WorldWideScience

Sample records for surface protein homologues

  1. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  2. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  3. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  4. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  5. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  6. Lipid-regulated sterol transfer between closely apposed membranes by oxysterol-binding protein homologues.

    Science.gov (United States)

    Schulz, Timothy A; Choi, Mal-Gi; Raychaudhuri, Sumana; Mears, Jason A; Ghirlando, Rodolfo; Hinshaw, Jenny E; Prinz, William A

    2009-12-14

    Sterols are transferred between cellular membranes by vesicular and poorly understood nonvesicular pathways. Oxysterol-binding protein-related proteins (ORPs) have been implicated in sterol sensing and nonvesicular transport. In this study, we show that yeast ORPs use a novel mechanism that allows regulated sterol transfer between closely apposed membranes, such as organelle contact sites. We find that the core lipid-binding domain found in all ORPs can simultaneously bind two membranes. Using Osh4p/Kes1p as a representative ORP, we show that ORPs have at least two membrane-binding surfaces; one near the mouth of the sterol-binding pocket and a distal site that can bind a second membrane. The distal site is required for the protein to function in cells and, remarkably, regulates the rate at which Osh4p extracts and delivers sterols in a phosphoinositide-dependent manner. Together, these findings suggest a new model of how ORPs could sense and regulate the lipid composition of adjacent membranes.

  7. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  8. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  9. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  10. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul

    2009-01-01

    Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  11. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA-binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul

    2009-01-01

    Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  12. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  13. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  14. An archaebacterial homologue of the essential eubacterial cell division protein FtsZ.

    Science.gov (United States)

    Baumann, P; Jackson, S P

    1996-06-25

    Life falls into three fundamental domains--Archaea, Bacteria, and Eucarya (formerly archaebacteria, eubacteria, and eukaryotes,. respectively). Though Archaea lack nuclei and share many morphological features with Bacteria, molecular analyses, principally of the transcription and translation machineries, have suggested that Archaea are more related to Eucarya than to Bacteria. Currently, little is known about the archaeal cell division apparatus. In Bacteria, a crucial component of the cell division machinery is FtsZ, a GTPase that localizes to a ring at the site of septation. Interestingly, FtsZ is distantly related in sequence to eukaryotic tubulins, which also interact with GTP and are components of the eukaryotic cell cytoskeleton. By screening for the ability to bind radiolabeled nucleotides, we have identified a protein of the hyperthermophilic archaeon Pyrococcus woesei that interacts tightly and specifically with GTP. Furthermore, through screening an expression library of P. woesei genomic DNA, we have cloned the gene encoding this protein. Sequence comparisons reveal that the P. woesei GTP-binding protein is strikingly related in sequence to eubacterial FtsZ and is marginally more similar to eukaryotic tubulins than are bacterial FtsZ proteins. Phylogenetic analyses reinforce the notion that there is an evolutionary linkage between FtsZ and tubulins. These findings suggest that the archaeal cell division apparatus may be fundamentally similar to that of Bacteria and lead us to consider the evolutionary relationships between Archaea, Bacteria, and Eucarya.

  15. The ATM homologue MEC1 is required for phosphorylation of replication protein A in yeast

    International Nuclear Information System (INIS)

    Brush, G.S.; Morrow, D.M.; Hieter, P.; Kelly, T.J.

    1996-01-01

    Replication protein A (RPA) is a highly conserved single-stranded DNA-binding protein, required for cellular DNA replication, repair, and recombination. In human cells, RPA is phosphorylated during the S and G2 phases of the cell cycle and also in response to ionizing or ultraviolet radiation. Saccharomyces cerevisiae exhibits a similar pattern of cell cycle-regulated RPA phosphorylation, and our studies indicate that the radiation-induced reactions occur in yeast as well. We have examined yeast RPA phosphorylation during the normal cell cycle and in response to environmental insult, and have demonstrated that the checkpoint gene MEC1 is required for the reaction under all conditions tested. Through examination of several checkpoint mutants, we have placed RPA phosphorylation in a novel pathway of the DNA damage response. MEC1 is similar in sequence to human ATM, the gene mutated in patients with ataxia-telangiectasia (A-T). A-T cells are deficient in multiple checkpoint pathways and are hypersensitive to killing by ionizing radiation. Because A-T cells exhibit a delay in ionizing radiation-induced RPA phosphorylation, our results indicate a functional similarity between MEC1 and ATM, and suggest that RPA phosphorylation is involved in a conserved eukaryotic DNA damage-response pathway defective in A-T

  16. Tumor cell surface proteins

    International Nuclear Information System (INIS)

    Kennel, S.J.; Braslawsky, G.R.; Flynn, K.; Foote, L.J.; Friedman, E.; Hotchkiss, J.A.; Huang, A.H.L.; Lankford, P.K.

    1982-01-01

    Cell surface proteins mediate interaction between cells and their environment. Unique tumor cell surface proteins are being identified and quantified in several tumor systems to address the following questions: (i) how do tumor-specific proteins arise during cell transformation; (ii) can these proteins be used as markers of tumor cell distribution in vivo; (iii) can cytotoxic drugs be targeted specifically to tumor cells using antibody; and (iv) can solid state radioimmunoassay of these proteins provide a means to quantify transformation frequencies. A tumor surface protein of 180,000 M/sub r/ (TSP-180) has been identified on cells of several lung carcinomas of BALB/c mice. TSP-180 was not detected on normal lung tissue, embryonic tissue, or other epithelial or sarcoma tumors, but it was found on lung carcinomas of other strains of mice. Considerable amino acid sequence homology exists among TSP-180's from several cell sources, indicating that TSP-180 synthesis is directed by normal cellular genes although it is not expressed in normal cells. The regulation of synthesis of TSP-180 and its relationship to normal cell surface proteins are being studied. Monoclonal antibodies (MoAb) to TSP-180 have been developed. The antibodies have been used in immunoaffinity chromatography to isolate TSP-180 from tumor cell sources. This purified tumor antigen was used to immunize rats. Antibody produced by these animals reacted at different sites (epitopes) on the TSP-180 molecule than did the original MoAb. These sera and MoAb from these animals are being used to identify normal cell components related to the TSP-180 molecule

  17. Protein surface shielding agents in protein crystallization

    International Nuclear Information System (INIS)

    Hašek, J.

    2011-01-01

    The crystallization process can be controlled by protein surface shielding agents blocking undesirable competitive adhesion modes during non-equilibrium processes of deposition of protein molecules on the surface of growing crystalline blocks. The hypothesis is based on a number of experimental proofs from diffraction experiments and also retrieved from the Protein Data Bank. The molecules adhering temporarily on the surface of protein molecules change the propensity of protein molecules to deposit on the crystal surface in a definite position and orientation. The concepts of competitive adhesion modes and protein surface shielding agents acting on the surface of molecules in a non-equilibrium process of protein crystallization provide a useful platform for the control of crystallization. The desirable goal, i.e. a transient preference of a single dominating adhesion mode between protein molecules during crystallization, leads to uniform deposition of proteins in a crystal. This condition is the most important factor for diffraction quality and thus also for the accuracy of protein structure determination. The presented hypothesis is a generalization of the experimentally well proven behaviour of hydrophilic polymers on the surface of protein molecules of other compounds

  18. Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

    Science.gov (United States)

    Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

    2003-10-01

    In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

  19. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  20. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  1. Hydrophobic patches on protein surfaces

    NARCIS (Netherlands)

    Lijnzaad, P.

    2007-01-01

    Hydrophobicity is a prime determinant of the structure and function of proteins. It is the driving force behind the folding of soluble proteins, and when exposed on the surface, it is frequently involved in recognition and binding of ligands and other proteins. The energetic cost of

  2. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  3. Bacterial motility complexes require the actin-like protein, MreB and the Ras homologue, MglA.

    Science.gov (United States)

    Mauriello, Emilia M F; Mouhamar, Fabrice; Nan, Beiyan; Ducret, Adrien; Dai, David; Zusman, David R; Mignot, Tâm

    2010-01-20

    Gliding motility in the bacterium Myxococcus xanthus uses two motility engines: S-motility powered by type-IV pili and A-motility powered by uncharacterized motor proteins and focal adhesion complexes. In this paper, we identified MreB, an actin-like protein, and MglA, a small GTPase of the Ras superfamily, as essential for both motility systems. A22, an inhibitor of MreB cytoskeleton assembly, reversibly inhibited S- and A-motility, causing rapid dispersal of S- and A-motility protein clusters, FrzS and AglZ. This suggests that the MreB cytoskeleton is involved in directing the positioning of these proteins. We also found that a DeltamglA motility mutant showed defective localization of AglZ and FrzS clusters. Interestingly, MglA-YFP localization mimicked both FrzS and AglZ patterns and was perturbed by A22 treatment, consistent with results indicating that both MglA and MreB bind to motility complexes. We propose that MglA and the MreB cytoskeleton act together in a pathway to localize motility proteins such as AglZ and FrzS to assemble the A-motility machineries. Interestingly, M. xanthus motility systems, like eukaryotic systems, use an actin-like protein and a small GTPase spatial regulator.

  4. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    Science.gov (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  5. Structural domains required for channel function of the mouse transient receptor potential protein homologue TRP1beta.

    Science.gov (United States)

    Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen

    2002-07-17

    Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.

  6. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

    Science.gov (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

    2018-01-01

    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  7. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

    Science.gov (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

    2015-07-01

    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  8. CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

    DEFF Research Database (Denmark)

    Madsen, Jens; Tornøe, Ida; Nielsen, Ole

    2003-01-01

    CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

  9. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

    Science.gov (United States)

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

    2009-09-01

    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  10. Competitive Protein Adsorption - Multilayer Adsorption and Surface Induced Protein Aggregation

    DEFF Research Database (Denmark)

    Holmberg, Maria; Hou, Xiaolin

    2009-01-01

    In this study, competitive adsorption of albumin and IgG (immunoglobulin G) from human serum solutions and protein mixtures onto polymer surfaces is studied by means of radioactive labeling. By using two different radiolabels (125I and 131I), albumin and IgG adsorption to polymer surfaces...... is monitored simultaneously and the influence from the presence of other human serum proteins on albumin and IgG adsorption, as well as their mutual influence during adsorption processes, is investigated. Exploring protein adsorption by combining analysis of competitive adsorption from complex solutions...... of high concentration with investigation of single protein adsorption and interdependent adsorption between two specific proteins enables us to map protein adsorption sequences during competitive protein adsorption. Our study shows that proteins can adsorb in a multilayer fashion onto the polymer surfaces...

  11. Rapid comparison of properties on protein surface.

    Science.gov (United States)

    Sael, Lee; La, David; Li, Bin; Rustamov, Raif; Kihara, Daisuke

    2008-10-01

    The mapping of physicochemical characteristics onto the surface of a protein provides crucial insights into its function and evolution. This information can be further used in the characterization and identification of similarities within protein surface regions. We propose a novel method which quantitatively compares global and local properties on the protein surface. We have tested the method on comparison of electrostatic potentials and hydrophobicity. The method is based on 3D Zernike descriptors, which provides a compact representation of a given property defined on a protein surface. Compactness and rotational invariance of this descriptor enable fast comparison suitable for database searches. The usefulness of this method is exemplified by studying several protein families including globins, thermophilic and mesophilic proteins, and active sites of TIM beta/alpha barrel proteins. In all the cases studied, the descriptor is able to cluster proteins into functionally relevant groups. The proposed approach can also be easily extended to other surface properties. This protein surface-based approach will add a new way of viewing and comparing proteins to conventional methods, which compare proteins in terms of their primary sequence or tertiary structure.

  12. Characterizing the statistical properties of protein surfaces

    Science.gov (United States)

    Bak, Ji Hyun; Bitbol, Anne-Florence; Bialek, William

    Proteins and their interactions form the body of the signaling transduction pathway in many living systems. In order to ensure the accuracy as well as the specificity of signaling, it is crucial that proteins recognize their correct interaction partners. How difficult, then, is it for a protein to discriminate its correct interaction partner(s) from the possibly large set of other proteins it may encounter in the cell? An important ingredient of recognition is shape complementarity. The ensemble of protein shapes should be constrained by the need for maintaining functional interactions while avoiding spurious ones. To address this aspect of protein recognition, we consider the ensemble of proteins in terms of the shapes of their surfaces. We take into account the high-resolution structures of E.coli non-DNA-binding cytoplasmic proteins, retrieved from the Protein Data Bank. We aim to characterize the statistical properties of the protein surfaces at two levels: First, we study the intrinsic dimensionality at the level of the ensemble of the surface objects. Second, at the level of the individual surfaces, we determine the scale of shape variation. We further discuss how the dimensionality of the shape space is linked to the statistical properties of individual protein surfaces. Jhb and WB acknowledge support from National Science Foundation Grants PHY-1305525 and PHY-1521553. AFB acknowledges support from the Human Frontier Science Program.

  13. Interactions between whey proteins and kaolinite surfaces

    International Nuclear Information System (INIS)

    Barral, S.; Villa-Garcia, M.A.; Rendueles, M.; Diaz, M.

    2008-01-01

    The nature of the interactions between whey proteins and kaolinite surfaces was investigated by adsorption-desorption experiments at room temperature, performed at the isoelectric point (IEP) of the proteins and at pH 7. It was found that kaolinite is a strong adsorbent for proteins, reaching the maximum adsorption capacity at the IEP of each protein. At pH 7.0, the retention capacity decreased considerably. The adsorption isotherms showed typical Langmuir characteristics. X-ray diffraction data for the protein-kaolinite complexes showed that protein molecules were not intercalated in the mineral structure, but immobilized at the external surfaces and the edges of the kaolinite. Fourier transform IR results indicate the absence of hydrogen bonding between kaolinite surfaces and the polypeptide chain. The adsorption patterns appear to be related to electrostatic interactions, although steric effects should be also considered

  14. Interactions between whey proteins and kaolinite surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Barral, S. [Department of Chemical Engineering and Environmental Technology, University of Oviedo, Julian Claveria 8, 33006 Oviedo (Spain); Villa-Garcia, M.A. [Department of Organic and Inorganic Chemistry, University of Oviedo, Julian Claveria 8, 33006 Oviedo (Spain)], E-mail: mavg@uniovi.es; Rendueles, M. [Project Management Area, University of Oviedo, Independencia 13, 33004 Oviedo (Spain); Diaz, M. [Department of Chemical Engineering and Environmental Technology, University of Oviedo, Julian Claveria 8, 33006 Oviedo (Spain)

    2008-07-15

    The nature of the interactions between whey proteins and kaolinite surfaces was investigated by adsorption-desorption experiments at room temperature, performed at the isoelectric point (IEP) of the proteins and at pH 7. It was found that kaolinite is a strong adsorbent for proteins, reaching the maximum adsorption capacity at the IEP of each protein. At pH 7.0, the retention capacity decreased considerably. The adsorption isotherms showed typical Langmuir characteristics. X-ray diffraction data for the protein-kaolinite complexes showed that protein molecules were not intercalated in the mineral structure, but immobilized at the external surfaces and the edges of the kaolinite. Fourier transform IR results indicate the absence of hydrogen bonding between kaolinite surfaces and the polypeptide chain. The adsorption patterns appear to be related to electrostatic interactions, although steric effects should be also considered.

  15. Metabolic behavior of cell surface biotinylated proteins

    International Nuclear Information System (INIS)

    Hare, J.F.; Lee, E.

    1989-01-01

    The turnover of proteins on the surface of cultured mammalian cells was measured by a new approach. Reactive free amino or sulfhydryl groups on surface-accessible proteins were derivatized with biotinyl reagents and the proteins solubilized from culture dishes with detergent. Solubilized, biotinylated proteins were then adsorbed onto streptavidin-agarose, released with sodium dodecyl sulfate and mercaptoethanol, and separated on polyacrylamide gels. Biotin-epsilon-aminocaproic acid N-hydroxysuccinimide ester (BNHS) or N-biotinoyl-N'-(maleimidohexanoyl)hydrazine (BM) were the derivatizing agents. Only 10-12 bands were adsorbed onto streptavidin-agarose from undervatized cells or from derivatized cells treated with free avidin at 4 degrees C. Two-dimensional isoelectric focusing-sodium dodecyl sulfate gel electrophoresis resolved greater than 100 BNHS-derivatized proteins and greater than 40 BM-derivatized proteins. There appeared to be little overlap between the two groups of derivatized proteins. Short-term pulse-chase studies showed an accumulation of label into both groups of biotinylated proteins up until 1-2 h of chase and a rapid decrease over the next 1-5 h. Delayed appearance of labeled protein at the cell surface was attributed to transit time from site of synthesis. The unexpected and unexplained rapid disappearance of pulse-labeled proteins from the cell surface was invariant for all two-dimensionally resolved proteins and was sensitive to temperature reduction to 18 degrees C. Long-term pulse-chase experiments beginning 4-8 h after the initiation of chase showed the disappearance of derivatized proteins to be a simple first-order process having a half-life of 115 h in the case of BNHS-derivatized proteins and 30 h in the case of BM-derivatized proteins

  16. Surface protein composition of Aeromonas hydrophila strains virulent for fish: identification of a surface array protein

    International Nuclear Information System (INIS)

    Dooley, J.S.G.; Trust, T.J.

    1988-01-01

    The surface protein composition of members of a serogroup of Aeromonas hydrophila was examined. Immunoblotting with antiserum raised against formalinized whole cells of A. hydrophila TF7 showed a 52K S-layer protein to be the major surface protein antigen, and impermeant Sulfo-NHS-Biotin cell surface labeling showed that the 52K S-layer protein was the only protein accessible to the Sulfo-NHS-Biotin label and effectively masked underlying outer membrane (OM) proteins. In its native surface conformation the 52K S-layer protein was only weakly reactive with a lactoperoxidase 125 I surface iodination procedure. A UV-induced rough lipopolysaccharide (LPS) mutant of TF7 was found to produce an intact S layer, but a deep rough LPS mutant was unable to maintain an array on the cell surface and excreted the S-layer protein into the growth medium, indicating that a minimum LPS oligosaccharide size required for A. hydrophila S-layer anchoring. The native S layer was permeable to 125 I in the lactoperoxidase radiolabeling procedure, and two major OM proteins of molecular weights 30,000 and 48,000 were iodinated. The 48K species was a peptidoglycan-associated, transmembrane protein which exhibited heat-modifiable SDS solubilization behavior characteristic of a porin protein. A 50K major peptidoglycan-associated OM protein which was not radiolabeled exhibited similar SDS heat modification characteristics and possibly represents a second porin protein

  17. Visualisation of variable binding pockets on protein surfaces by probabilistic analysis of related structure sets

    Directory of Open Access Journals (Sweden)

    Ashford Paul

    2012-03-01

    Full Text Available Abstract Background Protein structures provide a valuable resource for rational drug design. For a protein with no known ligand, computational tools can predict surface pockets that are of suitable size and shape to accommodate a complementary small-molecule drug. However, pocket prediction against single static structures may miss features of pockets that arise from proteins' dynamic behaviour. In particular, ligand-binding conformations can be observed as transiently populated states of the apo protein, so it is possible to gain insight into ligand-bound forms by considering conformational variation in apo proteins. This variation can be explored by considering sets of related structures: computationally generated conformers, solution NMR ensembles, multiple crystal structures, homologues or homology models. It is non-trivial to compare pockets, either from different programs or across sets of structures. For a single structure, difficulties arise in defining particular pocket's boundaries. For a set of conformationally distinct structures the challenge is how to make reasonable comparisons between them given that a perfect structural alignment is not possible. Results We have developed a computational method, Provar, that provides a consistent representation of predicted binding pockets across sets of related protein structures. The outputs are probabilities that each atom or residue of the protein borders a predicted pocket. These probabilities can be readily visualised on a protein using existing molecular graphics software. We show how Provar simplifies comparison of the outputs of different pocket prediction algorithms, of pockets across multiple simulated conformations and between homologous structures. We demonstrate the benefits of use of multiple structures for protein-ligand and protein-protein interface analysis on a set of complexes and consider three case studies in detail: i analysis of a kinase superfamily highlights the

  18. Visualisation of variable binding pockets on protein surfaces by probabilistic analysis of related structure sets.

    Science.gov (United States)

    Ashford, Paul; Moss, David S; Alex, Alexander; Yeap, Siew K; Povia, Alice; Nobeli, Irene; Williams, Mark A

    2012-03-14

    Protein structures provide a valuable resource for rational drug design. For a protein with no known ligand, computational tools can predict surface pockets that are of suitable size and shape to accommodate a complementary small-molecule drug. However, pocket prediction against single static structures may miss features of pockets that arise from proteins' dynamic behaviour. In particular, ligand-binding conformations can be observed as transiently populated states of the apo protein, so it is possible to gain insight into ligand-bound forms by considering conformational variation in apo proteins. This variation can be explored by considering sets of related structures: computationally generated conformers, solution NMR ensembles, multiple crystal structures, homologues or homology models. It is non-trivial to compare pockets, either from different programs or across sets of structures. For a single structure, difficulties arise in defining particular pocket's boundaries. For a set of conformationally distinct structures the challenge is how to make reasonable comparisons between them given that a perfect structural alignment is not possible. We have developed a computational method, Provar, that provides a consistent representation of predicted binding pockets across sets of related protein structures. The outputs are probabilities that each atom or residue of the protein borders a predicted pocket. These probabilities can be readily visualised on a protein using existing molecular graphics software. We show how Provar simplifies comparison of the outputs of different pocket prediction algorithms, of pockets across multiple simulated conformations and between homologous structures. We demonstrate the benefits of use of multiple structures for protein-ligand and protein-protein interface analysis on a set of complexes and consider three case studies in detail: i) analysis of a kinase superfamily highlights the conserved occurrence of surface pockets at the active

  19. A STE12 homologue of the homothallic ascomycete Sordaria macrospora interacts with the MADS box protein MCM1 and is required for ascosporogenesis.

    Science.gov (United States)

    Nolting, Nicole; Pöggeler, Stefanie

    2006-11-01

    The MADS box protein MCM1 controls diverse developmental processes and is essential for fruiting body formation in the homothallic ascomycete Sordaria macrospora. MADS box proteins derive their regulatory specificity from a wide range of different protein interactions. We have recently shown that the S. macrospora MCM1 is able to interact with the alpha-domain mating-type protein SMTA-1. To further evaluate the functional roles of MCM1, we used the yeast two-hybrid approach to identify MCM1-interacting proteins. From this screen, we isolated a protein with a putative N-terminal homeodomain and C-terminal C2/H2-Zn2+ finger domains. The protein is a member of the highly conserved fungal STE12 transcription factor family of proteins and was therefore termed STE12. Furthermore, we demonstrate by means of two-hybrid and far western analysis that in addition to MCM1, the S. macrospora STE12 protein is able to interact with the mating-type protein SMTA-1. Unlike the situation in the closely related heterothallic ascomycete Neurospora crassa, deletion (Delta) of the ste12 gene in S. macrospora neither affects vegetative growth nor fruiting body formation. However, ascus and ascospore development are highly impaired by the Deltaste12 mutation. Our data provide another example of the functional divergence within the fungal STE12 transcription factor family.

  20. Functional dynamics of cell surface membrane proteins.

    Science.gov (United States)

    Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio

    2014-04-01

    Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Proteins in solution: Fractal surfaces in solutions

    Directory of Open Access Journals (Sweden)

    R. Tscheliessnig

    2016-02-01

    Full Text Available The concept of the surface of a protein in solution, as well of the interface between protein and 'bulk solution', is introduced. The experimental technique of small angle X-ray and neutron scattering is introduced and described briefly. Molecular dynamics simulation, as an appropriate computational tool for studying the hydration shell of proteins, is also discussed. The concept of protein surfaces with fractal dimensions is elaborated. We finish by exposing an experimental (using small angle X-ray scattering and a computer simulation case study, which are meant as demonstrations of the possibilities we have at hand for investigating the delicate interfaces that connect (and divide protein molecules and the neighboring electrolyte solution.

  2. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  3. The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity.

    Science.gov (United States)

    Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y

    2004-03-19

    The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.

  4. Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue.

    Science.gov (United States)

    Busot, Grethel Yanet; McClure, Bruce; Ibarra-Sánchez, Claudia Patricia; Jiménez-Durán, Karina; Vázquez-Santana, Sonia; Cruz-García, Felipe

    2008-01-01

    After landing on a wet stigma, pollen grains hydrate and germination generally occurs. However, there is no certainty of the pollen tube growth through the style to reach the ovary. The pistil is a gatekeeper that evolved in many species to recognize and reject the self-pollen, avoiding endogamy and encouraging cross-pollination. However, recognition is a complex process, and specific factors are needed. Here the isolation and characterization of a stigma-specific protein from N. alata, NaStEP (N. alata Stigma Expressed Protein), that is homologous to Kunitz-type proteinase inhibitors, are reported. Activity gel assays showed that NaStEP is not a functional serine proteinase inhibitor. Immunohistochemical and protein blot analyses revealed that NaStEP is detectable in stigmas of self-incompatible (SI) species N. alata, N. forgetiana, and N. bonariensis, but not in self-compatible (SC) species N. tabacum, N. plumbaginifolia, N. benthamiana, N. longiflora, and N. glauca. NaStEP contains the vacuolar targeting sequence NPIVL, and immunocytochemistry experiments showed vacuolar localization in unpollinated stigmas. After self-pollination or pollination with pollen from the SC species N. tabacum or N. plumbaginifolia, NaStEP was also found in the stigmatic exudate. The synthesis and presence in the stigmatic exudate of this protein was strongly induced in N. alata following incompatible pollination with N. tabacum pollen. The transfer of NaStEP to the stigmatic exudate was accompanied by perforation of the stigmatic cell wall, which appeared to release the vacuolar contents to the apoplastic space. The increase in NaStEP synthesis after pollination and its presence in the stigmatic exudates suggest that this protein may play a role in the early pollen-stigma interactions that regulate pollen tube growth in Nicotiana.

  5. The catalytic subunit of human protein kinase CK2 structurally deviates from its maize homologue in complex with the nucleotide competitive inhibitor emodin

    DEFF Research Database (Denmark)

    Raaf, Jennifer; Klopffleisch, Karsten; Issinger, Olaf-Georg

    2008-01-01

    The Ser/Thr kinase CK2 (former name: casein kinase 2) is a heterotetrameric enzyme composed of two catalytic chains (CK2alpha) attached to a dimer of noncatalytic subunits. Together with the cyclin-dependent kinases and the mitogen-activated protein kinases, CK2alpha belongs to the CMGC family of...

  6. Cloning of a protein arginine methyltransferase PRMT1 homologue from Schistosoma mansoni: Evidence for roles in nuclear receptor signaling and RNA metabolism

    International Nuclear Information System (INIS)

    Mansure, Jose Joao; Furtado, Daniel Rodrigues; Bastos de Oliveira, Francisco Meirelles; Rumjanek, Franklin David; Franco, Gloria Regina; Fantappie, Marcelo Rosado

    2005-01-01

    The most studied arginine methyltransferase is the type I enzyme, which catalyzes the transfer of an S-adenosyl-L-methionine to a broad spectrum of substrates, including histones, RNA-transporting proteins, and nuclear hormone receptor coactivators. We cloned a cDNA encoding a protein arginine methyltransferase in Schistosoma mansoni (SmPRMT1). SmPRMT1 is highly homologous to the vertebrate PRMT1 enzyme. In vitro methylation assays showed that SmPRMT1 recombinant protein was able to specifically methylate histone H4. Two schistosome proteins likely to be involved in RNA metabolism, SMYB1 and SmSmD3, that display a number of RGG motifs, were strongly methylated by SmPRMT1. In vitro GST pull-down assays showed that SMYB1 and SmSmD3 physically interacted with SmPRMT1. Additional GST pull-down assay suggested the occurrence of a ternary complex including SmPRMT1, SmRXR1 nuclear receptor, and the p160 (SRC-1) nuclear receptor coactivator. Together, these data suggest a mechanism by which SmPRMT1 plays a role in nuclear receptor-mediated chromatin remodeling and RNA transactions

  7. Investigation of SnSPR1, a novel and abundant surface protein of Sarcocystis neurona merozoites.

    Science.gov (United States)

    Zhang, Deqing; Howe, Daniel K

    2008-04-15

    An expressed sequence tag (EST) sequencing project has produced over 15,000 partial cDNA sequences from the equine pathogen Sarcocystis neurona. While many of the sequences are clear homologues of previously characterized genes, a significant number of the S. neurona ESTs do not exhibit similarity to anything in the extensive sequence databases that have been generated. In an effort to characterize parasite proteins that are novel to S. neurona, a seemingly unique gene was selected for further investigation based on its abundant representation in the collection of ESTs and the predicted presence of a signal peptide and glycolipid anchor addition on the encoded protein. The gene was expressed in E. coli, and monospecific polyclonal antiserum against the recombinant protein was produced by immunization of a rabbit. Characterization of the native protein in S. neurona merozoites and schizonts revealed that it is a low molecular weight surface protein that is expressed throughout intracellular development of the parasite. The protein was designated Surface Protein 1 (SPR1) to reflect its display on the outer surface of merozoites and to distinguish it from the ubiquitous SAG/SRS surface antigens of the heteroxenous Coccidia. Interestingly, infection assays in the presence of the polyclonal antiserum suggested that SnSPR1 plays some role in attachment and/or invasion of host cells by S. neurona merozoites. The work described herein represents a general template for selecting and characterizing the various unidentified gene sequences that are plentiful in the EST databases for S. neurona and other apicomplexans. Furthermore, this study illustrates the value of investigating these novel sequences since it can offer new candidates for diagnostic or vaccine development while also providing greater insight into the biology of these parasites.

  8. Functional characterisation of the Schizosaccharomyces pombe homologue of the leukaemia-associated translocation breakpoint binding protein translin and its binding partner, TRAX.

    Science.gov (United States)

    Jaendling, Alessa; Ramayah, Soshila; Pryce, David W; McFarlane, Ramsay J

    2008-02-01

    Translin is a conserved protein which associates with the breakpoint junctions of chromosomal translocations linked with the development of some human cancers. It binds to both DNA and RNA and has been implicated in mRNA metabolism and regulation of genome stability. It has a binding partner, translin-associated protein X (TRAX), levels of which are regulated by the translin protein in higher eukaryotes. In this study we find that this regulatory function is conserved in the lower eukaryotes, suggesting that translin and TRAX have important functions which provide a selective advantage to both unicellular and multi-cellular eukaryotes, indicating that this function may not be tissue-specific in nature. However, to date, the biological importance of translin and TRAX remains unclear. Here we systematically investigate proposals that suggest translin and TRAX play roles in controlling mitotic cell proliferation, DNA damage responses, genome stability, meiotic/mitotic recombination and stability of GT-rich repeat sequences. We find no evidence for translin and/or TRAX primary function in these pathways, indicating that the conserved biochemical function of translin is not implicated in primary pathways for regulating genome stability and/or segregation.

  9. Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue

    OpenAIRE

    Busot, Grethel Yanet; McClure, Bruce; Ibarra-S?nchez, Claudia Patricia; Jim?nez-Dur?n, Karina; V?zquez-Santana, Sonia; Cruz-Garc?a, Felipe

    2008-01-01

    After landing on a wet stigma, pollen grains hydrate and germination generally occurs. However, there is no certainty of the pollen tube growth through the style to reach the ovary. The pistil is a gatekeeper that evolved in many species to recognize and reject the self-pollen, avoiding endogamy and encouraging cross-pollination. However, recognition is a complex process, and specific factors are needed. Here the isolation and characterization of a stigma-specific protein from N. alata, NaStE...

  10. Protein-mediated surface structuring in biomembranes

    Directory of Open Access Journals (Sweden)

    Maggio B.

    2005-01-01

    Full Text Available The lipids and proteins of biomembranes exhibit highly dissimilar conformations, geometrical shapes, amphipathicity, and thermodynamic properties which constrain their two-dimensional molecular packing, electrostatics, and interaction preferences. This causes inevitable development of large local tensions that frequently relax into phase or compositional immiscibility along lateral and transverse planes of the membrane. On the other hand, these effects constitute the very codes that mediate molecular and structural changes determining and controlling the possibilities for enzymatic activity, apposition and recombination in biomembranes. The presence of proteins constitutes a major perturbing factor for the membrane sculpturing both in terms of its surface topography and dynamics. We will focus on some results from our group within this context and summarize some recent evidence for the active involvement of extrinsic (myelin basic protein, integral (Folch-Lees proteolipid protein and amphitropic (c-Fos and c-Jun proteins, as well as a membrane-active amphitropic phosphohydrolytic enzyme (neutral sphingomyelinase, in the process of lateral segregation and dynamics of phase domains, sculpturing of the surface topography, and the bi-directional modulation of the membrane biochemical reactivity.

  11. Biomimetic surface coatings from modular amphiphilic proteins

    Science.gov (United States)

    Harden, James; Wan, Fan; Fischer, Stephen; Dick, Scott

    2010-03-01

    Recombinant DNA methods have been used to develop a library of diblock protein polymers for creating designer biofunctional interfaces. These proteins are composed of a surface-active, amphiphilic block joined to a disordered, water soluble block with an end terminal bioactive domain. The amphiphilic block has a strong affinity for many synthetic polymer surfaces, providing a facile means of imparting biological functionality to otherwise bio-neutral materials through physical self-assembly. We have incorporated a series of bioactive end domains into this diblock motif, including sequences that encode specific cell binding and signaling functions of extracellular matrix constituents (e.g. RGD and YIGSR). In this talk, we show that these diblock constructs self-assemble into biofunctional surface coatings on several model synthetic polymer materials. We demonstrate that surface adsorption of the proteins has minimal impacts on the presentation of the bioactive domains in the soluble block, and through the use of microscopic and cell proliferation assays, we show that the resulting biofunctional interfaces are capable of inducing appropriate cellular responses in a variety of human cell types.

  12. A Lectin from Dioclea violacea Interacts with Midgut Surface of Lutzomyia migonei, Unlike Its Homologues, Cratylia floribunda Lectin and Canavalia gladiata Lectin

    Directory of Open Access Journals (Sweden)

    Juliana Montezuma Barbosa Monteiro Tínel

    2014-01-01

    Full Text Available Leishmaniasis is a vector-borne disease transmitted by phlebotomine sand fly. Susceptibility and refractoriness to Leishmania depend on the outcome of multiple interactions that take place within the sand fly gut. Promastigote attachment to sand fly midgut epithelium is essential to avoid being excreted together with the digested blood meal. Promastigote and gut sand fly surface glycans are important ligands in this attachment. The purpose of the present study was to evaluate the interaction of three lectins isolated from leguminous seeds (Diocleinae subtribe, D-glucose and D-mannose-binding, with glycans on Lutzomyia migonei midgut. To study this interaction the lectins were labeled with FITC and a fluorescence assay was performed. The results showed that only Dioclea violacea lectin (DVL was able to interact with midgut glycans, unlike Cratylia floribunda lectin (CFL and Canavalia gladiata lectin (CGL. Furthermore, when DVL was blocked with D-mannose the interaction was inhibited. Differences of spatial arrangement of residues and volume of carbohydrate recognition domain (CRD may be the cause of the fine specificity of DVL for glycans in the surface on Lu. migonei midgut. The findings in this study showed the presence of glycans in the midgut with glucose/mannose residues in its composition and these residues may be important in interaction between Lu. migonei midgut and Leishmania.

  13. The light gene of Drosophila melanogaster encodes a homologue of VPS41, a yeast gene involved in cellular-protein trafficking.

    Science.gov (United States)

    Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M

    1998-04-01

    Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.

  14. Fission Yeast SCYL1/2 Homologue Ppk32: A Novel Regulator of TOR Signalling That Governs Survival during Brefeldin A Induced Stress to Protein Trafficking.

    Science.gov (United States)

    Kowalczyk, Katarzyna M; Petersen, Janni

    2016-05-01

    Target of Rapamycin (TOR) signalling allows eukaryotic cells to adjust cell growth in response to changes in their nutritional and environmental context. The two distinct TOR complexes (TORC1/2) localise to the cell's internal membrane compartments; the endoplasmic reticulum (ER), Golgi apparatus and lysosomes/vacuoles. Here, we show that Ppk32, a SCYL family pseudo-kinase, is a novel regulator of TOR signalling. The absence of ppk32 expression confers resistance to TOR inhibition. Ppk32 inhibition of TORC1 is critical for cell survival following Brefeldin A (BFA) induced stress. Treatment of wild type cells with either the TORC1 specific inhibitor rapamycin or the general TOR inhibitor Torin1 confirmed that a reduction in TORC1 activity promoted recovery from BFA induced stress. Phosphorylation of Ppk32 on two residues that are conserved within the SCYL pseudo-kinase family are required for this TOR inhibition. Phosphorylation on these sites controls Ppk32 protein levels and sensitivity to BFA. BFA induced ER stress does not account for the response to BFA that we report here, however BFA is also known to induce Golgi stress and impair traffic to lysosomes. In summary, Ppk32 reduce TOR signalling in response to BFA induced stress to support cell survival.

  15. Characterization of a Vibrio vulnificus LysR homologue, HupR, which regulates expression of the haem uptake outer membrane protein, HupA.

    Science.gov (United States)

    Litwin, C M; Quackenbush, J

    2001-12-01

    In Vibrio vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. Here, we show that the DNA upstream of hupA (haem uptake receptor) in V. vulnificus encodes a protein in the inverse orientation to hupA (named hupR). HupR shares homology with the LysR family of positive transcriptional activators. A hupA-lacZ fusion contained on a plasmid was transformed into Fur(-), Fur(+)and HupR(-)strains of V. vulnificus. The beta-galactosidase assays and Northern blot analysis showed that transcription of hupA is negatively regulated by iron and the Fur repressor in V. vulnificus. Under low-iron conditions with added haemin, the expression of hupA in the hupR mutant was significantly lower than in the wild-type. This diminished response to haem was detected by both Northern blot and hupA-lacZ fusion analysis. The haem response of hupA in the hupR mutant was restored to wild-type levels when complemented with hupR in trans. These studies suggest that HupR may act as a positive regulator of hupA transcription under low-iron conditions in the presence of haemin. Copyright 2001 Academic Press.

  16. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  17. Identification and characterization of the surface proteins of Clostridium difficile

    International Nuclear Information System (INIS)

    Dailey, D.C.

    1988-01-01

    Several clostridial proteins were detected on the clostridial cell surface by sensitive radioiodination techniques. Two major proteins and six minor proteins comprised the radioiodinated proteins on the clostridial cell surface. Cellular fractionation of surface radiolabeled C. difficile determined that the radioiodinated proteins were found in the cell wall fraction of C. difficile and surprisingly were also present in the clostridial membrane. Furthermore, an interesting phenomenon of disulfide-crosslinking of the cell surface proteins of C. difficile was observed. Disulfide-linked protein complexes were found in both the membrane and cell wall fractions. In addition, the cell surface proteins of C. difficile were found to be released into the culture medium. In attempts to further characterize the clostridial proteins recombinant DNA techniques were employed. In addition, the role of the clostridial cell surface proteins in the interactions of C. difficile with human PMNs was also investigated

  18. Structural and Biophysical Characterization of the Mycobacterium tuberculosis Protein Rv0577, a Protein Associated with Neutral Red Staining of Virulent Tuberculosis Strains and Homologue of the Streptomyces coelicolor Protein KbpA

    Energy Technology Data Exchange (ETDEWEB)

    Buchko, Garry W.; Echols, Nathaniel; Flynn, E. M.; Ng, Ho-Leung; Stephenson, Sam; Kim, Heungbok; Myler, Peter J.; Terwilliger, Thomas C.; Alber, Tom; Kim, Chang Y.

    2017-07-25

    The 261-residue Mycobacterium tuberculosis protein Rv0577 is a prominent antigen in tuberculosis patients, the responsible component for neutral red staining of virulent strains of M. tuberculosis, a putative component in a methylglyoxal detoxification pathway, and an agonist of toll-like receptor 2. It also has 36% sequence identity to AfsK-binding protein A (KbpA), a component in the complex secondary metabolite pathways in the Streptomycetes genus from which many commercial antibiotics are derived. To gain insight into the biological function of Rv0577 and the family of KpbA kinase regulators, the crystal structure for Rv0577 was determined to a resolution of 1.75 Å (3OXH), binding properties with neutral red and deoxyadenosine (Ado) surveyed, backbone dynamics measured, and thermal stability assayed by CD spectroscopy. The protein is composed of four approximate repeats with an topology arranged radially in consecutive pairs to form two continuous eight-strand -sheets capped on both ends with an -helix. The two -sheets intersect in the center at roughly a right angle and form an asymmetric deep “saddle” on both sides of the protein, saddle one (P11 to A129) and saddle two (L143 to A258), that may serve to bind ligands. NMR chemical shift perturbation experiments show that neutral red binds to Rv0577, further cementing the role of Rv0577 in the neutral red staining of virulent strains of M. tuberculosis. Similar experiments show that adenosine also bind to Rv0577, although less tightly, with estimated dissociation constants of 4.1 ± 0.3 mM for saddle one and > 1 M for saddle two. Heteronuclear steady-state {1H}-15N NOE, T1, and T2 values were generally uniform through-out the sequence with only a few modest pockets of differences suggestive of slightly different motion in loops between -strands in saddle 1. Circular dichroism spectroscopy characterization of the thermal stability of Rv0577 indicated irreversible unfolding upon heating with an estimated

  19. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  20. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  1. The Electrophoretic Mobility of Proteins near Surfaces

    Science.gov (United States)

    Ramasamy, Perumal; Singh, Avtar; Rafailovich, Miriam; Sokolov, Jonathan

    2004-03-01

    We have attempted to apply the methods developed for surface DNA electrophoresis (1) for proteomics. Droplets of FITC stained Abumin, Poly- L-Lysine, or Casein purchased from Sigma were deposited on glass cover slips. The droplets were then place in contact with a TBE buffer solution contained in a cell molded from PDMS. Pt electrodes were inserted into the cell and a voltage was a applied. The motion of the protein was then imaged with a Leica Confocal microscope as a function of buffer concentration, distance from the surface, and applied voltage. The mobilities were then compared with those of uncharged one micron florescent Polystyrene beads. References: 1)Henzel WJ, Watanabe C, Stults JT., !0 Protein Identification: The Origins of Peptide Mass Fingerprinting. !1 J. American Society for Mass Spectrometry. 14 (September 2003): 931-942 2)Mathesius U, Imin N, Natera SH, Rolfe BG., !0 Proteomics as a functional genomics tool. !1 Methods of Molecular Biology 236: 395-414. *Work supported in part by the NSF-MRSEC program

  2. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  3. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  4. Immunoevasive protein (IEP)-containing surface layer covering polydnavirus particles is essential for viral infection.

    Science.gov (United States)

    Furihata, Shunsuke; Tanaka, Kohjiro; Ryuda, Masasuke; Ochiai, Masanori; Matsumoto, Hitoshi; Csikos, Gyorge; Hayakawa, Yoichi

    2014-01-01

    Polydnaviruses (PDVs) are unique symbiotic viruses associated with parasitoid wasps: PDV particles are injected into lepidopteran hosts along with the wasp eggs and express genes that interfere with aspects of host physiology such as immune defenses and development. Recent comparative genomic studies of PDVs have significantly improved our understanding of their origin as well as the genome organization. However, the structural features of functional PDV particles remain ambiguous. To clear up the structure of Cotesia kariyai PDV (CkPDV) particles, we focused on immunoevasive protein (IEP), which is a mediator of immunoevasion by the wasp from the encapsulation reaction of the host insect's hemocytes, because it has been demonstrated to be present on the surface of the virus particle. We discovered that IEP tends to polymerize and constitutes a previously unidentified thin surface layer covering CkPDV particles. This outermost surface layer looked fragile and was easily removed from CkPVD particles by mechanical stressors such as shaking, which prevented CkPDV from expressing the encoded genes in the host target tissues such as fat body or hemocytes. Furthermore, we detected IEP homologue gene expression in the wasp's venom reservoirs, implying IEP has another unknown biological function in the wasp or parasitized hosts. Taken together, the present results demonstrated that female C. kariyai wasps produce the fragile thin layer partly composed of IEP to cover the outer surfaces of CkPDV particles; otherwise, they cannot function as infectious agents in the wasp's host. The fact that IEP family proteins are expressed in both venom reservoirs and oviducts suggests an intimate relationship between both tissues in the development of the parasitism strategy of the wasp. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Surface modification of protein enhances encapsulation in chitosan nanoparticles

    Science.gov (United States)

    Koyani, Rina D.; Andrade, Mariana; Quester, Katrin; Gaytán, Paul; Huerta-Saquero, Alejandro; Vazquez-Duhalt, Rafael

    2018-04-01

    Chitosan nanoparticles have a huge potential as nanocarriers for environmental and biomedical purposes. Protein encapsulation in nano-sized chitosan provides protection against inactivation, proteolysis, and other alterations due to environmental conditions, as well as the possibility to be targeted to specific tissues by ligand functionalization. In this work, we demonstrate that the chemical modification of the protein surface enhances the protein loading in chitosan nanocarriers. Encapsulation of green fluorescent protein and the cytochrome P450 was studied. The increase of electrostatic interactions between the free amino groups of chitosan and the increased number of free carboxylic groups in the protein surface enhance the protein loading, protein retention, and, thus, the enzymatic activity of chitosan nanoparticles. The chemical modification of protein surface with malonic acid moieties reduced drastically the protein isoelectric point increasing the protein interaction with the polycationic biomaterial and chitosan. The chemical modification of protein does not alter the morphology of chitosan nanoparticles that showed an average diameter of 18 nm, spheroidal in shape, and smooth surfaced. The strategy of chemical modification of protein surface, shown here, is a simple and efficient technique to enhance the protein loading in chitosan nanoparticles. This technique could be used for other nanoparticles based on polycationic or polyanionic materials. The increase of protein loading improves, doubtless, the performance of protein-loaded chitosan nanoparticles for biotechnological and biomedical applications.

