranspiration (ET) combining both land-based and remotely sensed (R/S) drivers and is transferable to observation-scarce regions. To provide ET at Census-required resolutions (~100-1000 m), we combine (i) an operational, long-term, high-quality, scientific record of reference crop ET (ETrc), (ii) R/S land-surface temperature (LST) and reflectance at finer spatial scales but coarser temporal scales, and (iii) the USDA Annual Cropland Data Layer as a geographic mask for cropped surfaces. Our presentation motivates this new ET framework and describes its ETrc input. The ETrc is generated by the Penman-Monteith equation, driven by hourly, 0.125-degree (~12-km) NLDAS data, from Jan 1, 1979, to within five days of the present. This is the first consistently modeled, daily, continent-wide ETrc dataset that is both up-to-date and as temporally extensive. The R/S component relies on this input to provide an ETrc magnitude at coarse scale relative to the imagery. Remote sensing of LST and/or surface reflectance permits inference of ET as a fraction of ETrc. One such method used by the USGS is the Simplified Surface Energy Balance (SSEB) approach, which adapted the hot and cold pixel approach of SEBAL/METRIC; an operational version (SSEBop) calculates ET-fraction for a given pixel and combines it with ETrc to estimate and map ET on a routine basis with a high degree of consistency at multiple spatial scales. Though these imagery options have limited temporal coverage due to the time between satellite overpasses (1 to 8 days for MODIS, 16 days for Landsat), ET-fraction so derived is stable on such time scales. Thus, as ETrc varies significantly across the diurnal cycle and inter-overpass periods, it is used to track conditions

Evaluation Of The Hydraulic Connection Between The Surface Water And The Groundwater Along El-Salam Canal, North Eastern Coast, Egypt

International Nuclear Information System (INIS)

Ismail, Y.L.; Ismail, N.A.; Abdel Mogheeth, S.M.; Salem, W.M.

2012-01-01

In the present study, the interconnection between the surface water of El-Salam Canal and the shallow groundwater in the adjacent aquifer has been discussed using both the environmental isotopes and the chemical analyses of the different water bodies along the canal trajectory from Faraskour in the west to Balousa in the east. The isotopic techniques were applied to investigate this relationship and to estimate the possible contribution from various sources such as groundwater, sea water and/or irrigation water, and finally to determine the extent of mixing between El-Salam Canal and the adjacent aquifers. Since the groundwater in the area is saline (more than 10000 ppm) while the mixed canal water is mainly fresh (less than 1000 ppm), the interconnection between the canal water and surrounding shallow groundwater leads to one of the following two hydrologic processes; seepage from the canal water to the shallow groundwater which means fresh water losses or leakage from the groundwater into the surface water which means water quality deterioration The present study aims to detect the hydraulic interconnection between the two water bodies by using environmental isotope techniques as well as detailed chemical analysis. For this purpose, 31 water samples from both surface water and groundwater were collected and analyzed for 18 O and 2 H contents as well as 44 representative water samples were collected and analyzed for the chemical components (anions and cations) as a major ions and minor constituents. The distribution of the analyzed samples on the 18 O vs. D diagram indicated that the samples could be classified into three genetic groups representing different sources of water. The first group reflects a contribution from evaporated rain water prior to infiltration to the groundwater, the second group represents a mixing trend between both of El-Farma drain water and El-Manzala lake water with the groundwater which have enriched isotopic values as well as high

Multi-objective analysis of the conjunctive use of surface water and groundwater in a multisource water supply system

Science.gov (United States)

Vieira, João; da Conceição Cunha, Maria

2017-04-01

A multi-objective decision model has been developed to identify the Pareto-optimal set of management alternatives for the conjunctive use of surface water and groundwater of a multisource urban water supply system. A multi-objective evolutionary algorithm, Borg MOEA, is used to solve the multi-objective decision model. The multiple solutions can be shown to stakeholders allowing them to choose their own solutions depending on their preferences. The multisource urban water supply system studied here is dependent on surface water and groundwater and located in the Algarve region, southernmost province of Portugal, with a typical warm Mediterranean climate. The rainfall is low, intermittent and concentrated in a short winter, followed by a long and dry period. A base population of 450 000 inhabitants and visits by more than 13 million tourists per year, mostly in summertime, turns water management critical and challenging. Previous studies on single objective optimization after aggregating multiple objectives together have already concluded that only an integrated and interannual water resources management perspective can be efficient for water resource allocation in this drought prone region. A simulation model of the multisource urban water supply system using mathematical functions to represent the water balance in the surface reservoirs, the groundwater flow in the aquifers, and the water transport in the distribution network with explicit representation of water quality is coupled with Borg MOEA. The multi-objective problem formulation includes five objectives. Two objective evaluate separately the water quantity and the water quality supplied for the urban use in a finite time horizon, one objective calculates the operating costs, and two objectives appraise the state of the two water sources - the storage in the surface reservoir and the piezometric levels in aquifer - at the end of the time horizon. The decision variables are the volume of withdrawals from

Water surface modeling from a single viewpoint video.

Science.gov (United States)

Li, Chuan; Pickup, David; Saunders, Thomas; Cosker, Darren; Marshall, David; Hall, Peter; Willis, Philip

2013-07-01

We introduce a video-based approach for producing water surface models. Recent advances in this field output high-quality results but require dedicated capturing devices and only work in limited conditions. In contrast, our method achieves a good tradeoff between the visual quality and the production cost: It automatically produces a visually plausible animation using a single viewpoint video as the input. Our approach is based on two discoveries: first, shape from shading (SFS) is adequate to capture the appearance and dynamic behavior of the example water; second, shallow water model can be used to estimate a velocity field that produces complex surface dynamics. We will provide qualitative evaluation of our method and demonstrate its good performance across a wide range of scenes.