  6. Identification of surface proteins in Enterococcus faecalis V583

    Directory of Open Access Journals (Sweden)

    Eijsink Vincent GH

    2011-03-01

    Full Text Available Abstract Background Surface proteins are a key to a deeper understanding of the behaviour of Gram-positive bacteria interacting with the human gastro-intestinal tract. Such proteins contribute to cell wall synthesis and maintenance and are important for interactions between the bacterial cell and the human host. Since they are exposed and may play roles in pathogenicity, surface proteins are interesting targets for drug design. Results Using methods based on proteolytic "shaving" of bacterial cells and subsequent mass spectrometry-based protein identification, we have identified surface-located proteins in Enterococcus faecalis V583. In total 69 unique proteins were identified, few of which have been identified and characterized previously. 33 of these proteins are predicted to be cytoplasmic, whereas the other 36 are predicted to have surface locations (31 or to be secreted (5. Lipid-anchored proteins were the most dominant among the identified surface proteins. The seemingly most abundant surface proteins included a membrane protein with a potentially shedded extracellular sulfatase domain that could act on the sulfate groups in mucin and a lipid-anchored fumarate reductase that could contribute to generation of reactive oxygen species. Conclusions The present proteome analysis gives an experimental impression of the protein landscape on the cell surface of the pathogenic bacterium E. faecalis. The 36 identified secreted (5 and surface (31 proteins included several proteins involved in cell wall synthesis, pheromone-regulated processes, and transport of solutes, as well as proteins with unknown function. These proteins stand out as interesting targets for further investigation of the interaction between E. faecalis and its environment.

  7. RPE cell surface proteins in normal and dystrophic rats

    International Nuclear Information System (INIS)

    Clark, V.M.; Hall, M.O.

    1986-01-01

    Membrane-bound proteins in plasma membrane enriched fractions from cultured rat RPE were analyzed by two-dimensional gel electrophoresis. Membrane proteins were characterized on three increasingly specific levels. Total protein was visualized by silver staining. A maximum of 102 separate proteins were counted in silver-stained gels. Glycoproteins were labeled with 3H-glucosamine or 3H-fucose and detected by autoradiography. Thirty-eight fucose-labeled and 61-71 glucosamine-labeled proteins were identified. All of the fucose-labeled proteins were labeled with glucosamine-derived radioactivity. Proteins exposed at the cell surface were labeled by lactoperoxidase-catalyzed radioiodination prior to preparation of membranes for two-dimensional analysis. Forty separate 125I-labeled surface proteins were resolved by two-dimensional electrophoresis/autoradiography. Comparison with the glycoprotein map showed that a number of these surface labeled proteins were glycoproteins. Two-dimensional maps of total protein, fucose-labeled, and glucosamine-labeled glycoproteins, and 125I-labeled surface proteins of membranes from dystrophic (RCS rdy-p+) and normal (Long Evans or RCS rdy+p+) RPE were compared. No differences in the total protein or surface-labeled proteins were observed. However, the results suggest that a 183K glycoprotein is more heavily glycosylated with glucosamine and fucose in normal RPE membranes as compared to membranes from dystrophic RPE

  8. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  9. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  10. Computational design of protein interactions: designing proteins that neutralize influenza by inhibiting its hemagglutinin surface protein

    Science.gov (United States)

    Fleishman, Sarel

    2012-02-01

    Molecular recognition underlies all life processes. Design of interactions not seen in nature is a test of our understanding of molecular recognition and could unlock the vast potential of subtle control over molecular interaction networks, allowing the design of novel diagnostics and therapeutics for basic and applied research. We developed the first general method for designing protein interactions. The method starts by computing a region of high affinity interactions between dismembered amino acid residues and the target surface and then identifying proteins that can harbor these residues. Designs are tested experimentally for binding the target surface and successful ones are affinity matured using yeast cell surface display. Applied to the conserved stem region of influenza hemagglutinin we designed two unrelated proteins that, following affinity maturation, bound hemagglutinin at subnanomolar dissociation constants. Co-crystal structures of hemagglutinin bound to the two designed binders were within 1Angstrom RMSd of their models, validating the accuracy of the design strategy. One of the designed proteins inhibits the conformational changes that underlie hemagglutinin's cell-invasion functions and blocks virus infectivity in cell culture, suggesting that such proteins may in future serve as diagnostics and antivirals against a wide range of pathogenic influenza strains. We have used this method to obtain experimentally validated binders of several other target proteins, demonstrating the generality of the approach. We discuss the combination of modeling and high-throughput characterization of design variants which has been key to the success of this approach, as well as how we have used the data obtained in this project to enhance our understanding of molecular recognition. References: Science 332:816 JMB, in press Protein Sci 20:753

  11. Surface Passivation for Single-molecule Protein Studies

    Science.gov (United States)

    Chandradoss, Stanley D.; Haagsma, Anna C.; Lee, Young Kwang; Hwang, Jae-Ho; Nam, Jwa-Min; Joo, Chirlmin

    2014-01-01

    Single-molecule fluorescence spectroscopy has proven to be instrumental in understanding a wide range of biological phenomena at the nanoscale. Important examples of what this technique can yield to biological sciences are the mechanistic insights on protein-protein and protein-nucleic acid interactions. When interactions of proteins are probed at the single-molecule level, the proteins or their substrates are often immobilized on a glass surface, which allows for a long-term observation. This immobilization scheme may introduce unwanted surface artifacts. Therefore, it is essential to passivate the glass surface to make it inert. Surface coating using polyethylene glycol (PEG) stands out for its high performance in preventing proteins from non-specifically interacting with a glass surface. However, the polymer coating procedure is difficult, due to the complication arising from a series of surface treatments and the stringent requirement that a surface needs to be free of any fluorescent molecules at the end of the procedure. Here, we provide a robust protocol with step-by-step instructions. It covers surface cleaning including piranha etching, surface functionalization with amine groups, and finally PEG coating. To obtain a high density of a PEG layer, we introduce a new strategy of treating the surface with PEG molecules over two rounds, which remarkably improves the quality of passivation. We provide representative results as well as practical advice for each critical step so that anyone can achieve the high quality surface passivation. PMID:24797261

  12. Competitive Protein Adsorption on Polysaccharide and Hyaluronate Modified Surfaces

    Science.gov (United States)

    Ombelli, Michela; Costello, Lauren; Postle, Corinne; Anantharaman, Vinod; Meng, Qing Cheng; Composto, Russell J.; Eckmann, David M.

    2011-01-01

    We measured adsorption of bovine serum albumin (BSA) and fibrinogen (Fg) onto six distinct bare and dextran- and hyaluronate-modified silicon surfaces created using two dextran grafting densities and three hyaluronic acid (HA) sodium salts derived from human umbilical cord, rooster comb and streptococcus zooepidemicus. Film thickness and surface morphology depended on HA molecular weight and concentration. BSA coverage was enhanced on surfaces upon competitive adsorption of BSA:Fg mixtures. Dextranization differentially reduced protein adsorption onto surfaces based on oxidation state. Hyaluronization was demonstrated to provide the greatest resistance to protein coverage, equivalent to that of the most resistant dextranized surface. Resistance to protein adsorption was independent of the type of hyaluronic acid utilized. With changing bulk protein concentration from 20 to 40 µg ml−1 for each species, Fg coverage on silicon increased by 4×, whereas both BSA and Fg adsorption on dextran and HA were far less dependent of protein bulk concentration. PMID:21623481

  13. SURF'S UP! – Protein classification by surface comparisons

    Indian Academy of Sciences (India)

    Prakash

    encounter large protein families with only a few members of ... server for analysis of functional relationships in protein families, as inferred from protein surface maps comparison ... features, SURF'S UP! can work with models obtained from comparative modelling. ... 1997) or, if the user is confident in the quality of automated.

  14. Directed supramolecular surface assembly of SNAP-tag fusion proteins

    NARCIS (Netherlands)

    Uhlenheuer, D.A.; Wasserberg, D.; Haase, C.; Nguyen, H.; Schenkel, J.H.; Huskens, J.; Ravoo, B.J.; Jonkheijm, P.; Brunsveld, L.

    2012-01-01

    Supramolecular assembly of proteins on surfaces and vesicles was investigated by site-selective incorporation of a supramolecular guest element on proteins. Fluorescent proteins were site-selectively labeled with bisadamantane by SNAP-tag technology. The assembly of the bisadamantane functionalized

  15. Directed Supramolecular Surface Assembly of SNAP-tag Fusion Proteins

    NARCIS (Netherlands)

    Uhlenheuer, D.A.; Wasserberg, D.; Haase, C.; Nguyen, Hoang D.; Schenkel, J.H.; Huskens, Jurriaan; Ravoo, B.J.; Jonkheijm, Pascal; Brunsveld, Luc

    2012-01-01

    Supramolecular assembly of proteins on surfaces and vesicles was investigated by site-selective incorporation of a supramolecular guest element on proteins. Fluorescent proteins were site-selectively labeled with bisadamantane by SNAP-tag technology. The assembly of the bisadamantane functionalized

  16. VASCo: computation and visualization of annotated protein surface contacts

    Directory of Open Access Journals (Sweden)

    Thallinger Gerhard G

    2009-01-01

    Full Text Available Abstract Background Structural data from crystallographic analyses contain a vast amount of information on protein-protein contacts. Knowledge on protein-protein interactions is essential for understanding many processes in living cells. The methods to investigate these interactions range from genetics to biophysics, crystallography, bioinformatics and computer modeling. Also crystal contact information can be useful to understand biologically relevant protein oligomerisation as they rely in principle on the same physico-chemical interaction forces. Visualization of crystal and biological contact data including different surface properties can help to analyse protein-protein interactions. Results VASCo is a program package for the calculation of protein surface properties and the visualization of annotated surfaces. Special emphasis is laid on protein-protein interactions, which are calculated based on surface point distances. The same approach is used to compare surfaces of two aligned molecules. Molecular properties such as electrostatic potential or hydrophobicity are mapped onto these surface points. Molecular surfaces and the corresponding properties are calculated using well established programs integrated into the package, as well as using custom developed programs. The modular package can easily be extended to include new properties for annotation. The output of the program is most conveniently displayed in PyMOL using a custom-made plug-in. Conclusion VASCo supplements other available protein contact visualisation tools and provides additional information on biological interactions as well as on crystal contacts. The tool provides a unique feature to compare surfaces of two aligned molecules based on point distances and thereby facilitates the visualization and analysis of surface differences.

  17. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  18. ABI domain-containing proteins contribute to surface protein display and cell division in Staphylococcus aureus.

    Science.gov (United States)

    Frankel, Matthew B; Wojcik, Brandon M; DeDent, Andrea C; Missiakas, Dominique M; Schneewind, Olaf

    2010-10-01

    The human pathogen Staphylococcus aureus requires cell wall anchored surface proteins to cause disease. During cell division, surface proteins with YSIRK signal peptides are secreted into the cross-wall, a layer of newly synthesized peptidoglycan between separating daughter cells. The molecular determinants for the trafficking of surface proteins are, however, still unknown. We screened mutants with non-redundant transposon insertions by fluorescence-activated cell sorting for reduced deposition of protein A (SpA) into the staphylococcal envelope. Three mutants, each of which harboured transposon insertions in genes for transmembrane proteins, displayed greatly reduced envelope abundance of SpA and surface proteins with YSIRK signal peptides. Characterization of the corresponding mutations identified three transmembrane proteins with abortive infectivity (ABI) domains, elements first described in lactococci for their role in phage exclusion. Mutations in genes for ABI domain proteins, designated spdA, spdB and spdC (surface protein display), diminish the expression of surface proteins with YSIRK signal peptides, but not of precursor proteins with conventional signal peptides. spdA, spdB and spdC mutants display an increase in the thickness of cross-walls and in the relative abundance of staphylococci with cross-walls, suggesting that spd mutations may represent a possible link between staphylococcal cell division and protein secretion. © 2010 Blackwell Publishing Ltd.

  19. Trichomonas vaginalis surface proteins: a view from the genome

    DEFF Research Database (Denmark)

    Hirt, R. P.; Noel, C. J.; Sicheritz-Pontén, Thomas

    2007-01-01

    Surface proteins of mucosal microbial pathogens play multiple and essential roles in initiating and sustaining the colonization of the heavily defended mucosa. The protist Trichomonas vaginalis is one of the most common human sexually transmitted pathogens that colonize the urogenital mucosa....... However, little is known about its surface proteins. The recently completed draft genome sequence of T. vaginalis provides an invaluable resource to guide molecular and cellular characterization of surface proteins and to investigate their role in pathogenicity. Here, we review the existing data on T...

  20. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  1. Hydration dynamics near a model protein surface

    International Nuclear Information System (INIS)

    Russo, Daniela; Hura, Greg; Head-Gordon, Teresa

    2003-01-01

    The evolution of water dynamics from dilute to very high concentration solutions of a prototypical hydrophobic amino acid with its polar backbone, N-acetyl-leucine-methylamide (NALMA), is studied by quasi-elastic neutron scattering and molecular dynamics simulation for both the completely deuterated and completely hydrogenated leucine monomer. We observe several unexpected features in the dynamics of these biological solutions under ambient conditions. The NALMA dynamics shows evidence of de Gennes narrowing, an indication of coherent long timescale structural relaxation dynamics. The translational water dynamics are analyzed in a first approximation with a jump diffusion model. At the highest solute concentrations, the hydration water dynamics is significantly suppressed and characterized by a long residential time and a slow diffusion coefficient. The analysis of the more dilute concentration solutions takes into account the results of the 2.0M solution as a model of the first hydration shell. Subtracting the first hydration layer based on the 2.0M spectra, the translational diffusion dynamics is still suppressed, although the rotational relaxation time and residential time are converged to bulk-water values. Molecular dynamics analysis shows spatially heterogeneous dynamics at high concentration that becomes homogeneous at more dilute concentrations. We discuss the hydration dynamics results of this model protein system in the context of glassy systems, protein function, and protein-protein interfaces

  2. Enhanced microcontact printing of proteins on nanoporous silica surface

    Energy Technology Data Exchange (ETDEWEB)

    Blinka, Ellen; Hu Ye; Gopal, Ashwini; Hoshino, Kazunori; Lin, Kevin; Zhang, John X J [Department of Biomedical Engineering, University of Texas at Austin, Austin, TX 78758 (United States); Loeffler, Kathryn; Liu Xuewu; Ferrari, Mauro, E-mail: John.Zhang@engr.utexas.edu [Department of Nanomedicine and Biomedical Engineering, University of Texas Health Science Service, Houston, TX 77031 (United States)

    2010-10-15

    We demonstrate porous silica surface modification, combined with microcontact printing, as an effective method for enhanced protein patterning and adsorption on arbitrary surfaces. Compared to conventional chemical treatments, this approach offers scalability and long-term device stability without requiring complex chemical activation. Two chemical surface treatments using functionalization with the commonly used 3-aminopropyltriethoxysilane (APTES) and glutaraldehyde (GA) were compared with the nanoporous silica surface on the basis of protein adsorption. The deposited thickness and uniformity of porous silica films were evaluated for fluorescein isothiocyanate (FITC)-labeled rabbit immunoglobulin G (R-IgG) protein printed onto the substrates via patterned polydimethlysiloxane (PDMS) stamps. A more complete transfer of proteins was observed on porous silica substrates compared to chemically functionalized substrates. A comparison of different pore sizes (4-6 nm) and porous silica thicknesses (96-200 nm) indicates that porous silica with 4 nm diameter, 57% porosity and a thickness of 96 nm provided a suitable environment for complete transfer of R-IgG proteins. Both fluorescence microscopy and atomic force microscopy (AFM) were used for protein layer characterizations. A porous silica layer is biocompatible, providing a favorable transfer medium with minimal damage to the proteins. A patterned immunoassay microchip was developed to demonstrate the retained protein function after printing on nanoporous surfaces, which enables printable and robust immunoassay detection for point-of-care applications.

  3. Cleaning of biomaterial surfaces: protein removal by different solvents.

    Science.gov (United States)

    Kratz, Fabian; Grass, Simone; Umanskaya, Natalia; Scheibe, Christian; Müller-Renno, Christine; Davoudi, Neda; Hannig, Matthias; Ziegler, Christiane

    2015-04-01

    The removal of biofilms or protein films from biomaterials is still a challenging task. In particular, for research investigations on real (applied) surfaces the reuse of samples is of high importance, because reuse allows the comparison of the same sample in different experiments. The aim of the present study was to evaluate the cleaning efficiency of different solvents (SDS, water, acetone, isopropanol, RIPA-buffer and Tween-20) on five different biomaterials (titanium, gold, PMMA (no acetone used), ceramic, and PTFE) with different wettability which were covered by layers of two different adsorbed proteins (BSA and lysozyme). The presence of a protein film after adsorption was confirmed by transmission electron microscopy (TEM). After treatment of the surfaces with the different solvents, the residual proteins on the surface were determined by BCA-assay (bicinchoninic acid assay). Data of the present study indicate that SDS is an effective solvent, but for several protein-substrate combinations it does not show the cleaning efficiency often mentioned in literature. RIPA-buffer and Tween-20 were more effective. They showed very low residual protein amounts after cleaning on all examined material surfaces and for both proteins, however, with small differences for the respective substrate-protein combinations. RIPA-buffer in combination with ultrasonication completely removed the protein layer as confirmed by TEM. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  5. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  6. Radio-iodinated surface proteins of electrophoretically separated rat lymphocytes

    International Nuclear Information System (INIS)

    Jilg, W.; Hannig, K.; Zeiller, K.

    1980-01-01

    Rat thymocytes and lymph node cells were separated into three T and one B subpopulation by means of free flow electrophoresis. The surface proteins of the separated cells were labelled by lactoperoxidase catalysed radioiodination. Most of the label was demonstrated to be at the cell surface. Although the surface protein patterns of the four lamphocyte subpopulations were rather similar, distinctive differences could be found. B cells had six labelled proteins which seemed to be absent in the other cells. In the T cell group three protein bands were identified, each with specificity for peripheral T cells, thymocytes and all T cells respectively. Four other proteins were found which showed quantitative differences between the four cell groups. (orig.) [de

  7. Modulating Protein Adsorption on Oxygen Plasma Modified Polysiloxane Surfaces

    International Nuclear Information System (INIS)

    Marletta, G.

    2006-01-01

    In the present paper we report the study on the adsorption behaviour of three model globular proteins, Human Serum Albumin, Lactoferrin and Egg Chicken Lysozyme onto both unmodified surfaces of a silicon-based polymer and the corresponding plasma treated surfaces. In particular, thin films of hydrophobic polysiloxane (about 90 degree of static water contact angle, WCA) were converted by oxygen plasma treatment at reduced pressure into very hydrophilic phases of SiOx (WCA less than 5 degree). The kinetics of protein adsorption processes were investigated by QCM-D technique, while the chemical structure and topography of the protein adlayer have been studied by Angular resolved-XPS and AFM respectively. It turned out that Albumin and Lysozyme exhibited the opposite preferential adsorption respectively onto the hydrophobic and hydrophilic surfaces, while Lactoferrin did not exhibit significant differences. The observed protein behaviour are discussed both in terms of surface-dependent parameters, including surface free energy and chemical structure, and in terms of protein-dependent parameters, including charge as well as the average molecular orientation in the adlayers. Finally, some examples of differential adsorption behaviour of the investigated proteins are reported onto nanopatterned polysiloxane surfaces consisting of hydrophobic nanopores surrounded by hydrophilic (plasma-treated) matrix and the reverse

  8. Role of sperm surface proteins in reproduction

    Czech Academy of Sciences Publication Activity Database

    Jonáková, Věra; Maňásková, Pavla; Davidová, Nina; Tichá, M.; Pěknicová, Jana

    2009-01-01

    Roč. 30, Supplement (2009), s. 63-64 ISSN 0196-3635. [9th International Congress of Andrology. 07.03.2009-10.03.2009, Barcelona] R&D Projects: GA MŠk(CZ) 1M06011; GA ČR(CZ) GA523/08/H064; GA ČR(CZ) GA303/06/0895 Institutional research plan: CEZ:AV0Z50520701 Keywords : boar seminal plasma proteins * spermadhesins * proteinase inhibitor * DQH * boar spermatozoa Subject RIV: CE - Biochemistry

  9. Protein-protein interaction site predictions with three-dimensional probability distributions of interacting atoms on protein surfaces.

    Directory of Open Access Journals (Sweden)

    Ching-Tai Chen

    Full Text Available Protein-protein interactions are key to many biological processes. Computational methodologies devised to predict protein-protein interaction (PPI sites on protein surfaces are important tools in providing insights into the biological functions of proteins and in developing therapeutics targeting the protein-protein interaction sites. One of the general features of PPI sites is that the core regions from the two interacting protein surfaces are complementary to each other, similar to the interior of proteins in packing density and in the physicochemical nature of the amino acid composition. In this work, we simulated the physicochemical complementarities by constructing three-dimensional probability density maps of non-covalent interacting atoms on the protein surfaces. The interacting probabilities were derived from the interior of known structures. Machine learning algorithms were applied to learn the characteristic patterns of the probability density maps specific to the PPI sites. The trained predictors for PPI sites were cross-validated with the training cases (consisting of 432 proteins and were tested on an independent dataset (consisting of 142 proteins. The residue-based Matthews correlation coefficient for the independent test set was 0.423; the accuracy, precision, sensitivity, specificity were 0.753, 0.519, 0.677, and 0.779 respectively. The benchmark results indicate that the optimized machine learning models are among the best predictors in identifying PPI sites on protein surfaces. In particular, the PPI site prediction accuracy increases with increasing size of the PPI site and with increasing hydrophobicity in amino acid composition of the PPI interface; the core interface regions are more likely to be recognized with high prediction confidence. The results indicate that the physicochemical complementarity patterns on protein surfaces are important determinants in PPIs, and a substantial portion of the PPI sites can be predicted

  10. Protein-Protein Interaction Site Predictions with Three-Dimensional Probability Distributions of Interacting Atoms on Protein Surfaces

    Science.gov (United States)

    Chen, Ching-Tai; Peng, Hung-Pin; Jian, Jhih-Wei; Tsai, Keng-Chang; Chang, Jeng-Yih; Yang, Ei-Wen; Chen, Jun-Bo; Ho, Shinn-Ying; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Protein-protein interactions are key to many biological processes. Computational methodologies devised to predict protein-protein interaction (PPI) sites on protein surfaces are important tools in providing insights into the biological functions of proteins and in developing therapeutics targeting the protein-protein interaction sites. One of the general features of PPI sites is that the core regions from the two interacting protein surfaces are complementary to each other, similar to the interior of proteins in packing density and in the physicochemical nature of the amino acid composition. In this work, we simulated the physicochemical complementarities by constructing three-dimensional probability density maps of non-covalent interacting atoms on the protein surfaces. The interacting probabilities were derived from the interior of known structures. Machine learning algorithms were applied to learn the characteristic patterns of the probability density maps specific to the PPI sites. The trained predictors for PPI sites were cross-validated with the training cases (consisting of 432 proteins) and were tested on an independent dataset (consisting of 142 proteins). The residue-based Matthews correlation coefficient for the independent test set was 0.423; the accuracy, precision, sensitivity, specificity were 0.753, 0.519, 0.677, and 0.779 respectively. The benchmark results indicate that the optimized machine learning models are among the best predictors in identifying PPI sites on protein surfaces. In particular, the PPI site prediction accuracy increases with increasing size of the PPI site and with increasing hydrophobicity in amino acid composition of the PPI interface; the core interface regions are more likely to be recognized with high prediction confidence. The results indicate that the physicochemical complementarity patterns on protein surfaces are important determinants in PPIs, and a substantial portion of the PPI sites can be predicted correctly with

  11. Extractable Bacterial Surface Proteins in Probiotic–Host Interaction

    Directory of Open Access Journals (Sweden)

    Fillipe L. R. do Carmo

    2018-04-01

    Full Text Available Some Gram-positive bacteria, including probiotic ones, are covered with an external proteinaceous layer called a surface-layer. Described as a paracrystalline layer and formed by the self-assembly of a surface-layer-protein (Slp, this optional structure is peculiar. The surface layer per se is conserved and encountered in many prokaryotes. However, the sequence of the corresponding Slp protein is highly variable among bacterial species, or even among strains of the same species. Other proteins, including surface layer associated proteins (SLAPs, and other non-covalently surface-bound proteins may also be extracted with this surface structure. They can be involved a various functions. In probiotic Gram-positives, they were shown by different authors and experimental approaches to play a role in key interactions with the host. Depending on the species, and sometime on the strain, they can be involved in stress tolerance, in survival within the host digestive tract, in adhesion to host cells or mucus, or in the modulation of intestinal inflammation. Future trends include the valorization of their properties in the formation of nanoparticles, coating and encapsulation, and in the development of new vaccines.

  12. Quantitative surface studies of protein adsorption by infrared spectroscopy. II. Quantification of adsorbed and bulk proteins

    International Nuclear Information System (INIS)

    Fink, D.J.; Hutson, T.B.; Chittur, K.K.; Gendreau, R.M.

    1987-01-01

    Attenuated total reflectance Fourier transform infrared spectra of surface-adsorbed proteins are correlated with concentration measurements determined by 125 I-labeled proteins. This paper demonstrates that linear correlations between the intensity of the major bands of proteins and the quantity of proteins can be obtained for human albumin and immunoglobulin G up to surface concentrations of approximately 0.25 microgram/cm2. A poorer correlation was observed for human fibrinogen. A linear correlation was also observed between the concentration in the bulk solution and the major bands of albumin up to a concentration of 60 mg/ml

  13. Competitive protein adsorption to polymer surface from human serum

    DEFF Research Database (Denmark)

    Holmberg, Maria; Jensen, Karin Bagger Stibius; Larsen, Niels Bent

    2008-01-01

    Surface modification by "soft" plasma polymerisation to obtain a hydrophilic and non-fouling polymer surface has been validated using radioactive labelling. Adsorption to unmodified and modified polymer surfaces, from both single protein and human serum solutions, has been investigated. By using...... different radioisotopes, albumin and Immunoglobulin G (IgG) adsorption has been monitored simultaneously during competitive adsorption processes, which to our knowledge has not been reported in the literature before. Results show that albumin and IgG adsorption is dependent on adsorption time...... and on the presence and concentration of other proteins in bulk solutions during adsorption. Generally, lower albumin and IgG adsorption was observed on the modified and more hydrophilic polymer surfaces, but otherwise the modified and unmodified polymer surfaces showed the same adsorption characteristics....

  14. Revealing Surface Waters on an Antifreeze Protein by Fusion Protein Crystallography Combined with Molecular Dynamic Simulations.

    Science.gov (United States)

    Sun, Tianjun; Gauthier, Sherry Y; Campbell, Robert L; Davies, Peter L

    2015-10-08

    Antifreeze proteins (AFPs) adsorb to ice through an extensive, flat, relatively hydrophobic surface. It has been suggested that this ice-binding site (IBS) organizes surface waters into an ice-like clathrate arrangement that matches and fuses to the quasi-liquid layer on the ice surface. On cooling, these waters join the ice lattice and freeze the AFP to its ligand. Evidence for the generality of this binding mechanism is limited because AFPs tend to crystallize with their IBS as a preferred protein-protein contact surface, which displaces some bound waters. Type III AFP is a 7 kDa globular protein with an IBS made up two adjacent surfaces. In the crystal structure of the most active isoform (QAE1), the part of the IBS that docks to the primary prism plane of ice is partially exposed to solvent and has clathrate waters present that match this plane of ice. The adjacent IBS, which matches the pyramidal plane of ice, is involved in protein-protein crystal contacts with few surface waters. Here we have changed the protein-protein contacts in the ice-binding region by crystallizing a fusion of QAE1 to maltose-binding protein. In this 1.9 Å structure, the IBS that fits the pyramidal plane of ice is exposed to solvent. By combining crystallography data with MD simulations, the surface waters on both sides of the IBS were revealed and match well with the target ice planes. The waters on the pyramidal plane IBS were loosely constrained, which might explain why other isoforms of type III AFP that lack the prism plane IBS are less active than QAE1. The AFP fusion crystallization method can potentially be used to force the exposure to solvent of the IBS on other AFPs to reveal the locations of key surface waters.

  15. Surface charge effects in protein adsorption on nanodiamonds.

    Science.gov (United States)

    Aramesh, M; Shimoni, O; Ostrikov, K; Prawer, S; Cervenka, J

    2015-03-19

    Understanding the interaction of proteins with charged diamond nanoparticles is of fundamental importance for diverse biomedical applications. Here we present a thorough study of protein binding, adsorption kinetics and structure on strongly positively (hydrogen-terminated) and negatively (oxygen-terminated) charged nanodiamond particles using a quartz crystal microbalance by dissipation and infrared spectroscopy. By using two model proteins (bovine serum albumin and lysozyme) of different properties (charge, molecular weight and rigidity), the main driving mechanism responsible for the protein binding to the charged nanoparticles was identified. Electrostatic interactions were found to dominate the protein adsorption dynamics, attachment and conformation. We developed a simple electrostatic model that can qualitatively explain the observed adsorption behaviour based on charge-induced pH modifications near the charged nanoparticle surfaces. Under neutral conditions, the local pH around the positively and negatively charged nanodiamonds becomes very high (11-12) and low (1-3) respectively, which has a profound impact on the protein charge, hydration and affinity to the nanodiamonds. Small proteins (lysozyme) were found to form multilayers with significant conformational changes to screen the surface charge, while larger proteins (albumin) formed monolayers with minor conformational changes. The findings of this study provide a step forward toward understanding and eventually predicting nanoparticle interactions with biofluids.

  16. Self-assembling triblock proteins for biofunctional surface modification

    Science.gov (United States)

    Fischer, Stephen E.

    Despite the tremendous promise of cell/tissue engineering, significant challenges remain in engineering functional scaffolds to precisely regulate the complex processes of tissue growth and development. As the point of contact between the cells and the scaffold, the scaffold surface plays a major role in mediating cellular behaviors. In this dissertation, the development and utility of self-assembling, artificial protein hydrogels as biofunctional surface modifiers is described. The design of these recombinant proteins is based on a telechelic triblock motif, in which a disordered polyelectrolyte central domain containing embedded bioactive ligands is flanked by two leucine zipper domains. Under moderate conditions of temperature and pH, the leucine zipper end domains form amphiphilic alpha-helices that reversibly associate into homo-trimeric aggregates, driving hydrogel formation. Moreover, the amphiphilic nature of these helical domains enables surface adsorption to a variety of scaffold materials to form biofunctional protein coatings. The nature and stability of these coatings in various solution conditions, and their interaction with mammalian cells is the primary focus of this dissertation. In particular, triblock protein coatings functionalized with cell recognition sequences are shown to produce well-defined surfaces with precise control over ligand density. The impact of this is demonstrated in multiple cell types through ligand density-dependent cell-substrate interactions. To improve the stability of these physically self-assembled coatings, two covalent crosslinking strategies are described---one in which a zero-length chemical crosslinker (EDC) is utilized and a second in which disulfide bonds are engineered into the recombinant proteins. These targeted crosslinking approaches are shown to increase the stability of surface adsorbed protein layers with minimal effect on the presentation of many bioactive ligands. Finally, to demonstrate the versatility

  17. Protein sequences bound to mineral surfaces persist into deep time

    DEFF Research Database (Denmark)

    Demarchi, Beatrice; Hall, Shaun; Roncal-Herrero, Teresa

    2016-01-01

    of Laetoli (3.8 Ma) and Olduvai Gorge (1.3 Ma) in Tanzania. By tracking protein diagenesis back in time we find consistent patterns of preservation, demonstrating authenticity of the surviving sequences. Molecular dynamics simulations of struthiocalcin-1 and -2, the dominant proteins within the eggshell......, reveal that distinct domains bind to the mineral surface. It is the domain with the strongest calculated binding energy to the calcite surface that is selectively preserved. Thermal age calculations demonstrate that the Laetoli and Olduvai peptides are 50 times older than any previously authenticated...

  18. Protein signatures using electrostatic molecular surfaces in harmonic space

    Directory of Open Access Journals (Sweden)

    C. Sofia Carvalho

    2013-10-01

    Full Text Available We developed a novel method based on the Fourier analysis of protein molecular surfaces to speed up the analysis of the vast structural data generated in the post-genomic era. This method computes the power spectrum of surfaces of the molecular electrostatic potential, whose three-dimensional coordinates have been either experimentally or theoretically determined. Thus we achieve a reduction of the initial three-dimensional information on the molecular surface to the one-dimensional information on pairs of points at a fixed scale apart. Consequently, the similarity search in our method is computationally less demanding and significantly faster than shape comparison methods. As proof of principle, we applied our method to a training set of viral proteins that are involved in major diseases such as Hepatitis C, Dengue fever, Yellow fever, Bovine viral diarrhea and West Nile fever. The training set contains proteins of four different protein families, as well as a mammalian representative enzyme. We found that the power spectrum successfully assigns a unique signature to each protein included in our training set, thus providing a direct probe of functional similarity among proteins. The results agree with established biological data from conventional structural biochemistry analyses.

  19. Protein-surface interactions on stimuli-responsive polymeric biomaterials.

    Science.gov (United States)

    Cross, Michael C; Toomey, Ryan G; Gallant, Nathan D

    2016-03-04

    Responsive surfaces: a review of the dependence of protein adsorption on the reversible volume phase transition in stimuli-responsive polymers. Specifically addressed are a widely studied subset: thermoresponsive polymers. Findings are also generalizable to other materials which undergo a similarly reversible volume phase transition. As of 2015, over 100,000 articles have been published on stimuli-responsive polymers and many more on protein-biomaterial interactions. Significantly, fewer than 100 of these have focused specifically on protein interactions with stimuli-responsive polymers. These report a clear trend of increased protein adsorption in the collapsed state compared to the swollen state. This control over protein interactions makes stimuli-responsive polymers highly useful in biomedical applications such as wound repair scaffolds, on-demand drug delivery, and antifouling surfaces. Outstanding questions are whether the protein adsorption is reversible with the volume phase transition and whether there is a time-dependence. A clear understanding of protein interactions with stimuli-responsive polymers will advance theoretical models, experimental results, and biomedical applications.

  20. Surface charge effects in protein adsorption on nanodiamonds

    Science.gov (United States)

    Aramesh, M.; Shimoni, O.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Understanding the interaction of proteins with charged diamond nanoparticles is of fundamental importance for diverse biomedical applications. Here we present a thorough study of protein binding, adsorption kinetics and structure on strongly positively (hydrogen-terminated) and negatively (oxygen-terminated) charged nanodiamond particles using a quartz crystal microbalance by dissipation and infrared spectroscopy. By using two model proteins (bovine serum albumin and lysozyme) of different properties (charge, molecular weight and rigidity), the main driving mechanism responsible for the protein binding to the charged nanoparticles was identified. Electrostatic interactions were found to dominate the protein adsorption dynamics, attachment and conformation. We developed a simple electrostatic model that can qualitatively explain the observed adsorption behaviour based on charge-induced pH modifications near the charged nanoparticle surfaces. Under neutral conditions, the local pH around the positively and negatively charged nanodiamonds becomes very high (11-12) and low (1-3) respectively, which has a profound impact on the protein charge, hydration and affinity to the nanodiamonds. Small proteins (lysozyme) were found to form multilayers with significant conformational changes to screen the surface charge, while larger proteins (albumin) formed monolayers with minor conformational changes. The findings of this study provide a step forward toward understanding and eventually predicting nanoparticle interactions with biofluids.Understanding the interaction of proteins with charged diamond nanoparticles is of fundamental importance for diverse biomedical applications. Here we present a thorough study of protein binding, adsorption kinetics and structure on strongly positively (hydrogen-terminated) and negatively (oxygen-terminated) charged nanodiamond particles using a quartz crystal microbalance by dissipation and infrared spectroscopy. By using two model proteins

  1. Surface proteins and the formation of biofilms by Staphylococcus aureus.

    Science.gov (United States)

    Kim, Sung Joon; Chang, James; Rimal, Binayak; Yang, Hao; Schaefer, Jacob

    2018-03-01

    Staphylococcus aureus biofilms pose a serious clinical threat as reservoirs for persistent infections. Despite this clinical significance, the composition and mechanism of formation of S. aureus biofilms are unknown. To address these problems, we used solid-state NMR to examine S. aureus (SA113), a strong biofilm-forming strain. We labeled whole cells and cell walls of planktonic cells, young biofilms formed for 12-24h after stationary phase, and more mature biofilms formed for up to 60h after stationary phase. All samples were labeled either by (i) [ 15 N]glycine and l-[1- 13 C]threonine, or in separate experiments, by (ii) l-[2- 13 C, 15 N]leucine. We then measured 13 C- 15 N direct bonds by C{N} rotational-echo double resonance (REDOR). The increase in peptidoglycan stems that have bridges connected to a surface protein was determined directly by a cell-wall double difference (biofilm REDOR difference minus planktonic REDOR difference). This procedure eliminates errors arising from differences in 15 N isotopic enrichments and from the routing of 13 C label from threonine degradation to glycine. For both planktonic cells and the mature biofilm, 20% of pentaglycyl bridges are not cross-linked and are potential surface-protein attachment sites. None of these sites has a surface protein attached in the planktonic cells, but one-fourth have a surface protein attached in the mature biofilm. Moreover, the leucine-label shows that the concentration of β-strands in leucine-rich regions doubles in the mature biofilm. Thus, a primary event in establishing a S. aureus biofilm is extensive decoration of the cell surface with surface proteins that are linked covalently to the cell wall and promote cell-cell adhesion. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Role of Streptococcus mutans surface proteins for biofilm formation

    Directory of Open Access Journals (Sweden)

    Michiyo Matsumoto-Nakano

    2018-02-01

    Full Text Available Summary: Streptococcus mutans has been implicated as a primary causative agent of dental caries in humans. An important virulence property of the bacterium is its ability to form biofilm known as dental plaque on tooth surfaces. In addition, this organism also produces glucosyltransferases, multiple glucan-binding proteins, protein antigen c, and collagen-binding protein, surface proteins that coordinate to produce dental plaque, thus inducing dental caries. Bacteria utilize quorum-sensing systems to modulate environmental stress responses. A major mechanism of response to signals is represented by the so called two-component signal transduction system, which enables bacteria to regulate their gene expression and coordinate activities in response to environmental stress. As for S. mutans, a signal peptide-mediated quorum-sensing system encoded by comCDE has been found to be a regulatory system that responds to cell density and certain environmental stresses by excreting a peptide signal molecule termed CSP (competence-stimulating peptide. One of its principal virulence factors is production of bacteriocins (peptide antibiotics referred to as mutacins. Two-component signal transduction systems are commonly utilized by bacteria to regulate bacteriocin gene expression and are also related to biofilm formation by S. mutans. Keywords: Streptococcus mutans, Surface proteins, Biofilm, Signal transduction

  3. Sputter deposited bioceramic coatings: surface characterisation and initial protein adsorption studies using surface-MALDI-MS

    DEFF Research Database (Denmark)

    Boyd, A. R.; Burke, G. A.; Duffy, H.

    2011-01-01

    Protein adsorption onto calcium phosphate (Ca–P) bioceramics utilised in hard tissue implant applications has been highlighted as one of the key events that influences the subsequent biological response, in vivo. This work reports on the use of surface-matrix assisted laser desorption ionisation...... to a combination of growth factors and lipoproteins present in serum. From the data obtained here it is evident that surface-MALDI-MS has significant utility as a tool for studying the dynamic nature of protein adsorption onto the surfaces of bioceramic coatings, which most likely plays a significant role...

  4. Deposition of heated whey proteins on a chromium oxide surface.

    NARCIS (Netherlands)

    Jeurnink, Th.; Verheul, M.; Cohen Stuart, M.A.; Kruif, de C.G.

    1996-01-01

    Whey protein solutions were given different heat treatments after which their deposition on a chromium oxide surface (the outer layer of stainless steel) was measured by reflectometry. The deposition was studied under controlled flow conditions by using a stagnation point flow configuration. The

  5. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  6. In vitro study of proteins surface activity by tritium probe

    International Nuclear Information System (INIS)

    Chernysheva, M.G.; Badun, G.A.

    2010-01-01

    A new technique for in vitro studies of biomacromolecules interactions, their adsorption at aqueous/organic liquid interfaces and distribution in the bulk of liquid/liquid systems was developed. The method includes (1) tritium labeling of biomolecules by tritium thermal activation method and (2) scintillation phase step with organic phase, which can be concerned as a model of cellular membrane. Two globular proteins lysozyme and human serum albumin tested. We have determined the conditions of tritium labeling when labeled by-products can be easy separated by means of dialysis and size-exclusion chromatography. Scintillation phase experiments were conducted for three types of organic liquids. Thus, the influences of the nature of organic phase on proteins adsorption and its distribution in the bulk of aqueous/organic liquid system were determined. It was found that proteins possess high surface activity at aqueous/organic liquid interface. Furthermore, values of hydrophobicity of globular proteins were found by the experiment. (author)

  7. Heat shock proteins on the human sperm surface.

    Science.gov (United States)

    Naaby-Hansen, Soren; Herr, John C

    2010-01-01

    The sperm plasma membrane is known to be critical to fertilization and to be highly regionalized into domains of head, mid- and principal pieces. However, the molecular composition of the sperm plasma membrane and its alterations during genital tract passage, capacitation and the acrosome reaction remains to be fully dissected. A two-dimensional gel-based proteomic study previously identified 98 human sperm proteins which were accessible for surface labelling with both biotin and radioiodine. In this report twelve dually labelled protein spots were excised from stained gels or PDVF membranes and analysed by mass spectrometry (MS) and Edman degradation. Seven members from four different heat shock protein (HSP) families were identified including HYOU1 (ORP150), HSPC1 (HSP86), HSPA5 (Bip), HSPD1 (HSP60), and several isoforms of the two testis-specific HSP70 chaperones HSPA2 and HSPA1L. An antiserum raised against the testis-specific HSPA2 chaperone reacted with three 65kDa HSPA2 isoforms and three high molecular weight surface proteins (78-79kDa, 84kDa and 90-93kDa). These proteins, together with seven 65kDa HSP70 forms, reacted with human anti-sperm IgG antibodies that blocked in vitro fertilization in humans. Three of these surface biotinylated human sperm antigens were immunoprecipitated with a rabbit antiserum raised against a linear peptide epitope in Chlamydia trachomatis HSP70. The results indicate diverse HSP chaperones are accessible for surface labelling on human sperm. Some of these share epitopes with C. trachomatis HSP70, suggesting an association between genital tract infection, immunity to HSP70 and reproductive failure. 2009 Elsevier Ireland Ltd. All rights reserved.

  8. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  9. The modular xylanase Xyn10A from Rhodothermus marinus is cell-attached, and its C-terminal domain has several putative homologues among cell-attached proteins within the phylum Bacteroidetes

    DEFF Research Database (Denmark)

    Karlsson, Eva Nordberg; Hachem, Maher Abou; Ramchuran, Santosh

    2004-01-01

    -termini of proteins that were predominantly extra-cellular/cell attached. A primary structure motif of three conserved regions including structurally important glycines and a proline was also identified suggesting a conserved 3D fold. This bioinformatic evidence suggested a possible role of this domain in mediating...

  10. Hepatitis B virus induces cell proliferation via HBx-induced microRNA-21 in hepatocellular carcinoma by targeting programmed cell death protein4 (PDCD4 and phosphatase and tensin homologue (PTEN.

    Directory of Open Access Journals (Sweden)

    Preeti Damania

    Full Text Available Hepatitis B viral infection-induced hepatocellular carcinoma is one of the major problems in the developing countries. One of the HBV proteins, HBx, modulates the host cell machinery via several mechanisms. In this study we hypothesized that HBV enhances cell proliferation via HBx-induced microRNA-21 in hepatocellular carcinoma. HBx gene was over-expressed, and miRNA-21 expression and cell proliferation were measured in Huh 7 and Hep G2 cells. miRNA-21 was over-expressed in these cells, cell proliferation and the target proteins were analyzed. To confirm the role of miRNA-21 in HBx-induced proliferation, Hep G 2.2.1.5 cells (a cell line that expresses HBV stably were used for miRNA-21 inhibition studies. HBx over-expression enhanced proliferation (3.7- and 4.5-fold increase; n = 3; p<0.01 and miRNA-21 expression (24- and 36-fold increase, normalized with 5S rRNA; p<0.001 in Huh 7 and Hep G2 cells respectively. HBx also resulted in the inhibition of miRNA-21 target proteins, PDCD4 and PTEN. miRNA-21 resulted in a significant increase in proliferation (2- and 2.3-fold increase over control cells; p<0.05 in Huh 7 and Hep G2 cells respectively and decreased target proteins, PDCD4 and PTEN expression. Anti-miR-21 resulted in a significant decrease in proliferation (p<0.05 and increased miRNA-21 target protein expression. We conclude that HBV infection enhances cell proliferation, at least in part, via HBx-induced miRNA-21 expression during hepatocellular carcinoma progression.

  11. Improved protein surface comparison and application to low-resolution protein structure data

    Directory of Open Access Journals (Sweden)

    Kihara Daisuke

    2010-12-01

    Full Text Available Abstract Background Recent advancements of experimental techniques for determining protein tertiary structures raise significant challenges for protein bioinformatics. With the number of known structures of unknown function expanding at a rapid pace, an urgent task is to provide reliable clues to their biological function on a large scale. Conventional approaches for structure comparison are not suitable for a real-time database search due to their slow speed. Moreover, a new challenge has arisen from recent techniques such as electron microscopy (EM, which provide low-resolution structure data. Previously, we have introduced a method for protein surface shape representation using the 3D Zernike descriptors (3DZDs. The 3DZD enables fast structure database searches, taking advantage of its rotation invariance and compact representation. The search results of protein surface represented with the 3DZD has showngood agreement with the existing structure classifications, but some discrepancies were also observed. Results The three new surface representations of backbone atoms, originally devised all-atom-surface representation, and the combination of all-atom surface with the backbone representation are examined. All representations are encoded with the 3DZD. Also, we have investigated the applicability of the 3DZD for searching protein EM density maps of varying resolutions. The surface representations are evaluated on structure retrieval using two existing classifications, SCOP and the CE-based classification. Conclusions Overall, the 3DZDs representing backbone atoms show better retrieval performance than the original all-atom surface representation. The performance further improved when the two representations are combined. Moreover, we observed that the 3DZD is also powerful in comparing low-resolution structures obtained by electron microscopy.

  12. Improved protein surface comparison and application to low-resolution protein structure data.

    Science.gov (United States)

    Sael, Lee; Kihara, Daisuke

    2010-12-14

    Recent advancements of experimental techniques for determining protein tertiary structures raise significant challenges for protein bioinformatics. With the number of known structures of unknown function expanding at a rapid pace, an urgent task is to provide reliable clues to their biological function on a large scale. Conventional approaches for structure comparison are not suitable for a real-time database search due to their slow speed. Moreover, a new challenge has arisen from recent techniques such as electron microscopy (EM), which provide low-resolution structure data. Previously, we have introduced a method for protein surface shape representation using the 3D Zernike descriptors (3DZDs). The 3DZD enables fast structure database searches, taking advantage of its rotation invariance and compact representation. The search results of protein surface represented with the 3DZD has showngood agreement with the existing structure classifications, but some discrepancies were also observed. The three new surface representations of backbone atoms, originally devised all-atom-surface representation, and the combination of all-atom surface with the backbone representation are examined. All representations are encoded with the 3DZD. Also, we have investigated the applicability of the 3DZD for searching protein EM density maps of varying resolutions. The surface representations are evaluated on structure retrieval using two existing classifications, SCOP and the CE-based classification. Overall, the 3DZDs representing backbone atoms show better retrieval performance than the original all-atom surface representation. The performance further improved when the two representations are combined. Moreover, we observed that the 3DZD is also powerful in comparing low-resolution structures obtained by electron microscopy.

  13. Volumetric interpretation of protein adsorption: interfacial packing of protein adsorbed to hydrophobic surfaces from surface-saturating solution concentrations.

    Science.gov (United States)

    Kao, Ping; Parhi, Purnendu; Krishnan, Anandi; Noh, Hyeran; Haider, Waseem; Tadigadapa, Srinivas; Allara, David L; Vogler, Erwin A

    2011-02-01

    The maximum capacity of a hydrophobic adsorbent is interpreted in terms of square or hexagonal (cubic and face-centered-cubic, FCC) interfacial packing models of adsorbed blood proteins in a way that accommodates experimental measurements by the solution-depletion method and quartz-crystal-microbalance (QCM) for the human proteins serum albumin (HSA, 66 kDa), immunoglobulin G (IgG, 160 kDa), fibrinogen (Fib, 341 kDa), and immunoglobulin M (IgM, 1000 kDa). A simple analysis shows that adsorbent capacity is capped by a fixed mass/volume (e.g. mg/mL) surface-region (interphase) concentration and not molar concentration. Nearly analytical agreement between the packing models and experiment suggests that, at surface saturation, above-mentioned proteins assemble within the interphase in a manner that approximates a well-ordered array. HSA saturates a hydrophobic adsorbent with the equivalent of a single square or hexagonally-packed layer of hydrated molecules whereas the larger proteins occupy two-or-more layers, depending on the specific protein under consideration and analytical method used to measure adsorbate mass (solution depletion or QCM). Square or hexagonal (cubic and FCC) packing models cannot be clearly distinguished by comparison to experimental data. QCM measurement of adsorbent capacity is shown to be significantly different than that measured by solution depletion for similar hydrophobic adsorbents. The underlying reason is traced to the fact that QCM measures contribution of both core protein, water of hydration, and interphase water whereas solution depletion measures only the contribution of core protein. It is further shown that thickness of the interphase directly measured by QCM systematically exceeds that inferred from solution-depletion measurements, presumably because the static model used to interpret solution depletion does not accurately capture the complexities of the viscoelastic interfacial environment probed by QCM. Copyright © 2010

  14. Dynamic, electronically switchable surfaces for membrane protein microarrays.

    Science.gov (United States)

    Tang, C S; Dusseiller, M; Makohliso, S; Heuschkel, M; Sharma, S; Keller, B; Vörös, J

    2006-02-01

    Microarray technology is a powerful tool that provides a high throughput of bioanalytical information within a single experiment. These miniaturized and parallelized binding assays are highly sensitive and have found widespread popularity especially during the genomic era. However, as drug diagnostics studies are often targeted at membrane proteins, the current arraying technologies are ill-equipped to handle the fragile nature of the protein molecules. In addition, to understand the complex structure and functions of proteins, different strategies to immobilize the probe molecules selectively onto a platform for protein microarray are required. We propose a novel approach to create a (membrane) protein microarray by using an indium tin oxide (ITO) microelectrode array with an electronic multiplexing capability. A polycationic, protein- and vesicle-resistant copolymer, poly(l-lysine)-grafted-poly(ethylene glycol) (PLL-g-PEG), is exposed to and adsorbed uniformly onto the microelectrode array, as a passivating adlayer. An electronic stimulation is then applied onto the individual ITO microelectrodes resulting in the localized release of the polymer thus revealing a bare ITO surface. Different polymer and biological moieties are specifically immobilized onto the activated ITO microelectrodes while the other regions remain protein-resistant as they are unaffected by the induced electrical potential. The desorption process of the PLL-g-PEG is observed to be highly selective, rapid, and reversible without compromising on the integrity and performance of the conductive ITO microelectrodes. As such, we have successfully created a stable and heterogeneous microarray of biomolecules by using selective electronic addressing on ITO microelectrodes. Both pharmaceutical diagnostics and biomedical technology are expected to benefit directly from this unique method.

  15. Preventing protein adsorption from a range of surfaces using an aqueous fish protein extract

    DEFF Research Database (Denmark)

    Pillai, Saju; Arpanaei, Ayyoob; Meyer, Rikke L.

    2009-01-01

    We utilize an aqueous extract of fish proteins (FPs) as a coating for minimizing the adsorption of fibrinogen (Fg) and human serum albumin (HSA). The surfaces include stainless steel (SS), gold (Au), silicon dioxide (SiO2), and poly(styrene) (PS). The adsorption processes (kinetics and adsorbed...

  16. Characterization of the Eimeria maxima sporozoite surface protein IMP1.

    Science.gov (United States)

    Jenkins, M C; Fetterer, R; Miska, K; Tuo, W; Kwok, O; Dubey, J P

    2015-07-30

    The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6-12h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by non-reducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection. Published by Elsevier B.V.

  17. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  18. Biological properties of Lactobacillus surface proteins 

    Directory of Open Access Journals (Sweden)

    Barbara Buda

    2013-04-01

    Full Text Available Lactobacillus, a genus of Gram-positive bacteria, includes many strains of probiotic microflora. Probiotics, by definition, are living microorganisms that exert beneficial effects on the host organism. The morphology and physiology of the Lactobacillus bacterial genus are described. The structure of the cell wall of Gram-positive bacteria is discussed. The surface S-layer of Lactobacillus composed of proteins (SLP with low molecular mass is presented. Cell surface proteins participating in the regulation of growth and survival of the intestinal epithelium cells are characterized. The influence of stress factors such as increased temperature, pH, and enzymes of gastric and pancreatic juice on SLP expression is described. The ability of binding of heavy metal ions by S-layer proteins is discussed. The characteristics of these structures, including the ability to adhere to epithelial cells, and the inhibition of invasion of pathogenic microflora of type Shigella, Salmonella, Escherichia coli and Clostridium and their toxins, are presented. 

  19. Protein adsorption at nanopatterned surfaces studied by QCM-D and SPR

    DEFF Research Database (Denmark)

    Kristensen, Stine; Pedersen, Gitte Albinus; Nejsum, Lene Niemann

    2013-01-01

    This paper presents the use of the quartz microbalance with dissipation combined with surface plasmon resonance to probe protein adsorption at nanopatterned surfaces. Three different types of adsorbing materials, representing rigid discrete nanoparticles, dense protein films and soft low density ...

  20. Surface-Enhanced Raman Scattering Nanoparticles as Optical Labels for Imaging Cell Surface Proteins

    Science.gov (United States)

    MacLaughlin, Christina M.

    Assaying the expression of cell surface proteins has widespread application for characterizing cell type, developmental stage, and monitoring disease transformation. Immunophenotyping is conducted by treating cells with labelled targeting moieties that have high affinity for relevant surface protein(s). The sensitivity and specificity of immunophenotyping is defined by the choice of contrast agent and therefore, the number of resolvable signals that can be used to simultaneously label cells. Narrow band width surface-enhanced Raman scattering (SERS) nanoparticles are proposed as optical labels for multiplexed immunophenotying. Two types of surface coatings were investigated to passivate the gold nanoparticles, incorporate SERS functionality, and to facilitate attachment of targeting antibodies. Thiolated poly(ethylene glycol) forms dative bonds with the gold surface and is compatible with multiple physisorbed Raman-active reporter molecules. Ternary lipid bilayers are used to encapsulate the gold nanoparticles particles, and incorporate three different classes of Raman reporters. TEM, UV-Visible absorbance spectroscopy, DLS, and electrophoretic light scattering were used characterize the particle coating. Colourimetric protein assay, and secondary antibody labelling were used to quantify the antibody conjugation. Three different in vitromodels were used to investigate the binding efficacy and specificity of SERS labels for their biomarker targets. Primary human CLL cells, LY10 B lymphoma, and A549 adenocarcinoma lines were targeted. Dark field imaging was used to visualize the colocalization of SERS labels with cells, and evidence of receptor clustering was obtained based on colour shifts of the particles' Rayleigh scattering. Widefield, and spatially-resolved Raman spectra were used to detect labels singly, and in combination from labelled cells. Fluorescence flow cytometry was used to test the particles' binding specificity, and SERS from labelled cells was also

  1. Surface peptide mapping of protein I and protein III of four strains of Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Judd, R.C.

    1982-01-01

    Whole cells and isolated outer membranes (OMs) of four strains of gonococci were surface radioiodinated with either lactoperoxidase or Iodogen (Pierce Chemical Co., Rockford, Ill.). These preparations were solubilized in sodium dodecyl sulfate and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Surface-radioiodinated protein I (PI) and PIII bands were excised from the sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels and digested with alpha-chymotrypsin, and the resultant 125 I-peptide fragments were resolved by high-voltage electrophoresis and thin-layer chromatography (i.e., surface peptide mapping). Radioemitting peptidic fragments were visualized by autoradiography. Results demonstrated that the PI molecule of each gonococcal strain studied had unique iodinatable peptides exposed on the surface of whole cells and OMs, whereas PIIIs appeared to have the same portion of the molecule exposed on the surface of bacteria or OMs, regardless of the gonococcal strain from which they were isolated. Many more radiolabeled peptides were seen in surface peptide maps of PIs from radiolabeled OMs than in those from radioiodinated whole cells, whereas different peptidic fragments were seen in the surface peptide maps of PIIIs from radiolabeled OMs than were seen in those from radiolabeled whole cells. These data suggest that PI may contribute strain-specific antigenic determinants and PIII may contribute cross-reactive determinants and that the surface exposure of PI and PIII is different in isolated OMs than in the OM of intact gonococci

  2. Shotgun proteomic analytical approach for studying proteins adsorbed onto liposome surface

    KAUST Repository

    Capriotti, Anna Laura; Caracciolo, Giulio; Cavaliere, Chiara; Crescenzi, Carlo; Pozzi, Daniela; Laganà , Aldo

    2011-01-01

    The knowledge about the interaction between plasma proteins and nanocarriers employed for in vivo delivery is fundamental to understand their biodistribution. Protein adsorption onto nanoparticle surface (protein corona) is strongly affected

  3. Molecular biology of Chlamydia pneumoniae surface proteins and their role in immunopathogenicity

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Boesen, Thomas; Hjernø, Karin

    1999-01-01

    present on the surface of the bacteria, we analyzed what components are present on the C pneumoniae surface. We identified a family of proteins, the GGAI or Omp4-15 proteins, of which at least 3 are present on the surface of C pneumoniae. We immunized rabbits with recombinant GGAI proteins and used...

  4. Prediction of antigenic epitopes on protein surfaces by consensus scoring

    Directory of Open Access Journals (Sweden)

    Zhang Chi

    2009-09-01

    Full Text Available Abstract Background Prediction of antigenic epitopes on protein surfaces is important for vaccine design. Most existing epitope prediction methods focus on protein sequences to predict continuous epitopes linear in sequence. Only a few structure-based epitope prediction algorithms are available and they have not yet shown satisfying performance. Results We present a new antigen Epitope Prediction method, which uses ConsEnsus Scoring (EPCES from six different scoring functions - residue epitope propensity, conservation score, side-chain energy score, contact number, surface planarity score, and secondary structure composition. Applied to unbounded antigen structures from an independent test set, EPCES was able to predict antigenic eptitopes with 47.8% sensitivity, 69.5% specificity and an AUC value of 0.632. The performance of the method is statistically similar to other published methods. The AUC value of EPCES is slightly higher compared to the best results of existing algorithms by about 0.034. Conclusion Our work shows consensus scoring of multiple features has a better performance than any single term. The successful prediction is also due to the new score of residue epitope propensity based on atomic solvent accessibility.

  5. G-Protein Coupled Receptors: Surface Display and Biosensor Technology

    Science.gov (United States)

    McMurchie, Edward; Leifert, Wayne

    Signal transduction by G-protein coupled receptors (GPCRs) underpins a multitude of physiological processes. Ligand recognition by the receptor leads to the activation of a generic molecular switch involving heterotrimeric G-proteins and guanine nucleotides. With growing interest and commercial investment in GPCRs in areas such as drug targets, orphan receptors, high-throughput screening of drugs and biosensors, greater attention will focus on assay development to allow for miniaturization, ultrahigh-throughput and, eventually, microarray/biochip assay formats that will require nanotechnology-based approaches. Stable, robust, cell-free signaling assemblies comprising receptor and appropriate molecular switching components will form the basis of future GPCR/G-protein platforms, which should be able to be adapted to such applications as microarrays and biosensors. This chapter focuses on cell-free GPCR assay nanotechnologies and describes some molecular biological approaches for the construction of more sophisticated, surface-immobilized, homogeneous, functional GPCR sensors. The latter points should greatly extend the range of applications to which technologies based on GPCRs could be applied.

  6. Surface proteins of bacteria of the genus Bifidobacterium 

    Directory of Open Access Journals (Sweden)

    Ewa Dylus

    2013-05-01

    Full Text Available Beneficial effects due to the presence of probiotic bacteria of the genus Bifidobacterium in the human intestinal tract are still an interesting object of study. So far activities have been confirmed of bifidobacteria in stimulation of the host immune system, stimulation of tumor cell apoptosis, improvement of bowel motility, alleviation of symptoms of lactose intolerance, cholesterol lowering capacity, prevention and treatment of diarrhea and irritable bowel syndrome, alleviation of allergy or atopic dermatitis, maintenance of homeostasis of the intestine, and stimulation of the development of normal intestinal microflora in infants. A multitude of therapeutic properties encourages researchers to investigate the possibility of using the potential of Bifidobacterium in the prevention and treatment of other conditions such as rheumatoid arthritis and depression. Although it is known that the beneficial effects are due to intestinal mucosal colonization by these bacteria, the cell components responsible for the colonization are still not determined. In addition to the beneficial effects of probiotic administration, there were also negative effects including sepsis. Therefore research has been directed to identify specific components of Bifidobacterium responsible for probiotic effects. Currently researchers are focused on identifying, isolating and evaluating the properties of surface proteins that are probably involved in the adhesion of bacterial cells to the intestinal epithelium, improving colonization. This paper is an overview of current knowledge on Bifidobacterium surface proteins. The ways of transport and anchoring proteins in Gram-positive bacterial cells, the assembly of cell wall, and a description of the genus Bifidobacterium are presented.

  7. Thermal green protein, an extremely stable, nonaggregating fluorescent protein created by structure-guided surface engineering.

    Science.gov (United States)

    Close, Devin W; Paul, Craig Don; Langan, Patricia S; Wilce, Matthew C J; Traore, Daouda A K; Halfmann, Randal; Rocha, Reginaldo C; Waldo, Geoffery S; Payne, Riley J; Rucker, Joseph B; Prescott, Mark; Bradbury, Andrew R M

    2015-07-01

    In this article, we describe the engineering and X-ray crystal structure of Thermal Green Protein (TGP), an extremely stable, highly soluble, non-aggregating green fluorescent protein. TGP is a soluble variant of the fluorescent protein eCGP123, which despite being highly stable, has proven to be aggregation-prone. The X-ray crystal structure of eCGP123, also determined within the context of this paper, was used to carry out rational surface engineering to improve its solubility, leading to TGP. The approach involved simultaneously eliminating crystal lattice contacts while increasing the overall negative charge of the protein. Despite intentional disruption of lattice contacts and introduction of high entropy glutamate side chains, TGP crystallized readily in a number of different conditions and the X-ray crystal structure of TGP was determined to 1.9 Å resolution. The structural reasons for the enhanced stability of TGP and eCGP123 are discussed. We demonstrate the utility of using TGP as a fusion partner in various assays and significantly, in amyloid assays in which the standard fluorescent protein, EGFP, is undesirable because of aberrant oligomerization. © 2014 Wiley Periodicals, Inc.

  8. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  9. Imparting albumin-binding affinity to a human protein by mimicking the contact surface of a bacterial binding protein.

    Science.gov (United States)

    Oshiro, Satoshi; Honda, Shinya

    2014-04-18

    Attachment of a bacterial albumin-binding protein module is an attractive strategy for extending the plasma residence time of protein therapeutics. However, a protein fused with such a bacterial module could induce unfavorable immune reactions. To address this, we designed an alternative binding protein by imparting albumin-binding affinity to a human protein using molecular surface grafting. The result was a series of human-derived 6 helix-bundle proteins, one of which specifically binds to human serum albumin (HSA) with adequate affinity (KD = 100 nM). The proteins were designed by transferring key binding residues of a bacterial albumin-binding module, Finegoldia magna protein G-related albumin-binding domain (GA) module, onto the human protein scaffold. Despite 13-15 mutations, the designed proteins maintain the original secondary structure by virtue of careful grafting based on structural informatics. Competitive binding assays and thermodynamic analyses of the best binders show that the binding mode resembles that of the GA module, suggesting that the contacting surface of the GA module is mimicked well on the designed protein. These results indicate that the designed protein may act as an alternative low-risk binding module to HSA. Furthermore, molecular surface grafting in combination with structural informatics is an effective approach for avoiding deleterious mutations on a target protein and for imparting the binding function of one protein onto another.

  10. New reactive polymer for protein immobilisation on sensor surfaces.

    Science.gov (United States)

    Kyprianou, Dimitris; Guerreiro, Antonio R; Chianella, Iva; Piletska, Elena V; Fowler, Steven A; Karim, Kal; Whitcombe, Michael J; Turner, Anthony P F; Piletsky, Sergey A

    2009-01-01

    Immobilisation of biorecognition elements on transducer surfaces is a key step in the development of biosensors. The immobilisation needs to be fast, cheap and most importantly should not affect the biorecognition activity of the immobilised receptor. A novel protocol for the covalent immobilisation of biomolecules containing primary amines using an inexpensive and simple polymer is presented. This tri-dimensional (3D) network leads to a random immobilisation of antibodies on the polymer and ensures the availability of a high percentage of antibody binding sites. The reactivity of the polymer is based on the reaction between primary amines and thioacetal groups included in the polymer network. These functional groups (thioacetal) do not need any further activation in order to react with proteins, making it attractive for sensor fabrication. The novel polymer also contains thiol derivative groups (disulphide groups or thioethers) that promote self-assembling on a metal transducer surface. For demonstration purposes the polymer was immobilised on Au Biacore chips. The resulting polymer layer was characterised using contact angle meter, atomic force microscopy (AFM) and ellipsometry. A general protocol suitable for the immobilisation of bovine serum albumin (BSA), enzymes and antibodies such as polyclonal anti-microcystin-LR antibody and monoclonal anti-prostate specific antigen (anti-PSA) antibody was then optimised. The affinity characteristics of developed immunosensors were investigated in reaction with microcystin-LR, and PSA. The calculated detection limit for analytes depended on the properties of antibodies. The detection limit for microcystin-LR was 10 ngmL(-1) and for PSA 0.01 ngmL(-1). The non-specific binding of analytes to synthesised polymers was very low. The polymer-coated chips were stored for up to 2 months without any noticeable deterioration in their ability to react with proteins. These findings make this new polymer very promising for the

  11. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  12. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  13. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Science.gov (United States)

    Reolon, Luciano Antonio; Martello, Carolina Lumertz; Schrank, Irene Silveira; Ferreira, Henrique Bunselmeyer

    2014-01-01

    The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae), the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia.

  14. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Directory of Open Access Journals (Sweden)

    Luciano Antonio Reolon

    Full Text Available The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae, the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia.

  15. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  16. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  17. Hydrophobicity-driven self-assembly of protein and silver nanoparticles for protein detection using surface-enhanced Raman scattering.

    Science.gov (United States)

    Kahraman, Mehmet; Balz, Ben N; Wachsmann-Hogiu, Sebastian

    2013-05-21

    Surface-enhanced Raman scattering (SERS) is a promising analytical technique for the detection and characterization of biological molecules and structures. The role of hydrophobic and hydrophilic surfaces in the self-assembly of protein-metallic nanoparticle structures for label-free protein detection is demonstrated. Aggregation is driven by both the hydrophobicity of the surface as well as the charge of the proteins. The best conditions for obtaining a reproducible SERS signal that allows for sensitive, label-free protein detection are provided by the use of hydrophobic surfaces and 16 × 10(11) NPs per mL. A detection limit of approximately 0.5 μg mL(-1) is achieved regardless of the proteins' charge properties and size. The developed method is simple and can be used for reproducible and sensitive detection and characterization of a wide variety of biological molecules and various structures with different sizes and charge status.

  18. Binding Ligand Prediction for Proteins Using Partial Matching of Local Surface Patches

    Directory of Open Access Journals (Sweden)

    Lee Sael

    2010-12-01

    Full Text Available Functional elucidation of uncharacterized protein structures is an important task in bioinformatics. We report our new approach for structure-based function prediction which captures local surface features of ligand binding pockets. Function of proteins, specifically, binding ligands of proteins, can be predicted by finding similar local surface regions of known proteins. To enable partial comparison of binding sites in proteins, a weighted bipartite matching algorithm is used to match pairs of surface patches. The surface patches are encoded with the 3D Zernike descriptors. Unlike the existing methods which compare global characteristics of the protein fold or the global pocket shape, the local surface patch method can find functional similarity between non-homologous proteins and binding pockets for flexible ligand molecules. The proposed method improves prediction results over global pocket shape-based method which was previously developed by our group.

  19. Binding ligand prediction for proteins using partial matching of local surface patches.

    Science.gov (United States)

    Sael, Lee; Kihara, Daisuke

    2010-01-01

    Functional elucidation of uncharacterized protein structures is an important task in bioinformatics. We report our new approach for structure-based function prediction which captures local surface features of ligand binding pockets. Function of proteins, specifically, binding ligands of proteins, can be predicted by finding similar local surface regions of known proteins. To enable partial comparison of binding sites in proteins, a weighted bipartite matching algorithm is used to match pairs of surface patches. The surface patches are encoded with the 3D Zernike descriptors. Unlike the existing methods which compare global characteristics of the protein fold or the global pocket shape, the local surface patch method can find functional similarity between non-homologous proteins and binding pockets for flexible ligand molecules. The proposed method improves prediction results over global pocket shape-based method which was previously developed by our group.

  20. AFM study of adsorption of protein A on a poly(dimethylsiloxane) surface

    International Nuclear Information System (INIS)

    Yu Ling; Lu Zhisong; Gan Ye; Liu Yingshuai; Li, C M

    2009-01-01

    In this paper, the morphology and kinetics of adsorption of protein A on a PDMS surface is studied by AFM. The results of effects of pH, protein concentration and contact time of the adsorption reveal that the morphology of adsorbed protein A is significantly affected by pH and adsorbed surface concentration, in which the pH away from the isoelectric point (IEP) of protein A could produce electrical repulsion to change the protein conformation, while the high adsorbed surface protein volume results in molecular networks. Protein A can form an adsorbed protein film on PDMS with a maximum volume of 2.45 x 10 -3 μm 3 . This work enhances our fundamental understanding of protein A adsorption on PDMS, a frequently used substrate component in miniaturized immunoassay devices.

  1. Modelling of microbial polyhydroxyalkanoate surface binding protein PhaP for rational mutagenesis.

    Science.gov (United States)

    Zhao, Hongyu; Yao, Zhenyu; Chen, Xiangbin; Wang, Xinquan; Chen, Guo-Qiang

    2017-11-01

    Phasins are unusual amphiphilic proteins that bind to microbial polyhydroxyalkanoate (PHA) granules in nature and show great potential for various applications in biotechnology and medicine. Despite their remarkable diversity, only the crystal structure of PhaP A h from Aeromonas hydrophila has been solved to date. Based on the structure of PhaP A h , homology models of PhaP A z from Azotobacter sp. FA-8 and PhaP TD from Halomonas bluephagenesis TD were successfully established, allowing rational mutagenesis to be conducted to enhance the stability and surfactant properties of these proteins. PhaP A z mutants, including PhaP A z Q38L and PhaP A z Q78L, as well as PhaP TD mutants, including PhaP TD Q38M and PhaP TD Q72M, showed better emulsification properties and improved thermostability (6-10°C higher melting temperatures) compared with their wild-type homologues under the same conditions. Importantly, the established PhaP homology-modelling approach, based on the high-resolution structure of PhaP A h , can be generalized to facilitate the study of other PhaP members. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  2. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  3. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  4. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  5. Competitive Adsorption of Plasma Proteins on Polysaccharide-Modified Silicon Surfaces

    National Research Council Canada - National Science Library

    Ombelli, Michela; Costello, Lauren B; Meng, Qing C; Composto, Russell J; Eckmann, David M

    2005-01-01

    .... Competitive protein adsorption plays a key role in the hemocompatibility of the surface. The synthesis of nonfouling surfaces is therefore one of the major prerequisites for devices for biomedical applications...

  6. Photoswitchable method for the ordered attachment of proteins to surfaces

    Science.gov (United States)

    Camarero, Julio A.; De Yoreo, James J.; Kwon, Youngeun

    2010-04-20

    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  7. Modulating surface rheology by electrostatic protein/polysaccharide interactions

    NARCIS (Netherlands)

    Ganzevles, R.A.; Zinoviadou, K.; Vliet, van T.; Cohen Stuart, M.A.; Jongh, de H.H.J.

    2006-01-01

    There is a large interest in mixed protein/polysaccharide layers at air-water and oil-water interfaces because of their ability to stabilize foams and emulsions. Mixed protein/polysaccharide adsorbed layers at air-water interfaces can be prepared either by adsorption of soluble protein/

  8. Photoswitchable method for the ordered attachment of proteins to surfaces

    Science.gov (United States)

    Camarero, Julio A [Livermore, CA; DeYoreo, James J [Clayton, CA; Kwon, Youngeun [Livermore, CA

    2011-07-05

    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  9. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  10. Variation in a surface-exposed region of the Mycoplasma pneumoniae P40 protein as a consequence of homologous DNA recombination between RepMP5 elements.

    Science.gov (United States)

    Spuesens, Emiel B M; van de Kreeke, Nick; Estevão, Silvia; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

    2011-02-01

    Mycoplasma pneumoniae is a human pathogen that causes a range of respiratory tract infections. The first step in infection is adherence of the bacteria to the respiratory epithelium. This step is mediated by a specialized organelle, which contains several proteins (cytadhesins) that have an important function in adherence. Two of these cytadhesins, P40 and P90, represent the proteolytic products from a single 130 kDa protein precursor, which is encoded by the MPN142 gene. Interestingly, MPN142 contains a repetitive DNA element, termed RepMP5, of which homologues are found at seven other loci within the M. pneumoniae genome. It has been hypothesized that these RepMP5 elements, which are similar but not identical in sequence, recombine with their counterpart within MPN142 and thereby provide a source of sequence variation for this gene. As this variation may give rise to amino acid changes within P40 and P90, the recombination between RepMP5 elements may constitute the basis of antigenic variation and, possibly, immune evasion by M. pneumoniae. To investigate the sequence variation of MPN142 in relation to inter-RepMP5 recombination, we determined the sequences of all RepMP5 elements in a collection of 25 strains. The results indicate that: (i) inter-RepMP5 recombination events have occurred in seven of the strains, and (ii) putative RepMP5 recombination events involving MPN142 have induced amino acid changes in a surface-exposed part of the P40 protein in two of the strains. We conclude that recombination between RepMP5 elements is a common phenomenon that may lead to sequence variation of MPN142-encoded proteins.

  11. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  12. Effect of fullerenol surface chemistry on nanoparticle binding-induced protein misfolding

    Science.gov (United States)

    Radic, Slaven; Nedumpully-Govindan, Praveen; Chen, Ran; Salonen, Emppu; Brown, Jared M.; Ke, Pu Chun; Ding, Feng

    2014-06-01

    Fullerene and its derivatives with different surface chemistry have great potential in biomedical applications. Accordingly, it is important to delineate the impact of these carbon-based nanoparticles on protein structure, dynamics, and subsequently function. Here, we focused on the effect of hydroxylation -- a common strategy for solubilizing and functionalizing fullerene -- on protein-nanoparticle interactions using a model protein, ubiquitin. We applied a set of complementary computational modeling methods, including docking and molecular dynamics simulations with both explicit and implicit solvent, to illustrate the impact of hydroxylated fullerenes on the structure and dynamics of ubiquitin. We found that all derivatives bound to the model protein. Specifically, the more hydrophilic nanoparticles with a higher number of hydroxyl groups bound to the surface of the protein via hydrogen bonds, which stabilized the protein without inducing large conformational changes in the protein structure. In contrast, fullerene derivatives with a smaller number of hydroxyl groups buried their hydrophobic surface inside the protein, thereby causing protein denaturation. Overall, our results revealed a distinct role of surface chemistry on nanoparticle-protein binding and binding-induced protein misfolding.Fullerene and its derivatives with different surface chemistry have great potential in biomedical applications. Accordingly, it is important to delineate the impact of these carbon-based nanoparticles on protein structure, dynamics, and subsequently function. Here, we focused on the effect of hydroxylation -- a common strategy for solubilizing and functionalizing fullerene -- on protein-nanoparticle interactions using a model protein, ubiquitin. We applied a set of complementary computational modeling methods, including docking and molecular dynamics simulations with both explicit and implicit solvent, to illustrate the impact of hydroxylated fullerenes on the structure and

  13. [Adsorption characteristics of proteins on membrane surface and effect of protein solution environment on permeation behavior of berberine].

    Science.gov (United States)

    Li, Yi-Qun; Xu, Li; Zhu, Hua-Xu; Tang, Zhi-Shu; Li, Bo; Pan, Yong-Lan; Yao, Wei-Wei; Fu, Ting-Ming; Guo, Li-Wei

    2017-10-01

    In order to explore the adsorption characteristics of proteins on the membrane surface and the effect of protein solution environment on the permeation behavior of berberine, berberine and proteins were used as the research object to prepare simulated solution. Low field NMR, static adsorption experiment and membrane separation experiment were used to study the interaction between the proteins and ceramic membrane or between the proteins and berberine. The static adsorption capacity of proteins, membrane relative flux, rejection rate of proteins, transmittance rate of berberine and the adsorption rate of proteins and berberine were used as the evaluation index. Meanwhile, the membrane resistance distribution, the particle size distribution and the scanning electron microscope (SEM) were determined to investigate the adsorption characteristics of proteins on ceramic membrane and the effect on membrane separation process of berberine. The results showed that the ceramic membrane could adsorb the proteins and the adsorption model was consistent with Langmuir adsorption model. In simulating the membrane separation process, proteins were the main factor to cause membrane fouling. However, when the concentration of proteins was 1 g•L⁻¹, the proteins had no significant effect on membrane separation process of berberine. Copyright© by the Chinese Pharmaceutical Association.

  14. Pre-absorbed immunoproteomics: a novel method for the detection of Streptococcus suis surface proteins.

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    Full Text Available Streptococcus suis serotype 2 (SS2 is a zoonotic pathogen that can cause infections in pigs and humans. Bacterial surface proteins are often investigated as potential vaccine candidates and biomarkers of virulence. In this study, a novel method for identifying bacterial surface proteins is presented, which combines immunoproteomic and immunoserologic techniques. Critical to the success of this new method is an improved procedure for generating two-dimensional electrophoresis gel profiles of S. suis proteins. The S. suis surface proteins identified in this study include muramidase-released protein precursor (MRP and an ABC transporter protein, while MRP is thought to be one of the main virulence factors in SS2 located on the bacterial surface. Herein, we demonstrate that the ABC transporter protein can bind to HEp-2 cells, which strongly suggests that this protein is located on the bacterial cell surface and may be involved in pathogenesis. An immunofluorescence assay confirmed that the ABC transporter is localized to the bacterial outer surface. This new method may prove to be a useful tool for identifying surface proteins, and aid in the development of new vaccine subunits and disease diagnostics.

  15. Enhanced protein retention on poly(caprolactone) via surface initiated polymerization of acrylamide

    International Nuclear Information System (INIS)

    Ma, Yuhao; Cai, Mengtan; He, Liu; Luo, Xianglin

    2016-01-01

    Graphical abstract: - Highlights: • Dense package of poly(acrylamide) on poly(caprolactone) surface was achieved by surface-initiated atom transfer radical polymerization. • Poly(acrylamide) grafted surface exhibited high protein retention ability. • Loaded protein was resistant to detachment and maintained its structure without denaturation. - Abstract: To enhance the biocompatibility or extend the biomedical application of poly(caprolactone) (PCL), protein retention on PCL surface is often required. In this study, poly(acrylamide) (PAAm) brushes were grown from PCL surface via surface-initiated atom transfer radical polymerization (SI-ATRP) and served as a protein-capturing platform. Grafted PAAm was densely packed on surface and exhibited superior protein retention ability. Captured protein was found to be resistant to washing under detergent environment. Furthermore, protein structure after being captured was investigated by circular dichroism (CD) spectroscopy, and the CD spectra verified that secondary structure of captured proteins was maintained, indicating no denaturation of protein happened for retention process.

  16. Protein consensus-based surface engineering (ProCoS): a computer-assisted method for directed protein evolution.

    Science.gov (United States)

    Shivange, Amol V; Hoeffken, Hans Wolfgang; Haefner, Stefan; Schwaneberg, Ulrich

    2016-12-01

    Protein consensus-based surface engineering (ProCoS) is a simple and efficient method for directed protein evolution combining computational analysis and molecular biology tools to engineer protein surfaces. ProCoS is based on the hypothesis that conserved residues originated from a common ancestor and that these residues are crucial for the function of a protein, whereas highly variable regions (situated on the surface of a protein) can be targeted for surface engineering to maximize performance. ProCoS comprises four main steps: ( i ) identification of conserved and highly variable regions; ( ii ) protein sequence design by substituting residues in the highly variable regions, and gene synthesis; ( iii ) in vitro DNA recombination of synthetic genes; and ( iv ) screening for active variants. ProCoS is a simple method for surface mutagenesis in which multiple sequence alignment is used for selection of surface residues based on a structural model. To demonstrate the technique's utility for directed evolution, the surface of a phytase enzyme from Yersinia mollaretii (Ymphytase) was subjected to ProCoS. Screening just 1050 clones from ProCoS engineering-guided mutant libraries yielded an enzyme with 34 amino acid substitutions. The surface-engineered Ymphytase exhibited 3.8-fold higher pH stability (at pH 2.8 for 3 h) and retained 40% of the enzyme's specific activity (400 U/mg) compared with the wild-type Ymphytase. The pH stability might be attributed to a significantly increased (20 percentage points; from 9% to 29%) number of negatively charged amino acids on the surface of the engineered phytase.

  17. SURF'S UP! – Protein classification by surface comparisons

    Indian Academy of Sciences (India)

    2006-12-12

    Dec 12, 2006 ... Large-scale genome sequencing and structural genomics projects generate numerous sequences and structures for 'hypothetical' proteins without functional characterizations. Detection of homology to experimentally characterized proteins can provide functional clues, but the accuracy of homology-based ...

  18. Gonadal cell surface receptor for plasma retinol-binding protein

    International Nuclear Information System (INIS)

    Krishna Bhat, M.; Cama, H.R.

    1979-01-01

    A specific membrane receptor for plasma retinol-binding protein has been demonstrated in testicular cells. Prealbumin-2 did not show any specific binding to the membrane. The affinity of retinol-binding protein for receptor drastically decreases upon delivery of retinol and the retinol-binding protein does not enter the cell. The mechanism of delivery of retinol to the target cell by plasma retinol-binding protein has been investigated. The process involves two steps; direct binding of retinol-binding protein to the receptor and uptake of retinol by the target cell with a concomitant drastic reduction in the affinity of the retinol-binding protein to the receptor. Probably the second step of the process needs a cytosolic factor, possibly the cellular retinol-binding protein or an enzyme. The binding of retinol-binding protein to the receptor is saturable and reversible. The interaction shows a Ksub(d) value of 2.1x10 -10 . The specific binding of a retinol-binding protein with great affinity has been employed in the development of a method for radioassay of the receptor. The receptor level of the gonadal cell has been found to vary with the stage of differentiation. The receptor concentrations in 11-week-old birds and adult birds are comparable. Testosterone treatment of 11-week-old birds produced a substantial increase in the receptor concentration over control, while the protein content increased marginally, indicating that, probably, synthesis of the receptor is specifcally induced by testosterone during spermatogenesis, and the concentration of receptor is relatively higher before the formation of the acrosome. (Auth.)

  19. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  20. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  1. The putative proteinase maturation protein A of Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective immune responses

    NARCIS (Netherlands)

    K. Overweg (Karin); A. Kerr; M. Sluijter (Marcel); M.H. Jackson; T.J. Mitchell; A.P. de Jong; R. de Groot (Ronald); P.W.M. Hermans (Peter)

    2000-01-01

    textabstractSurface-exposed proteins often play an important role in the interaction between pathogenic bacteria and their host. We isolated a pool of hydrophobic, surface-associated proteins of Streptococcus pneumoniae. The opsonophagocytic activity of hyperimmune

  2. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. In-cell thermodynamics and a new role for protein surfaces.

    Science.gov (United States)

    Smith, Austin E; Zhou, Larry Z; Gorensek, Annelise H; Senske, Michael; Pielak, Gary J

    2016-02-16

    There is abundant, physiologically relevant knowledge about protein cores; they are hydrophobic, exquisitely well packed, and nearly all hydrogen bonds are satisfied. An equivalent understanding of protein surfaces has remained elusive because proteins are almost exclusively studied in vitro in simple aqueous solutions. Here, we establish the essential physiological roles played by protein surfaces by measuring the equilibrium thermodynamics and kinetics of protein folding in the complex environment of living Escherichia coli cells, and under physiologically relevant in vitro conditions. Fluorine NMR data on the 7-kDa globular N-terminal SH3 domain of Drosophila signal transduction protein drk (SH3) show that charge-charge interactions are fundamental to protein stability and folding kinetics in cells. Our results contradict predictions from accepted theories of macromolecular crowding and show that cosolutes commonly used to mimic the cellular interior do not yield physiologically relevant information. As such, we provide the foundation for a complete picture of protein chemistry in cells.

  4. Major membrane surface proteins of Mycoplasma hyopneumoniae selectively modified by covalently bound lipid

    International Nuclear Information System (INIS)

    Wise, K.S.; Kim, M.F.

    1987-01-01

    Surface protein antigens of Mycoplasma hyopneumoniae were identified by direct antibody-surface binding or by radioimmunoprecipitation of surface 125 I-labeled proteins with a series of monoclonal antibodies (MAbs). Radioimmunoprecipitation of TX-114-phase proteins from cells labeled with [ 35 S] methionine, 14 C-amino acids, or [ 3 H] palmitic acid showed that proteins p65, p50, and p44 were abundant and (with one other hydrophobic protein, p60) were selectively labeled with lipid. Alkaline hydroxylamine treatment of labeled proteins indicated linkage of lipids by amide or stable O-linked ester bonds. Proteins p65, p50, and p44 were highly immunogenic in the natural host as measured by immunoblots of TX-114-phase proteins with antisera from swine inoculated with whole organisms. These proteins were antigenically and structurally unrelated, since hyperimmune mouse antibodies to individual gel-purified proteins were monospecific and gave distinct proteolytic epitope maps. Intraspecies size variants of one surface antigen of M. hyopneumoniae were revealed by a MAb to p70 (defined in strain J, ATCC 25934), which recognized a large p73 component on strain VPP11 (ATCC 25617). In addition, MAb to internal, aqueous-phase protein p82 of strain J failed to bind an analogous antigen in strain VPP11

  5. Structural determinants for protein adsorption/non-adsorption to silica surface

    International Nuclear Information System (INIS)

    Mathe, Christelle; Devineau, Stephanie; Aude, Jean-Christophe; Lagniel, Gilles; Chedin, Stephane; Legros, Veronique; Mathon, Marie-Helene; Renault, Jean-Philippe; Pin, Serge; Boulard, Yves; Labarre, Jean

    2013-01-01

    The understanding of the mechanisms involved in the interaction of proteins with inorganic surfaces is of major interest in both fundamental research and applications such as nano-technology. However, despite intense research, the mechanisms and the structural determinants of protein/surface interactions are still unclear. We developed a strategy consisting in identifying, in a mixture of hundreds of soluble proteins, those proteins that are adsorbed on the surface and those that are not. If the two protein subsets are large enough, their statistical comparative analysis must reveal the physicochemical determinants relevant for adsorption versus non-adsorption. This methodology was tested with silica nanoparticles. We found that the adsorbed proteins contain a higher number of charged amino acids, particularly arginine, which is consistent with involvement of this basic amino acid in electrostatic interactions with silica. The analysis also identified a marked bias toward low aromatic amino acid content (phenylalanine, tryptophan, tyrosine and histidine) in adsorbed proteins. Structural analyses and molecular dynamics simulations of proteins from the two groups indicate that non-adsorbed proteins have twice as many p-p interactions and higher structural rigidity. The data are consistent with the notion that adsorption is correlated with the flexibility of the protein and with its ability to spread on the surface. Our findings led us to propose a refined model of protein adsorption. (authors)

  6. Major membrane surface proteins of Mycoplasma hyopneumoniae selectively modified by covalently bound lipid

    Energy Technology Data Exchange (ETDEWEB)

    Wise K.S.; Kim, M.F.

    1987-12-01

    Surface protein antigens of Mycoplasma hyopneumoniae were identified by direct antibody-surface binding or by radioimmunoprecipitation of surface /sup 125/I-labeled proteins with a series of monoclonal antibodies (MAbs). Radioimmunoprecipitation of TX-114-phase proteins from cells labeled with (/sup 35/S) methionine, /sup 14/C-amino acids, or (/sup 3/H) palmitic acid showed that proteins p65, p50, and p44 were abundant and (with one other hydrophobic protein, p60) were selectively labeled with lipid. Alkaline hydroxylamine treatment of labeled proteins indicated linkage of lipids by amide or stable O-linked ester bonds. Proteins p65, p50, and p44 were highly immunogenic in the natural host as measured by immunoblots of TX-114-phase proteins with antisera from swine inoculated with whole organisms. These proteins were antigenically and structurally unrelated, since hyperimmune mouse antibodies to individual gel-purified proteins were monospecific and gave distinct proteolytic epitope maps. Intraspecies size variants of one surface antigen of M. hyopneumoniae were revealed by a MAb to p70 (defined in strain J, ATCC 25934), which recognized a large p73 component on strain VPP11 (ATCC 25617). In addition, MAb to internal, aqueous-phase protein p82 of strain J failed to bind an analogous antigen in strain VPP11.

  7. Structural determinants for protein adsorption/non-adsorption to silica surface.

    Directory of Open Access Journals (Sweden)

    Christelle Mathé

    Full Text Available The understanding of the mechanisms involved in the interaction of proteins with inorganic surfaces is of major interest in both fundamental research and applications such as nanotechnology. However, despite intense research, the mechanisms and the structural determinants of protein/surface interactions are still unclear. We developed a strategy consisting in identifying, in a mixture of hundreds of soluble proteins, those proteins that are adsorbed on the surface and those that are not. If the two protein subsets are large enough, their statistical comparative analysis must reveal the physicochemical determinants relevant for adsorption versus non-adsorption. This methodology was tested with silica nanoparticles. We found that the adsorbed proteins contain a higher number of charged amino acids, particularly arginine, which is consistent with involvement of this basic amino acid in electrostatic interactions with silica. The analysis also identified a marked bias toward low aromatic amino acid content (phenylalanine, tryptophan, tyrosine and histidine in adsorbed proteins. Structural analyses and molecular dynamics simulations of proteins from the two groups indicate that non-adsorbed proteins have twice as many π-π interactions and higher structural rigidity. The data are consistent with the notion that adsorption is correlated with the flexibility of the protein and with its ability to spread on the surface. Our findings led us to propose a refined model of protein adsorption.

  8. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  9. Nitrate as a probe of cytochrome c surface: crystallographic identification of crucial "hot spots" for protein-protein recognition.

    Science.gov (United States)

    De March, Matteo; Demitri, Nicola; De Zorzi, Rita; Casini, Angela; Gabbiani, Chiara; Guerri, Annalisa; Messori, Luigi; Geremia, Silvano

    2014-06-01

    The electrostatic surface of cytochrome c and its changes with the iron oxidation state are involved in the docking and undocking processes of this protein to its biological partners in the mitochondrial respiratory pathway. To investigate the subtle mechanisms of formation of productive macromolecular complexes and of their breakage following the electron transfer process, the X-ray structures of horse heart ferri-cytochrome c (trigonal form) and ferro-cytochrome c (monoclinic form) were obtained using nitrate ions both as a crystallizing agent and an anionic probe for mapping the electrostatic surface changes. Both crystal forms contain three protein molecules in the asymmetric unit. In addition, a total of 21.5 and 18 crystallographically independent nitrate ions were identified for the trigonal and monoclinic forms, respectively. By matching all the six crystallographically independent protein molecules, 26 different anion-protein interaction sites were identified on the surfaces of cytochrome c, 10 of which were found in both forms, 8 present only in the oxidized and 8 only in the reduced form. The structural analysis of the electron transfer complexes, based on this new information, suggests a specific exit strategy for cytochrome c after formation of productive protein-protein complexes: a directional sliding mechanism for the electron shuttle on the surface of the redox partner is proposed to take place after the electron transfer process has occurred. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. New developments for the site-specific attachment of protein to surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Camarero, J A

    2005-05-12

    Protein immobilization on surfaces is of great importance in numerous applications in biology and biophysics. The key for the success of all these applications relies on the immobilization technique employed to attach the protein to the corresponding surface. Protein immobilization can be based on covalent or noncovalent interaction of the molecule with the surface. Noncovalent interactions include hydrophobic interactions, hydrogen bonding, van der Waals forces, electrostatic forces, or physical adsorption. However, since these interactions are weak, the molecules can get denatured or dislodged, thus causing loss of signal. They also result in random attachment of the protein to the surface. Site-specific covalent attachment of proteins onto surfaces, on the other hand, leads to molecules being arranged in a definite, orderly fashion and uses spacers and linkers to help minimize steric hindrances between the protein surface. This work reviews in detail some of the methods most commonly used as well as the latest developments for the site-specific covalent attachment of protein to solid surfaces.

  11. Characterization of Silk Fibroin Modified Surface: A Proteomic View of Cellular Response Proteins Induced by Biomaterials

    Directory of Open Access Journals (Sweden)

    Ming-Hui Yang

    2014-01-01

    Full Text Available The purpose of this study was to develop the pathway of silk fibroin (SF biopolymer surface induced cell membrane protein activation. Fibroblasts were used as an experimental model to evaluate the responses of cellular proteins induced by biopolymer material using a mass spectrometry-based profiling system. The surface was covered by multiwalled carbon nanotubes (CNTs and SF to increase the surface area, enhance the adhesion of biopolymer, and promote the rate of cell proliferation. The amount of adhered fibroblasts on CNTs/SF electrodes of quartz crystal microbalance (QCM greatly exceeded those on other surfaces. Moreover, analyzing differential protein expressions of adhered fibroblasts on the biopolymer surface by proteomic approaches indicated that CD44 may be a key protein. Through this study, utilization of mass spectrometry-based proteomics in evaluation of cell adhesion on biopolymer was proposed.

  12. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  13. Surface dynamics in allosteric regulation of protein-protein interactions: modulation of calmodulin functions by Ca2+.

    Directory of Open Access Journals (Sweden)

    Yosef Y Kuttner

    2013-04-01

    Full Text Available Knowledge of the structural basis of protein-protein interactions (PPI is of fundamental importance for understanding the organization and functioning of biological networks and advancing the design of therapeutics which target PPI. Allosteric modulators play an important role in regulating such interactions by binding at site(s orthogonal to the complex interface and altering the protein's propensity for complex formation. In this work, we apply an approach recently developed by us for analyzing protein surfaces based on steered molecular dynamics simulation (SMD to the study of the dynamic properties of functionally distinct conformations of a model protein, calmodulin (CaM, whose ability to interact with target proteins is regulated by the presence of the allosteric modulator Ca(2+. Calmodulin is a regulatory protein that acts as an intracellular Ca(2+ sensor to control a wide variety of cellular processes. We demonstrate that SMD analysis is capable of pinpointing CaM surfaces implicated in the recognition of both the allosteric modulator Ca(2+ and target proteins. Our analysis of changes in the dynamic properties of the CaM backbone elicited by Ca(2+ binding yielded new insights into the molecular mechanism of allosteric regulation of CaM-target interactions.

  14. Association of lipids with integral membrane surface proteins of Mycoplasma hyorhinis

    International Nuclear Information System (INIS)

    Bricker, T.M.; Boyer, M.J.; Keith, J.; Watson-McKown, R.; Wise, K.S.

    1988-01-01

    Triton X-114 (TX-114)-phase fractionation was used to identify and characterize integral membrane surface proteins of the wall-less procaryote Mycoplasma hyorhinis GDL. Phase fractionation of mycoplasmas followed by analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed selective partitioning of approximately 30 [ 35 S]methionine-labeled intrinsic membrane proteins into the TX-114 phase. Similar analysis of [ 3 H]palmitate-labeled cells showed that approximately 20 proteins of this organism were associated with lipid, all of which also efficiently partitioned as integral membrane components into the detergent phase. Immunoblotting and immunoprecipitation of TX-114-phase proteins from 125 I-surface-labeled cells with four monoclonal antibodies to distinct surface epitopes of M. hyorhinis identified surface proteins p120, p70, p42, and p23 as intrinsic membrane components. Immunoprecipitation of [ 3 H]palmitate-labeled TX-114-phase proteins further established that surface proteins p120, p70, and p23 (a molecule that mediates complement-dependent mycoplasmacidal monoclonal antibody activity) were among the lipid-associated proteins of this organism. Two of these proteins, p120 and p123, were acidic (pI less than or equal to 4.5), as shown by two-dimensional isoelectric focusing. This study established that M. hyorhinis contains an abundance of integral membrane proteins tightly associated with lipids and that many of these proteins are exposed at the external surface of the single limiting plasma membrane. Monoclonal antibodies are reported that will allow detailed analysis of the structure and processing of lipid-associated mycoplasma proteins

  15. Non-interacting surface solvation and dynamics in protein-protein interactions

    NARCIS (Netherlands)

    Visscher, Koen M.; Kastritis, Panagiotis L.|info:eu-repo/dai/nl/315886668; Bonvin, Alexandre M J J|info:eu-repo/dai/nl/113691238

    2015-01-01

    Protein-protein interactions control a plethora of cellular processes, including cell proliferation, differentiation, apoptosis, and signal transduction. Understanding how and why proteins interact will inevitably lead to novel structure-based drug design methods, as well as design of de novo

  16. DARC: Mapping Surface Topography by Ray-Casting for Effective Virtual Screening at Protein Interaction Sites.

    Science.gov (United States)

    Gowthaman, Ragul; Miller, Sven A; Rogers, Steven; Khowsathit, Jittasak; Lan, Lan; Bai, Nan; Johnson, David K; Liu, Chunjing; Xu, Liang; Anbanandam, Asokan; Aubé, Jeffrey; Roy, Anuradha; Karanicolas, John

    2016-05-12

    Protein-protein interactions represent an exciting and challenging target class for therapeutic intervention using small molecules. Protein interaction sites are often devoid of the deep surface pockets presented by "traditional" drug targets, and crystal structures reveal that inhibitors typically engage these sites using very shallow binding modes. As a consequence, modern virtual screening tools developed to identify inhibitors of traditional drug targets do not perform as well when they are instead deployed at protein interaction sites. To address the need for novel inhibitors of important protein interactions, here we introduce an alternate docking strategy specifically designed for this regime. Our method, termed DARC (Docking Approach using Ray-Casting), matches the topography of a surface pocket "observed" from within the protein to the topography "observed" when viewing a potential ligand from the same vantage point. We applied DARC to carry out a virtual screen against the protein interaction site of human antiapoptotic protein Mcl-1 and found that four of the top-scoring 21 compounds showed clear inhibition in a biochemical assay. The Ki values for these compounds ranged from 1.2 to 21 μM, and each had ligand efficiency comparable to promising small-molecule inhibitors of other protein-protein interactions. These hit compounds do not resemble the natural (protein) binding partner of Mcl-1, nor do they resemble any known inhibitors of Mcl-1. Our results thus demonstrate the utility of DARC for identifying novel inhibitors of protein-protein interactions.

  17. Effects of salts on protein-surface interactions: applications for column chromatography.

    Science.gov (United States)

    Tsumoto, Kouhei; Ejima, Daisuke; Senczuk, Anna M; Kita, Yoshiko; Arakawa, Tsutomu

    2007-07-01

    Development of protein pharmaceuticals depends on the availability of high quality proteins. Various column chromatographies are used to purify proteins and characterize the purity and properties of the proteins. Most column chromatographies require salts, whether inorganic or organic, for binding, elution or simply better recovery and resolution. The salts modulate affinity of the proteins for particular columns and nonspecific protein-protein or protein-surface interactions, depending on the type and concentration of the salts, in both specific and nonspecific manners. Salts also affect the binding capacity of the column, which determines the size of the column to be used. Binding capacity, whether equilibrium or dynamic (under an approximation of a slow flow rate), depends on the binding constant, protein concentration and the number of the binding site on the column as well as nonspecific binding. This review attempts to summarize the mechanism of the salt effects on binding affinity and capacity for various column chromatographies and on nonspecific protein-protein or protein-surface interactions. Understanding such salt effects should also be useful in preventing nonspecific protein binding to various containers. Copyright 2007 Wiley-Liss, Inc.

  18. Sensing surface mechanical deformation using active probes driven by motor proteins

    Science.gov (United States)

    Inoue, Daisuke; Nitta, Takahiro; Kabir, Arif Md. Rashedul; Sada, Kazuki; Gong, Jian Ping; Konagaya, Akihiko; Kakugo, Akira

    2016-01-01

    Studying mechanical deformation at the surface of soft materials has been challenging due to the difficulty in separating surface deformation from the bulk elasticity of the materials. Here, we introduce a new approach for studying the surface mechanical deformation of a soft material by utilizing a large number of self-propelled microprobes driven by motor proteins on the surface of the material. Information about the surface mechanical deformation of the soft material is obtained through changes in mobility of the microprobes wandering across the surface of the soft material. The active microprobes respond to mechanical deformation of the surface and readily change their velocity and direction depending on the extent and mode of surface deformation. This highly parallel and reliable method of sensing mechanical deformation at the surface of soft materials is expected to find applications that explore surface mechanics of soft materials and consequently would greatly benefit the surface science. PMID:27694937

  19. Characterization of the Eimeria maxima sporozoite surface protein IMP1

    Science.gov (United States)

    The purpose of this study was to characterize Eimeria maxima immunoprotective protein IMP1 that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transc...

  20. Shotgun proteomic analytical approach for studying proteins adsorbed onto liposome surface

    KAUST Repository

    Capriotti, Anna Laura

    2011-07-02

    The knowledge about the interaction between plasma proteins and nanocarriers employed for in vivo delivery is fundamental to understand their biodistribution. Protein adsorption onto nanoparticle surface (protein corona) is strongly affected by vector surface characteristics. In general, the primary interaction is thought to be electrostatic, thus surface charge of carrier is supposed to play a central role in protein adsorption. Because protein corona composition can be critical in modifying the interactive surface that is recognized by cells, characterizing its formation onto lipid particles may serve as a fundamental predictive model for the in vivo efficiency of a lipidic vector. In the present work, protein coronas adsorbed onto three differently charged cationic liposome formulations were compared by a shotgun proteomic approach based on nano-liquid chromatography-high-resolution mass spectrometry. About 130 proteins were identified in each corona, with only small differences between the different cationic liposome formulations. However, this study could be useful for the future controlled design of colloidal drug carriers and possibly in the controlled creation of biocompatible surfaces of other devices that come into contact with proteins into body fluids. © 2011 Springer-Verlag.

  1. Protein conformational transitions at the liquid-gas interface as studied by dilational surface rheology.

    Science.gov (United States)

    Noskov, Boris A

    2014-04-01

    Experimental results on the dynamic dilational surface elasticity of protein solutions are analyzed and compared. Short reviews of the protein behavior at the liquid-gas interface and the dilational surface rheology precede the main sections of this work. The kinetic dependencies of the surface elasticity differ strongly for the solutions of globular and non-globular proteins. In the latter case these dependencies are similar to those for solutions of non-ionic amphiphilic polymers and have local maxima corresponding to the formation of the distal region of the surface layer (type I). In the former case the dynamic surface elasticity is much higher (>60 mN/m) and the kinetic dependencies are monotonical and similar to the data for aqueous dispersions of solid nanoparticles (type II). The addition of strong denaturants to solutions of bovine serum albumin and β-lactoglobulin results in an abrupt transition from the type II to type I dependencies if the denaturant concentration exceeds a certain critical value. These results give a strong argument in favor of the preservation of the protein globular structure in the course of adsorption without any denaturants. The addition of cationic surfactants also can lead to the non-monotonical kinetic dependencies of the dynamic surface elasticity indicating destruction of the protein tertiary and secondary structures. The addition of anionic surfactants gives similar results only for the protein solutions of high ionic strength. The influence of cationic surfactants on the local maxima of the kinetic dependencies of the dynamic surface elasticity for solutions of a non-globular protein (β-casein) differs from the influence of anionic surfactants due to the heterogeneity of the charge distribution along the protein chain. In this case one can use small admixtures of ionic surfactants as probes of the adsorption mechanism. The effect of polyelectrolytes on the kinetic dependencies of the dynamic surface elasticity of protein

  2. Low level of sequence diversity at merozoite surface protein-1 locus of Plasmodium ovale curtisi and P. ovale wallikeri from Thai isolates.

    Science.gov (United States)

    Putaporntip, Chaturong; Hughes, Austin L; Jongwutiwes, Somchai

    2013-01-01

    The merozoite surface protein-1 (MSP-1) is a candidate target for the development of blood stage vaccines against malaria. Polymorphism in MSP-1 can be useful as a genetic marker for strain differentiation in malarial parasites. Although sequence diversity in the MSP-1 locus has been extensively analyzed in field isolates of Plasmodium falciparum and P. vivax, the extent of variation in its homologues in P. ovale curtisi and P. ovale wallikeri, remains unknown. Analysis of the mitochondrial cytochrome b sequences of 10 P. ovale isolates from symptomatic malaria patients from diverse endemic areas of Thailand revealed co-existence of P. ovale curtisi (n = 5) and P. ovale wallikeri (n = 5). Direct sequencing of the PCR-amplified products encompassing the entire coding region of MSP-1 of P. ovale curtisi (PocMSP-1) and P. ovale wallikeri (PowMSP-1) has identified 3 imperfect repeated segments in the former and one in the latter. Most amino acid differences between these proteins were located in the interspecies variable domains of malarial MSP-1. Synonymous nucleotide diversity (πS) exceeded nonsynonymous nucleotide diversity (πN) for both PocMSP-1 and PowMSP-1, albeit at a non-significant level. However, when MSP-1 of both these species was considered together, πS was significantly greater than πN (pdiversity at this locus prior to speciation. Phylogenetic analysis based on conserved domains has placed PocMSP-1 and PowMSP-1 in a distinct bifurcating branch that probably diverged from each other around 4.5 million years ago. The MSP-1 sequences support that P. ovale curtisi and P. ovale wallikeri are distinct species. Both species are sympatric in Thailand. The low level of sequence diversity in PocMSP-1 and PowMSP-1 among Thai isolates could stem from persistent low prevalence of these species, limiting the chance of outcrossing at this locus.

  3. Altering protein surface charge with chemical modification modulates protein–gold nanoparticle aggregation

    International Nuclear Information System (INIS)

    Jamison, Jennifer A.; Bryant, Erika L.; Kadali, Shyam B.; Wong, Michael S.; Colvin, Vicki L.; Matthews, Kathleen S.; Calabretta, Michelle K.

    2011-01-01

    Gold nanoparticles (AuNP) can interact with a wide range of molecules including proteins. Whereas significant attention has focused on modifying the nanoparticle surface to regulate protein–AuNP assembly or influence the formation of the protein “corona,” modification of the protein surface as a mechanism to modulate protein–AuNP interaction has been less explored. Here, we examine this possibility utilizing three small globular proteins—lysozyme with high isoelectric point (pI) and established interactions with AuNP; α-lactalbumin with similar tertiary fold to lysozyme but low pI; and myoglobin with a different globular fold and an intermediate pI. We first chemically modified these proteins to alter their charged surface functionalities, and thereby shift protein pI, and then applied multiple methods to assess protein–AuNP assembly. At pH values lower than the anticipated pI of the modified protein, AuNP exposure elicits changes in the optical absorbance of the protein–NP solutions and other properties due to aggregate formation. Above the expected pI, however, protein–AuNP interaction is minimal, and both components remain isolated, presumably because both species are negatively charged. These data demonstrate that protein modification provides a powerful tool for modulating whether nanoparticle–protein interactions result in material aggregation. The results also underscore that naturally occurring protein modifications found in vivo may be critical in defining nanoparticle–protein corona compositions.

  4. Protein resistance of surfaces modified with oligo(ethylene glycol) aryl diazonium derivatives.

    Science.gov (United States)

    Fairman, Callie; Ginges, Joshua Z; Lowe, Stuart B; Gooding, J Justin

    2013-07-22

    Anti-fouling surfaces are of great importance for reducing background interference in biosensor signals. Oligo(ethylene glycol) (OEG) moieties are commonly used to confer protein resistance on gold, silicon and carbon surfaces. Herein, we report the modification of surfaces using electrochemical deposition of OEG aryl diazonium salts. Using electrochemical and contact angle measurements, the ligand packing density is found to be loose, which supports the findings of the fluorescent protein labelling that aryl diazonium OEGs confer resistance to nonspecific adsorption of proteins albeit lower than alkane thiol-terminated OEGs. In addition to protein resistance, aryl diazonium attachment chemistry results in stable modification. In common with OEG species on gold electrodes, OEGs with distal hydroxyl moieties do confer superior protein resistance to those with a distal methoxy group. This is especially the case for longer derivatives where superior coiling of the OEG chains is possible. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Proteomic analysis of cell surface-associated proteins from probiotic Lactobacillus plantarum

    DEFF Research Database (Denmark)

    Beck, Hans Christian; Madsen, Søren M; Glenting, Jacob

    2009-01-01

    In the present study, we used a proteomic approach to identify surface-associated proteins from the probiotic bacterium Lactobacillus plantarum 299v. Proteins were extracted from the cell surface using a mild wash in phosphate buffer and analysed by sodium dodecyl sulphate-polyacrylamide gel...... of probiotics in the gastrointestinal tract. The results provide the basis for future studies on the molecular mechanisms of probiotics....

  6. Hybrid surface platform for the simultaneous detection of proteins and DNA using a surface plasmon resonance (SPR) imaging sensor

    Czech Academy of Sciences Publication Activity Database

    Homola, Jiří; Piliarik, Marek; Ladd, J.; Taylor, A.; Shaoyi, J.

    2008-01-01

    Roč. 80, č. 11 (2008), s. 4231-4236 ISSN 0003-2700 R&D Projects: GA AV ČR KAN200670701 Institutional research plan: CEZ:AV0Z20670512 Keywords : Surface plasmon resonance imaging * DNA-directed immobilization * protein array Subject RIV: JB - Sensors, Measurment, Regulation Impact factor: 5.712, year: 2008

  7. Pooled protein immunization for identification of cell surface antigens in Streptococcus sanguinis.

    Directory of Open Access Journals (Sweden)

    Xiuchun Ge

    2010-07-01

    Full Text Available Available bacterial genomes provide opportunities for screening vaccines by reverse vaccinology. Efficient identification of surface antigens is required to reduce time and animal cost in this technology. We developed an approach to identify surface antigens rapidly in Streptococcus sanguinis, a common infective endocarditis causative species.We applied bioinformatics for antigen prediction and pooled antigens for immunization. Forty-seven surface-exposed proteins including 28 lipoproteins and 19 cell wall-anchored proteins were chosen based on computer algorithms and comparative genomic analyses. Eight proteins among these candidates and 2 other proteins were pooled together to immunize rabbits. The antiserum reacted strongly with each protein and with S. sanguinis whole cells. Affinity chromatography was used to purify the antibodies to 9 of the antigen pool components. Competitive ELISA and FACS results indicated that these 9 proteins were exposed on S. sanguinis cell surfaces. The purified antibodies had demonstrable opsonic activity.The results indicate that immunization with pooled proteins, in combination with affinity purification, and comprehensive immunological assays may facilitate cell surface antigen identification to combat infectious diseases.

  8. Pooled protein immunization for identification of cell surface antigens in Streptococcus sanguinis.

    Science.gov (United States)

    Ge, Xiuchun; Kitten, Todd; Munro, Cindy L; Conrad, Daniel H; Xu, Ping

    2010-07-26

    Available bacterial genomes provide opportunities for screening vaccines by reverse vaccinology. Efficient identification of surface antigens is required to reduce time and animal cost in this technology. We developed an approach to identify surface antigens rapidly in Streptococcus sanguinis, a common infective endocarditis causative species. We applied bioinformatics for antigen prediction and pooled antigens for immunization. Forty-seven surface-exposed proteins including 28 lipoproteins and 19 cell wall-anchored proteins were chosen based on computer algorithms and comparative genomic analyses. Eight proteins among these candidates and 2 other proteins were pooled together to immunize rabbits. The antiserum reacted strongly with each protein and with S. sanguinis whole cells. Affinity chromatography was used to purify the antibodies to 9 of the antigen pool components. Competitive ELISA and FACS results indicated that these 9 proteins were exposed on S. sanguinis cell surfaces. The purified antibodies had demonstrable opsonic activity. The results indicate that immunization with pooled proteins, in combination with affinity purification, and comprehensive immunological assays may facilitate cell surface antigen identification to combat infectious diseases.

  9. Adsorption of plasma proteins : adsorption behaviour on apolar surfaces and effect on colloid stability

    NARCIS (Netherlands)

    van der Scheer, Albert

    1978-01-01

    In this thesis the adsorption of some plasma proteins (human albumin (HSA) and fibrinogen (HFb)) on non polar surfaces is studied, together with the influence of these proteins on the stability of polystyrene latices. The aim of these investigations is a better understanding of the processes

  10. Nitrate as a probe of cytochrome c surface : crystallographic identification of crucial "hot spots" for protein-protein recognition

    NARCIS (Netherlands)

    De March, Matteo; Demitri, Nicola; De Zorzi, Rita; Casini, Angela; Gabbiani, Chiara; Guerri, Annalisa; Messori, Luigi; Geremia, Silvano

    The electrostatic surface of cytochrome c and its changes with the iron oxidation state are involved in the docking and undocking processes of this protein to its biological partners in the mitochondrial respiratory pathway. To investigate the subtle mechanisms of formation of productive

  11. Hydrophilic crosslinked-polymeric surface capable of effective suppression of protein adsorption

    Energy Technology Data Exchange (ETDEWEB)

    Kamon, Yuri; Inoue, Naoko; Mihara, Erika; Kitayama, Yukiya; Ooya, Tooru; Takeuchi, Toshifumi, E-mail: takeuchi@gold.kobe-u.ac.jp

    2016-08-15

    Highlights: • Three hydrophilic crosslinked polymers were examined for protein adsorption. • All polymers showed low nonspecific adsorption of negatively charged proteins. • Poly(MMPC) showed the lowest adsorption for positively charged proteins. • Poly(MMPC) is able to reduce nonspecific adsorption of a wide range of proteins. - Abstract: We investigated the nonspecific adsorption of proteins towards three hydrophilic crosslinked-polymeric thin layers prepared by surface-initiated atom transfer radical polymerization using N,N′-methylenebisacrylamide, 2-(methacryloyloxy)ethyl-[N-(2-methacryloyloxy)ethyl]phosphorylcholine (MMPC), or 6,6′-diacryloyl-trehalose crosslinkers. Protein binding experiments were performed by surface plasmon resonance with six proteins of different pI values including α-lactalbumin, bovine serum albumin (BSA), myoglobin, ribonuclease A, cytochrome C, and lysozyme in buffer solution at pH 7.4. All of the obtained crosslinked-polymeric thin layers showed low nonspecific adsorption of negatively charged proteins at pH 7.4 such as α-lactalbumin, BSA, and myoglobin. Nonspecific adsorption of positively charged proteins including ribonuclease A, cytochrome C, and lysozyme was the lowest for poly(MMPC). These results suggest poly(MMPC) can effectively reduce nonspecific adsorption of a wide range of proteins that are negatively or positively charged at pH 7.4. MMPC is a promising crosslinker for a wide range of polymeric materials requiring low nonspecific protein binding.

  12. Probing Enzyme-Surface Interactions via Protein Engineering and Single-Molecule Techniques

    Science.gov (United States)

    2017-06-26

    SECURITY CLASSIFICATION OF: The overall objective of this research was to exploit protein engineering and fluorescence single-molecule methods to...enhance our understanding of the interaction of proteins and surfaces. Given this objective, the specific aims of this research were to: 1) exploit the...incorporation of unnatural amino acids in proteins to introduce single-molecule probes (i.e., fluorophores for fluorescence resonance energy transfer

  13. Lsa63, a newly identified surface protein of Leptospira interrogans binds laminin and collagen IV.

    Science.gov (United States)

    Vieira, Monica L; de Morais, Zenaide M; Gonçales, Amane P; Romero, Eliete C; Vasconcellos, Silvio A; Nascimento, Ana L T O

    2010-01-01

    Leptospira interrogans is the etiological agent of leptospirosis, a zoonotic disease that affects populations worldwide. We have identified in proteomic studies a protein that is encoded by the gene LIC10314 and expressed in virulent strain of L. interrogans serovar Pomona. This protein was predicted to be surface exposed by PSORT program and contains a p83/100 domain identified by BLAST analysis that is conserved in protein antigens of several strains of Borrelia and Treponema spp. The proteins containing this domain have been claimed antigen candidates for serodiagnosis of Lyme borreliosis. Thus, we have cloned the LIC10314 and expressed the protein in Escherichia coli BL21-SI strain by using the expression vector pAE. The recombinant protein tagged with N-terminal hexahistidine was purified by metal-charged chromatography and characterized by circular dichroism spectroscopy. This protein is conserved among several species of pathogenic Leptospira and absent in the saprophytic strain L. biflexa. We confirm by liquid-phase immunofluorescence assays with living organisms that this protein is most likely a new surface leptospiral protein. The ability of the protein to mediate attachment to ECM components was evaluated by binding assays. The leptospiral protein encoded by LIC10314, named Lsa63 (Leptospiral surface adhesin of 63kDa), binds strongly to laminin and collagen IV in a dose-dependent and saturable fashion. In addition, Lsa63 is probably expressed during infection since it was recognized by antibodies of serum samples of confirmed-leptospirosis patients in convalescent phase of the disease. Altogether, the data suggests that this novel identified surface protein may be involved in leptospiral pathogenesis. 2009 The British Infection Society. Published by Elsevier Ltd. All rights reserved.

  14. Protein immobilization on epoxy-activated thin polymer films: effect of surface wettability and enzyme loading.

    Science.gov (United States)

    Chen, Bo; Pernodet, Nadine; Rafailovich, Miriam H; Bakhtina, Asya; Gross, Richard A

    2008-12-02

    A series of epoxy-activated polymer films composed of poly(glycidyl methacrylate/butyl methacrylate/hydroxyethyl methacrylate) were prepared. Variation in comonomer composition allowed exploration of relationships between surface wettability and Candida antartica lipase B (CALB) binding to surfaces. By changing solvents and polymer concentrations, suitable conditions were developed for preparation by spin-coating of uniform thin films. Film roughness determined by AFM after incubation in PBS buffer for 2 days was less than 1 nm. The occurrence of single CALB molecules and CALB aggregates at surfaces was determined by AFM imaging and measurements of volume. Absolute numbers of protein monomers and multimers at surfaces were used to determine values of CALB specific activity. Increased film wettability, as the water contact angle of films increased from 420 to 550, resulted in a decreased total number of immobilized CALB molecules. With further increases in the water contact angle of films from 55 degrees to 63 degrees, there was an increased tendency of CALB molecules to form aggregates on surfaces. On all flat surfaces, two height populations, differing by more than 30%, were observed from height distribution curves. They are attributed to changes in protein conformation and/or orientation caused by protein-surface and protein-protein interactions. The fraction of molecules in these populations changed as a function of film water contact angle. The enzyme activity of immobilized films was determined by measuring CALB-catalyzed hydrolysis of p-nitrophenyl butyrate. Total enzyme specific activity decreased by decreasing film hydrophobicity.

  15. Influence of surface features of hydroxyapatite on the adsorption of proteins relevant to bone regeneration.

    Science.gov (United States)

    Fernández-Montes Moraleda, Belén; San Román, Julio; Rodríguez-Lorenzo, Luís M

    2013-08-01

    Protein-surface interaction may determine the success or failure of an implanted device. Not much attention have been paid to the specific surface parametes of hydroxyapatite (OHAp) that modulates and determines the formation and potential activity of the layer of proteins that is first formed when the material get in contact with the host tissue. the influence of specific surface area (SSA), crystallite size (CS) and particle size (PS) of OHAp on the adsorption of proteins relevant for bone regeneration is evaluated in this article. OHAp have been prepared by a wet chemical reaction of Ca(OH)2 with H3PO4. One set of reactions included poly acrylic acid in the reactant solution to modify the properties of the powder. Fibrinogen (Fg) Fraction I, type I: from Human plasma, (67% Protein), and Fibronectin (Fn) from Human plasma were selected to perform the adsorption experiments. The analysis of protein adsorption was carried out by UV/Vis spectrometry. A lower SSA and a different aspect ratio are obtained when the acrylic acid is included in the reaction badge. The deconvolution of the amide I band on the Raman spectra of free and adsorbed proteins reveals that the interaction apatite-protein happens through the carboxylate groups of the proteins. The combined analysis of CS, SSA and PS should be considered on the design of OHAp materials intended to interact with proteins. Copyright © 2013 Wiley Periodicals, Inc.

  16. Gold nanoparticles: role of size and surface chemistry on blood protein adsorption

    Energy Technology Data Exchange (ETDEWEB)

    Benetti, F., E-mail: filippo.benetti@unitn.it; Fedel, M. [BIOtech Research Centre (Italy); Minati, L.; Speranza, G. [Fondazione Bruno Kessler (Italy); Migliaresi, C. [BIOtech Research Centre (Italy)

    2013-06-15

    Material interaction with blood proteins is a critical issue, since it could influence the biological processes taking place in the body following implantation/injection. This is particularly important in the case of nanoparticles, where innovative properties, such as size and high surface to volume ratio can lead to a behavioral change with respect to bulk macroscopic materials and could be responsible for a potential risk for human health. The aim of this work was to compare gold nanoparticles (AuNP) and planar surfaces to study the role of surface curvature moving from the macro- to the nano-size in the process of blood protein adsorption. In the course of the study, different protocols were tested to optimize the analysis of protein adsorption on gold nanoparticles. AuNP with different size (10, 60 and 200 nm diameter) and surface coatings (citrate and polyethylene glycol) were carefully characterized. The stabilizing action of blood proteins adsorbed on AuNP was studied measuring the variation of size and solubility of the nanoparticles following incubation with single protein solutions (human serum albumin and fibrinogen) and whole blood plasma. In addition, we developed a method to elute proteins from AuNP to study the propensity of gold materials to adsorb plasma proteins in function of dimensional characteristics and surface chemistry. We showed a different efficacy of the various eluting media tested, proving that even the most aggressive agent cannot provide a complete detachment of the protein corona. Enhanced protein adsorption was evidenced on AuNP if compared to gold laminae (bare and PEGylated) used as macroscopic control, probably due to the superior AuNP surface reactivity.

  17. Identification of variant-specific surface proteins in Giardia muris trophozoites.

    Science.gov (United States)

    Ropolo, Andrea S; Saura, Alicia; Carranza, Pedro G; Lujan, Hugo D

    2005-08-01

    Giardia lamblia undergoes antigenic variation, a process that might allow the parasite to evade the host's immune response and adapt to different environments. Here we show that Giardia muris, a related species that naturally infects rodents, possesses multiple variant-specific surface proteins (VSPs) and expresses VSPs on its surface, suggesting that it undergoes antigenic variation similar to that of G. lamblia.

  18. Identification of Variant-Specific Surface Proteins in Giardia muris Trophozoites

    OpenAIRE

    Ropolo, Andrea S.; Saura, Alicia; Carranza, Pedro G.; Lujan, Hugo D.

    2005-01-01

    Giardia lamblia undergoes antigenic variation, a process that might allow the parasite to evade the host's immune response and adapt to different environments. Here we show that Giardia muris, a related species that naturally infects rodents, possesses multiple variant-specific surface proteins (VSPs) and expresses VSPs on its surface, suggesting that it undergoes antigenic variation similar to that of G. lamblia.

  19. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  20. Characterizing and modeling protein-surface interactions in lab-on-chip devices

    Science.gov (United States)

    Katira, Parag

    Protein adsorption on surfaces determines the response of other biological species present in the surrounding solution. This phenomenon plays a major role in the design of biomedical and biotechnological devices. While specific protein adsorption is essential for device function, non-specific protein adsorption leads to the loss of device function. For example, non-specific protein adsorption on bioimplants triggers foreign body response, in biosensors it leads to reduced signal to noise ratios, and in hybrid bionanodevices it results in the loss of confinement and directionality of molecular shuttles. Novel surface coatings are being developed to reduce or completely prevent the non-specific adsorption of proteins to surfaces. A novel quantification technique for extremely low protein coverage on surfaces has been developed. This technique utilizes measurement of the landing rate of microtubule filaments on kinesin proteins adsorbed on a surface to determine the kinesin density. Ultra-low limits of detection, dynamic range, ease of detection and availability of a ready-made kinesin-microtubule kit makes this technique highly suitable for detecting protein adsorption below the detection limits of standard techniques. Secondly, a random sequential adsorption model is presented for protein adsorption to PEO-coated surfaces. The derived analytical expressions accurately predict the observed experimental results from various research groups, suggesting that PEO chains act as almost perfect steric barriers to protein adsorption. These expressions can be used to predict the performance of a variety of systems towards resisting protein adsorption and can help in the design of better non-fouling surface coatings. Finally, in biosensing systems, target analytes are captured and concentrated on specifically adsorbed proteins for detection. Non-specific adsorption of proteins results in the loss of signal, and an increase in the background. The use of nanoscale transducers as

  1. Heterologous protein display on the cell surface of lactic acid bacteria mediated by the s-layer protein

    Directory of Open Access Journals (Sweden)

    Han Lanlan

    2011-10-01

    Full Text Available Abstract Background Previous studies have revealed that the C-terminal region of the S-layer protein from Lactobacillus is responsible for the cell wall anchoring, which provide an approach for targeting heterologous proteins to the cell wall of lactic acid bacteria (LAB. In this study, we developed a new surface display system in lactic acid bacteria with the C-terminal region of S-layer protein SlpB of Lactobacillus crispatus K2-4-3 isolated from chicken intestine. Results Multiple sequence alignment revealed that the C-terminal region (LcsB of Lb. crispatus K2-4-3 SlpB had a high similarity with the cell wall binding domains SA and CbsA of Lactobacillus acidophilus and Lb. crispatus. To evaluate the potential application as an anchoring protein, the green fluorescent protein (GFP or beta-galactosidase (Gal was fused to the N-terminus of the LcsB region, and the fused proteins were successfully produced in Escherichia coli, respectively. After mixing them with the non-genetically modified lactic acid bacteria cells, the fused GFP-LcsB and Gal-LcsB were functionally associated with the cell surface of various lactic acid bacteria tested. In addition, the binding capacity could be improved by SDS pretreatment. Moreover, both of the fused proteins could simultaneously bind to the surface of a single cell. Furthermore, when the fused DNA fragment of gfp:lcsB was inserted into the Lactococcus lactis expression vector pSec:Leiss:Nuc, the GFP could not be secreted into the medium under the control of the nisA promoter. Western blot, in-gel fluorescence assay, immunofluorescence microscopy and SDS sensitivity analysis confirmed that the GFP was successfully expressed onto the cell surface of L. lactis with the aid of the LcsB anchor. Conclusion The LcsB region can be used as a functional scaffold to target the heterologous proteins to the cell surfaces of lactic acid bacteria in vitro and in vivo, and has also the potential for biotechnological

  2. Microscopic Investigation of Reversible Nanoscale Surface Size Dependent Protein Conjugation

    Directory of Open Access Journals (Sweden)

    Michael A. Carpenter

    2009-05-01

    Full Text Available Aβ1-40 coated 20 nm gold colloidal nanoparticles exhibit a reversible color change as pH is externally altered between pH 4 and 10. This reversible process may contain important information on the initial reversible step reported for the fibrillogenesis of Aβ (a hallmark of Alzheimer’s disease. We examined this reversible color change by microscopic investigations. AFM images on graphite surfaces revealed the morphology of Aβ aggregates with gold colloids. TEM images clearly demonstrate the correspondence between spectroscopic features and conformational changes of the gold colloid.

  3. Analyses of Interactions Between Heparin and the Apical Surface Proteins of Plasmodium falciparum

    Science.gov (United States)

    Kobayashi, Kyousuke; Takano, Ryo; Takemae, Hitoshi; Sugi, Tatsuki; Ishiwa, Akiko; Gong, Haiyan; Recuenco, Frances C.; Iwanaga, Tatsuya; Horimoto, Taisuke; Akashi, Hiroomi; Kato, Kentaro

    2013-11-01

    Heparin, a sulfated glycoconjugate, reportedly inhibits the blood-stage growth of the malaria parasite Plasmodium falciparum. Elucidation of the inhibitory mechanism is valuable for developing novel invasion-blocking treatments based on heparin. Merozoite surface protein 1 has been reported as a candidate target of heparin; however, to better understand the molecular mechanisms involved, we characterized the molecules that bind to heparin during merozoite invasion. Here, we show that heparin binds only at the apical tip of the merozoite surface and that multiple heparin-binding proteins localize preferentially in the apical organelles. To identify heparin-binding proteins, parasite proteins were fractionated by means of heparin affinity chromatography and subjected to immunoblot analysis with ligand-specific antibodies. All tested members of the Duffy and reticulocyte binding-like families bound to heparin with diverse affinities. These findings suggest that heparin masks the apical surface of merozoites and blocks interaction with the erythrocyte membrane after initial attachment.

  4. InterProSurf: a web server for predicting interacting sites on protein surfaces

    Science.gov (United States)

    Negi, Surendra S.; Schein, Catherine H.; Oezguen, Numan; Power, Trevor D.; Braun, Werner

    2009-01-01

    Summary A new web server, InterProSurf, predicts interacting amino acid residues in proteins that are most likely to interact with other proteins, given the 3D structures of subunits of a protein complex. The prediction method is based on solvent accessible surface area of residues in the isolated subunits, a propensity scale for interface residues and a clustering algorithm to identify surface regions with residues of high interface propensities. Here we illustrate the application of InterProSurf to determine which areas of Bacillus anthracis toxins and measles virus hemagglutinin protein interact with their respective cell surface receptors. The computationally predicted regions overlap with those regions previously identified as interface regions by sequence analysis and mutagenesis experiments. PMID:17933856

  5. Isolation of two biologically active cell surface proteins from Brucella abortus by chromatofocusing

    International Nuclear Information System (INIS)

    Tabatabai, L.B.; Deyoe, B.L.

    1983-01-01

    Brucella abortus contains a group of immunogenic cell surface proteins which have potential value as a vaccine or as a diagnostic reagent for the prevention and diagnosis of bovine brucellosis. Under nondenaturing conditions, these proteins range in molecular weight from 10,000-124,000, as determined by high performance liquid chromatography (HPLC) on TSK 3000sw. By analytical isoelectrofocusing, 6 major protein bands could be distinguished with pI's ranging from 4.0 to 6.0 and 3 additional major proteins with pI's of 7.5, 9.5, and 10. By chromatofocusing on Polybuffer Exchanger 94 with a pH gradient from 6-4, two of the six proteins from pI 4-6 were separated, a pI 4.9 and a pI 4.7 protein; a third fraction contained the high pI proteins. The former two proteins were homogeneous by analytical isoelectrofocusing, and a molecular weight of 54,000 daltons was found for both protein species by HPLC on TSK 3000sw. The pI 4-6 and not the pI 9.5 and 10 proteins, could be radiolabeled when intact cells were radioiodinated with diazotized ( 125 I)-iodosulfanilic acid. Biological activity of the proteins as assessed in lemmings indicated that immunization with the pI 4.7 and 4.9 proteins afforded better protection against experimental brucellosis than immunization with the high pI proteins. These results support our view that a single surface protein may be sufficient for the prevention of experimental brucellosis

  6. Isolation of two biologically active cell surface proteins from Brucella abortus by chromatofocusing

    Energy Technology Data Exchange (ETDEWEB)

    Tabatabai, L.B.; Deyoe, B.L.

    1983-01-01

    Brucella abortus contains a group of immunogenic cell surface proteins which have potential value as a vaccine or as a diagnostic reagent for the prevention and diagnosis of bovine brucellosis. Under nondenaturing conditions, these proteins range in molecular weight from 10,000-124,000, as determined by high performance liquid chromatography (HPLC) on TSK 3000sw. By analytical isoelectrofocusing, 6 major protein bands could be distinguished with pI's ranging from 4.0 to 6.0 and 3 additional major proteins with pI's of 7.5, 9.5, and 10. By chromatofocusing on Polybuffer Exchanger 94 with a pH gradient from 6-4, two of the six proteins from pI 4-6 were separated, a pI 4.9 and a pI 4.7 protein; a third fraction contained the high pI proteins. The former two proteins were homogeneous by analytical isoelectrofocusing, and a molecular weight of 54,000 daltons was found for both protein species by HPLC on TSK 3000sw. The pI 4-6 and not the pI 9.5 and 10 proteins, could be radiolabeled when intact cells were radioiodinated with diazotized (/sup 125/I)-iodosulfanilic acid. Biological activity of the proteins as assessed in lemmings indicated that immunization with the pI 4.7 and 4.9 proteins afforded better protection against experimental brucellosis than immunization with the high pI proteins. These results support our view that a single surface protein may be sufficient for the prevention of experimental brucellosis.

  7. Facile Photoimmobilization of Proteins onto Low-Binding PEG-Coated Polymer Surfaces

    DEFF Research Database (Denmark)

    Larsen, Esben Kjær Unmack; Mikkelsen, Morten Bo Lindholm; Larsen, Niels Bent

    2014-01-01

    was verified for both enzymes and antibodies, and their presence on the surface was confirmed by X-ray photoelectron spectroscopy (XPS) and confocal fluorescence microscopy. Conjugation of capture antibody onto the PEG coating was employed for a simplified ELISA protocol without the need for blocking uncoated...... surface areas, showing ng/mL sensitivity to a cytokine antigen target. Moreover, spatially patterned attachment of fluorescently labeled protein onto the low-binding PEG-coated surface was achieved with a projection lithography system that enabled the creation of micrometer-sized protein features....

  8. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  9. Cell Surface Properties of Lactococcus lactis Reveal Milk Protein Binding Specifically Evolved in Dairy Isolates

    Directory of Open Access Journals (Sweden)

    Mariya Tarazanova

    2017-09-01

    Full Text Available Surface properties of bacteria are determined by the molecular composition of the cell wall and they are important for interactions of cells with their environment. Well-known examples of bacterial interactions with surfaces are biofilm formation and the fermentation of solid materials like food and feed. Lactococcus lactis is broadly used for the fermentation of cheese and buttermilk and it is primarily isolated from either plant material or the dairy environment. In this study, we characterized surface hydrophobicity, charge, emulsification properties, and the attachment to milk proteins of 55 L. lactis strains in stationary and exponential growth phases. The attachment to milk protein was assessed through a newly developed flow cytometry-based protocol. Besides finding a high degree of biodiversity, phenotype-genotype matching allowed the identification of candidate genes involved in the modification of the cell surface. Overexpression and gene deletion analysis allowed to verify the predictions for three identified proteins that altered surface hydrophobicity and attachment of milk proteins. The data also showed that lactococci isolated from a dairy environment bind higher amounts of milk proteins when compared to plant isolates. It remains to be determined whether the alteration of surface properties also has potential to alter starter culture functionalities.

  10. Cell Surface Properties of Lactococcus lactis Reveal Milk Protein Binding Specifically Evolved in Dairy Isolates

    Science.gov (United States)

    Tarazanova, Mariya; Huppertz, Thom; Beerthuyzen, Marke; van Schalkwijk, Saskia; Janssen, Patrick; Wels, Michiel; Kok, Jan; Bachmann, Herwig

    2017-01-01

    Surface properties of bacteria are determined by the molecular composition of the cell wall and they are important for interactions of cells with their environment. Well-known examples of bacterial interactions with surfaces are biofilm formation and the fermentation of solid materials like food and feed. Lactococcus lactis is broadly used for the fermentation of cheese and buttermilk and it is primarily isolated from either plant material or the dairy environment. In this study, we characterized surface hydrophobicity, charge, emulsification properties, and the attachment to milk proteins of 55 L. lactis strains in stationary and exponential growth phases. The attachment to milk protein was assessed through a newly developed flow cytometry-based protocol. Besides finding a high degree of biodiversity, phenotype-genotype matching allowed the identification of candidate genes involved in the modification of the cell surface. Overexpression and gene deletion analysis allowed to verify the predictions for three identified proteins that altered surface hydrophobicity and attachment of milk proteins. The data also showed that lactococci isolated from a dairy environment bind higher amounts of milk proteins when compared to plant isolates. It remains to be determined whether the alteration of surface properties also has potential to alter starter culture functionalities. PMID:28936202

  11. Functional display of proteins, mutant proteins, fragments of proteins and peptides on the surface of filamentous (bacterio) phages: A review

    NARCIS (Netherlands)

    Pannekoek, H.; van Meijer, M.; Gaardsvoll, H.; van Zonneveld, A. J.

    1995-01-01

    Cytoplasmic expression of complex eukaryotic proteins inEscherichia coli usually yields inactive protein preparations. In some cases, (part) of the biological activity can be recovered by rather inefficient denaturation-renaturation procedures. Recently, novel concepts have been developed for the

  12. Protein arrangement on modified diamond-like carbon surfaces – An ARXPS study

    Energy Technology Data Exchange (ETDEWEB)

    Oosterbeek, Reece N., E-mail: reece.oosterbeek@auckland.ac.nz [Department of Chemical and Materials Engineering, The University of Auckland, Private Bag 92019 (New Zealand); Seal, Christopher K. [Light Metals Research Centre, The University of Auckland, Private Bag 92019 (New Zealand); Hyland, Margaret M. [Department of Chemical and Materials Engineering, The University of Auckland, Private Bag 92019 (New Zealand)

    2014-12-01

    Highlights: • DLC coatings were modified by Ar{sup +} ion sputtering and laser graphitisation. • The surface properties of the coatings were measured, and it was found that the above methods increased sp{sup 2} content and altered surface energy. • ARXPS was used to observe protein arrangement on the surface. • Polar CO/CN groups were seen to be segregated towards the interface, indicating they play an important role in bonding. • This segregation increased with increasing polar surface energy, indicating an increased net attraction between polar groups. - Abstract: Understanding the nature of the interface between a biomaterial implant and the biological fluid is an essential step towards creating improved implant materials. This study examined a diamond-like carbon coating biomaterial, the surface energy of which was modified by Ar{sup +} ion sputtering and laser graphitisation. The arrangement of proteins was analysed by angle resolved X-ray photoelectron spectroscopy, and the effects of the polar component of surface energy on this arrangement were observed. It was seen that polar groups (such as CN, CO) are more attracted to the coating surface due to the stronger polar interactions. This results in a segregation of these groups to the DLC–protein interface; at increasing takeoff angle (further from to DLC–protein interface) fewer of these polar groups are seen. Correspondingly, groups that interact mainly by dispersive forces (CC, CH) were found to increase in intensity as takeoff angle increased, indicating they are segregated away from the DLC–protein interface. The magnitude of the segregation was seen to increase with increasing polar surface energy, this was attributed to an increased net attraction between the solid surface and polar groups at higher polar surface energy (γ{sub S}{sup p})

  13. Protein arrangement on modified diamond-like carbon surfaces – An ARXPS study

    International Nuclear Information System (INIS)

    Oosterbeek, Reece N.; Seal, Christopher K.; Hyland, Margaret M.

    2014-01-01

    Highlights: • DLC coatings were modified by Ar + ion sputtering and laser graphitisation. • The surface properties of the coatings were measured, and it was found that the above methods increased sp 2 content and altered surface energy. • ARXPS was used to observe protein arrangement on the surface. • Polar CO/CN groups were seen to be segregated towards the interface, indicating they play an important role in bonding. • This segregation increased with increasing polar surface energy, indicating an increased net attraction between polar groups. - Abstract: Understanding the nature of the interface between a biomaterial implant and the biological fluid is an essential step towards creating improved implant materials. This study examined a diamond-like carbon coating biomaterial, the surface energy of which was modified by Ar + ion sputtering and laser graphitisation. The arrangement of proteins was analysed by angle resolved X-ray photoelectron spectroscopy, and the effects of the polar component of surface energy on this arrangement were observed. It was seen that polar groups (such as CN, CO) are more attracted to the coating surface due to the stronger polar interactions. This results in a segregation of these groups to the DLC–protein interface; at increasing takeoff angle (further from to DLC–protein interface) fewer of these polar groups are seen. Correspondingly, groups that interact mainly by dispersive forces (CC, CH) were found to increase in intensity as takeoff angle increased, indicating they are segregated away from the DLC–protein interface. The magnitude of the segregation was seen to increase with increasing polar surface energy, this was attributed to an increased net attraction between the solid surface and polar groups at higher polar surface energy (γ S p )

  14. Covalent attachment of proteins to solid supports and surfaces via Sortase-mediated ligation.

    Directory of Open Access Journals (Sweden)

    Lilyan Chan

    Full Text Available BACKGROUND: There is growing interest in the attachment of proteins to solid supports for the development of supported catalysts, affinity matrices, and micro devices as well as for the development of planar and bead based protein arrays for multiplexed assays of protein concentration, interactions, and activity. A critical requirement for these applications is the generation of a stable linkage between the solid support and the immobilized, but still functional, protein. METHODOLOGY: Solid supports including crosslinked polymer beads, beaded agarose, and planar glass surfaces, were modified to present an oligoglycine motif to solution. A range of proteins were ligated to the various surfaces using the Sortase A enzyme of S. aureus. Reactions were carried out in aqueous buffer conditions at room temperature for times between one and twelve hours. CONCLUSIONS: The Sortase A transpeptidase of S. aureus provides a general, robust, and gentle approach to the selective covalent immobilization of proteins on three very different solid supports. The proteins remain functional and accessible to solution. Sortase mediated ligation is therefore a straightforward methodology for the preparation of solid supported enzymes and bead based assays, as well as the modification of planar surfaces for microanalytical devices and protein arrays.

  15. Evaluation of protein adsorption onto a polyurethane nanofiber surface having different segment distributions

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Yuko; Koizumi, Gaku [Frontier Fiber Technology and Science, Graduate School of Engineering, University of Fukui (Japan); Sakamoto, Hiroaki, E-mail: hi-saka@u-fukui.ac.jp [Tenure-Track Program for Innovative Research, University of Fukui (Japan); Suye, Shin-ichiro [Frontier Fiber Technology and Science, Graduate School of Engineering, University of Fukui (Japan)

    2017-02-01

    Electrospinning is well known to be an effective method for fabricating polymeric nanofibers with a diameter of several hundred nanometers. Recently, the molecular-level orientation within nanofibers has attracted particular attention. Previously, we used atomic force microscopy to visualize the phase separation between soft and hard segments of a polyurethane (PU) nanofiber surface prepared by electrospinning. The unstretched PU nanofibers exhibited irregularly distributed hard segments, whereas hard segments of stretched nanofibers prepared with a high-speed collector exhibited periodic structures along the long-axis direction. PU was originally used to inhibit protein adsorption, but because the surface segment distribution was changed in the stretched nanofiber, here, we hypothesized that the protein adsorption property on the stretched nanofiber might be affected. We investigated protein adsorption onto PU nanofibers to elucidate the effects of segment distribution on the surface properties of PU nanofibers. The amount of adsorbed protein on stretched PU nanofibers was increased compared with that of unstretched nanofibers. These results indicate that the hard segment alignment on stretched PU nanofibers mediated protein adsorption. It is therefore expected that the amount of protein adsorption can be controlled by rotation of the collector. - Highlights: • The hard segments of stretched PU nanofibers exhibit periodic structures. • The adsorbed protein on stretched PU nanofibers was increased compared with PU film. • The hard segment alignment on stretched PU nanofibers mediated protein adsorption.

  16. 3D-SURFER: software for high-throughput protein surface comparison and analysis.

    Science.gov (United States)

    La, David; Esquivel-Rodríguez, Juan; Venkatraman, Vishwesh; Li, Bin; Sael, Lee; Ueng, Stephen; Ahrendt, Steven; Kihara, Daisuke

    2009-11-01

    We present 3D-SURFER, a web-based tool designed to facilitate high-throughput comparison and characterization of proteins based on their surface shape. As each protein is effectively represented by a vector of 3D Zernike descriptors, comparison times for a query protein against the entire PDB take, on an average, only a couple of seconds. The web interface has been designed to be as interactive as possible with displays showing animated protein rotations, CATH codes and structural alignments using the CE program. In addition, geometrically interesting local features of the protein surface, such as pockets that often correspond to ligand binding sites as well as protrusions and flat regions can also be identified and visualized. 3D-SURFER is a web application that can be freely accessed from: http://dragon.bio.purdue.edu/3d-surfer dkihara@purdue.edu Supplementary data are available at Bioinformatics online.

  17. Phagocytosis escape by a Staphylococcus aureus protein that connects complement and coagulation proteins at the bacterial surface.

    Directory of Open Access Journals (Sweden)

    Ya-Ping Ko

    Full Text Available Upon contact with human plasma, bacteria are rapidly recognized by the complement system that labels their surface for uptake and clearance by phagocytic cells. Staphylococcus aureus secretes the 16 kD Extracellular fibrinogen binding protein (Efb that binds two different plasma proteins using separate domains: the Efb N-terminus binds to fibrinogen, while the C-terminus binds complement C3. In this study, we show that Efb blocks phagocytosis of S. aureus by human neutrophils. In vitro, we demonstrate that Efb blocks phagocytosis in plasma and in human whole blood. Using a mouse peritonitis model we show that Efb effectively blocks phagocytosis in vivo, either as a purified protein or when produced endogenously by S. aureus. Mutational analysis revealed that Efb requires both its fibrinogen and complement binding residues for phagocytic escape. Using confocal and transmission electron microscopy we show that Efb attracts fibrinogen to the surface of complement-labeled S. aureus generating a 'capsule'-like shield. This thick layer of fibrinogen shields both surface-bound C3b and antibodies from recognition by phagocytic receptors. This information is critical for future vaccination attempts, since opsonizing antibodies may not function in the presence of Efb. Altogether we discover that Efb from S. aureus uniquely escapes phagocytosis by forming a bridge between a complement and coagulation protein.

  18. Surfaceome and Proteosurfaceome in Parietal Monoderm Bacteria: Focus on Protein Cell-Surface Display

    Directory of Open Access Journals (Sweden)

    Mickaël Desvaux

    2018-02-01

    Full Text Available The cell envelope of parietal monoderm bacteria (archetypal Gram-positive bacteria is formed of a cytoplasmic membrane (CM and a cell wall (CW. While the CM is composed of phospholipids, the CW is composed at least of peptidoglycan (PG covalently linked to other biopolymers, such as teichoic acids, polysaccharides, and/or polyglutamate. Considering the CW is a porous structure with low selective permeability contrary to the CM, the bacterial cell surface hugs the molecular figure of the CW components as a well of the external side of the CM. While the surfaceome corresponds to the totality of the molecules found at the bacterial cell surface, the proteinaceous complement of the surfaceome is the proteosurfaceome. Once translocated across the CM, secreted proteins can either be released in the extracellular milieu or exposed at the cell surface by associating to the CM or the CW. Following the gene ontology (GO for cellular components, cell-surface proteins at the CM can either be integral (GO: 0031226, i.e., the integral membrane proteins, or anchored to the membrane (GO: 0046658, i.e., the lipoproteins. At the CW (GO: 0009275, cell-surface proteins can be covalently bound, i.e., the LPXTG-proteins, or bound through weak interactions to the PG or wall polysaccharides, i.e., the cell wall binding proteins. Besides monopolypeptides, some proteins can associate to each other to form supramolecular protein structures of high molecular weight, namely the S-layer, pili, flagella, and cellulosomes. After reviewing the cell envelope components and the different molecular mechanisms involved in protein attachment to the cell envelope, perspectives in investigating the proteosurfaceome in parietal monoderm bacteria are further discussed.

  19. Characterization of the antigenicity of Cpl1, a surface protein of Cryptococcus neoformans var. neoformans.

    Science.gov (United States)

    Cai, Jian-Piao; Liu, Ling-Li; To, Kelvin K W; Lau, Candy C Y; Woo, Patrick C Y; Lau, Susanna K P; Guo, Yong-Hui; Ngan, Antonio H Y; Che, Xiao-Yan; Yuen, Kwok-Yung

    2015-01-01

    Cryptococcus neoformans var. neoformans is an important fungal pathogen. The capsule is a well established virulence factor and a target site for diagnostic tests. The CPL1 gene is required for capsular formation and virulence. The protein product Cpl1 has been proposed to be a secreted protein, but the characteristics of this protein have not been reported. Here we sought to characterize Cpl1. Phylogenetic analysis showed that the Cpl1 of C. neoformans var. neoformans and the Cpl1 orthologs identified in C. neoformans var. grubii and C. gattii formed a distinct cluster among related fungi; while the putative ortholog found in Trichosporon asahii was distantly related to the Cryptococcus cluster. We expressed Cpl1 abundantly as a secreted His-tagged protein in Pichia pastoris. The protein was used to immunize guinea pigs and rabbits for high titer mono-specific polyclonal antibody that was shown to be highly specific against the cell wall of C. neoformans var. neoformans and did not cross react with C. gattii, T. asahii, Aspergillus spp., Candida spp. and Penicillium spp. Using the anti-Cpl1 antibody, we detected Cpl1 protein in the fresh culture supernatant of C. neoformans var. neoformans and we showed by immunostaining that the Cpl1 protein was located on the surface. The Cpl1 protein is a specific surface protein of C. neoformans var. neoformans. © 2015 by The Mycological Society of America.

  20. Development, Characterization, and Optimization of Protein Level in Date Bars Using Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Muhammad Nadeem

    2012-01-01

    Full Text Available This project was designed to produce a nourishing date bar with commercial value especially for school going children to meet their body development requirements. Protein level of date bars was optimized using response surface methodology (RSM. Economical and underutilized sources, that is, whey protein concentrate and vetch protein isolates, were explored for protein supplementation. Fourteen date bar treatments were produced using a central composite design (CCD with 2 variables and 3 levels for each variable. Date bars were then analyzed for nutritional profile. Proximate composition revealed that addition of whey protein concentrate and vetch protein isolates improved the nutritional profile of date bars. Protein level, texture, and taste were considerably improved by incorporating 6.05% whey protein concentrate and 4.35% vetch protein isolates in date bar without affecting any sensory characteristics during storage. Response surface methodology was observed as an economical and effective tool to optimize the ingredient level and to discriminate the interactive effects of independent variables.

  1. Detecting Local Ligand-Binding Site Similarity in Non-Homologous Proteins by Surface Patch Comparison

    Science.gov (United States)

    Sael, Lee; Kihara, Daisuke

    2012-01-01

    Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. PMID:22275074

  2. Detecting local ligand-binding site similarity in nonhomologous proteins by surface patch comparison.

    Science.gov (United States)

    Sael, Lee; Kihara, Daisuke

    2012-04-01

    Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. Copyright © 2011 Wiley Periodicals, Inc.

  3. Visualization of red-ox proteins on the gold surface using enzymatic polypyrrole formation

    International Nuclear Information System (INIS)

    Ramanaviciene, A.; Kausaite-Minkstimiene, A.; Voronovic, J.; Ramanavicius, A.; Oztekin, Y.; Carac, G.; German, N.

    2011-01-01

    We describe a new method for the visualization of the activity of red-ox proteins on a gold interface. Glucose oxidase was selected as a model system. Surfaces were modified by adhesion of glucose oxidase on (a) electrochemically cleaned gold; (b) gold films modified with gold nanoparticles, (c) a gold surface modified with self-assembled monolayer, and (d) covalent immobilization of protein on the gold surface modified with a self-assembled monolayer. The simple optical method for the visualization of enzyme on the surfaces is based on the enzymatic formation of polypyrrole. The activity of the enzyme was quantified via enzymatic formation of polypyrrole, which was detected and investigated by quartz microbalance and amperometric techniques. The experimental data suggest that the enzymatic formation of the polymer may serve as a method to indicate the adhesion of active redox enzyme on such surfaces. (author)

  4. Plasma membrane of a marine T cell lymphoma: surface labelling, membrane isolation, separation of membrane proteins and distribution of surface label amongst these proteins

    International Nuclear Information System (INIS)

    Crumpton, M.J.; Marchalonis, J.J.; Haustein, D.; Atwell, J.L.; Harris, A.W.

    1976-01-01

    Two established techniques for analysis of plasma membranes, namely, lactoperoxidase catalyzed surface radioiodination of intact cells and bulk membrane isolation following disruption of cells by shear forces, were applied in studies of membrane proteins of continuously cultured cells of the monoclonal T lymphoma line WEHI-22. It was found that macromolecular 125 I-iodide incorporated into plasma membrane proteins of intact cells was at least as good a marker for the plasma as was the commonly used enzyme 5'-nucleotidase, T lymphoma plasma membrane proteins were complex when analysed by polyacrylamide gel electrophoresis in sodium dodecylsulphate-containing buffers and more than thirty distinct components were resolved. More than fifteen of the components observed on a mass basis were also labelled with 125 I-iodide. Certain bands, however, exhibited a degree of label disproportionate to their staining properties with Coomassie Blue. This was interpreted in terms of their accessibility to the solvent in the intact cells. (author)

  5. The ability of IgY to recognize surface proteins of Streptococcus mutans

    Directory of Open Access Journals (Sweden)

    Basri A. Gani

    2009-12-01

    Full Text Available Background: Streptococcus mutans are gram positive bacteria classified into viridians group, and have a role in pathogenesis of dental caries. It’s adhesion to the tooth surface is mediated by cell surface proteins, which interact with specific receptor located in tooth pellicle. Glucan binding protein, Glukosyltransferase, and antigen I/II are basic proteins of S. mutans, which have a role in initiating the interaction. A previous study showed that chicken’s IgY can interfere the interaction. Purpose: The objective of this study was to assess the ability of IgY in recognizing the surface molecule of Streptococcus mutans expressed by various serotypes (c, d, e, f and a strain derived from IPB, Bogor. Method: Western blot was used as a method to determine such capability. Result: The result showed that IgY has a potency to recognize antigen I/II, but not the other proteins on the cell surface of all bacteria tested. Conclusion: The ability of IgY to bind the surface protein, antigen I/II, indicates that this avian antibody could be used as a candidate for anti-adhesion in preventing dental caries.

  6. Fibrillar Structure and Charge Determine the Interaction of Polyglutamine Protein Aggregates with the Cell Surface*

    Science.gov (United States)

    Trevino, R. Sean; Lauckner, Jane E.; Sourigues, Yannick; Pearce, Margaret M.; Bousset, Luc; Melki, Ronald; Kopito, Ron R.

    2012-01-01

    The pathogenesis of most neurodegenerative diseases, including transmissible diseases like prion encephalopathy, inherited disorders like Huntington disease, and sporadic diseases like Alzheimer and Parkinson diseases, is intimately linked to the formation of fibrillar protein aggregates. It is becoming increasingly appreciated that prion-like intercellular transmission of protein aggregates can contribute to the stereotypical spread of disease pathology within the brain, but the mechanisms underlying the binding and uptake of protein aggregates by mammalian cells are largely uninvestigated. We have investigated the properties of polyglutamine (polyQ) aggregates that endow them with the ability to bind to mammalian cells in culture and the properties of the cell surface that facilitate such uptake. Binding and internalization of polyQ aggregates are common features of mammalian cells and depend upon both trypsin-sensitive and trypsin-resistant saturable sites on the cell surface, suggesting the involvement of cell surface proteins in this process. polyQ aggregate binding depends upon the presence of a fibrillar amyloid-like structure and does not depend upon electrostatic interaction of fibrils with the cell surface. Sequences in the huntingtin protein that flank the amyloid-forming polyQ tract also influence the extent to which aggregates are able to bind to cell surfaces. PMID:22753412

  7. In vitro investigation of protein adsorption and platelet adhesion on inorganic biomaterial surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Yan Huang [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Lue Xiaoying [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China)], E-mail: luxy@seu.edu.cn; Ma Jingwu [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Nan Huang [Institute of Biomaterials and Surface Engineering, Southwest Jiaotong University, Chengdu 610031 (China)], E-mail: nhuang@263.com

    2008-11-15

    The aim of this paper was to study the surface properties, protein adsorption and platelet adhesion behaviors of diamond-like carbon (DLC) and titanium (Ti) films. The surface energy and microstructures of these films were characterized by contact angle measurement and atomic force microscopy (AFM). A modified Coomassie brilliant blue (CBB) protein assay was used to study the amount of adsorbed proteins. Platelet adhesion was assessed by scanning electron microscopy (SEM). The AFM results show that the DLC film is smoother than Ti. Protein adsorption results from CBB protein assay show that the ratio of adsorbed albumin (Alb) to IgG (R{sub A/I}) on DLC is larger than Ti, which coincide with the sequence of the ratio of interfacial tension between solid surface and Alb ({gamma}{sub S,Alb}) to interfacial tension between surface and IgG ({gamma}{sub S,IgG}) ({gamma}{sub S,Alb}/{gamma}{sub S,IgG}). The DLC film has a preferential adsorption for Alb. The results suggest that the ratio of {gamma}{sub S,Alb}/{gamma}{sub S,IgG} may indicate an Alb/IgG affinity ratio of materials. More platelets adhere on Ti film than on DLC, which may correspond to the surface roughness of materials. The conclusion is the blood compatibility of DLC seems to be better than Ti.

  8. Multilayer Choline Phosphate Molecule Modified Surface with Enhanced Cell Adhesion but Resistance to Protein Adsorption.

    Science.gov (United States)

    Chen, Xingyu; Yang, Ming; Liu, Botao; Li, Zhiqiang; Tan, Hong; Li, Jianshu

    2017-08-22

    Choline phosphate (CP), which is a new zwitterionic molecule, and has the reverse order of phosphate choline (PC) and could bind to the cell membrane though the unique CP-PC interaction. Here we modified a glass surface with multilayer CP molecules using surface-initiated atom-transfer radical polymerization (SI-ATRP) and the ring-opening method. Polymeric brushes of (dimethylamino)ethyl methacrylate (DMAEMA) were synthesized by SI-ATRP from the glass surface. Then the grafted PDMAEMA brushes were used to introduce CP groups to fabricate the multilayer CP molecule modified surface. The protein adsorption experiment and cell culture test were used to evaluate the biocompatibility of the modified surfaces by using human umbilical veinendothelial cells (HUVECs). The protein adsorption results demonstrated that the multilayer CP molecule decorated surface could prevent the adsorption of fibrinogen and serum protein. The adhesion and proliferation of cells were improved significantly on the multilayer CP molecule modified surface. Therefore, the biocompatibility of the material surface could be improved by the modified multilayer CP molecule, which exhibits great potential for biomedical applications, e.g., scaffolds in tissue engineering.

  9. Surfing the Protein-Protein Interaction Surface Using Docking Methods: Application to the Design of PPI Inhibitors

    Directory of Open Access Journals (Sweden)

    Rushikesh Sable

    2015-06-01

    Full Text Available Blocking protein-protein interactions (PPI using small molecules or peptides modulates biochemical pathways and has therapeutic significance. PPI inhibition for designing drug-like molecules is a new area that has been explored extensively during the last decade. Considering the number of available PPI inhibitor databases and the limited number of 3D structures available for proteins, docking and scoring methods play a major role in designing PPI inhibitors as well as stabilizers. Docking methods are used in the design of PPI inhibitors at several stages of finding a lead compound, including modeling the protein complex, screening for hot spots on the protein-protein interaction interface and screening small molecules or peptides that bind to the PPI interface. There are three major challenges to the use of docking on the relatively flat surfaces of PPI. In this review we will provide some examples of the use of docking in PPI inhibitor design as well as its limitations. The combination of experimental and docking methods with improved scoring function has thus far resulted in few success stories of PPI inhibitors for therapeutic purposes. Docking algorithms used for PPI are in the early stages, however, and as more data are available docking will become a highly promising area in the design of PPI inhibitors or stabilizers.

  10. Surfing the Protein-Protein Interaction Surface Using Docking Methods: Application to the Design of PPI Inhibitors.

    Science.gov (United States)

    Sable, Rushikesh; Jois, Seetharama

    2015-06-23

    Blocking protein-protein interactions (PPI) using small molecules or peptides modulates biochemical pathways and has therapeutic significance. PPI inhibition for designing drug-like molecules is a new area that has been explored extensively during the last decade. Considering the number of available PPI inhibitor databases and the limited number of 3D structures available for proteins, docking and scoring methods play a major role in designing PPI inhibitors as well as stabilizers. Docking methods are used in the design of PPI inhibitors at several stages of finding a lead compound, including modeling the protein complex, screening for hot spots on the protein-protein interaction interface and screening small molecules or peptides that bind to the PPI interface. There are three major challenges to the use of docking on the relatively flat surfaces of PPI. In this review we will provide some examples of the use of docking in PPI inhibitor design as well as its limitations. The combination of experimental and docking methods with improved scoring function has thus far resulted in few success stories of PPI inhibitors for therapeutic purposes. Docking algorithms used for PPI are in the early stages, however, and as more data are available docking will become a highly promising area in the design of PPI inhibitors or stabilizers.

  11. A novel carbohydrate-binding surface layer protein from the hyperthermophilic archaeon Pyrococcus horikoshii.

    Science.gov (United States)

    Goda, Shuichiro; Koga, Tomoyuki; Yamashita, Kenichiro; Kuriura, Ryo; Ueda, Toshifumi

    2018-04-08

    In Archaea and Bacteria, surface layer (S-layer) proteins form the cell envelope and are involved in cell protection. In the present study, a putative S-layer protein was purified from the crude extract of Pyrococcus horikoshii using affinity chromatography. The S-layer gene was cloned and expressed in Escherichia coli. Isothermal titration calorimetry analyses showed that the S-layer protein bound N-acetylglucosamine and induced agglutination of the gram-positive bacterium Micrococcus lysodeikticus. The protein comprised a 21-mer structure, with a molecular mass of 1,340 kDa, as determined using small-angle X-ray scattering. This protein showed high thermal stability, with a midpoint of thermal denaturation of 79 °C in dynamic light scattering experiments. This is the first description of the carbohydrate-binding archaeal S-layer protein and its characteristics.

  12. Selective radiolabeling of cell surface proteins to a high specific activity

    International Nuclear Information System (INIS)

    Thompson, J.A.; Lau, A.L.; Cunningham, D.D.

    1987-01-01

    A procedure was developed for selective radiolabeling of membrane proteins on cells to higher specific activities than possible with available techniques. Cell surface amino groups were derivatized with 125 I-(hydroxyphenyl)propionyl groups via 125 I-sulfosuccinimidyl (hydroxyphenyl)propionate ( 125 II-sulfo-SHPP). This reagent preferentially labeled membrane proteins exposed at the cell surface of erythrocytes as assessed by the degree of radiolabel incorporation into erythrocyte ghost proteins and hemoglobin. Comparison with the lactoperoxidase-[ 125 I]iodide labeling technique revealed that 125 I-sulfo-SHPP labeled cell surface proteins to a much higher specific activity and hemoglobin to a much lower specific activity. Additionally, this reagent was used for selective radiolabeling of membrane proteins on the cytoplasmic face of the plasma membrane by blocking exofacial amino groups with uniodinated sulfo-SHPP, lysing the cells, and then incubating them with 125 I-sulfo-SHPP. Exclusive labeling of either side of the plasma membrane was demonstrated by the labeling of some marker proteins with well-defined spacial orientations on erythroctyes. Transmembrane proteins such as the epidermal growth factor receptor on cultured cells could also be labeled differentially from either side of the plasma membrane

  13. Analysis of direct immobilized recombinant protein G on a gold surface

    International Nuclear Information System (INIS)

    Kim, Hyunhee; Kang, Da-Yeon; Goh, Hyun-Jeong; Oh, Byung-Keun; Singh, Ravindra P.; Oh, Soo-Min; Choi, Jeong-Woo

    2008-01-01

    Abstact: For the immobilization of IgG, various techniques such as chemical linker, thiolated protein G methods, and fragmentation of antibodies have been reported [Y.M. Bae, B.K. Oh, W. Lee, W.H. Lee, J.W. Choi, Biosensors Bioelectron. 21 (2005) 103; W. Lee, B.K. Oh, W.H. Lee, J.W. Choi, Colloids Surf. B-Biointerfaces, 40 (2005) 143; A.A. Karyakin, G.V. Presnova, M.Y. Rubtsova, A.M. Egorov, Anal. Chem. 72 (2000) 3805]. Here, we modified the immunoglobulin Fc-binding B-domain of protein G to contain two cysteine residues at its C-terminus by a genetic engineering technique. The resulting recombinant protein, RPGcys, retained IgG-binding activity in the same manner as native protein G. RPGcys was immobilized on a gold surface by strong affinity between thiol of cysteine and gold. The orientations of both IgG layers immobilized on the base recombinant protein Gs were analyzed by fluorescence microscope, atomic force microscope (AFM), and surface plasmon resonance (SPR). Our data revealed that IgG-binding activity of RPGcys on gold surface significantly increased in comparison to wild type of protein G (RPGwild), which was physically adsorbed due to absence of cysteine residue. Immobilization of highly oriented antibodies based on cysteine-modified protein G could be useful for the fabrication of immunosensor systems

  14. Effect of enzymatic treatment of extracted sunflower proteins on solubility, amino acid composition, and surface activity.

    Science.gov (United States)

    Conde, José Miñones; Escobar, María del Mar Yust; Pedroche Jiménez, Justo J; Rodríguez, Francisco Millán; Rodríguez Patino, Juan M

    2005-10-05

    Industrial proteins from agriculture of either animal or vegetable origin, including their peptide derivatives, are of great importance, from the qualitative and quantitative point of view, in food formulations (emulsions and foams). A fundamental understanding of the physical, chemical, and functional properties of these proteins is essential if the performance of proteins in foods is to be improved and if underutilized proteins, such as plant proteins (and their hydrolysates and peptides derivatives), are to be increasingly used in traditional and new processed food products (safe, high-quality, health foods with good nutritional value). In this contribution we have determined the main physicochemical characteristics (solubility, composition, and analysis of amino acids) of a sunflower protein isolate (SPI) and its hydrolysates with low (5.62%), medium (23.5%), and high (46.3%) degrees of hydrolysis. The hydrolysates were obtained by enzymatic treatment with Alcalase 2.4 L for DH 5.62 and 23.5% and with Alcalase 2.4 L and Flavorzyme 1000 MG sequentially for DH 46.3%. The protein concentration dependence on surface pressure (surface pressure isotherm), a measure of the surface activity of the products (SPI and its hydrolysates), was obtained by tensiometry. We have observed that the degree of hydrolysis has an effect on solubility, composition, and content of the amino acids of the SPI and its hydrolysates. The superficial activity and the adsorption efficiency were also affected by the degree of hydrolysis.

  15. Fast protein tertiary structure retrieval based on global surface shape similarity.

    Science.gov (United States)

    Sael, Lee; Li, Bin; La, David; Fang, Yi; Ramani, Karthik; Rustamov, Raif; Kihara, Daisuke

    2008-09-01

    Characterization and identification of similar tertiary structure of proteins provides rich information for investigating function and evolution. The importance of structure similarity searches is increasing as structure databases continue to expand, partly due to the structural genomics projects. A crucial drawback of conventional protein structure comparison methods, which compare structures by their main-chain orientation or the spatial arrangement of secondary structure, is that a database search is too slow to be done in real-time. Here we introduce a global surface shape representation by three-dimensional (3D) Zernike descriptors, which represent a protein structure compactly as a series expansion of 3D functions. With this simplified representation, the search speed against a few thousand structures takes less than a minute. To investigate the agreement between surface representation defined by 3D Zernike descriptor and conventional main-chain based representation, a benchmark was performed against a protein classification generated by the combinatorial extension algorithm. Despite the different representation, 3D Zernike descriptor retrieved proteins of the same conformation defined by combinatorial extension in 89.6% of the cases within the top five closest structures. The real-time protein structure search by 3D Zernike descriptor will open up new possibility of large-scale global and local protein surface shape comparison. 2008 Wiley-Liss, Inc.

  16. Synthesis of an endothelial cell mimicking surface containing thrombomodulin and endothelial protein C receptor

    Science.gov (United States)

    Kador, Karl Erich

    Synthetic materials for use in blood contacting applications have been studied for many years with limited success. One of the main areas of need for these materials is the design of synthetic vascular grafts for use in the hundreds of thousands of patients who have coronary artery bypass grafting, many without suitable veins for autologous grafts. The design of these grafts is constrained by two common modes of failure, the formation of intimal hyperplasia (IH) and thrombosis. IH formation has been previously linked to a mismatching of the mechanical properties of the graft and has been overcome by creating grafts using materials whose compliance mimics that of the native artery. Several techniques and surface modification have been designed to limit thrombosis on the surface of synthetic materials. One which has shown the greatest promise is the immobilization of Thrombomodulin (TM), a protein found on the endothelial cell membrane lining native blood vessels involved in the activation of the anticoagulant Protein C (PC). While TM immobilization has been shown to arrest thrombin formation and limit fibrous formations in in-vitro and in-vivo experiments, it has shown to be transport limiting under arterial flow. On the endothelial cell surface, TM is co-localized with Endothelial Protein C Receptor (EPCR), which increases PC transport onto the cell surface and increases PC activation via TM between 20-100 fold. This dissertation will describe the chemical modification of medical grade polyurethane (PU), whose compliance has been shown to match that of native arteries. This modification will enable the immobilization of two proteins on an enzymatically relevant scale estimated at less than 10 nm. This dissertation will further describe the immobilization of the proteins TM and EPCR, and analyze the ability of a surface co-immobilized with these proteins to activate the anticoagulant PC. Finally, it will compare the ability of this co-immobilized surface to delay

  17. Enhanced Hydrophilicity and Protein Adsorption of Titanium Surface by Sodium Bicarbonate Solution

    Directory of Open Access Journals (Sweden)

    Shengnan Jia

    2015-01-01

    Full Text Available The aim of this study was to investigate a novel and convenient method of chemical treatment to modify the hydrophilicity of titanium surfaces. Sand-blasted and acid-etched (SLA titanium surfaces and machined titanium surfaces were treated with sodium bicarbonate (NaHCO3 solution. The wetting behavior of both kinds of surfaces was measured by water contact angle (WCA test. The surface microstructure was assessed with scanning electron microscopy (SEM and three-dimensional (3D optical microscopy. The elemental compositions of the surfaces were analyzed by X-ray photoelectron spectroscopy (XPS. The protein adsorption analysis was performed with fibronectin. Results showed that, after 1 M NaHCO3 treatment, the hydrophilicity of both SLA and machined surfaces was enhanced. No significant microstructural change presented on titanium surfaces after NaHCO3 treatment. The deprotonation and ion exchange activities might cause the enhanced hydrophilicity of titanium surfaces. The increased protein adsorption of NaHCO3-treated SLA surfaces might indicate their improved tissue-integration in clinical use.

  18. Magnetic capture of polydopamine-encapsulated Hela cells for the analysis of cell surface proteins.

    Science.gov (United States)

    Liu, Yiying; Yan, Guoquan; Gao, Mingxia; Zhang, Xiangmin

    2018-02-10

    A novel method to characterize cell surface proteins and complexes has been developed. Polydopamine (PDA)-encapsulated Hela cells were prepared for plasma membrane proteome research. Since the PDA protection, the encapsulated cells could be maintained for more than two weeks. Amino groups functionalized magnetic nanoparticles were also used for cell capture by the reaction with the PDA coatings. Plasma membrane fragments were isolated and enriched with assistance of an external magnetic field after disruption of the coated cells by ultrasonic treatment. Plasma membrane proteins (PMPs) and complexes were well preserved on the fragments and identified by shot-gun proteomic analytical strategy. 385 PMPs and 1411 non-PMPs were identified using the method. 85.2% of these PMPs were lipid-raft associated proteins. Ingenuity Pathway Analysis was employed for bio-information extraction from the identified proteins. It was found that 653 non-PMPs had interactions with 140 PMPs. Among them, epidermal growth factor receptor and its complexes, and a series of important pathways including STAT3 pathway were observed. All these results demonstrated that the new approach is of great importance in applying to the research of physiological function and mechanism of the plasma membrane proteins. This work developed a novel strategy for the proteomic analysis of cell surface proteins. According to the results, 73.3% of total identified proteins were lipid-raft associated proteins, which imply that the proposed method is of great potential in the identification of lipid-raft associated proteins. In addition, a series of protein-protein interactions and pathways related to Hela cells were pointed out. All these results demonstrated that our proposed approach is of great importance and could well be applied to the physiological function and mechanism research of plasma membrane proteins. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Protein arrangement on modified diamond-like carbon surfaces - An ARXPS study

    Science.gov (United States)

    Oosterbeek, Reece N.; Seal, Christopher K.; Hyland, Margaret M.

    2014-12-01

    Understanding the nature of the interface between a biomaterial implant and the biological fluid is an essential step towards creating improved implant materials. This study examined a diamond-like carbon coating biomaterial, the surface energy of which was modified by Ar+ ion sputtering and laser graphitisation. The arrangement of proteins was analysed by angle resolved X-ray photoelectron spectroscopy, and the effects of the polar component of surface energy on this arrangement were observed. It was seen that polar groups (such as CN, CO) are more attracted to the coating surface due to the stronger polar interactions. This results in a segregation of these groups to the DLC-protein interface; at increasing takeoff angle (further from to DLC-protein interface) fewer of these polar groups are seen. Correspondingly, groups that interact mainly by dispersive forces (CC, CH) were found to increase in intensity as takeoff angle increased, indicating they are segregated away from the DLC-protein interface. The magnitude of the segregation was seen to increase with increasing polar surface energy, this was attributed to an increased net attraction between the solid surface and polar groups at higher polar surface energy (γSp).

  20. Protein adsorption at polymer-grafted surfaces: Comparison between a mixture of saliva proteins and some well-defined model proteins

    NARCIS (Netherlands)

    Kawasaki, K.; Kambara, M.; Matsumura, H.; Norde, W.

    2003-01-01

    Grafting a dense layer of soluble polymers onto a surface is a well-established method for controlling protein adsorption. In the present study, polyethylene oxide (PEO) layers of three different grafting densities were prepared, i.e. 10-15 nm2, 5.5 nm2 and 4 nm2 per polymer chain, respectively. The

  1. Controlled surface chemistry of diamond/β-SiC composite films for preferential protein adsorption.

    Science.gov (United States)

    Wang, Tao; Handschuh-Wang, Stephan; Yang, Yang; Zhuang, Hao; Schlemper, Christoph; Wesner, Daniel; Schönherr, Holger; Zhang, Wenjun; Jiang, Xin

    2014-02-04

    Diamond and SiC both process extraordinary biocompatible, electronic, and chemical properties. A combination of diamond and SiC may lead to highly stable materials, e.g., for implants or biosensors with excellent sensing properties. Here we report on the controllable surface chemistry of diamond/β-SiC composite films and its effect on protein adsorption. For systematic and high-throughput investigations, novel diamond/β-SiC composite films with gradient composition have been synthesized using the hot filament chemical vapor deposition (HFCVD) technique. As revealed by scanning electron microscopy (SEM), the diamond/β-SiC ratio of the composite films shows a continuous change from pure diamond to β-SiC over a length of ∼ 10 mm on the surface. X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) was employed to unveil the surface termination of chemically oxidized and hydrogen treated surfaces. The surface chemistry of the composite films was found to depend on diamond/β-SiC ratio and the surface treatment. As observed by confocal fluorescence microscopy, albumin and fibrinogen were preferentially adsorbed from buffer: after surface oxidation, the proteins preferred to adsorb on diamond rather than on β-SiC, resulting in an increasing amount of proteins adsorbed to the gradient surfaces with increasing diamond/β-SiC ratio. By contrast, for hydrogen-treated surfaces, the proteins preferentially adsorbed on β-SiC, leading to a decreasing amount of albumin adsorbed on the gradient surfaces with increasing diamond/β-SiC ratio. The mechanism of preferential protein adsorption is discussed by considering the hydrogen bonding of the water self-association network to OH-terminated surfaces and the change of the polar surface energy component, which was determined according to the van Oss method. These results suggest that the diamond/β-SiC gradient film can be a promising material for biomedical applications which

  2. Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method.

    Science.gov (United States)

    Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

    2014-08-01

    Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

  3. CASTp 3.0: computed atlas of surface topography of proteins.

    Science.gov (United States)

    Tian, Wei; Chen, Chang; Lei, Xue; Zhao, Jieling; Liang, Jie

    2018-06-01

    Geometric and topological properties of protein structures, including surface pockets, interior cavities and cross channels, are of fundamental importance for proteins to carry out their functions. Computed Atlas of Surface Topography of proteins (CASTp) is a web server that provides online services for locating, delineating and measuring these geometric and topological properties of protein structures. It has been widely used since its inception in 2003. In this article, we present the latest version of the web server, CASTp 3.0. CASTp 3.0 continues to provide reliable and comprehensive identifications and quantifications of protein topography. In addition, it now provides: (i) imprints of the negative volumes of pockets, cavities and channels, (ii) topographic features of biological assemblies in the Protein Data Bank, (iii) improved visualization of protein structures and pockets, and (iv) more intuitive structural and annotated information, including information of secondary structure, functional sites, variant sites and other annotations of protein residues. The CASTp 3.0 web server is freely accessible at http://sts.bioe.uic.edu/castp/.

  4. Nanoscale protein arrays of rich morphologies via self-assembly on chemically treated diblock copolymer surfaces

    International Nuclear Information System (INIS)

    Song Sheng; Milchak, Marissa; Zhou Hebing; Lee, Thomas; Hanscom, Mark; Hahm, Jong-in

    2013-01-01

    Well-controlled assembly of proteins on supramolecular templates of block copolymers can be extremely useful for high-throughput biodetection. We report the adsorption and assembly characteristics of a model antibody protein to various polystyrene-block-poly(4-vinylpyridine) templates whose distinctive nanoscale structures are obtained through time-regulated exposure to chloroform vapor. The strong adsorption preference of the protein to the polystyrene segment in the diblock copolymer templates leads to an easily predictable, controllable, rich set of nanoscale protein morphologies through self-assembly. We also demonstrate that the chemical identities of various subareas within individual nanostructures can be readily elucidated by investigating the corresponding protein adsorption behavior on each chemically distinct area of the template. In our approach, a rich set of intricate nanoscale morphologies of protein arrays that cannot be easily attained through other means can be generated straightforwardly via self-assembly of proteins on chemically treated diblock copolymer surfaces, without the use of clean-room-based fabrication tools. Our approach provides much-needed flexibility and versatility for the use of block copolymer-based protein arrays in biodetection. The ease of fabrication in producing well-defined and self-assembled templates can contribute to a high degree of versatility and simplicity in acquiring an intricate nanoscale geometry and spatial distribution of proteins in arrays. These advantages can be extremely beneficial both for fundamental research and biomedical detection, especially in the areas of solid-state-based, high-throughput protein sensing. (paper)

  5. Exploring the Leishmania Hydrophilic Acylated Surface Protein B (HASPB) Export Pathway by Live Cell Imaging Methods.

    Science.gov (United States)

    MacLean, Lorna; Price, Helen; O'Toole, Peter

    2016-01-01

    Leishmania major is a human-infective protozoan parasite transmitted by the bite of the female phlebotomine sand fly. The L. major hydrophilic acylated surface protein B (HASPB) is only expressed in infective parasite stages suggesting a role in parasite virulence. HASPB is a "nonclassically" secreted protein that lacks a conventional signal peptide, reaching the cell surface by an alternative route to the classical ER-Golgi pathway. Instead HASPB trafficking to and exposure on the parasite plasma membrane requires dual N-terminal acylation. Here, we use live cell imaging methods to further explore this pathway allowing visualization of key events in real time at the individual cell level. These methods include live cell imaging using fluorescent reporters to determine the subcellular localization of wild type and acylation site mutation HASPB18-GFP fusion proteins, fluorescence recovery after photobleaching (FRAP) to analyze the dynamics of HASPB in live cells, and live antibody staining to detect surface exposure of HASPB by confocal microscopy.

  6. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  7. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Plasma immersion ion implantation of polyurethane shape memory polymer: Surface properties and protein immobilization

    Science.gov (United States)

    Cheng, Xinying; Kondyurin, Alexey; Bao, Shisan; Bilek, Marcela M. M.; Ye, Lin

    2017-09-01

    Polyurethane-type shape memory polymers (SMPU) are promising biomedical implant materials due to their ability to recover to a predetermined shape from a temporary shape induced by thermal activation close to human body temperature and their advantageous mechanical properties including large recovery strains and low recovery stresses. Plasma Immersion Ion Implantation (PIII) is a surface modification process using energetic ions that generates radicals in polymer surfaces leading to carbonisation and oxidation and the ability to covalently immobilise proteins without the need for wet chemistry. Here we show that PIII treatment of SMPU significantly enhances its bioactivity making SMPU suitable for applications in permanent implantable biomedical devices. Scanning Electron Microscopy (SEM), contact angle measurements, surface energy measurements, attenuated total reflection Fourier transform infrared (ATR-FTIR) spectroscopy and X-ray photoelectron spectroscopy (XPS) were used to characterise the PIII modified surface, including its after treatment aging kinetics and its capability to covalently immobilise protein directly from solution. The results show a substantial improvement in wettability and dramatic changes of surface chemical composition dependent on treatment duration, due to the generation of radicals and subsequent oxidation. The SMPU surface, PIII treated for 200s, achieved a saturated level of covalently immobilized protein indicating that a full monolayer coverage was achieved. We conclude that PIII is a promising and efficient surface modification method to enhance the biocompatibility of SMPU for use in medical applications that demand bioactivity for tissue integration and stability in vivo.

  9. Protein structural transition at negatively charged electrode surfaces. Effects of temperature and current density

    Czech Academy of Sciences Publication Activity Database

    Černocká, Hana; Ostatná, Veronika; Paleček, Emil

    2015-01-01

    Roč. 174, AUG 2015 (2015), s. 356-360 ISSN 0013-4686 R&D Projects: GA ČR(CZ) GAP301/11/2055; GA ČR(CZ) GA15-15479S; GA ČR(CZ) GA13-00956S Institutional support: RVO:68081707 Keywords : Bovine serum albumin * sensing of surface-attached protein stability * protein structural transition at Hg Subject RIV: BO - Biophysics Impact factor: 4.803, year: 2015

  10. Epididymosomes: transfer of fertility-modulating proteins to the sperm surface

    OpenAIRE

    Patricia A Martin-DeLeon

    2015-01-01

    A variety of glycosylphosphatidylinositol (GPI)-linked proteins are acquired on spermatozoa from epididymal luminal fluids (ELF) during sperm maturation. These proteins serve roles in immunoprotection and in key steps of fertilization such as capacitation, acrosomal exocytosis and sperm-egg interactions. Their acquisition on sperm cells is mediated both by membrane vesicles (epididymosomes, EP) which were first reported to dock on the sperm surface, and by lipid carriers which facilitate the ...

  11. Overexpression and surface localization of the Chlamydia trachomatis major outer membrane protein in Escherichia coli

    DEFF Research Database (Denmark)

    Koehler, JF; Birkelund, Svend; Stephens, RS

    1992-01-01

    The Chlamydia trachomatis major outer membrane protein (MOMP) is the quantitatively predominant surface protein which has important functional, structural and antigenic properties. We have cloned and overexpressed the MOMP in Escherichia coli. The MOMP is surface exposed in C. trachomatis....... The induction of MOMP expression had a rapidly lethal effect on the L2rMOMP E. coli clone. Although no genetic system exists for Chlamydia, development of a stable, inducible E. coli clone which overexpresses the chlamydial MOMP permits a study of the biological properties of the MOMP, including...

  12. Structure of the Streptococcus pneumoniae Surface Protein and Adhesin PfbA

    OpenAIRE

    Suits, Michael D.; Boraston, Alisdair B.

    2013-01-01

    PfbA (plasmin- and fibronectin-binding protein A) is an extracellular Streptococcus pneumoniae cell-wall attached surface protein that binds to fibronectin, plasmin, and plasminogen. Here we present a structural analysis of the surface exposed domains of PfbA using a combined approach of X-ray crystallography and small-angle X-ray scattering (SAXS). The crystal structure of the PfbA core domain, here called PfbAβ, determined to 2.28 Å resolution revealed an elongated 12-stranded parallel β-he...

  13. Isolation of recombinant antibodies directed against surface proteins of Clostridium difficile.

    Science.gov (United States)

    Shirvan, Ali Nazari; Aitken, Robert

    2016-01-01

    Clostridium difficile has emerged as an increasingly important nosocomial pathogen and the prime causative agent of antibiotic-associated diarrhoea and pseudomembranous colitis in humans. In addition to toxins A and B, immunological studies using antisera from patients infected with C. difficile have shown that a number of other bacterial factors contribute to the pathogenesis, including surface proteins, which are responsible for adhesion, motility and other interactions with the human host. In this study, various clostridial targets, including FliC, FliD and cell wall protein 66, were expressed and purified. Phage antibody display yielded a large panel of specific recombinant antibodies, which were expressed, purified and characterised. Reactions of the recombinant antibodies with their targets were detected by enzyme-linked immunosorbent assay; and Western blotting suggested that linear rather than conformational epitopes were recognised. Binding of the recombinant antibodies to surface-layer proteins and their components showed strain specificity, with good recognition of proteins from C. difficile 630. However, no reaction was observed for strain R20291-a representative of the 027 ribotype. Binding of the recombinant antibodies to C. difficile M120 extracts indicated that a component of a surface-layer protein of this strain might possess immunoglobulin-binding activities. The recombinant antibodies against FliC and FliD proteins were able to inhibit bacterial motility. Copyright © 2016. Published by Elsevier Editora Ltda.

  14. Analysis of the free-energy surface of proteins from reversible folding simulations.

    Directory of Open Access Journals (Sweden)

    Lucy R Allen

    2009-07-01

    Full Text Available Computer generated trajectories can, in principle, reveal the folding pathways of a protein at atomic resolution and possibly suggest general and simple rules for predicting the folded structure of a given sequence. While such reversible folding trajectories can only be determined ab initio using all-atom transferable force-fields for a few small proteins, they can be determined for a large number of proteins using coarse-grained and structure-based force-fields, in which a known folded structure is by construction the absolute energy and free-energy minimum. Here we use a model of the fast folding helical lambda-repressor protein to generate trajectories in which native and non-native states are in equilibrium and transitions are accurately sampled. Yet, representation of the free-energy surface, which underlies the thermodynamic and dynamic properties of the protein model, from such a trajectory remains a challenge. Projections over one or a small number of arbitrarily chosen progress variables often hide the most important features of such surfaces. The results unequivocally show that an unprojected representation of the free-energy surface provides important and unbiased information and allows a simple and meaningful description of many-dimensional, heterogeneous trajectories, providing new insight into the possible mechanisms of fast-folding proteins.

  15. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily

    Science.gov (United States)

    Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.

    2005-01-01

    Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

  16. Identification of novel surface-exposed proteins of Rickettsia rickettsii by affinity purification and proteomics.

    Directory of Open Access Journals (Sweden)

    Wenping Gong

    Full Text Available Rickettsia rickettsii, the causative agent of Rocky Mountain spotted fever, is the most pathogenic member among Rickettsia spp. Surface-exposed proteins (SEPs of R. rickettsii may play important roles in its pathogenesis or immunity. In this study, R. rickettsii organisms were surface-labeled with sulfo-NHS-SS-biotin and the labeled proteins were affinity-purified with streptavidin. The isolated proteins were separated by two-dimensional electrophoresis, and 10 proteins were identified among 23 protein spots by electrospray ionization tandem mass spectrometry. Five (OmpA, OmpB, GroEL, GroES, and a DNA-binding protein of the 10 proteins were previously characterized as surface proteins of R. rickettsii. Another 5 proteins (Adr1, Adr2, OmpW, Porin_4, and TolC were first recognized as SEPs of R. rickettsii herein. The genes encoding the 5 novel SEPs were expressed in Escherichia coli cells, resulting in 5 recombinant SEPs (rSEPs, which were used to immunize mice. After challenge with viable R. rickettsii cells, the rickettsial load in the spleen, liver, or lung of mice immunized with rAdr2 and in the lungs of mice immunized with other rSEPs excluding rTolC was significantly lower than in mice that were mock-immunized with PBS. The in vitro neutralization test revealed that sera from mice immunized with rAdr1, rAdr2, or rOmpW reduced R. rickettsii adherence to and invasion of vascular endothelial cells. The immuno-electron microscopic assay clearly showed that the novel SEPs were located in the outer and/or inner membrane of R. rickettsii. Altogether, the 5 novel SEPs identified herein might be involved in the interaction of R. rickettsii with vascular endothelial cells, and all of them except TolC were protective antigens.

  17. Identification of Novel Surface-Exposed Proteins of Rickettsia rickettsii by Affinity Purification and Proteomics

    Science.gov (United States)

    Gong, Wenping; Xiong, Xiaolu; Qi, Yong; Jiao, Jun; Duan, Changsong; Wen, Bohai

    2014-01-01

    Rickettsia rickettsii, the causative agent of Rocky Mountain spotted fever, is the most pathogenic member among Rickettsia spp. Surface-exposed proteins (SEPs) of R. rickettsii may play important roles in its pathogenesis or immunity. In this study, R. rickettsii organisms were surface-labeled with sulfo-NHS-SS-biotin and the labeled proteins were affinity-purified with streptavidin. The isolated proteins were separated by two-dimensional electrophoresis, and 10 proteins were identified among 23 protein spots by electrospray ionization tandem mass spectrometry. Five (OmpA, OmpB, GroEL, GroES, and a DNA-binding protein) of the 10 proteins were previously characterized as surface proteins of R. rickettsii. Another 5 proteins (Adr1, Adr2, OmpW, Porin_4, and TolC) were first recognized as SEPs of R. rickettsii herein. The genes encoding the 5 novel SEPs were expressed in Escherichia coli cells, resulting in 5 recombinant SEPs (rSEPs), which were used to immunize mice. After challenge with viable R. rickettsii cells, the rickettsial load in the spleen, liver, or lung of mice immunized with rAdr2 and in the lungs of mice immunized with other rSEPs excluding rTolC was significantly lower than in mice that were mock-immunized with PBS. The in vitro neutralization test revealed that sera from mice immunized with rAdr1, rAdr2, or rOmpW reduced R. rickettsii adherence to and invasion of vascular endothelial cells. The immuno-electron microscopic assay clearly showed that the novel SEPs were located in the outer and/or inner membrane of R. rickettsii. Altogether, the 5 novel SEPs identified herein might be involved in the interaction of R. rickettsii with vascular endothelial cells, and all of them except TolC were protective antigens. PMID:24950252

  18. Optimising the Use of TRIzol-extracted Proteins in Surface Enhanced Laser Desorption/ Ionization (SELDI Analysis

    Directory of Open Access Journals (Sweden)

    Perlaky Laszlo

    2006-03-01

    Full Text Available Abstract Background Research with clinical specimens is always hampered by the limited availability of relevant samples, necessitating the use of a single sample for multiple assays. TRIzol is a common reagent for RNA extraction, but DNA and protein fractions can also be used for other studies. However, little is known about using TRIzol-extracted proteins in proteomic research, partly because proteins extracted from TRIzol are very resistant to solubilization. Results To facilitate the use of TRIzol-extracted proteins, we first compared the ability of four different common solubilizing reagents to solubilize the TRIzol-extracted proteins from an osteosarcoma cell line, U2-OS. Then we analyzed the solubilized proteins by Surface Enhanced Laser Desorption/ Ionization technique (SELDI. The results showed that solubilization of TRIzol-extracted proteins with 9.5 M Urea and 2% CHAPS ([3-[(3-cholamidopropyl-dimethylammonio]propanesulfonate] (UREA-CHAPS was significantly better than the standard 1% SDS in terms of solubilization efficiency and the number of detectable ion peaks. Using three different types of SELDI arrays (CM10, H50, and IMAC-Cu, we demonstrated that peak detection with proteins solubilized by UREA-CHAPS was reproducible (r > 0.9. Further SELDI analysis indicated that the number of ion peaks detected in TRIzol-extracted proteins was comparable to a direct extraction method, suggesting many proteins still remain in the TRIzol protein fraction. Conclusion Our results suggest that UREA-CHAPS performed very well in solubilizing TRIzol-extracted proteins for SELDI applications. Protein fractions left over after TRIzol RNA extraction could be a valuable but neglected source for proteomic or biochemical analysis when additional samples are not available.

  19. Human and pneumococcal cell surface glyceraldehyde-3-phosphate dehydrogenase (GAPDH) proteins are both ligands of human C1q protein.

    Science.gov (United States)

    Terrasse, Rémi; Tacnet-Delorme, Pascale; Moriscot, Christine; Pérard, Julien; Schoehn, Guy; Vernet, Thierry; Thielens, Nicole M; Di Guilmi, Anne Marie; Frachet, Philippe

    2012-12-14

    C1q, a key component of the classical complement pathway, is a major player in the response to microbial infection and has been shown to detect noxious altered-self substances such as apoptotic cells. In this work, using complementary experimental approaches, we identified the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a C1q partner when exposed at the surface of human pathogenic bacteria Streptococcus pneumoniae and human apoptotic cells. The membrane-associated GAPDH on HeLa cells bound the globular regions of C1q as demonstrated by pulldown and cell surface co-localization experiments. Pneumococcal strains deficient in surface-exposed GAPDH harbored a decreased level of C1q recognition when compared with the wild-type strains. Both recombinant human and pneumococcal GAPDHs interacted avidly with C1q as measured by surface plasmon resonance experiments (K(D) = 0.34-2.17 nm). In addition, GAPDH-C1q complexes were observed by transmission electron microscopy after cross-linking. The purified pneumococcal GAPDH protein activated C1 in an in vitro assay unlike the human form. Deposition of C1q, C3b, and C4b from human serum at the surface of pneumococcal cells was dependent on the presence of surface-exposed GAPDH. This ability of C1q to sense both human and bacterial GAPDHs sheds new insights on the role of this important defense collagen molecule in modulating the immune response.

  20. Human and Pneumococcal Cell Surface Glyceraldehyde-3-phosphate Dehydrogenase (GAPDH) Proteins Are Both Ligands of Human C1q Protein*

    Science.gov (United States)

    Terrasse, Rémi; Tacnet-Delorme, Pascale; Moriscot, Christine; Pérard, Julien; Schoehn, Guy; Vernet, Thierry; Thielens, Nicole M.; Di Guilmi, Anne Marie; Frachet, Philippe

    2012-01-01

    C1q, a key component of the classical complement pathway, is a major player in the response to microbial infection and has been shown to detect noxious altered-self substances such as apoptotic cells. In this work, using complementary experimental approaches, we identified the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a C1q partner when exposed at the surface of human pathogenic bacteria Streptococcus pneumoniae and human apoptotic cells. The membrane-associated GAPDH on HeLa cells bound the globular regions of C1q as demonstrated by pulldown and cell surface co-localization experiments. Pneumococcal strains deficient in surface-exposed GAPDH harbored a decreased level of C1q recognition when compared with the wild-type strains. Both recombinant human and pneumococcal GAPDHs interacted avidly with C1q as measured by surface plasmon resonance experiments (KD = 0.34–2.17 nm). In addition, GAPDH-C1q complexes were observed by transmission electron microscopy after cross-linking. The purified pneumococcal GAPDH protein activated C1 in an in vitro assay unlike the human form. Deposition of C1q, C3b, and C4b from human serum at the surface of pneumococcal cells was dependent on the presence of surface-exposed GAPDH. This ability of C1q to sense both human and bacterial GAPDHs sheds new insights on the role of this important defense collagen molecule in modulating the immune response. PMID:23086952

  1. Highly multiplexed and quantitative cell-surface protein profiling using genetically barcoded antibodies.

    Science.gov (United States)

    Pollock, Samuel B; Hu, Amy; Mou, Yun; Martinko, Alexander J; Julien, Olivier; Hornsby, Michael; Ploder, Lynda; Adams, Jarrett J; Geng, Huimin; Müschen, Markus; Sidhu, Sachdev S; Moffat, Jason; Wells, James A

    2018-03-13

    Human cells express thousands of different surface proteins that can be used for cell classification, or to distinguish healthy and disease conditions. A method capable of profiling a substantial fraction of the surface proteome simultaneously and inexpensively would enable more accurate and complete classification of cell states. We present a highly multiplexed and quantitative surface proteomic method using genetically barcoded antibodies called phage-antibody next-generation sequencing (PhaNGS). Using 144 preselected antibodies displayed on filamentous phage (Fab-phage) against 44 receptor targets, we assess changes in B cell surface proteins after the development of drug resistance in a patient with acute lymphoblastic leukemia (ALL) and in adaptation to oncogene expression in a Myc-inducible Burkitt lymphoma model. We further show PhaNGS can be applied at the single-cell level. Our results reveal that a common set of proteins including FLT3, NCR3LG1, and ROR1 dominate the response to similar oncogenic perturbations in B cells. Linking high-affinity, selective, genetically encoded binders to NGS enables direct and highly multiplexed protein detection, comparable to RNA-sequencing for mRNA. PhaNGS has the potential to profile a substantial fraction of the surface proteome simultaneously and inexpensively to enable more accurate and complete classification of cell states. Copyright © 2018 the Author(s). Published by PNAS.

  2. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  3. Native Liquid Extraction Surface Analysis Mass Spectrometry: Analysis of Noncovalent Protein Complexes Directly from Dried Substrates

    Science.gov (United States)

    Martin, Nicholas J.; Griffiths, Rian L.; Edwards, Rebecca L.; Cooper, Helen J.

    2015-08-01

    Liquid extraction surface analysis (LESA) mass spectrometry is a promising tool for the analysis of intact proteins from biological substrates. Here, we demonstrate native LESA mass spectrometry of noncovalent protein complexes of myoglobin and hemoglobin from a range of surfaces. Holomyoglobin, in which apomyoglobin is noncovalently bound to the prosthetic heme group, was observed following LESA mass spectrometry of myoglobin dried onto glass and polyvinylidene fluoride surfaces. Tetrameric hemoglobin [(αβ)2 4H] was observed following LESA mass spectrometry of hemoglobin dried onto glass and polyvinylidene fluoride (PVDF) surfaces, and from dried blood spots (DBS) on filter paper. Heme-bound dimers and monomers were also observed. The `contact' LESA approach was particularly suitable for the analysis of hemoglobin tetramers from DBS.

  4. Origin of cell surface proteins released from Micrococcus radiodurans by ionizing radiation

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.

    1975-01-01

    The exposure of Micrococcus radiodurans to sublethal doses of ionizing radiation causes the release of certain proteins into the surrounding medium. As estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, these proteins range from approximately 20,000 to 125,000 daltons. At least some of the proteins, including an exonuclease, have a surface location and appear to originate from the lipid-rich midwall layer. The exonuclease has two functionally distinct locations, one with its active site available to external substrate and a second with the active site masked from the exterior. Ionizing radiation releases both the masked and unmasked activity into the surrounding medium

  5. TGP, an extremely stable, non-aggregating fluorescent protein created by structure-guided surface engineering

    OpenAIRE

    Close, Devin W.; Don Paul, Craig; Langan, Patricia S.; Wilce, Matthew C.J.; Traore, Daouda A.K.; Halfmann, Randal; Rocha, Reginaldo C.; Waldo, Geoffery S.; Payne, Riley J.; Rucker, Joseph B.; Prescott, Mark; Bradbury, Andrew R.M.

    2015-01-01

    In this paper we describe the engineering and X-ray crystal structure of Thermal Green Protein (TGP), an extremely stable, highly soluble, non-aggregating green fluorescent protein. TGP is a soluble variant of the fluorescent protein eCGP123, which despite being highly stable, has proven to be aggregation-prone. The X-ray crystal structure of eCGP123, also determined within the context of this paper, was used to carry out rational surface engineering to improve its solubility, leading to TGP....

  6. Predicting Ligand Binding Sites on Protein Surfaces by 3-Dimensional Probability Density Distributions of Interacting Atoms

    Science.gov (United States)

    Jian, Jhih-Wei; Elumalai, Pavadai; Pitti, Thejkiran; Wu, Chih Yuan; Tsai, Keng-Chang; Chang, Jeng-Yih; Peng, Hung-Pin; Yang, An-Suei

    2016-01-01

    Predicting ligand binding sites (LBSs) on protein structures, which are obtained either from experimental or computational methods, is a useful first step in functional annotation or structure-based drug design for the protein structures. In this work, the structure-based machine learning algorithm ISMBLab-LIG was developed to predict LBSs on protein surfaces with input attributes derived from the three-dimensional probability density maps of interacting atoms, which were reconstructed on the query protein surfaces and were relatively insensitive to local conformational variations of the tentative ligand binding sites. The prediction accuracy of the ISMBLab-LIG predictors is comparable to that of the best LBS predictors benchmarked on several well-established testing datasets. More importantly, the ISMBLab-LIG algorithm has substantial tolerance to the prediction uncertainties of computationally derived protein structure models. As such, the method is particularly useful for predicting LBSs not only on experimental protein structures without known LBS templates in the database but also on computationally predicted model protein structures with structural uncertainties in the tentative ligand binding sites. PMID:27513851

  7. A Genetically Encoded pH Sensor for Tracking Surface Proteins through Endocytosis**

    OpenAIRE

    Grover, Anmol; Schmidt, Brigitte F.; Salter, Russell D.; Watkins, Simon C.; Waggoner, Alan S.; Bruchez, Marcel P.

    2012-01-01

    We have combined our fluorogen activating peptide[1] with a new tandem dye molecule to develop a biosensor that labels a cell-surface protein and displays an easily detectable pH dependent emission color change by efficient intramolecular Förster resonant energy transfer. This probe has demonstrated pH variations in β2-adrenergic receptor trafficking and revealed a process of surface to endosome inter-cellular transfer in dendritic cells with potential significance in antigen transfer.

  8. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  9. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  10. Detection of vitamin D binding protein on the surface of cytotrophoblasts isolated from human placentae

    International Nuclear Information System (INIS)

    Nestler, J.E.; McLeod, J.F.; Kowalski, M.A.; Strauss, J.F. III; Haddad, J.G. Jr.

    1987-01-01

    Vitamin D binding protein (DBP), a Mr 56,000-58,000 alpha 2-glycoprotein, is the major serum protein involved in the transport of vitamin D sterols. Recently it has been suggested that DBP may also be involved in immunoglobulin G binding to cells. Because the trophoblast is involved in the transport of molecules such as vitamin D and immunoglobulin G to the fetus, we asked whether DBP could be detected on the surface of human placental trophoblast cells. Cytotrophoblasts purified from human term placentae were fixed and made permeant with Triton X-100 and examined by indirect immunofluorescence after incubation with a monoclonal antibody to DBP. Greater than 90% of these cells stained positively, whereas no staining was observed with nonimmune antiserum. The presence of DBP on/in the surface of cytotrophoblasts could also be demonstrated by fluorescent cytometry. When cell surface-associated proteins of cytotrophoblasts were radioiodinated, a Mr 57,000 radiolabeled protein could be immunoisolated from the cell lysate with a purified monospecific polyclonal antibody to DBP. Immunoisolation of this radiolabeled protein was prevented by the addition of excess unlabeled human DBP to the cell lysate before incubation with antibody. This Mr 57,000 radiolabeled protein could also be isolated by affinity chromatography selecting for proteins that bind to globular actin. When cytotrophoblasts were incubated with [ 35 S]methionine for 3 or 18 h, active synthesis of DBP could not be demonstrated by immunoisolation techniques. These studies demonstrate the presence of DBP on the surface of well washed, human cytotrophoblasts. This DBP may be maternally derived, since active synthesis of DBP could not be demonstrated

  11. Using extremely halophilic bacteria to understand the role of surface charge and surface hydration in protein evolution, folding, and function

    Science.gov (United States)

    Hoff, Wouter; Deole, Ratnakar; Osu Collaboration

    2013-03-01

    Halophilic Archaea accumulate molar concentrations of KCl in their cytoplasm as an osmoprotectant, and have evolved highly acidic proteomes that only function at high salinity. We examine osmoprotection in the photosynthetic Proteobacteria Halorhodospira halophila. We find that H. halophila has an acidic proteome and accumulates molar concentrations of KCl when grown in high salt media. Upon growth of H. halophila in low salt media, its cytoplasmic K + content matches that of Escherichia coli, revealing an acidic proteome that can function in the absence of high cytoplasmic salt concentrations. These findings necessitate a reassessment of two central aspects of theories for understanding extreme halophiles. We conclude that proteome acidity is not driven by stabilizing interactions between K + ions and acidic side chains, but by the need for maintaining sufficient solvation and hydration of the protein surface at high salinity through strongly hydrated carboxylates. We propose that obligate protein halophilicity is a non-adaptive property resulting from genetic drift in which constructive neutral evolution progressively incorporates weakly stabilizing K + binding sites on an increasingly acidic protein surface.

  12. Epididymosomes: transfer of fertility-modulating proteins to the sperm surface.

    Science.gov (United States)

    Martin-DeLeon, Patricia A

    2015-01-01

    A variety of glycosylphosphatidylinositol (GPI)-linked proteins are acquired on spermatozoa from epididymal luminal fluids (ELF) during sperm maturation. These proteins serve roles in immunoprotection and in key steps of fertilization such as capacitation, acrosomal exocytosis and sperm-egg interactions. Their acquisition on sperm cells is mediated both by membrane vesicles (epididymosomes, EP) which were first reported to dock on the sperm surface, and by lipid carriers which facilitate the transfer of proteins associated with the membrane-free fraction of ELF. While the nonvesicular fraction is more efficient, both pathways are dependent on hydrophobic interactions between the GPI-anchor and the external lipid layer of the sperm surface. More recently proteomic and hypothesis-driven studies have shown that EP from several mammals carry transmembrane (TM) proteins, including plasma membrane Ca 2 + -ATPase 4 (PMCA4). Synthesized in the testis, PMCA4 is an essential protein and the major Ca 2 + efflux pump in murine spermatozoa. Delivery of PMCA4 to spermatozoa from bovine and mouse EP during epididymal maturation and in vitro suggests that the docking of EP on the sperm surface precedes fusion, and experimental evidence supports a fusogenic mechanism for TM proteins. Fusion is facilitated by CD9, which generates fusion-competent sites on membranes. On the basis of knowledge of PMCA4's interacting partners a number of TM and membrane-associated proteins have been identified or are predicted to be present, in the epididymosomal cargo deliverable to spermatozoa. These Ca 2 + -dependent proteins, undetected in proteomic studies, play essential roles in sperm motility and fertility, and their detection highlights the usefulness of the hypothesis-driven approach.

  13. Epididymosomes: transfer of fertility-modulating proteins to the sperm surface

    Directory of Open Access Journals (Sweden)

    Patricia A Martin-DeLeon

    2015-01-01

    Full Text Available A variety of glycosylphosphatidylinositol (GPI-linked proteins are acquired on spermatozoa from epididymal luminal fluids (ELF during sperm maturation. These proteins serve roles in immunoprotection and in key steps of fertilization such as capacitation, acrosomal exocytosis and sperm-egg interactions. Their acquisition on sperm cells is mediated both by membrane vesicles (epididymosomes, EP which were first reported to dock on the sperm surface, and by lipid carriers which facilitate the transfer of proteins associated with the membrane-free fraction of ELF. While the nonvesicular fraction is more efficient, both pathways are dependent on hydrophobic interactions between the GPI-anchor and the external lipid layer of the sperm surface. More recently proteomic and hypothesis-driven studies have shown that EP from several mammals carry transmembrane (TM proteins, including plasma membrane Ca 2 + -ATPase 4 (PMCA4. Synthesized in the testis, PMCA4 is an essential protein and the major Ca 2 + efflux pump in murine spermatozoa. Delivery of PMCA4 to spermatozoa from bovine and mouse EP during epididymal maturation and in vitro suggests that the docking of EP on the sperm surface precedes fusion, and experimental evidence supports a fusogenic mechanism for TM proteins. Fusion is facilitated by CD9, which generates fusion-competent sites on membranes. On the basis of knowledge of PMCA4′s interacting partners a number of TM and membrane-associated proteins have been identified or are predicted to be present, in the epididymosomal cargo deliverable to spermatozoa. These Ca 2 + -dependent proteins, undetected in proteomic studies, play essential roles in sperm motility and fertility, and their detection highlights the usefulness of the hypothesis-driven approach.

  14. Overexpression of human virus surface glycoprotein precursors induces cytosolic unfolded protein response in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Sasnauskas Kęstutis

    2011-05-01

    Full Text Available Abstract Background The expression of human virus surface proteins, as well as other mammalian glycoproteins, is much more efficient in cells of higher eukaryotes rather than yeasts. The limitations to high-level expression of active viral surface glycoproteins in yeast are not well understood. To identify possible bottlenecks we performed a detailed study on overexpression of recombinant mumps hemagglutinin-neuraminidase (MuHN and measles hemagglutinin (MeH in yeast Saccharomyces cerevisiae, combining the analysis of recombinant proteins with a proteomic approach. Results Overexpressed recombinant MuHN and MeH proteins were present in large aggregates, were inactive and totally insoluble under native conditions. Moreover, the majority of recombinant protein was found in immature form of non-glycosylated precursors. Fractionation of yeast lysates revealed that the core of viral surface protein aggregates consists of MuHN or MeH disulfide-linked multimers involving eukaryotic translation elongation factor 1A (eEF1A and is closely associated with small heat shock proteins (sHsps that can be removed only under denaturing conditions. Complexes of large Hsps seem to be bound to aggregate core peripherally as they can be easily removed at high salt concentrations. Proteomic analysis revealed that the accumulation of unglycosylated viral protein precursors results in specific cytosolic unfolded protein response (UPR-Cyto in yeast cells, characterized by different action and regulation of small Hsps versus large chaperones of Hsp70, Hsp90 and Hsp110 families. In contrast to most environmental stresses, in the response to synthesis of recombinant MuHN and MeH, only the large Hsps were upregulated whereas sHsps were not. Interestingly, the amount of eEF1A was also increased during this stress response. Conclusions Inefficient translocation of MuHN and MeH precursors through ER membrane is a bottleneck for high-level expression in yeast. Overexpression of

  15. Mapping Hydrophobicity on the Protein Molecular Surface at Atom-Level Resolution

    Science.gov (United States)

    Nicolau Jr., Dan V.; Paszek, Ewa; Fulga, Florin; Nicolau, Dan V.

    2014-01-01

    A precise representation of the spatial distribution of hydrophobicity, hydrophilicity and charges on the molecular surface of proteins is critical for the understanding of the interaction with small molecules and larger systems. The representation of hydrophobicity is rarely done at atom-level, as this property is generally assigned to residues. A new methodology for the derivation of atomic hydrophobicity from any amino acid-based hydrophobicity scale was used to derive 8 sets of atomic hydrophobicities, one of which was used to generate the molecular surfaces for 35 proteins with convex structures, 5 of which, i.e., lysozyme, ribonuclease, hemoglobin, albumin and IgG, have been analyzed in more detail. Sets of the molecular surfaces of the model proteins have been constructed using spherical probes with increasingly large radii, from 1.4 to 20 Å, followed by the quantification of (i) the surface hydrophobicity; (ii) their respective molecular surface areas, i.e., total, hydrophilic and hydrophobic area; and (iii) their relative densities, i.e., divided by the total molecular area; or specific densities, i.e., divided by property-specific area. Compared with the amino acid-based formalism, the atom-level description reveals molecular surfaces which (i) present an approximately two times more hydrophilic areas; with (ii) less extended, but between 2 to 5 times more intense hydrophilic patches; and (iii) 3 to 20 times more extended hydrophobic areas. The hydrophobic areas are also approximately 2 times more hydrophobicity-intense. This, more pronounced “leopard skin”-like, design of the protein molecular surface has been confirmed by comparing the results for a restricted set of homologous proteins, i.e., hemoglobins diverging by only one residue (Trp37). These results suggest that the representation of hydrophobicity on the protein molecular surfaces at atom-level resolution, coupled with the probing of the molecular surface at different geometric resolutions

  16. Surface plasmon resonance biosensor for parallelized detection of protein biomarkers in diluted blood plasma

    Czech Academy of Sciences Publication Activity Database

    Piliarik, Marek; Bocková, Markéta; Homola, Jiří

    2010-01-01

    Roč. 26, č. 4 (2010), s. 1656-1661 ISSN 0956-5663 R&D Projects: GA AV ČR KAN200670701 Institutional research plan: CEZ:AV0Z20670512 Keywords : Surface plasmon resonance * Protein array * Cancer marker Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 5.361, year: 2010

  17. Preparation and recognition of surface molecularly imprinted core-shell microbeads for protein in aqueous solutions

    International Nuclear Information System (INIS)

    Lu Yan; Yan Changling; Gao Shuyan

    2009-01-01

    In this paper, a surface molecular imprinting technique was reported for preparing core-shell microbeads of protein imprinting, and bovine hemoglobin or bovine serum albumin were used as model proteins for studying the imprinted core-shell microbeads. 3-Aminophenylboronic acid (APBA) was polymerized onto the surface of polystyrene microbead in the presence of the protein templates to create protein-imprinted core-shell microbeads. The various samples were characterized using scanning electron microscopy (SEM), transmission electron microscopy (TEM), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS) and Brunauer-Emmett-Teller (BET) methods. The effect of pH on rebinding of the template hemoglobin, the specific binding and selective recognition were studied for the imprinted microbeads. The results show that the bovine hemoglobin-imprinted core-shell microbeads were successfully created. The shell was a sort of imprinted thin films with porous structure and larger surface areas. The imprinted microbeads have good selectivity for templates and high stability. Due to the recognition sites locating at or closing to the surface, these imprinted microbeads have good property of mass-transport. Unfortunately, the imprint technology was not successfully applied to imprinting bovine serum albumin (BSA).

  18. Analysis of the lipidated recombinant outer surface protein A from Borrelia burgdorferi by mass spectrometry

    NARCIS (Netherlands)

    Bouchon, B.; Klein, Michele; Bischoff, Rainer; Van Dorsselaer, A.; Roitsch, C.

    1997-01-01

    The outer surface protein A, OspA, from the spirochete Borrelia burgdorferi is a lipoprotein of 25 kDa. The recombinant OspA (rOspA) expressed in Escherichia coli has been purified and analyzed by electrospray mass spectrometry (ESMS). A heterogenous spectrum gave a measured mass of 28,462 +/- 9 Da

  19. Dynamics of Agglutinin-Like Sequence (ALS) Protein Localization on the Surface of Candida Albicans

    Science.gov (United States)

    Coleman, David Andrew

    2009-01-01

    The ALS gene family encodes large cell-surface glycoproteins associated with "C. albicans" pathogenesis. Als proteins are thought to act as adhesin molecules binding to host tissues. Wide variation in expression levels among the ALS genes exists and is related to cell morphology and environmental conditions. "ALS1," "ALS3," and "ALS4" are three of…

  20. Functionalization of SU-8 photoresist surfaces with IgG proteins

    International Nuclear Information System (INIS)

    Blagoi, Gabriela; Keller, Stephan; Johansson, Alicia; Boisen, Anja; Dufva, Martin

    2008-01-01

    The negative epoxy-based photoresist SU-8 has a variety of applications within microelectromechanical systems (MEMS) and lab-on-a-chip systems. Here, several methods to functionalize SU-8 surfaces with IgG proteins were investigated. Fluorescent labeled proteins and fluorescent sandwich immunoassays were employed to characterize the binding efficiency of model proteins to bare SU-8 surface, SU-8 treated with cerium ammonium nitrate (CAN) etchant and CAN treated surfaces modified by aminosilanization. The highest binding capacity of antibodies was observed on bare SU-8. This explains why bare SU-8 in a functional fluorescent sandwich immunoassay detecting C-reactive protein (CRP) gave twice as high signal as compared with the other two surfaces. Immunoassays performed on bare SU-8 and CAN treated SU-8 resulted in detection limits of CRP of 30 and 80 ng/ml respectively which is sufficient for detecting CRP in clinical samples, where concentrations of 3-10 μg/ml are normal for healthy individuals. In conclusion, bare SU-8 and etched SU-8 can be modified with antibodies by a simple adsorption procedure which simplifies building lab-on-a-chip systems in SU-8. Additionally, we report the fabrication process and use of microwells created in a SU-8 layer with the same dimensions as a standard microscope glass slide that could fit into fluorescent scanners. The SU-8 microwells minimize the reagent consumption and are straightforward to handle compared to SU-8 coated microscope slides

  1. Non-invasive high throughput approach for protein hydrophobicity determination based on surface tension.

    Science.gov (United States)

    Amrhein, Sven; Bauer, Katharina Christin; Galm, Lara; Hubbuch, Jürgen

    2015-12-01

    The surface hydrophobicity of a protein is an important factor for its interactions in solution and thus the outcome of its production process. Yet most of the methods are not able to evaluate the influence of these hydrophobic interactions under natural conditions. In the present work we have established a high resolution stalagmometric method for surface tension determination on a liquid handling station, which can cope with accuracy as well as high throughput requirements. Surface tensions could be derived with a low sample consumption (800 μL) and a high reproducibility (content. The protein influence on the solutions' surface tension was correlated to the hydrophobicity of lysozyme, human lysozyme, BSA, and α-lactalbumin. Differences in proteins' hydrophobic character depending on pH and species could be resolved. Within this work we have developed a pH dependent hydrophobicity ranking, which was found to be in good agreement with literature. For the studied pH range of 3-9 lysozyme from chicken egg white was identified to be the most hydrophilic. α-lactalbumin at pH 3 exhibited the most pronounced hydrophobic character. The stalagmometric method occurred to outclass the widely used spectrophotometric method with bromophenol blue sodium salt as it gave reasonable results without restrictions on pH and protein species. © 2015 Wiley Periodicals, Inc.

  2. Enterococcal surface protein transiently aggravates Enterococcus faecium-induced urinary tract infection in mice

    NARCIS (Netherlands)

    Leendertse, Masja; Heikens, Esther; Wijnands, Lucas M.; van Luit-Asbroek, Miranda; Teske, Gwendoline J. D.; Roelofs, Joris J. T. H.; Bonten, Marc J. M.; van der Poll, Tom; Willems, Rob J. L.

    2009-01-01

    The role that the enterococcal surface protein Esp plays in the capacity of Enterococcus faecium to adhere to uroepithelial cells and the role that it plays in urinary tract infection and peritonitis was investigated in vitro and in vivo, respectively, using Esp-expressing E. faecium (E1162) and its

  3. Preparation and recognition of surface molecularly imprinted core-shell microbeads for protein in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Lu Yan, E-mail: yanlu2001@sohu.com [College of Chemistry and Environmental Science, Henan Normal University, 46 Jlanshe Road, Xinxiang 453007 (China); Yan Changling; Gao Shuyan [College of Chemistry and Environmental Science, Henan Normal University, 46 Jlanshe Road, Xinxiang 453007 (China)

    2009-04-01

    In this paper, a surface molecular imprinting technique was reported for preparing core-shell microbeads of protein imprinting, and bovine hemoglobin or bovine serum albumin were used as model proteins for studying the imprinted core-shell microbeads. 3-Aminophenylboronic acid (APBA) was polymerized onto the surface of polystyrene microbead in the presence of the protein templates to create protein-imprinted core-shell microbeads. The various samples were characterized using scanning electron microscopy (SEM), transmission electron microscopy (TEM), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS) and Brunauer-Emmett-Teller (BET) methods. The effect of pH on rebinding of the template hemoglobin, the specific binding and selective recognition were studied for the imprinted microbeads. The results show that the bovine hemoglobin-imprinted core-shell microbeads were successfully created. The shell was a sort of imprinted thin films with porous structure and larger surface areas. The imprinted microbeads have good selectivity for templates and high stability. Due to the recognition sites locating at or closing to the surface, these imprinted microbeads have good property of mass-transport. Unfortunately, the imprint technology was not successfully applied to imprinting bovine serum albumin (BSA).

  4. Surface N-glycoproteome patterns reveal key proteins of neuronal differentiation

    Czech Academy of Sciences Publication Activity Database

    Tylečková, Jiřina; Valeková, Ivona; Žižková, Martina; Rákocyová, Michaela; Maršala, S.; Maršala, M.; Gadher, S. J.; Kovářová, Hana

    2016-01-01

    Roč. 132, č. 1 (2016), s. 13-20 ISSN 1874-3919 R&D Projects: GA MŠk ED2.1.00/03.0124; GA TA ČR(CZ) TA01011466 Institutional support: RVO:67985904 Keywords : cell adhesion proteins * cell surface capture * neuronal differentiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.914, year: 2016

  5. Surface (glyco-)proteins: primary structure and crystallization under microgravity conditions

    Science.gov (United States)

    Claus, H.; Akca, E.; Schultz, N.; Karbach, G.; Schlott, B.; Debaerdemaeker, T.; De Clercq, J.-P.; König, H.

    2001-08-01

    The Archaea comprise microorganisms that live under environmental extremes, like high temperature, low pH value or high salt concentration. Their cells are often covered by a single layer of (glyco)protein subunits (S-layer) in hexagonal arrangement. In order to get further hints about the molecular mechanisms of protein stabilization we compared the primary and secondary structures of archaeal S-layer (glyco)proteins. We found an increase of charged amino acids in the S-layer proteins of the extreme thermophilic species compared to their mesophilic counterparts. Our data and those of other authors suggest that ionic interactions, e.g., salt bridges seem to be played a major role in protein stabilization at high temperatures. Despite the differences in the growth optima and the predominance of some amino acids the primary structures of S-layers revealed also a significant degree of identity between phylogenetically related archaea. These obervations indicate that protein sequences of S-layers have been conserved during the evolution from extremely thermophilic to mesophilic life. To support these findings the three-dimensional structure of the S-layer proteins has to be elucidated. Recently, we described the first successful crystallization of an extreme thermophilic surface(glyco)protein under microgravity conditions.

  6. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  7. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  8. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  9. Exploring the Plant–Microbe Interface by Profiling the Surface-Associated Proteins of Barley Grains

    DEFF Research Database (Denmark)

    Sultan, Abida; Andersen, Birgit; Svensson, Birte

    2016-01-01

    Cereal grains are colonized by a microbial community that actively interacts with the plant via secretion of various enzymes, hormones, and metabolites. Microorganisms decompose plant tissues by a collection of depolymerizing enzymes, including β-1,4-xylanases, that are in turn inhibited by plant...... xylanase inhibitors. To gain insight into the importance of the microbial consortia and their interaction with barley grains, we used a combined gel-based (2-DE coupled to MALDI-TOF-TOF MS) and gel-free (LC–MS/MS) proteomics approach complemented with enzyme activity assays to profile the surface......-associated proteins and xylanolytic activities of two barley cultivars. The surface-associated proteome was dominated by plant proteins with roles in defense and stress-responses, while the relatively less abundant microbial (bacterial and fungal) proteins were involved in cell-wall and polysaccharide degradation...

  10. Fluorescent proteins as efficient tools for evaluating the surface PEGylation of silica nanoparticles

    Science.gov (United States)

    Zhang, Wei; Ma, Minyan; Zhang, Xiao-ai; Zhang, Ze-yu; Saleh, Sayed M.; Wang, Xu-dong

    2017-06-01

    Surface PEGylation is essential for preventing non-specific binding of biomolecules when silica nanoparticles are utilized for in vivo applications. Methods for installing poly(ethylene glycol) on a silica surface have been widely explored but varies from study to study. Because there is a lack of a satisfactory method for evaluating the properties of silica surface after PEGylation, the prepared nanoparticles are not fully characterized before use. In some cases, even non-PEGylated silica nanoparticles were produced, which is unfortunately not recognized by the end-user. In this work, a fluorescent protein was employed, which acts as a sensitive material for evaluating the surface protein adsorption properties of silica nanoparticles. Eleven different methods were systematically investigated for their reaction efficiency towards surface PEGylation. Results showed that both reaction conditions (including pH, catalyst) and surface functional groups of parent silica nanoparticles play critical roles in producing fully PEGylated silica nanoparticles. Great care needs to be taken in choosing the proper coupling chemistry for surface PEGylation. The data and method shown here will guarantee high-quality PEGylated silica nanoparticles to be produced and guide their applications in biology, chemistry, industry and medicine.

  11. Identification of sporozoite surface proteins and antigens of Eimeria nieschulzi (Apicomplexa)

    International Nuclear Information System (INIS)

    Tilley, M.; Upton, S.J.

    1990-01-01

    Sodium dodecyl sulfate polyacrylamide gel electrophoresis, immunoblotting, lectin binding, and 125 I surface labeling of sporozoites were used to probe sporozoites of the rat coccidian, Eimeria nieschulzi. Analysis of silver stained gels revealed greater than 50 bands. Surface iodination revealed about 14 well labeled, and about 10 weakly labeled but potential, surface proteins. The most heavily labeled surface proteins had molecular masses of 60, 53-54, 45, 28, 23-24, 17, 15, 14, 13, and 12 kD. Following electrophoresis and Western blotting, 2 of the 12 125I labeled lectin probes bound to two bands on the blots, which collectively indicated that two bands were glycosylated. Concanavalin A (ConA) specifically recognized a band at 53 kD, which may represent a surface glycoprotein, and a lectin derived from Osage orange (MPA) bound to a single band at 82-88 kD, that may also be a surface molecule. Immunoblotting using sera collected from rats inoculated orally with oocysts, as well as sera from mice hyperimmunized with sporozoites, revealed that many surface molecules appear to be immunogenic

  12. THE SURFACE-MEDIATED UNFOLDING KINETICS OF GLOBULAR PROTEINS IS DEPENDENT ON MOLECULAR WEIGHT AND TEMPERATURE

    Energy Technology Data Exchange (ETDEWEB)

    Patananan, A.N.; Goheen, S.C.

    2008-01-01

    The adsorption and unfolding pathways of proteins on rigid surfaces are essential in numerous complex processes associated with biomedical engineering, nanotechnology, and chromatography. It is now well accepted that the kinetics of unfolding are characterized by chemical and physical interactions dependent on protein deformability and structure, as well as environmental pH, temperature, and surface chemistry. Although this fundamental process has broad implications in medicine and industry, little is known about the mechanism because of the atomic lengths and rapid time scales involved. Therefore, the unfolding kinetics of myoglobin, β-glucosidase, and ovalbumin were investigated by adsorbing the globular proteins to non-porous cationic polymer beads. The protein fractions were adsorbed at different residence times (0, 9, 10, 20, and 30 min) at near-physiological conditions using a gradient elution system similar to that in high-performance liquid chromatography. The elution profi les and retention times were obtained by ultraviolet/visible spectrophotometry. A decrease in recovery was observed with time for almost all proteins and was attributed to irreversible protein unfolding on the non-porous surfaces. These data, and those of previous studies, fi t a positively increasing linear trend between percent unfolding after a fi xed (9 min) residence time (71.8%, 31.1%, and 32.1% of myoglobin, β-glucosidase, and ovalbumin, respectively) and molecular weight. Of all the proteins examined so far, only myoglobin deviated from this trend with higher than predicted unfolding rates. Myoglobin also exhibited an increase in retention time over a wide temperature range (0°C and 55°C, 4.39 min and 5.74 min, respectively) whereas ovalbumin and β-glucosidase did not. Further studies using a larger set of proteins are required to better understand the physiological and physiochemical implications of protein unfolding kinetics. This study confi rms that surface

  13. Nucleolin: acharan sulfate–binding protein on the surface of cancer cells

    Science.gov (United States)

    Joo, Eun Ji; ten Dam, Gerdy B.; van Kuppevelt, Toin H.; Toida, Toshihiko; Linhardt, Robert J.; Kim, Yeong Shik

    2005-01-01

    Glycosaminoglycans (GAGs) are complex polysaccharides that participate in the regulation of physiological processes through the interactions with a wide variety of proteins. Acharan sulfate (AS), isolated from the giant African snail Achatina fulica, primarily consists of the repeating disaccharide structure α-D-N-acetylglucosaminyl (1→4) 2-sulfoiduronic acid. Exogenous AS was injected subcutaneously near the tumor tissue in C57BL/6 mice that had been implanted with Lewis lung carcinoma cells (LLCs). The location of AS in the tumor was assessed by staining of sectioned tissues with alcian blue and periodic acid–Schiff (PAS) reagent. In vitro assays indicated binding of cells to 50 μg/ml AS (or heparin) after a 5-h incubation. Immunofluorescence assays, using anti-AS antibody, detected AS at the cell surface. The outer-surface of LLCs were next biotinylated to identify the AS-binding proteins. Biotinylated cells were lysed, and the lysates were fractionated on the AS affinity column using a stepwise salt gradient (0, 0.1, 0.3, 0.5, 0.7, 1.0, and 2.0 M). The fractions were analyzed by SDS–PAGE with silver staining and western blotting. We focused on the proteins with high affinity for AS (eluting at 1 M NaCl) and detected only two bands by western blotting. ESI Q-TOF MS analysis of one of these bands, molecular weight ~110 kDa, showed it to be nucleolin. A phosphorylated form of nucleolin on the surface of cells acts as a cell surface receptor for a variety of ligands, including growth factors (i.e., basic fibroblast growth factor) and chemokines (i.e., midkine). These results show that nucleolin is one of several AS-binding proteins and suggest that AS might demonstrate its tumor growth inhibitory activity by binding the nucleolin receptor protein on the surface of cancer cells. PMID:15329357

  14. Templating Biomineralization: Surface Directed Protein Self-assembly and External Magnetic Field Stimulation of Osteoblasts

    Science.gov (United States)

    Ba, Xiaolan

    biomineralization is investigated by SEM, GIXRD and energy dispersive X-ray spectroscopy (EDXS). Gene expression during the exposure of SMF is also studies by RT-PCR. The results indicated that exposure to SMF induces osteoblasts to produce larger quantities of HA, with higher degree of crystalline order. The controlling and understanding of protein on the surface is of great interest in biomedical application such as implant medicine, biosensor design, food processing, and chromatographic separations. The adsorbed protein onto the surface significantly determines the performance of biomaterials in a biological environment. Recent studies have suggested that the preservation of the native secondary structure of protein adsorbed is essential for biological application. In order to manipulate protein adsorption and design biocompatible materials, the mechanisms underlying protein-surface interactions, especially how surface properties of materials induce conformational changes of adsorbed proteins, needs to be well understood. Here we demonstrated that even though SPS is a necessary condition, it is not sufficient. We show that low substrate conductivity as well as proper salt concentration are also critical in sustained protein adsorption continuously. These factors allow one to pattern regions of different conducting properties and for the first time patterns physiologically relevant protein structures. Here we show that we can achieve patterned biomineralized regimes, both with plasma proteins in a simple and robust manner without additional functionalization or application of electrochemical gradients. Since the data indicate that the patterns just need to differ in electrical conductivity, rather than surface chemistry, we propose that the creation of transient image charges, due to incomplete charge screening, may be responsible for sustain the driving force for continual protein absorption.

  15. Functionalization of SU-8 Photoresist Surfaces with IgG Proteins

    DEFF Research Database (Denmark)

    Blagoi, Gabriela; Keller, Stephan Urs; Johansson, Alicia

    2008-01-01

    immunoassays were employed to characterize the binding efficiency of model proteins to bare SU-8 surface, SU-8 treated with cerium ammonium nitrate (CAN) etchant and CAN treated surfaces modified by aminosilanization. The highest binding capacity of antibodies was observed on bare SU-8. This explains why bare...... SU-8 in a functional fluorescent sandwich immunoassay detecting C-reactive protein (CRP) gave twice as high signal as compared with the other two surfaces. Immunoassays performed on bare SU-8 and CAN treated SU-8 resulted in detection limits of CRP of 30 and 80 ng/ml respectively which is sufficient...... for detecting CRP in clinical samples, where concentrations of 3–10 μg/ml are normal for healthy individuals. In conclusion, bare SU-8 and etched SU-8 can be modified with antibodies by a simple adsorption procedure which simplifies building lab-on-a-chip systems in SU-8. Additionally, we report the fabrication...

  16. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  17. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  18. Analysis of Pseudomonas aeruginosa Cell Envelope Proteome by Capture of Surface-Exposed Proteins on Activated Magnetic Nanoparticles

    OpenAIRE

    Vecchietti, Davide; Di Silvestre, Dario; Miriani, Matteo; Bonomi, Francesco; Marengo, Mauro; Bragonzi, Alessandra; Cova, Lara; Franceschi, Eleonora; Mauri, Pierluigi; Bertoni, Giovanni

    2012-01-01

    We report on specific magneto-capturing followed by Multidimensional Protein Identification Technology (MudPIT) for the analysis of surface-exposed proteins of intact cells of the bacterial opportunistic pathogen Pseudomonas aeruginosa. The magneto-separation of cell envelope fragments from the soluble cytoplasmic fraction allowed the MudPIT identification of the captured and neighboring proteins. Remarkably, we identified 63 proteins captured directly by nanoparticles and 67 proteins embedde...

  19. Monitoring glycolipid transfer protein activity and membrane interaction with the surface plasmon resonance technique.

    Science.gov (United States)

    Ohvo-Rekilä, Henna; Mattjus, Peter

    2011-01-01

    The glycolipid transfer protein (GLTP) is a protein capable of binding and transferring glycolipids. GLTP is cytosolic and it can interact through its FFAT-like (two phenylalanines in an acidic tract) motif with proteins localized on the surface of the endoplasmic reticulum. Previous in vitro work with GLTP has focused mainly on the complete transfer reaction of the protein, that is, binding and subsequent removal of the glycolipid from the donor membrane, transfer through the aqueous environment, and the final release of the glycolipid to an acceptor membrane. Using bilayer vesicles and surface plasmon resonance spectroscopy, we have now, for the first time, analyzed the binding and lipid removal capacity of GLTP with a completely label-free technique. This technique is focused on the initial steps in GLTP-mediated transfer and the parameters affecting these steps can be more precisely determined. We used the new approach for detailed structure-function studies of GLTP by examining the glycolipid transfer capacity of specific GLTP tryptophan mutants. Tryptophan 96 is crucial for the transfer activity of the protein and tryptophan 142 is an important part of the proteins membrane interacting domain. Further, we varied the composition of the used lipid vesicles and gained information on the effect of membrane properties on GLTP activity. GLTP prefers to interact with more tightly packed membranes, although GLTP-mediated transfer is faster from more fluid membranes. This technique is very useful for the study of membrane-protein interactions and lipid-transfer rates and it can easily be adapted to other membrane-interacting proteins. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  1. Bacterial surface layer proteins as a novel capillary coating material for capillary electrophoretic separations

    Energy Technology Data Exchange (ETDEWEB)

    Moreno-Gordaliza, Estefanía, E-mail: emorenog@ucm.es [Division of Analytical Biosciences, Leiden Academic Centre for Drug Research, Universiteit Leiden, Einsteinweg 55, 2300, RA, Leiden (Netherlands); Department of Analytical Chemistry, Faculty of Chemistry, Universidad Complutense de Madrid, Avda. Complutense s/n, 28040, Madrid (Spain); Stigter, Edwin C.A. [Division of Analytical Biosciences, Leiden Academic Centre for Drug Research, Universiteit Leiden, Einsteinweg 55, 2300, RA, Leiden (Netherlands); Department of Molecular Cancer Research, Universitair Medisch Centrum Utrecht, Wilhelmina Kinder Ziekenhuis, Lundlaan 6, 3584, EA Utrecht (Netherlands); Lindenburg, Petrus W.; Hankemeier, Thomas [Division of Analytical Biosciences, Leiden Academic Centre for Drug Research, Universiteit Leiden, Einsteinweg 55, 2300, RA, Leiden (Netherlands)

    2016-06-07

    A novel concept for stable coating in capillary electrophoresis, based on recrystallization of surface layer proteins on hydrophobized fused silica capillaries, was demonstrated. Surface layer protein A (SlpA) from Lactobacillus acidophilus bacteria was extracted, purified and used for coating pre-silanized glass substrates presenting different surface wettabilities (either hydrophobic or hydrophilic). Contact angle determination on SlpA-coated hydrophobic silica slides showed that the surfaces turned to hydrophilic after coating (53 ± 5°), due to a protein monolayer formation by protein-surface hydrophobic interactions. Visualization by atomic force microscopy demonstrated the presence of a SlpA layer on methylated silica slides displaying a surface roughness of 0.44 ± 0.02 nm. Additionally, a protein layer was visualized by fluorescence microscopy in methylated silica capillaries coated with SlpA and fluorescein isothiocyanate-labeled. The SlpA-coating showed an outstanding stability, even after treatment with 20 mM NaOH (pH 12.3). The electroosmotic flow in coated capillaries showed a partial suppression at pH 7.50 (3.8 ± 0.5 10{sup −9} m{sup 2} V{sup −1} s{sup −1}) when compared with unmodified fused silica (5.9 ± 0.1 10{sup −8} m{sup 2} V{sup −1} s{sup −1}). To demonstrate the potential of this novel coating, the SlpA-coated capillaries were applied for the first time for electrophoretic separation, and proved to be very suitable for the isotachophoretic separation of lipoproteins in human serum. The separations showed a high degree of repeatability (absolute migration times with 1.1–1.8% coefficient-of-variation (CV) within a day) and 2–3% CV inter-capillary reproducibility. The capillaries were stable for more than 100 runs at pH 9.40, and showed to be an exceptional alternative for challenging electrophoretic separations at long-term use. - Highlights: • New coating using recrystallized surface-layer proteins on

  2. Tumor suppressor protein SMAR1 modulates the roughness of cell surface: combined AFM and SEM study

    Directory of Open Access Journals (Sweden)

    Mamgain Hitesh

    2009-10-01

    Full Text Available Abstract Background Imaging tools such as scanning electron microscope (SEM and atomic force microscope (AFM can be used to produce high-resolution topographic images of biomedical specimens and hence are well suited for imaging alterations in cell morphology. We have studied the correlation of SMAR1 expression with cell surface smoothness in cell lines as well as in different grades of human breast cancer and mouse tumor sections. Methods We validated knockdown and overexpression of SMAR1 using RT-PCR as well as Western blotting in human embryonic kidney (HEK 293, human breast cancer (MCF-7 and mouse melanoma (B16F1 cell lines. The samples were then processed for cell surface roughness studies using atomic force microscopy (AFM and scanning electron microscopy (SEM. The same samples were used for microarray analysis as well. Tumors sections from control and SMAR1 treated mice as well as tissues sections from different grades of human breast cancer on poly L-lysine coated slides were used for AFM and SEM studies. Results Tumor sections from mice injected with melanoma cells showed pronounced surface roughness. In contrast, tumor sections obtained from nude mice that were first injected with melanoma cells followed by repeated injections of SMAR1-P44 peptide, exhibited relatively smoother surface profile. Interestingly, human breast cancer tissue sections that showed reduced SMAR1 expression exhibited increased surface roughness compared to the adjacent normal breast tissue. Our AFM data establishes that treatment of cells with SMAR1-P44 results into increase in cytoskeletal volume that is supported by comparative gene expression data showing an increase in the expression of specific cytoskeletal proteins compared to the control cells. Altogether, these findings indicate that tumor suppressor function of SMAR1 might be exhibited through smoothening of cell surface by regulating expression of cell surface proteins. Conclusion Tumor suppressor

  3. Surface Proteins of Lactococcus lactis: Bacterial Resources for Muco-adhesion in the Gastrointestinal Tract

    Directory of Open Access Journals (Sweden)

    Muriel Mercier-Bonin

    2017-11-01

    Full Text Available Food and probiotic bacteria, in particular lactic acid bacteria, are ingested in large amounts by humans and are part of the transient microbiota which is increasingly considered to be able to impact the resident microbiota and thus possibly the host health. The lactic acid bacterium Lactococcus lactis is extensively used in starter cultures to produce dairy fermented food. Also because of a generally recognized as safe status, L. lactis has been considered as a possible vehicle to deliver in vivo therapeutic molecules with anti-inflammatory properties in the gastrointestinal tract. One of the key factors that may favor health effects of beneficial bacteria to the host is their capacity to colonize transiently the gut, notably through close interactions with mucus, which covers and protects the intestinal epithelium. Several L. lactis strains have been shown to exhibit mucus-binding properties and bacterial surface proteins have been identified as key determinants of such capacity. In this review, we describe the different types of surface proteins found in L. lactis, with a special focus on mucus-binding proteins and pili. We also review the different approaches used to investigate the adhesion of L. lactis to mucus, and particularly to mucins, one of its major components, and we present how these approaches allowed revealing the role of surface proteins in muco-adhesion.

  4. Enhanced protein loading on a planar Si(111)-H surface with second generation NTA

    Science.gov (United States)

    Liu, Xiang; Han, Huan-Mei; Liu, Hong-Bo; Xiao, Shou-jun

    2010-08-01

    A Si(111)-H surface was modified via a direct reaction between Si-H and 1-undecylenic acid (UA) under microwave irradiation to form molecular monolayers with terminal carboxyl groups. After esterifying carboxylic acid being esterified with N-hydroxysuccinimide (NHS), aminobutyl nitrilotriacetic acid (ANTA) was bound to the silicon surface through amidation (pH = 8.0) between its primary amino group and NHS-ester, producing nitrilotriacetic acid (NTA) anions. Then hexa-histidine tagged thioredoxin-urodilatin (his-tagged protein) and FITC-labeled hexa-histidine tagged thioredoxin-urodilatin (FITC-his-tagged protein) can be anchored after NTA was coordinated with Ni 2+. Furthermore, the NTA-terminated chip was acidified with 0.1 M HCl and subsequently esterified with NHS and then amidated with ANTA again to produce a second generation NTA. Thus the surface density of nitrilotriacetic acid anions was improved and resultantly that of anchored proteins was also enhanced through the iterative reactions. Both multiple transmission-reflection infrared spectroscopy (MTR-IR) and fluorescence scanning measurements demonstrated a proximate 1.63 times of anchored proteins on the second generation NTA/Ni 2+ as that on the first generation NTA/Ni 2+ monolayer.

  5. Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

    Energy Technology Data Exchange (ETDEWEB)

    Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.; Liu, Corey W.; Nygaard, Rie; Rosenbaum, Daniel M.; Fung, Juan José; Choi, Hee-Jung; Thian, Foon Sun; Kobilka, Tong Sun; Puglisi, Joseph D.; Weis, William I.; Pardo, Leonardo; Prosser, R. Scott; Mueller, Luciano; Kobilka, Brian K. (Stanford-MED); (Toronto); (BMS); (UAB, Spain)

    2010-01-14

    G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the native ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.

  6. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  7. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  8. Impact of surface coating and food-mimicking media on nanosilver-protein interaction

    Energy Technology Data Exchange (ETDEWEB)

    Burcza, Anna, E-mail: anna.burcza@mri.bund.de; Gräf, Volker; Walz, Elke; Greiner, Ralf [Max Rubner-Institute, Department of Food Technology and Bioprocess Engineering (Germany)

    2015-11-15

    The application of silver nanoparticles (AgNPs) in food contact materials has recently become a subject of dispute due to the possible migration of silver in nanoform into foods and beverages. Therefore, the analysis of the interaction of AgNPs with food components, especially proteins, is of high importance in order to increase our knowledge of the behavior of nanoparticles in food matrices. AgPURE™ W10 (20 nm), an industrially applied nanomaterial, was compared with AgNPs of similar size frequently investigated for scientific purposes differing in the surface capping agent (spherical AgNP coated with either PVP or citrate). The interactions of the AgNPs with whey proteins (BSA, α-lactalbumin and β-lactoglobulin) at different pH values (4.2, 7 or 7.4) were investigated using surface plasmon resonance, SDS-PAGE, and asymmetric flow field-flow fractionation. The data obtained by the three different methods correlated well. Besides the nature of the protein and the nanoparticle coating, the environment was shown to affect the interaction significantly. The strongest interaction was obtained with BSA and AgNPs in an acidic environment. Neutral and slightly alkaline conditions however, seemed to prevent the AgNP-protein interaction almost completely. Furthermore, the interaction of whey proteins with AgPURE™ W10 was found to be weaker compared to the interaction with the other two AgNPs under all conditions investigated.

  9. Impact of surface coating and food-mimicking media on nanosilver-protein interaction

    International Nuclear Information System (INIS)

    Burcza, Anna; Gräf, Volker; Walz, Elke; Greiner, Ralf

    2015-01-01

    The application of silver nanoparticles (AgNPs) in food contact materials has recently become a subject of dispute due to the possible migration of silver in nanoform into foods and beverages. Therefore, the analysis of the interaction of AgNPs with food components, especially proteins, is of high importance in order to increase our knowledge of the behavior of nanoparticles in food matrices. AgPURE™ W10 (20 nm), an industrially applied nanomaterial, was compared with AgNPs of similar size frequently investigated for scientific purposes differing in the surface capping agent (spherical AgNP coated with either PVP or citrate). The interactions of the AgNPs with whey proteins (BSA, α-lactalbumin and β-lactoglobulin) at different pH values (4.2, 7 or 7.4) were investigated using surface plasmon resonance, SDS-PAGE, and asymmetric flow field-flow fractionation. The data obtained by the three different methods correlated well. Besides the nature of the protein and the nanoparticle coating, the environment was shown to affect the interaction significantly. The strongest interaction was obtained with BSA and AgNPs in an acidic environment. Neutral and slightly alkaline conditions however, seemed to prevent the AgNP-protein interaction almost completely. Furthermore, the interaction of whey proteins with AgPURE™ W10 was found to be weaker compared to the interaction with the other two AgNPs under all conditions investigated

  10. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  11. Surface displaced alfa-enolase of Lactobacillus plantarum is a fibronectin binding protein

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2009-02-01

    Full Text Available Abstract Background Lactic acid bacteria of the genus Lactobacillus and Bifidobacterium are one of the most important health promoting groups of the human intestinal microbiota. Their protective role within the gut consists in out competing invading pathogens for ecological niches and metabolic substrates. Among the features necessary to provide health benefits, commensal microorganisms must have the ability to adhere to human intestinal cells and consequently to colonize the gut. Studies on mechanisms mediating adhesion of lactobacilli to human intestinal cells showed that factors involved in the interaction vary mostly among different species and strains, mainly regarding interaction between bacterial adhesins and extracellular matrix or mucus proteins. We have investigated the adhesive properties of Lactobacillus plantarum, a member of the human microbiota of healthy individuals. Results We show the identification of a Lactobacillus plantarum LM3 cell surface protein (48 kDa, which specifically binds to human fibronectin (Fn, an extracellular matrix protein. By means of mass spectrometric analysis this protein was identified as the product of the L. plantarum enoA1 gene, coding the EnoA1 alfa-enolase. Surface localization of EnoA1 was proved by immune electron microscopy. In the mutant strain LM3-CC1, carrying the enoA1 null mutation, the 48 kDa adhesin was not anymore detectable neither by anti-enolase Western blot nor by Fn-overlay immunoblotting assay. Moreover, by an adhesion assay we show that LM3-CC1 cells bind to fibronectin-coated surfaces less efficiently than wild type cells, thus demonstrating the significance of the surface displaced EnoA1 protein for the L. plantarum LM3 adhesion to fibronectin. Conclusion Adhesion to host tissues represents a crucial early step in the colonization process of either pathogens or commensal bacteria. We demonstrated the involvement of the L. plantarum Eno A1 alfa-enolase in Fn-binding, by studying

  12. Rapid microscale in-gel processing and digestion of proteins using surface acoustic waves.

    Science.gov (United States)

    Kulkarni, Ketav P; Ramarathinam, Sri H; Friend, James; Yeo, Leslie; Purcell, Anthony W; Perlmutter, Patrick

    2010-06-21

    A new method for in-gel sample processing and tryptic digestion of proteins is described. Sample preparation, rehydration, in situ digestion and peptide extraction from gel slices are dramatically accelerated by treating the gel slice with surface acoustic waves (SAWs). Only 30 minutes total workflow time is required for this new method to produce base peak chromatograms (BPCs) of similar coverage and intensity to those observed for traditional processing and overnight digestion. Simple set up, good reproducibility, excellent peptide recoveries, rapid turnover of samples and high confidence protein identifications put this technology at the fore-front of the next generation of proteomics sample processing tools.

  13. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  14. Surface force analysis of molecular interfacial interactions of proteins and lipids with polymeric biomaterials

    International Nuclear Information System (INIS)

    Hamilton-Brown, P.; Griesser, H.J.; Meagher, L.

    2001-01-01

    Full text: Adverse biological responses to biomedical devices are often caused by the irreversible accumulation of biological deposits onto the surfaces of devices. Such deposits cause blocking of artificial blood vessels, fibrous encapsulation of soft tissue regenerative devices, 'fouling' of contact lenses, secondary cataracts on intraocular lenses, and other undesirable events that interfere with the intended functions of biomedical devices. The formation of deposits is triggered by an initial stage in which various proteins and lipids rapidly adsorb onto the synthetic material surface; further biological molecules and ultimately cellular entities (e.g., host cells, bacteria) then settle onto the initial adsorbed layer. Hence, to avoid or control the accumulation of biological deposits, molecular understanding is required of the initial adsorption processes. Such adsorption is caused by attractive interfacial forces, which we are characterising by the use of a novel method. In the present study, polymeric thin film coatings, polyethylene oxide (PEO), and polysaccharide coatings have been analysed in terms of their surface forces and the ensuing propensity for protein and lipid adsorption. Interfacial forces are measured using atomic force microscopy (AFM) with a colloid-modified tip in a liquid cell using solutions of physiological pH and ionic strength. The chemical composition and uniformity of the coatings was characterised by X-ray Photon Spectroscopy (XPS). For a polymeric solid coating, repulsive forces have been measured against a silica colloid probe, and the dominant surface force is electrostatic. For the highly hydrated, 'soft' PEO and polysaccharide coatings, on the other hand, steric/entropic forces are also significant and contribute to interfacial interactions with proteins and lipids. In one system we have observed a time dependence of the electrostatic surface potential, which affects interaction with charged proteins. Force measurements were

  15. 3D-SURFER 2.0: web platform for real-time search and characterization of protein surfaces.

    Science.gov (United States)

    Xiong, Yi; Esquivel-Rodriguez, Juan; Sael, Lee; Kihara, Daisuke

    2014-01-01

    The increasing number of uncharacterized protein structures necessitates the development of computational approaches for function annotation using the protein tertiary structures. Protein structure database search is the basis of any structure-based functional elucidation of proteins. 3D-SURFER is a web platform for real-time protein surface comparison of a given protein structure against the entire PDB using 3D Zernike descriptors. It can smoothly navigate the protein structure space in real-time from one query structure to another. A major new feature of Release 2.0 is the ability to compare the protein surface of a single chain, a single domain, or a single complex against databases of protein chains, domains, complexes, or a combination of all three in the latest PDB. Additionally, two types of protein structures can now be compared: all-atom-surface and backbone-atom-surface. The server can also accept a batch job for a large number of database searches. Pockets in protein surfaces can be identified by VisGrid and LIGSITE (csc) . The server is available at http://kiharalab.org/3d-surfer/.

  16. Cell wall structure suitable for surface display of proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Matsuoka, Hiroyuki; Hashimoto, Kazuya; Saijo, Aki; Takada, Yuki; Kondo, Akihiko; Ueda, Mitsuyoshi; Ooshima, Hiroshi; Tachibana, Taro; Azuma, Masayuki

    2014-02-01

    A display system for adding new protein functions to the cell surfaces of microorganisms has been developed, and applications of the system to various fields have been proposed. With the aim of constructing a cell surface environment suitable for protein display in Saccharomyces cerevisiae, the cell surface structures of cell wall mutants were investigated. Four cell wall mutant strains were selected by analyses using a GFP display system via a GPI anchor. β-Glucosidase and endoglucanase II were displayed on the cell surface in the four mutants, and their activities were evaluated. mnn2 deletion strain exhibited the highest activity for both the enzymes. In particular, endoglucanase II activity using carboxymethylcellulose as a substrate in the mutant strain was 1.9-fold higher than that of the wild-type strain. In addition, the activity of endoglucanase II released from the mnn2 deletion strain by Zymolyase 20T treatment was higher than that from the wild-type strain. The results of green fluorescent protein (GFP) and endoglucanase displays suggest that the amounts of enzyme displayed on the cell surface were increased by the mnn2 deletion. The enzyme activity of the mnn2 deletion strain was compared with that of the wild-type strain. The relative value (mnn2 deletion mutant/wild-type strain) of endoglucanase II activity using carboxymethylcellulose as a substrate was higher than that of β-glucosidase activity using p-nitrophenyl-β-glucopyranoside as a substrate, suggesting that the cell surface environment of the mnn2 deletion strain facilitates the binding of high-molecular-weight substrates to the active sites of the displayed enzymes. Copyright © 2014 John Wiley & Sons, Ltd.

  17. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Exposure of the Plasmodium falciparum clonally variant STEVOR proteins on the merozoite surface

    Directory of Open Access Journals (Sweden)

    Meri Seppo

    2011-03-01

    Full Text Available Abstract Background Plasmodium falciparum merozoites are free invasive forms that invade host erythrocytes in iterative cycles in the presence of different arms of the immune system. Variant antigens are known to play a role in immune evasion and several gene families coding for variant antigens have been identified in P. falciparum. However, none of them have been reported to be expressed on the surface of merozoites. Methods Flow cytometry, immunofluorescence microscopy, and immunoblotting assays were performed to assess surface exposure, membrane association and stage specific expression of the STEVOR family of variants proteins, respectively. Results Using a polyclonal antibody (anti-PFL2610w with a broad specificity towards different STEVOR variants, the STEVOR proteins were identified on the surface of non-permeabilized/non-fixed merozoites in flow cytometry assays. Anti-PFL2610w antibody showed that several STEVORs were expressed in the trophozoite stage of the parasite but only one variant was integrated into the merozoite membrane. Moreover, this antibody failed to identify STEVORs on the surface of the parent schizont infected erythrocytes (IE although they were readily identified when schizont IE were permeabilized. Conclusions These data suggest for a role for STEVOR in immune evasion by P. falciparum merozoites to allow successful invasion of erythrocytes. Additionally, the expression of STEVORs in the schizont stage may only represent a step in the biogenesis process of the merozoite surface coat.

  19. Genetically encoded pH sensor for tracking surface proteins through endocytosis.

    Science.gov (United States)

    Grover, Anmol; Schmidt, Brigitte F; Salter, Russell D; Watkins, Simon C; Waggoner, Alan S; Bruchez, Marcel P

    2012-05-14

    Traffic cam: a tandem dye prepared from a FRET acceptor and a fluorogenic donor functions as a cell surface ratiometric pH indicator, which upon internalization serves to follow protein trafficking during endocytosis. This sensor was used to analyze agonist-dependent internalization of β(2)-adrenergic receptors. It was also used as a surrogate antigen to reveal direct surface-to-endosome antigen transfer between dendritic cells (not shown). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Mosaic amino acid conservation in 3D-structures of surface protein and polymerase of hepatitis B virus

    NARCIS (Netherlands)

    van Hemert, Formijn J.; Zaaijer, Hans L.; Berkhout, Ben; Lukashov, Vladimir V.

    2008-01-01

    Surface protein and polymerase of hepatitis B virus provide a striking example of gene overlap. Inclusion of more coding constraints in the phylogenetic analysis forces the tree toward accepted topology. Three-dimensional protein modeling demonstrates that participation in local protein function

  1. Protein-protein networks construction and their relevance measurement based on multi-epitope-ligand-kartographie and gene ontology data of T-cell surface proteins for polymyositis.

    Science.gov (United States)

    Li, Fang-Zhen; Gao, Feng

    2012-08-01

    Polymyositis is an inflammatory myopathy characterized by muscle invasion of T-cells penetrating the basal lamina and displacing the plasma membrane of normal muscle fibers. In order to understand the different adhesive mechanisms at the T-cell surface, Schubert randomly selected 19 proteins expressed at the T-cell surface and studied them using MELK technique [4], among which 15 proteins are picked up for further study by us. Two types of functional similarity networks are constructed for these proteins. The first type is MELK similarity network, which is constructed based on their MELK data by using the McNemar's test [24]. The second type is GO similarity network, which is constructed based on their GO annotation data by using the RSS method to measuring functional similarity. Then the subset surprisology theory is employed to measure the degree of similarity between two networks. Our computing results show that these two types of networks are high related. This conclusion added new values on MELK technique and expanded its applications greatly.

  2. Analysis of Pseudomonas aeruginosa cell envelope proteome by capture of surface-exposed proteins on activated magnetic nanoparticles.

    Directory of Open Access Journals (Sweden)

    Davide Vecchietti

    Full Text Available We report on specific magneto-capturing followed by Multidimensional Protein Identification Technology (MudPIT for the analysis of surface-exposed proteins of intact cells of the bacterial opportunistic pathogen Pseudomonas aeruginosa. The magneto-separation of cell envelope fragments from the soluble cytoplasmic fraction allowed the MudPIT identification of the captured and neighboring proteins. Remarkably, we identified 63 proteins captured directly by nanoparticles and 67 proteins embedded in the cell envelope fragments. For a high number of proteins, our analysis strongly indicates either surface exposure or localization in an envelope district. The localization of most identified proteins was only predicted or totally unknown. This novel approach greatly improves the sensitivity and specificity of the previous methods, such as surface shaving with proteases that was also tested on P. aeruginosa. The magneto-capture procedure is simple, safe, and rapid, and appears to be well-suited for envelope studies in highly pathogenic bacteria.

  3. Analysis of Pseudomonas aeruginosa Cell Envelope Proteome by Capture of Surface-Exposed Proteins on Activated Magnetic Nanoparticles

    Science.gov (United States)

    Vecchietti, Davide; Di Silvestre, Dario; Miriani, Matteo; Bonomi, Francesco; Marengo, Mauro; Bragonzi, Alessandra; Cova, Lara; Franceschi, Eleonora; Mauri, Pierluigi; Bertoni, Giovanni

    2012-01-01

    We report on specific magneto-capturing followed by Multidimensional Protein Identification Technology (MudPIT) for the analysis of surface-exposed proteins of intact cells of the bacterial opportunistic pathogen Pseudomonas aeruginosa. The magneto-separation of cell envelope fragments from the soluble cytoplasmic fraction allowed the MudPIT identification of the captured and neighboring proteins. Remarkably, we identified 63 proteins captured directly by nanoparticles and 67 proteins embedded in the cell envelope fragments. For a high number of proteins, our analysis strongly indicates either surface exposure or localization in an envelope district. The localization of most identified proteins was only predicted or totally unknown. This novel approach greatly improves the sensitivity and specificity of the previous methods, such as surface shaving with proteases that was also tested on P. aeruginosa. The magneto-capture procedure is simple, safe, and rapid, and appears to be well-suited for envelope studies in highly pathogenic bacteria. PMID:23226459

  4. Molecular surface representation using 3D Zernike descriptors for protein shape comparison and docking.

    Science.gov (United States)

    Kihara, Daisuke; Sael, Lee; Chikhi, Rayan; Esquivel-Rodriguez, Juan

    2011-09-01

    The tertiary structures of proteins have been solved in an increasing pace in recent years. To capitalize the enormous efforts paid for accumulating the structure data, efficient and effective computational methods need to be developed for comparing, searching, and investigating interactions of protein structures. We introduce the 3D Zernike descriptor (3DZD), an emerging technique to describe molecular surfaces. The 3DZD is a series expansion of mathematical three-dimensional function, and thus a tertiary structure is represented compactly by a vector of coefficients of terms in the series. A strong advantage of the 3DZD is that it is invariant to rotation of target object to be represented. These two characteristics of the 3DZD allow rapid comparison of surface shapes, which is sufficient for real-time structure database screening. In this article, we review various applications of the 3DZD, which have been recently proposed.

  5. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  6. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  7. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  8. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  9. Protein analysis in dissolved organic matter: What proteins from organic debris, soil leachate and surface water can tell us - a perspective

    Directory of Open Access Journals (Sweden)

    W. X. Schulze

    2005-01-01

    Full Text Available Mass spectrometry based analysis of proteins is widely used to study cellular processes in model organisms. However, it has not yet routinely been applied in environmental research. Based on observations that protein can readily be detected as a component of dissolved organic matter (DOM, this article gives an example about the possible use of protein analysis in ecology and environmental sciences focusing on different terrestrial ecosystems. At this stage, there are two areas of interest: (1 the identification of phylogenetic groups contributing to the environmental protein pool, and (2 identification of the organismic origin of specific enzymes that are important for ecosystem processes. In this paper, mass spectrometric protein analysis was applied to identify proteins from decomposing plant material and DOM of soil leachates and surface water samples derived from different environments. It is concluded, that mass spectrometric protein analysis is capable of distinguishing phylogenetic origin of proteins from litter protein extracts, leachates of different soil horizons, and from various sources of terrestrial surface water. Current limitation is imposed by the limited knowledge of complete genomes of soil organisms. The protein analysis allows to relate protein presence to biogeochemical processes, and to identify the source organisms for specific active enzymes. Further applications, such as in pollution research are conceivable. In summary, the analysis of proteins opens a new area of research between the fields of microbiology and biogeochemistry.

  10. ProtPOS: a python package for the prediction of protein preferred orientation on a surface.

    Science.gov (United States)

    Ngai, Jimmy C F; Mak, Pui-In; Siu, Shirley W I

    2016-08-15

    Atomistic molecular dynamics simulation is a promising technique to investigate the energetics and dynamics in the protein-surface adsorption process which is of high relevance to modern biotechnological applications. To increase the chance of success in simulating the adsorption process, favorable orientations of the protein at the surface must be determined. Here, we present ProtPOS which is a lightweight and easy-to-use python package that can predict low-energy protein orientations on a surface of interest. It combines a fast conformational sampling algorithm with the energy calculation of GROMACS. The advantage of ProtPOS is it allows users to select any force fields suitable for the system at hand and provide structural output readily available for further simulation studies. ProtPOS is freely available for academic and non-profit uses at http://cbbio.cis.umac.mo/software/protpos Supplementary data are available at Bioinformatics online. shirleysiu@umac.mo. © The Author 2016. Published by Oxford University Press.

  11. The application of polythiol molecules for protein immobilisation on sensor surfaces.

    Science.gov (United States)

    Kyprianou, Dimitris; Guerreiro, Antonio R; Nirschl, Martin; Chianella, Iva; Subrahmanyam, Sreenath; Turner, Anthony P F; Piletsky, Sergey

    2010-01-15

    The immobilisation of bio-receptors on transducer surfaces is a key step in the development of biosensors. The immobilisation needs to be fast, cheap and most importantly should not affect the biorecognition activity of the immobilised receptor. The development of a protocol for biomolecule immobilisation onto a surface plasmon resonance (SPR) sensor surface using inexpensive polythiol compounds is presented here. The method used here is based on the reaction between primary amines and thioacetal groups, formed upon reaction of o-phthaldialdehyde (OPA) and thiol compounds. The self-assembled thiol monolayers were characterised using contact angle and XPS. The possibility to immobilise proteins on monolayers was assessed by employing BSA as a model protein. For the polythiol layers exhibiting the best performance, a general protocol was optimised suitable for the immobilisation of enzymes and antibodies such as anti-prostate specific antigen (anti-PSA) and anti Salmonella typhimurium. The kinetic data was obtained for PSA binding to anti-PSA and for S. typhimurium cells with a detection limit of 5x10(6) cells mL(-1) with minimal non-specific binding of other biomolecules. These findings make this technique a very promising alternative for amine coupling compared to peptide bond formation. Additionally, it offers opportunity for immobilising proteins (even those with low isoelectric point) on neutral polythiol layers without any activation step. Copyright 2009 Elsevier B.V. All rights reserved.

  12. Surface Plasmon Resonance Investigations of Bioselective Element Based on the Recombinant Protein A for Immunoglobulin Detection

    Science.gov (United States)

    Bakhmachuk, A.; Gorbatiuk, O.; Rachkov, A.; Dons'koi, B.; Khristosenko, R.; Ushenin, I.; Peshkova, V.; Soldatkin, A.

    2017-02-01

    The developed surface plasmon resonance (SPR) biosensor based on the recombinant Staphylococcal protein A with an additional cysteine residue (SPA-Cys) used as a biorecognition component showed a good selectivity and sensitivity for the immunoglobulin detection. The developed biosensor with SPA-Cys-based bioselective element can also be used as a first step of immunosensor creation. The successful immobilization of SPA-Cys on the nanolayer gold sensor surface of the SPR spectrometer was performed. The efficiency of blocking nonspecific sorption sites on the sensor surface with milk proteins, gelatin, BSA, and HSA was studied, and a rather high efficiency of using gelatin was confirmed. The SPR biosensor selectively interacted with IgG and did not interact with the control proteins. The linear dependence of the sensor response on the IgG concentration in the range from 2 to 10 μg/ml was shown. Using the calibration curve, the IgG concentration was measured in the model samples. The determined concentrations are in good agreement ( r 2 = 0.97) with the given concentration of IgG.

  13. Bone Morphogenetic Protein Coating on Titanium Implant Surface: a Systematic Review

    Directory of Open Access Journals (Sweden)

    Haim Haimov

    2017-06-01

    Full Text Available Objectives: The purpose of the study is to systematically review the osseointegration process improvement by bone morphogenetic protein coating on titanium implant surface. Material and Methods: An electronic literature search was conducted through the MEDLINE (PubMed and EMBASE databases. The search was restricted for articles published during the last 10 years from October 2006 to September 2016 and articles were limited to English language. Results: A total of 41 articles were reviewed, and 8 of the most relevant articles that are suitable to the criteria were selected. Articles were analysed regarding concentration of bone morphogenetic protein (BMP, delivery systems, adverse reactions and the influence of the BMP on the bone and peri-implant surface in vivo. Finally, the present data included 340 implants and 236 models. Conclusions: It’s clearly shown from most of the examined studies that bone morphogenetic protein increases bone regeneration. Further studies should be done in order to induce and sustain bone formation activity. Osteogenic agent should be gradually liberated and not rapidly released with priority to three-dimension reservoir (incorporated titanium implant surface in order to avoid following severe side effects: inflammation, bleeding, haematoma, oedema, erythema, and graft failure.

  14. Fabrication of Surface Protein-Imprinted Nanoparticles Using a Metal Chelating Monomer via Aqueous Precipitation Polymerization.

    Science.gov (United States)

    Li, Wei; Sun, Yan; Yang, Chongchong; Yan, Xianming; Guo, Hao; Fu, Guoqi

    2015-12-16

    Molecular imprinting is a promising way for constructing artificial protein recognition materials, but it has been challenged by difficulties such as restricted biomacromolecule transfer in the cross-linked polymer networks, and reduced template-monomer interactions that are due to the required aqueous media. Herein, we propose a strategy for imprinting of histidine (His)-exposed proteins by combining previous approaches such as surface imprinting over nanostructures, utilization of metal coordination interactions, and adoption of aqueous precipitation polymerization capable of forming reversible physical crosslinks. With lysozyme as a model template bearing His residues, imprinted polymer nanoshells were grafted over vinyl-modified nanoparticles by aqueous precipitation copolymerization of a Cu(2+) chelating monomer with a temperature-responsive monomer carried out at 37 °C, above the volume phase-transition temperature (VPTT) of the final copolymer. The imprinted nanoshells showed significant temperature sensitivity and the template removal could be facilitated by swelling of the imprinted layers at 4 °C, below the VPTT. The resultant core-shell imprinted nanoparticles exhibited strikingly high rebinding selectivity against a variety of nontemplate proteins. An imprinting factor up to 22.7 was achieved, which is among the best values reported for protein imprinting, and a rather high specific binding capacity of 67.3 mg/g was obtained. Moreover, this approach was successfully extended to preliminary imprinting of hemoglobin, another protein with accessible His. Therefore, it may be a versatile method for fabrication of high-performance surface-imprinted nanoparticles toward His-exposed proteins.

  15. New Monoclonal Antibodies to Defined Cell Surface Proteins on Human Pluripotent Stem Cells.

    Science.gov (United States)

    O'Brien, Carmel M; Chy, Hun S; Zhou, Qi; Blumenfeld, Shiri; Lambshead, Jack W; Liu, Xiaodong; Kie, Joshua; Capaldo, Bianca D; Chung, Tung-Liang; Adams, Timothy E; Phan, Tram; Bentley, John D; McKinstry, William J; Oliva, Karen; McMurrick, Paul J; Wang, Yu-Chieh; Rossello, Fernando J; Lindeman, Geoffrey J; Chen, Di; Jarde, Thierry; Clark, Amander T; Abud, Helen E; Visvader, Jane E; Nefzger, Christian M; Polo, Jose M; Loring, Jeanne F; Laslett, Andrew L

    2017-03-01

    The study and application of human pluripotent stem cells (hPSCs) will be enhanced by the availability of well-characterized monoclonal antibodies (mAbs) detecting cell-surface epitopes. Here, we report generation of seven new mAbs that detect cell surface proteins present on live and fixed human ES cells (hESCs) and human iPS cells (hiPSCs), confirming our previous prediction that these proteins were present on the cell surface of hPSCs. The mAbs all show a high correlation with POU5F1 (OCT4) expression and other hPSC surface markers (TRA-160 and SSEA-4) in hPSC cultures and detect rare OCT4 positive cells in differentiated cell cultures. These mAbs are immunoreactive to cell surface protein epitopes on both primed and naive state hPSCs, providing useful research tools to investigate the cellular mechanisms underlying human pluripotency and states of cellular reprogramming. In addition, we report that subsets of the seven new mAbs are also immunoreactive to human bone marrow-derived mesenchymal stem cells (MSCs), normal human breast subsets and both normal and tumorigenic colorectal cell populations. The mAbs reported here should accelerate the investigation of the nature of pluripotency, and enable development of robust cell separation and tracing technologies to enrich or deplete for hPSCs and other human stem and somatic cell types. Stem Cells 2017;35:626-640. © 2016 The Authors Stem Cells published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.

  16. Durable grafting of silkworm pupa protein onto the surface of polyethylene terephthalate fibers

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jianfeng, E-mail: 584884673@qq.com [College of Textiles & Garments, Southwest University, Chongqing 400716 (China); Chongqing Engineering Research Center of Biomaterial Fiber and Modern Textile, 400716 (China); Zheng, Dandan, E-mail: 183737543@qq.com [College of Textiles & Garments, Southwest University, Chongqing 400716 (China); Chongqing Engineering Research Center of Biomaterial Fiber and Modern Textile, 400716 (China); Zhang, Fengxiu, E-mail: zhangfx656472@sina.com.cn [School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Zhang, Guangxian, E-mail: zgx656472@sina.com [College of Textiles & Garments, Southwest University, Chongqing 400716 (China); Chongqing Engineering Research Center of Biomaterial Fiber and Modern Textile, 400716 (China)

    2016-12-01

    In this paper, reactive –NH{sub 2} groups (8.36 × 10{sup −6} mol/g fabric) were introduced to the surface of polyethylene terephthalate (PET) fabrics by a nitration and reduction method, and epoxy groups were introduced to silkworm pupa protein (SPP) by reaction with epoxy chloropropane. PET-SPP composite fabrics were then prepared by reaction of these two precursors. The results showed that the SPP was firmly grafted onto the PET fabric surface and that the hydrophilicity of the fabric was markedly improved by the grafting of SPP. SEM images revealed a layer of substance covering the surface of the PET fibers, and XPS investigation showed that the nitrogen content of the PET-SPP fabric was higher than that of the original PET fabric (2.32% vs 0%). ATR-FTIR adsorption bands at 1653 and 1543 cm{sup −1} suggested the successful grafting of SPP onto the PET fabric surface. The DSC and TG of the PET fibers demonstrated that the thermal stability of the original PET fibers was maintained well by the SPP-grafted PET fibers. The breaking strength, bending rigidity, air permeability, and crease recovery angle of the original PET fabric were also retained by the SPP-grafted PET fabric. - Highlights: • Reactive –NH{sub 2} groups were introduced to PET fibers by nitration and reduction method. • Reactive epoxy groups were introduced to silkworm pupa protein by reacting with epoxy chloropropane. • The silkworm pupa protein could be grafted firmly on the PET fabric surface through covalent bond. • The skin-friendly property and hydrophilicity of PET-SPP fabric were improved greatly. • The wearability of PET-SPP composite fabric kept well.

  17. Bacterial surface-displayed GII.4 human norovirus capsid proteins bound to surface of Romaine lettuce through HBGA-like molecules

    Science.gov (United States)

    Human Noroviruses (HuNoVs) are the main cause of nonbacterial gastroenteritis. Contaminated produce is a main vehicle for dissemination of HuNoVs. In this study, we used an ice nucleation protein (INP) mediated surface display system to present the protruding domain of GII.4 HuNoV capsid protein (G...

  18. Protein imprinting and recognition via forming nanofilms on microbeads surfaces in aqueous media

    International Nuclear Information System (INIS)

    Lu Yan; Yan Changling; Wang Xuejing; Wang Gongke

    2009-01-01

    In this paler, we present a technique of forming nanofilms of poly-3-aminophenylboronic acid (pAPBA) on the surfaces of polystyrene (PS) microbeads for proteins (papain and trypsin) in aqueous. Papain was chosen as a model to study the feasibility of the technique and trypsin as an extension. Obtained core-shell microbeads were characterized using scanning electron microscopy (SEM), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS) and BET methods. The results show that pAPBA formed nanofilms (60-100 nm in thickness) on the surfaces of PS microbeads. The specific surface area of the papain-imprinted beads was about 180 m 2 g -1 and its pore size was 31 nm. These imprinted microbeads exhibit high recognition specificity and fast mass transfer kinetics. The specificity of these imprinted beads mainly originates from the spatial effect of imprinted sites. Because the protein-imprinted sites were located at, or close to, the surface, the imprinted beads have good site accessibility toward the template molecules. The facility of the imprinting protocol and the high recognition properties of imprinted microbeads make the approach an attractive solution to problems in the field of biotechnology.

  19. Comparison of Zirconium Phosphonate-Modified Surfaces for Immobilizing Phosphopeptides and Phosphate-Tagged Proteins.

    Science.gov (United States)

    Forato, Florian; Liu, Hao; Benoit, Roland; Fayon, Franck; Charlier, Cathy; Fateh, Amina; Defontaine, Alain; Tellier, Charles; Talham, Daniel R; Queffélec, Clémence; Bujoli, Bruno

    2016-06-07

    Different routes for preparing zirconium phosphonate-modified surfaces for immobilizing biomolecular probes are compared. Two chemical-modification approaches were explored to form self-assembled monolayers on commercially available primary amine-functionalized slides, and the resulting surfaces were compared to well-characterized zirconium phosphonate monolayer-modified supports prepared using Langmuir-Blodgett methods. When using POCl3 as the amine phosphorylating agent followed by treatment with zirconyl chloride, the result was not a zirconium-phosphonate monolayer, as commonly assumed in the literature, but rather the process gives adsorbed zirconium oxide/hydroxide species and to a lower extent adsorbed zirconium phosphate and/or phosphonate. Reactions giving rise to these products were modeled in homogeneous-phase studies. Nevertheless, each of the three modified surfaces effectively immobilized phosphopeptides and phosphopeptide tags fused to an affinity protein. Unexpectedly, the zirconium oxide/hydroxide modified surface, formed by treating the amine-coated slides with POCl3/Zr(4+), afforded better immobilization of the peptides and proteins and efficient capture of their targets.

  20. Phospholipase D specific for the phosphatidylinositol anchor of cell-surface proteins is abundant in plasma

    International Nuclear Information System (INIS)

    Low, M.G.; Prasad, A.R.S.

    1988-01-01

    An enzyme activity capable of degrading the glycosyl-phosphatidylinositol membrane anchor of cell-surface proteins has previously been reported in a number of mammalian tissues. The experiments reported here demonstrate that this anchor-degrading activity is also abundant in mammalian plasma. The activity was inhibited by EGTA or 1,10-phenanthroline. It was capable of removing the anchor from alkaline phosphatase, 5'-nucleotidase, and variant surface glycoprotein but had little or no activity toward phosphatidylinositol or phosphatidylcholine. Phosphatidic acid was the only 3 H-labeled product when this enzyme hydrolyzed [ 3 H]myristate-labeled variant surface glycoprotein. It could be distinguished from the Ca 2 =-dependent inositol phospholipid-specific phospholipase C activity in several rat tissues on the basis of its molecular size and its sensitivity to 1,10-phenanthroline. The data therefore suggest that this activity is due to a phospholipase D with specificity for glycosylphosphatidylinositol structures. Although the precise physiological function of this anchor-specific phospholipase D remains to be determined, these findings indicate that it could play an important role in regulating the expression and release of cell-surface proteins in vivo

  1. Ice-surface adsorption enhanced colligative effect of antifreeze proteins in ice growth inhibition

    Science.gov (United States)

    Mao, Yougang; Ba, Yong

    2006-09-01

    This Communication describes a mechanism to explain antifreeze protein's function to inhibit the growth of ice crystals. We propose that the adsorption of antifreeze protein (AFP) molecules on an ice surface induces a dense AFP-water layer, which can significantly decrease the mole fraction of the interfacial water and, thus, lower the temperature for a seed ice crystal to grow in a super-cooled AFP solution. This mechanism can also explain the nearly unchanged melting point for the ice crystal due to the AFP's ice-surface adsorption. A mathematical model combining the Langmuir theory of adsorption and the colligative effect of thermodynamics has been proposed to find the equilibrium constants of the ice-surface adsorptions, and the interfacial concentrations of AFPs through fitting the theoretical curves to the experimental thermal hysteresis data. This model has been demonstrated by using the experimental data of serial size-mutated beetle Tenebrio molitor (Tm) AFPs. It was found that the AFP's ice-surface adsorptions could increase the interfacial AFP's concentrations by 3 to 4 orders compared with those in the bulk AFP solutions.

  2. The continuing conundrum of the LEA proteins.

    Science.gov (United States)

    Tunnacliffe, Alan; Wise, Michael J

    2007-10-01

    Research into late embryogenesis abundant (LEA) proteins has been ongoing for more than 20 years but, although there is a strong association of LEA proteins with abiotic stress tolerance particularly dehydration and cold stress, for most of that time, their function has been entirely obscure. After their initial discovery in plant seeds, three major groups (numbered 1, 2 and 3) of LEA proteins have been described in a range of different plants and plant tissues. Homologues of groups 1 and 3 proteins have also been found in bacteria and in certain invertebrates. In this review, we present some new data, survey the biochemistry, biophysics and bioinformatics of the LEA proteins and highlight several possible functions. These include roles as antioxidants and as membrane and protein stabilisers during water stress, either by direct interaction or by acting as molecular shields. Along with other hydrophilic proteins and compatible solutes, LEA proteins might also serve as "space fillers" to prevent cellular collapse at low water activities. This multifunctional capacity of the LEA proteins is probably attributable in part to their structural plasticity, as they are largely lacking in secondary structure in the fully hydrated state, but can become more folded during water stress and/or through association with membrane surfaces. The challenge now facing researchers investigating these enigmatic proteins is to make sense of the various in vitro defined functions in the living cell: Are the LEA proteins truly multi-talented, or are they still just misunderstood?

  3. Regulation of CD93 cell surface expression by protein kinase C isoenzymes.

    Science.gov (United States)

    Ikewaki, Nobunao; Kulski, Jerzy K; Inoko, Hidetoshi

    2006-01-01

    Human CD93, also known as complement protein 1, q subcomponent, receptor (C1qRp), is selectively expressed by cells with a myeloid lineage, endothelial cells, platelets, and microglia and was originally reported to be involved in the complement protein 1, q subcomponent (C1q)-mediated enhancement of phagocytosis. The intracellular molecular events responsible for the regulation of its expression on the cell surface, however, have not been determined. In this study, the effect of protein kinases in the regulation of CD93 expression on the cell surface of a human monocyte-like cell line (U937), a human NK-like cell line (KHYG-1), and a human umbilical vein endothelial cell line (HUV-EC-C) was investigated using four types of protein kinase inhibitors, the classical protein kinase C (cPKC) inhibitor Go6976, the novel PKC (nPKC) inhibitor Rottlerin, the protein kinase A (PKA) inhibitor H-89 and the protein tyrosine kinase (PTK) inhibitor herbimycin A at their optimum concentrations for 24 hr. CD93 expression was analyzed using flow cytometry and glutaraldehyde-fixed cellular enzyme-linked immunoassay (EIA) techniques utilizing a CD93 monoclonal antibody (mAb), mNI-11, that was originally established in our laboratory as a CD93 detection probe. The nPKC inhibitor Rottlerin strongly down-regulated CD93 expression on the U937 cells in a dose-dependent manner, whereas the other inhibitors had little or no effect. CD93 expression was down-regulated by Go6976, but not by Rottlerin, in the KHYG-1 cells and by both Rottlerin and Go6976 in the HUV-EC-C cells. The PKC stimulator, phorbol myristate acetate (PMA), strongly up-regulated CD93 expression on the cell surface of all three cell-lines and induced interleukin-8 (IL-8) production by the U937 cells and interferon-gamma (IFN-gamma) production by the KHYG-1 cells. In addition, both Go6976 and Rottlerin inhibited the up-regulation of CD93 expression induced by PMA and IL-8 or IFN-gamma production in the respective cell

  4. Accessible surface area of proteins from purely sequence information and the importance of global features

    Science.gov (United States)

    Faraggi, Eshel; Zhou, Yaoqi; Kloczkowski, Andrzej

    2014-03-01

    We present a new approach for predicting the accessible surface area of proteins. The novelty of this approach lies in not using residue mutation profiles generated by multiple sequence alignments as descriptive inputs. Rather, sequential window information and the global monomer and dimer compositions of the chain are used. We find that much of the lost accuracy due to the elimination of evolutionary information is recouped by the use of global features. Furthermore, this new predictor produces similar results for proteins with or without sequence homologs deposited in the Protein Data Bank, and hence shows generalizability. Finally, these predictions are obtained in a small fraction (1/1000) of the time required to run mutation profile based prediction. All these factors indicate the possible usability of this work in de-novo protein structure prediction and in de-novo protein design using iterative searches. Funded in part by the financial support of the National Institutes of Health through Grants R01GM072014 and R01GM073095, and the National Science Foundation through Grant NSF MCB 1071785.

  5. TGP, an extremely stable, non-aggregating fluorescent protein created by structure-guided surface engineering

    Science.gov (United States)

    Close, Devin W.; Don Paul, Craig; Langan, Patricia S.; Wilce, Matthew C.J.; Traore, Daouda A.K.; Halfmann, Randal; Rocha, Reginaldo C.; Waldo, Geoffery S.; Payne, Riley J.; Rucker, Joseph B.; Prescott, Mark; Bradbury, Andrew R.M.

    2014-01-01

    In this paper we describe the engineering and X-ray crystal structure of Thermal Green Protein (TGP), an extremely stable, highly soluble, non-aggregating green fluorescent protein. TGP is a soluble variant of the fluorescent protein eCGP123, which despite being highly stable, has proven to be aggregation-prone. The X-ray crystal structure of eCGP123, also determined within the context of this paper, was used to carry out rational surface engineering to improve its solubility, leading to TGP. The approach involved simultaneously eliminating crystal lattice contacts while increasing the overall negative charge of the protein. Despite intentional disruption of lattice contacts and introduction of high entropy glutamate side chains, TGP crystallized readily in a number of different conditions and the X-ray crystal structure of TGP was determined to 1.9 Å resolution. The structural reasons for the enhanced stability of TGP and eCGP123 are discussed. We demonstrate the utility of using TGP as a fusion partner in various assays and significantly, in amyloid assays in which the standard fluorescent protein, EGFP, is undesirable because of aberrant oligomerization. PMID:25287913

  6. Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.

    Science.gov (United States)

    Bykowski, Tomasz; Babb, Kelly; von Lackum, Kate; Riley, Sean P; Norris, Steven J; Stevenson, Brian

    2006-07-01

    The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.

  7. Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

    DEFF Research Database (Denmark)

    Bokoch, Michael P; Zou, Yaozhong; Rasmussen, Søren Gøgsig Faarup

    2010-01-01

    extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known...... conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive...... about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the native ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the beta(2) adrenergic...

  8. ErpC, a member of the complement regulator-acquiring family of surface proteins from Borrelia burgdorferi, possesses an architecture previously unseen in this protein family

    International Nuclear Information System (INIS)

    Caesar, Joseph J. E.; Johnson, Steven; Kraiczy, Peter; Lea, Susan M.

    2013-01-01

    The structure of ErpC, a member of the complement regulator-acquiring surface protein family from B. burgdorferi, has been solved, providing insights into the strategies of complement evasion by this zoonotic bacterium and suggesting a common architecture for other members of this protein family. Borrelia burgdorferi is a spirochete responsible for Lyme disease, the most commonly occurring vector-borne disease in Europe and North America. The bacterium utilizes a set of proteins, termed complement regulator-acquiring surface proteins (CRASPs), to aid evasion of the human complement system by recruiting and presenting complement regulator factor H on its surface in a manner that mimics host cells. Presented here is the atomic resolution structure of a member of this protein family, ErpC. The structure provides new insights into the mechanism of recruitment of factor H and other factor H-related proteins by acting as a molecular mimic of host glycosaminoglycans. It also describes the architecture of other CRASP proteins belonging to the OspE/F-related paralogous protein family and suggests that they have evolved to bind specific complement proteins, aiding survival of the bacterium in different hosts

  9. Single-molecule resolution of protein dynamics on polymeric membrane surfaces: the roles of spatial and population heterogeneity.

    Science.gov (United States)

    Langdon, Blake B; Mirhossaini, Roya B; Mabry, Joshua N; Sriram, Indira; Lajmi, Ajay; Zhang, Yanxia; Rojas, Orlando J; Schwartz, Daniel K

    2015-02-18

    Although polymeric membranes are widely used in the purification of protein pharmaceuticals, interactions between biomolecules and membrane surfaces can lead to reduced membrane performance and damage to the product. In this study, single-molecule fluorescence microscopy provided direct observation of bovine serum albumin (BSA) and human monoclonal antibody (IgG) dynamics at the interface between aqueous buffer and polymeric membrane materials including regenerated cellulose and unmodified poly(ether sulfone) (PES) blended with either polyvinylpyrrolidone (PVP), polyvinyl acetate-co-polyvinylpyrrolidone (PVAc-PVP), or polyethylene glycol methacrylate (PEGM) before casting. These polymer surfaces were compared with model surfaces composed of hydrophilic bare fused silica and hydrophobic trimethylsilane-coated fused silica. At extremely dilute protein concentrations (10(-3)-10(-7) mg/mL), protein surface exchange was highly dynamic with protein monomers desorbing from the surface within ∼1 s after adsorption. Protein oligomers (e.g., nonspecific dimers, trimers, or larger aggregates), although less common, remained on the surface for 5 times longer than monomers. Using newly developed super-resolution methods, we could localize adsorption sites with ∼50 nm resolution and quantify the spatial heterogeneity of the various surfaces. On a small anomalous subset of the adsorption sites, proteins adsorbed preferentially and tended to reside for significantly longer times (i.e., on "strong" sites). Proteins resided for shorter times overall on surfaces that were more homogeneous and exhibited fewer strong sites (e.g., PVAc-PVP/PES). We propose that strong surface sites may nucleate protein aggregation, initiated preferentially by protein oligomers, and accelerate ultrafiltration membrane fouling. At high protein concentrations (0.3-1.0 mg/mL), fewer strong adsorption sites were observed, and surface residence times were reduced. This suggests that at high concentrations

  10. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  11. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  12. High performance workflow implementation for protein surface characterization using grid technology

    Directory of Open Access Journals (Sweden)

    Clematis Andrea

    2005-12-01

    Full Text Available Abstract Background This study concerns the development of a high performance workflow that, using grid technology, correlates different kinds of Bioinformatics data, starting from the base pairs of the nucleotide sequence to the exposed residues of the protein surface. The implementation of this workflow is based on the Italian Grid.it project infrastructure, that is a network of several computational resources and storage facilities distributed at different grid sites. Methods Workflows are very common in Bioinformatics because they allow to process large quantities of data by delegating the management of resources to the information streaming. Grid technology optimizes the computational load during the different workflow steps, dividing the more expensive tasks into a set of small jobs. Results Grid technology allows efficient database management, a crucial problem for obtaining good results in Bioinformatics applications. The proposed workflow is implemented to integrate huge amounts of data and the results themselves must be stored into a relational database, which results as the added value to the global knowledge. Conclusion A web interface has been developed to make this technology accessible to grid users. Once the workflow has started, by means of the simplified interface, it is possible to follow all the different steps throughout the data processing. Eventually, when the workflow has been terminated, the different features of the protein, like the amino acids exposed on the protein surface, can be compared with the data present in the output database.

  13. Developmental expression of a cell surface protein involved in sea urchin skeleton formation

    International Nuclear Information System (INIS)

    Farach, M.C.; Valdizan, M.; Park, H.R.; Decker, G.L.; Lennarz, W.J.

    1986-01-01

    The authors have previously used a monoclonal antibody (1223) to identify a 130 Kd cell surface protein involved in skeleton formation is sea urchin embryos. In the current study the authors have examined the expression of the 1223 antigen over the course of development of embryos of two species, Strongylocentrotus purpuratus and Lytechinus pictus. The 130 Kd protein is detected in S. purp eggs on immunoblots. Labeling with [ 3 H] leucine and immunoaffinity chromatography show that it also is synthesized shortly after fertilization. Immunofluroescence reveals that at this early stage the 1223 antigen is uniformly distributed on all of the cells. Synthesis decreases to a minimum by the time of hatching (18 h), as does the total amount of antigen present in the embryo. A second period of synthesis commences at the mesenchyme blastula stage, when the spicule-forming primary mesenchyme cells (PMCs) have appeared. During this later stage, synthesis and cell surface expression are restricted to the PMCs. In contrast to S. purp., in L. pictus the 130 Kd protein does not appear until the PMCs are formed. Hybrid embryos demonstrate a pattern of expression of the maternal species. These results suggest that early expression of 1223 antigen in S. purp. is due to utilization of maternal transcripts present in the egg. In both species later expression in PMCs appears to be the result of cell-type specific synthesis, perhaps encoded by embryonic transcripts

  14. The hepatitis B virus large surface protein (LHBs) is a transcriptional activator.

    Science.gov (United States)

    Hildt, E; Saher, G; Bruss, V; Hofschneider, P H

    1996-11-01

    It has been shown that a C-terminally truncated form of the middle-sized hepatitis B virus (HBV) surface protein (MHBst) functions as a transcriptional activator. This function is dependent on the cytosolic orientation of the N-terminal PreS2 domain of MHBst, but in the case of wild-type MHBs, the PreS2 domain is contranslationally translocated into the ER lumen. Recent reports demonstrated that the PreS2 domain of the large HBV surface protein (LHBs) initially remains on the cytosolic side of the ER membrane after translation. Therefore, the question arose as to whether the LHBs protein exhibits the same transcriptional activator function as MHBst. We show that LHBs, like MHBst, is indeed able to activate a variety of promoter elements. There is evidence for a PKC-dependent activation of AP-1 and NF-kappa B by LHBs. Downstream of the PKC the functionality of c-Raf-1 kinase is a prerequisite for LHBs-dependent activation of AP-1 and NF-kappa B since inhibition of c-Raf-1 kinase abolishes LHBs-dependent transcriptional activation of AP-1 and NF-kappa B.

  15. Proteome analysis and serological characterization of surface-exposed proteins of Rickettsia heilongjiangensis.

    Directory of Open Access Journals (Sweden)

    Yong Qi

    Full Text Available BACKGROUND: Rickettsia heilongjiangensis, the agent of Far-Eastern spotted fever (FESF, is an obligate intracellular bacterium. The surface-exposed proteins (SEPs of rickettsiae are involved in rickettsial adherence to and invasion of host cells, intracellular bacterial growth, and/or interaction with immune cells. They are also potential molecular candidates for the development of diagnostic reagents and vaccines against rickettsiosis. METHODS: R. heilongjiangensis SEPs were identified by biotin-streptavidin affinity purification and 2D electrophoreses coupled with ESI-MS/MS. Recombinant SEPs were probed with various sera to analyze their serological characteristics using a protein microarray and an enzyme-linked immune sorbent assay (ELISA. RESULTS: Twenty-five SEPs were identified, most of which were predicted to reside on the surface of R. heilongjiangensis cells. Bioinformatics analysis suggests that these proteins could be involved in bacterial pathogenesis. Eleven of the 25 SEPs were recognized as major seroreactive antigens by sera from R. heilongjiangensis-infected mice and FESF patients. Among the major seroreactive SEPs, microarray assays and/or ELISAs revealed that GroEL, OmpA-2, OmpB-3, PrsA, RplY, RpsB, SurA and YbgF had modest sensitivity and specificity for recognizing R. heilongjiangensis infection and/or spotted fever. CONCLUSIONS: Many of the SEPs identified herein have potentially important roles in R. heilongjiangensis pathogenicity. Some of them have potential as serodiagnostic antigens or as subunit vaccine antigens against the disease.

  16. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  17. Photo-induced formation of nitrous acid (HONO) on protein surfaces

    Science.gov (United States)

    Meusel, Hannah; Elshorbany, Yasin; Bartels-Rausch, Thorsten; Selzle, Kathrin; Lelieveld, Jos; Ammann, Markus; Pöschl, Ulrich; Su, Hang; Cheng, Yafang

    2014-05-01

    The study of nitrous acid (HONO) is of great interest, as the photolysis of HONO leads to the OH radical, which is the most important oxidant in the troposphere. HONO is directly emitted by combustion of fossil fuel and from soil biogenic nitrite (Su et al., 2011), and can also be formed by gas phase reactions of NO and OH and heterogeneous reactions of NO2. Previous atmospheric measurements have shown unexpectedly high HONO concentrations during daytime. Measured mixing ratios were about one order of magnitude higher than model simulations (Kleffmann et al. 2005, Vogel et al. 2003). The additional daytime source of HONO might be attributed to the photolysis of adsorbed nitric acid or heterogeneous photochemistry of NO2 on organic substrates, such as humic acids or polyphenolic compounds (Stemmler et al., 2006), or indirectly through nitration of phenols and subsequent photolysis of nitrophenols (Sosedova et al., 2011, Bejan et al., 2006). An important reactive surface for the heterogeneous formation of HONO could involve proteins, which are ubiquitous in the environment. They are part of coarse biological aerosol particles like pollen grains, fine particles (fragments of pollen, microorganism, plant debris) and dissolved in rainwater, soil and road dust (Miguel et al. 1999). In this project a thin film of bovine serum albumin (BSA), a model protein with 67 kDa and 21 tyrosine residues per molecule, is irradiated and exposed to nitrogen dioxide in humidified nitrogen. The formation of HONO is measured with long path absorption photometry (LOPAP). The generated HONO is in the range of 100 to 1100 ppt depending on light intensity, NO2 concentration and film thickness. Light induced HONO formation on protein surfaces is stable over the 20-hours experiment of irradiation and exposure. On the other hand, light activated proteins reacting with NO2 form nitrated proteins, as detected by liquid chromatography (LC-DAD). Our experiments on tetranitromethane (TNM) nitrated

  18. Interrogating the Plasmodium Sporozoite Surface: Identification of Surface-Exposed Proteins and Demonstration of Glycosylation on CSP and TRAP by Mass Spectrometry-Based Proteomics.

    Directory of Open Access Journals (Sweden)

    Kristian E Swearingen

    2016-04-01

    Full Text Available Malaria parasite infection is initiated by the mosquito-transmitted sporozoite stage, a highly motile invasive cell that targets hepatocytes in the liver for infection. A promising approach to developing a malaria vaccine is the use of proteins located on the sporozoite surface as antigens to elicit humoral immune responses that prevent the establishment of infection. Very little of the P. falciparum genome has been considered as potential vaccine targets, and candidate vaccines have been almost exclusively based on single antigens, generating the need for novel target identification. The most advanced malaria vaccine to date, RTS,S, a subunit vaccine consisting of a portion of the major surface protein circumsporozoite protein (CSP, conferred limited protection in Phase III trials, falling short of community-established vaccine efficacy goals. In striking contrast to the limited protection seen in current vaccine trials, sterilizing immunity can be achieved by immunization with radiation-attenuated sporozoites, suggesting that more potent protection may be achievable with a multivalent protein vaccine. Here, we provide the most comprehensive analysis to date of proteins located on the surface of or secreted by Plasmodium falciparum salivary gland sporozoites. We used chemical labeling to isolate surface-exposed proteins on sporozoites and identified these proteins by mass spectrometry. We validated several of these targets and also provide evidence that components of the inner membrane complex are in fact surface-exposed and accessible to antibodies in live sporozoites. Finally, our mass spectrometry data provide the first direct evidence that the Plasmodium surface proteins CSP and TRAP are glycosylated in sporozoites, a finding that could impact the selection of vaccine antigens.

  19. The role of side chain conformational flexibility in surface recognition by Tenebrio molitor antifreeze protein

    Science.gov (United States)

    Daley, Margaret E.; Sykes, Brian D.

    2003-01-01

    Two-dimensional nuclear magnetic resonance spectroscopy was used to investigate the flexibility of the threonine side chains in the β-helical Tenebrio molitor antifreeze protein (TmAFP) at low temperatures. From measurement of the 3Jαβ 1H-1H scalar coupling constants, the χ1 angles and preferred rotamer populations can be calculated. It was determined that the threonines on the ice-binding face of the protein adopt a preferred rotameric conformation at near freezing temperatures, whereas the threonines not on the ice-binding face sample many rotameric states. This suggests that TmAFP maintains a preformed ice-binding conformation in solution, wherein the rigid array of threonines that form the AFP-ice interface matches the ice crystal lattice. A key factor in binding to the ice surface and inhibition of ice crystal growth appears to be the close surface-to-surface complementarity between the AFP and crystalline ice, and the lack of an entropic penalty associated with freezing out motions in a flexible ligand. PMID:12824479

  20. Hydration behavior at the ice-binding surface of the Tenebrio molitor antifreeze protein.

    Science.gov (United States)

    Midya, Uday Sankar; Bandyopadhyay, Sanjoy

    2014-05-08

    Molecular dynamics (MD) simulations have been carried out at two different temperatures (300 and 220 K) to study the conformational rigidity of the hyperactive Tenebrio molitor antifreeze protein (TmAFP) in aqueous medium and the structural arrangements of water molecules hydrating its surface. It is found that irrespective of the temperature the ice-binding surface (IBS) of the protein is relatively more rigid than its nonice-binding surface (NIBS). The presence of a set of regularly arranged internally bound water molecules is found to play an important role in maintaining the flat rigid nature of the IBS. Importantly, the calculations reveal that the strategically located hydroxyl oxygens of the threonine (Thr) residues in the IBS influence the arrangements of five sets of ordered waters around it on two parallel planes that closely resemble the basal plane of ice. As a result, these waters can register well with the ice basal plane, thereby allowing the IBS to preferentially bind at the ice interface and inhibit its growth. This provides a possible molecular reason behind the ice-binding activity of TmAFP at the basal plane of ice.

  1. Surface properties of nanocrystalline TiO2 coatings in relation to the in vitro plasma protein adsorption

    International Nuclear Information System (INIS)

    Lorenzetti, M; Kobe, S; Novak, S; Bernardini, G; Santucci, A; Luxbacher, T

    2015-01-01

    This study reports on the selective adsorption of whole plasma proteins on hydrothermally (HT) grown TiO 2 -anatase coatings and its dependence on the three main surface properties: surface charge, wettability and roughness. The influence of the photo-activation of TiO 2 by UV irradiation was also evaluated. Even though the protein adhesion onto Ti-based substrates was only moderate, better adsorption of any protein (at pH = 7.4) occurred for the most negatively charged and hydrophobic substrate (Ti non-treated) and for the most nanorough and hydrophilic surface (HT Ti3), indicating that the mutual action of the surface characteristics is responsible for the attraction and adhesion of the proteins. The HT coatings showed a higher adsorption of certain proteins (albumin ‘passivation’ layer, apolipoproteins, vitamin D-binding protein, ceruloplasmin, α-2-HS-glycoprotein) and higher ratios of albumin to fibrinogen and albumin to immunoglobulin γ-chains. The UV pre-irradiation affected the surface properties and strongly reduced the adsorption of the proteins. These results provide in-depth knowledge about the characterization of nanocrystalline TiO 2 coatings for body implants and provide a basis for future studies on the hemocompatibility and biocompatibility of such surfaces. (paper)

  2. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  3. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  4. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  5. Binding of a cementum attachment protein to extracellular matrix components and to dental surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Pitaru, S; Hekmati, H [Department of Oral Biology, Goldschleger School of Dental Medicine, Tel Aviv University (Israel); Savion, N [Goldschleger Eye Institute, Sackler School of Medicine, Tel Aviv University (Israel); Olsen, S; Narayanan, S A [Department of Pathology, School of Medicine, University of Washington, Seattle, Washington (United States)

    1992-01-01

    Cementum proteins (CP) have been shown to mediate cell attachment. Among these, a 55 kDa protein was isolated. The purpose of the present study was to assess the capacity of CP to bind to non-demineralized and demineralized root surfaces and to support cell attachment to dentin. CP were prepared by sequential extraction of bovine cementum with 25 mM EDTA, 0.5 M acetic acid followed by 4 M guanidine HCl. The latter was subjected to ion exchange chromatography on a DEAE-3SW column and eluted stepwise with a 0-0.5 M NaCl gradient. CP were labelled with [sup 125]I and the capacity of [sup 125]I-CP to bind to mineralized and partially demineralized dentin, synthetic hydroxyapatite, collagen, fibronectin and fibrillar collagen-fibronectin cimplex was assessed. It was found that CP bind specifically to mineralized dentin and synthetic hydroxyapatite but not to demineralized dentin. The specific binding was 60% of the total binding. SDS-PAGE analysis of the proteins bound to dentin indicated that the main bound protein had a molecular weight of 55 kDa. CP exhibited high affinity for fibronectin (k[sub D] = 1.56 x 10[sup -10] M) and fibronectincollagen complex, but their binding to either molecular or fibrillar collagen was negligible. It is suggested that CP may play an important role in the attachment of cells of the periodontium to cementum extracellular matrix during homeostasis and regeneration. (au).

  6. A Gravity-Responsive Time-Keeping Protein of the Plant and Animal Cell Surface

    Science.gov (United States)

    Morre, D. James

    2003-01-01

    The hypothesis under investigation was that a ubiquinol (NADH) oxidase protein of the cell surface with protein disulfide-thiol interchange activity (= NOX protein) is a plant and animal time-keeping ultradian (period of less than 24 h) driver of both cell enlargement and the biological clock that responds to gravity. Despite considerable work in a large number of laboratories spanning several decades, this is, to my knowledge, our work is the first demonstration of a time-keeping biochemical reaction that is both gravity-responsive and growth-related and that has been shown to determine circadian periodicity. As such, the NOX protein may represent both the long-sought biological gravity receptor and the core oscillator of the cellular biological clock. Completed studies have resulted in 12 publications and two issued NASA-owned patents of the clock activity. The gravity response and autoentrainment were characterized in cultured mammalian cells and in two plant systems together with entrainment by light and small molecules (melatonin). The molecular basis of the oscillatory behavior was investigated using spectroscopic methods (Fourier transform infrared and circular dichroism) and high resolution electron microscopy. We have also applied these findings to an understanding of the response to hypergravity. Statistical methods for analysis of time series phenomena were developed (Foster et al., 2003).

  7. Pathogenic Leptospira species acquire factor H and vitronectin via the surface protein LcpA.

    Science.gov (United States)

    da Silva, Ludmila Bezerra; Miragaia, Lidia Dos Santos; Breda, Leandro Carvalho Dantas; Abe, Cecilia Mari; Schmidt, Mariana Costa Braga; Moro, Ana Maria; Monaris, Denize; Conde, Jonas Nascimento; Józsi, Mihály; Isaac, Lourdes; Abreu, Patrícia Antônia Estima; Barbosa, Angela Silva

    2015-03-01

    Upon infection, pathogenic Leptospira species bind several complement regulators in order to overcome host innate immunity. We previously characterized a 20-kDa leptospiral surface protein which interacts with C4b binding protein (C4BP): leptospiral complement regulator-acquiring protein A (LcpA). Here we show that LcpA also interacts with human factor H (FH), which remains functionally active once bound to the protein. Antibodies directed against short consensus repeat 20 (SCR20) inhibited binding of FH to LcpA by approximately 90%, thus confirming that this particular domain is involved in the interaction. We have also shown for the first time that leptospires bind human vitronectin and that the interaction is mediated by LcpA. Coincubation with heparin blocked LcpA-vitronectin interaction in a dose-dependent manner, strongly suggesting that binding may occur through the heparin binding domains of vitronectin. LcpA also bound to the terminal pathway component C9 and inhibited Zn(2+)-induced polymerization and membrane attack complex (MAC) formation. Competitive binding assays indicated that LcpA interacts with C4BP, FH, and vitronectin through distinct sites. Taken together, our findings indicate that LcpA may play a role in leptospiral immune evasion. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Characterization of surface layer proteins and its role in probiotic properties of three Lactobacillus strains.

    Science.gov (United States)

    Meng, Jun; Zhu, Xiao; Gao, Shu-Ming; Zhang, Qiu-Xiang; Sun, Zhen; Lu, Rong-Rong

    2014-04-01

    The objective of this study was the characterization of the surface layer proteins (SLPs) and their functional role in the probiotic activity of Lactobacillus helveticus fb213, L. acidophilus fb116 and L. acidophilus fb214. SLPs were extracted and identified by SDS-PAGE, circular dichroism spectra and LC-MS analysis. The results revealed that the molecular masses of the three proteins were 49.7 kDa, 46.0 kDa and 44.6 kDa, respectively. The secondary structures and amino acid compositions of the three proteins were found to be similar. After removing SLPs, the survival of the three lactobacilli in simulated gastric and intestinal juices was reduced by 2-3log as compared with survival of the intact cells. And the adhesion ability of the three strains to HT-29 cells decreased by 61%, 65% and 92%, respectively. SLPs also inhibited the adhesion and invasion of Escherichia coli ATCC 43893 to HT-29 cells. These results suggest that SLPs are advantageous barriers for lactobacilli in the gastrointestinal tract, and these proteins help make it possible for lactobacilli to serve their probiotic functions. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. The extraction of liquid, protein molecules and yeast cells from paper through surface acoustic wave atomization.

    Science.gov (United States)

    Qi, Aisha; Yeo, Leslie; Friend, James; Ho, Jenny

    2010-02-21

    Paper has been proposed as an inexpensive and versatile carrier for microfluidics devices with abilities well beyond simple capillary action for pregnancy tests and the like. Unlike standard microfluidics devices, extracting a fluid from the paper is a challenge and a drawback to its broader use. Here, we extract fluid from narrow paper strips using surface acoustic wave (SAW) irradiation that subsequently atomizes the extracted fluid into a monodisperse aerosol for use in mass spectroscopy, medical diagnostics, and drug delivery applications. Two protein molecules, ovalbumin and bovine serum albumin (BSA), have been preserved in paper and then extracted using atomized mist through SAW excitation; protein electrophoresis shows there is less than 1% degradation of either protein molecule in this process. Finally, a solution of live yeast cells was infused into paper, which was subsequently dried for preservation then remoistened to extract the cells via SAW atomization, yielding live cells at the completion of the process. The successful preservation and extraction of fluids, proteins and yeast cells significantly expands the usefulness of paper in microfluidics.

  10. Data on the role of accessible surface area on osmolytes-induced protein stabilization

    Directory of Open Access Journals (Sweden)

    Safikur Rahman

    2017-02-01

    Full Text Available This paper describes data related to the research article “Testing the dependence of stabilizing effect of osmolytes on the fractional increase in the accessible surface area on thermal and chemical denaturations of proteins” [1]. Heat- and guanidinium chloride (GdmCl-induced denaturation of three disulfide free proteins (bovine cytochrome c (b-cyt-c, myoglobin (Mb and barstar in the presence of different concentrations of methylamines (sarcosine, glycine-betaine (GB and trimethylamine-N-oxide (TMAO was monitored by [ϴ]222, the mean residue ellipticity at 222 nm at pH 7.0. Methylamines belong to a class of osmolytes known to protect proteins from deleterious effect of urea. This paper includes comprehensive thermodynamic data obtained from the heat- and GdmCl-induced denaturations of barstar, b-cyt-c and Mb.

  11. Tailoring odorant-binding protein coatings characteristics for surface acoustic wave biosensor development

    Energy Technology Data Exchange (ETDEWEB)

    Di Pietrantonio, F., E-mail: fabio.dp@idasc.cnr.it [Institute of Acoustics and Sensors “O. M. Corbino”, National Research Council of Italy, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Benetti, M. [Institute of Acoustics and Sensors “O. M. Corbino”, National Research Council of Italy, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Dinca, V. [National Institute for Lasers, Plasma and Radiation Physics, 409 Atomistilor Street, PO Box MG-16, 077125 Magurele (Romania); Cannatà, D. [Institute of Acoustics and Sensors “O. M. Corbino”, National Research Council of Italy, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Verona, E. [Institute for Photonics and Nanotechnologies, National Research Council of Italy, Via del Cineto Romano 42, 00156 Rome (Italy); D’Auria, S. [Institute of Protein Biochemistry, National Research Council of Italy, Via Pietro Castellino 111, 80131 Naples (Italy); Dinescu, M. [National Institute for Lasers, Plasma and Radiation Physics, 409 Atomistilor Street, PO Box MG-16, 077125 Magurele (Romania)

    2014-05-01

    In this study, wild type bovine odorant-binding proteins (wtbOBPs) were deposited by matrix-assisted pulsed laser evaporation (MAPLE) and utilized as active material on surface acoustic wave (SAW) biosensors. Fourier transform infrared spectroscopy (FTIR), and atomic force microscopy (AFM) were used to determine the chemical, morphological characteristics of the protein thin films. The FTIR data demonstrates that the functional groups of wtbOBPs do not suffer significant changes in the MAPLE-deposited films when compared to the reference one. The topographical studies show that the homogeneity, density and the roughness of the coatings are related mainly to the laser parameters (fluence and number of pulses). SAW biosensor responses to different concentrations of R-(–)-1-octen-3-ol (octenol) and R-(–)-carvone (carvone) were evaluated. The obtained sensitivities, achieved through the optimization of deposition parameters, demonstrated that MAPLE is a promising deposition technique for SAW biosensor implementation.

  12. Surface adsorption of lattice HP proteins: Thermodynamics and structural transitions using Wang-Landau sampling

    International Nuclear Information System (INIS)

    Li Yingwai; Landau, David P; Wüst, Thomas

    2012-01-01

    Wang-Landau sampling has been applied to investigate the thermodynamics and structural properties of a lattice hydrophobic-polar heteropolymer (the HP protein model) interacting with an attractive substrate. For simplicity, we consider a short HP sequence consisting of only 36 monomers interacting with a substrate which attracts all monomers in the sequence. The conformational “phase transitions” have been identified by a canonical analysis of the specific heat and suitable structural observables. Three major “transitions”, namely, adsorption, hydrophobic core formation and “flattening” of adsorbed structures, are observed. Depending on the surface attractive strength relative to the intra-protein attraction among the H monomers, these processes take place in different sequences upon cooling.

  13. Low level chemiluminescence measurement of the binding of 8-methoxypsoralen to proteins and lymphocytic surfaces

    International Nuclear Information System (INIS)

    Lange, B.

    1980-01-01

    Photochemotherapy with 8-methoxypsoralen (8-MOP) and longwave ultraviolet light is beneficial in such different disorders like psoriasis, lichen planus, and mykosis fungoides. In contrast to a widely accepted hypothesis 8-MOP does not solely bind to nucleic acid, but also to certain proteins. The mechanism of this binding as well as the precise binding area are unknown. Therefore the UV-provoked reactions of 8-MOP with a lipid mixture, a glucosaminoglycan solution, a protein solution, and lymphocyte suspensions, respectively were investigated using low level chemiluminescence (LLCL). It was found an 8-MOP concentration-dependent decrease of LLCL intensity in the lymphocyte suspensions (10 3 to 10 4 cells/μl). This effect is result of the diminution of the photoactive 8-MOP content of the solution. 8-MOP binds quickly and in the course of a free radical reaction to lymphocytic surfaces and coincidentally loses its potency to start LLCL-detectable free radical chain responses. (author)

  14. Selective cell-surface labeling of the molecular motor protein prestin

    International Nuclear Information System (INIS)

    McGuire, Ryan M.; Silberg, Jonathan J.; Pereira, Fred A.; Raphael, Robert M.

    2011-01-01

    Highlights: → Trafficking to the plasma membrane is required for prestin function. → Biotin acceptor peptide (BAP) was fused to prestin through a transmembrane domain. → BAP-prestin can be metabolically labeled with biotin in HEK293 cells. → Biotin-BAP-prestin allows for selective imaging of fully trafficked prestin. → The biotin-BAP-prestin displays voltage-sensitive activity. -- Abstract: Prestin, a multipass transmembrane protein whose N- and C-termini are localized to the cytoplasm, must be trafficked to the plasma membrane to fulfill its cellular function as a molecular motor. One challenge in studying prestin sequence-function relationships within living cells is separating the effects of amino acid substitutions on prestin trafficking, plasma membrane localization and function. To develop an approach for directly assessing prestin levels at the plasma membrane, we have investigated whether fusion of prestin to a single pass transmembrane protein results in a functional fusion protein with a surface-exposed N-terminal tag that can be detected in living cells. We find that fusion of the biotin-acceptor peptide (BAP) and transmembrane domain of the platelet-derived growth factor receptor (PDGFR) to the N-terminus of prestin-GFP yields a membrane protein that can be metabolically-labeled with biotin, trafficked to the plasma membrane, and selectively detected at the plasma membrane using fluorescently-tagged streptavidin. Furthermore, we show that the addition of a surface detectable tag and a single-pass transmembrane domain to prestin does not disrupt its voltage-sensitive activity.

  15. Probing protein surface with a solvent mimetic carbene coupled to detection by mass spectrometry.

    Science.gov (United States)

    Gómez, Gabriela E; Mundo, Mariana R; Craig, Patricio O; Delfino, José M

    2012-01-01

    Much knowledge into protein folding, ligand binding, and complex formation can be derived from the examination of the nature and size of the accessible surface area (SASA) of the polypeptide chain, a key parameter in protein science not directly measurable in an experimental fashion. To this end, an ideal chemical approach should aim at exerting solvent mimicry and achieving minimal selectivity to probe the protein surface regardless of its chemical nature. The choice of the photoreagent diazirine to fulfill these goals arises from its size comparable to water and from being a convenient source of the extremely reactive methylene carbene (:CH(2)). The ensuing methylation depends primarily on the solvent accessibility of the polypeptide chain, turning it into a valuable signal to address experimentally the measurement of SASA in proteins. The superb sensitivity and high resolution of modern mass spectrometry techniques allows us to derive a quantitative signal proportional to the extent of modification (EM) of the sample. Thus, diazirine labeling coupled to electrospray mass spectrometry (ESI-MS) detection can shed light on conformational features of the native as well as non-native states, not easily addressable by other methods. Enzymatic fragmentation of the polypeptide chain at the level of small peptides allows us to locate the covalent tag along the amino acid sequence, therefore enabling the construction of a map of solvent accessibility. Moreover, by subsequent MS/MS analysis of peptides, we demonstrate here the feasibility of attaining amino acid resolution in defining the target sites. © American Society for Mass Spectrometry, 2011

  16. Glial cell adhesion and protein adsorption on SAM coated semiconductor and glass surfaces of a microfluidic structure

    Science.gov (United States)

    Sasaki, Darryl Y.; Cox, Jimmy D.; Follstaedt, Susan C.; Curry, Mark S.; Skirboll, Steven K.; Gourley, Paul L.

    2001-05-01

    The development of microsystems that merge biological materials with microfabricated structures is highly dependent on the successful interfacial interactions between these innately incompatible materials. Surface passivation of semiconductor and glass surfaces with thin organic films can attenuate the adhesion of proteins and cells that lead to biofilm formation and biofouling of fluidic structures. We have examined the adhesion of glial cells and serum albumin proteins to microfabricated glass and semiconductor surfaces coated with self-assembled monolayers of octadecyltrimethoxysilane and N-(triethoxysilylpropyl)-O- polyethylene oxide urethane, to evaluate the biocompatibility and surface passivation those coatings provide.

  17. Arabinogalactan-proteins and the research challenges for these enigmatic plant cell surface proteoglycans

    Science.gov (United States)

    Tan, Li; Showalter, Allan M.; Egelund, Jack; Hernandez-Sanchez, Arianna; Doblin, Monika S.; Bacic, Antony

    2012-01-01

    Arabinogalactan-proteins (AGPs) are complex glycoconjugates that are commonly found at the cell surface and in secretions of plants. Their location and diversity of structures have made them attractive targets as modulators of plant development but definitive proof of their direct role(s) in biological processes remains elusive. Here we overview the current state of knowledge on AGPs, identify key challenges impeding progress in the field and propose approaches using modern bioinformatic, (bio)chemical, cell biological, molecular and genetic techniques that could be applied to redress these gaps in our knowledge. PMID:22754559

  18. Iodo-gen-catalysed iodination for identification of surface-exposed outer membrane proteins of Escherichia coli K12

    International Nuclear Information System (INIS)

    Ferreira, L.C.S.; Almeida, D.F. de

    1987-01-01

    Surface proteins of Escherichia coli K12 were identified by radiolabelling using 1,3,4,6 - tatrachloro, 3-alpha, 6-alpha - diphenylgycoluryl (Iodo-Gen) and 131 I. Labelled proteins were localized in the outer membrane of the cells. Using this technique it has been possible to observe technique it has been possible to observe that the eletrophoretic pattern of surface proteins changes according to the growth phases in culture. Radiolabelling of E.coli cells inculbated at 42 0 C showed that the syntheses of two surface proteins were temperature-inducible. At least one such protein may be involved in the process of cell division in E.coli K12. (author) [pt

  19. Bee venom phospholipase A2 as a membrane-binding vector for cell surface display or internalization of soluble proteins.

    Science.gov (United States)

    Babon, Aurélie; Wurceldorf, Thibault; Almunia, Christine; Pichard, Sylvain; Chenal, Alexandre; Buhot, Cécile; Beaumelle, Bruno; Gillet, Daniel

    2016-06-15

    We showed that bee venom phospholipase A2 can be used as a membrane-binding vector to anchor to the surface of cells a soluble protein fused to its C-terminus. ZZ, a two-domain derivative of staphylococcal protein A capable of binding constant regions of antibodies was fused to the C-terminus of the phospholipase or to a mutant devoid of enzymatic activity. The fusion proteins bound to the surface of cells and could themselves bind IgGs. Their fate depended on the cell type to which they bound. On the A431 carcinoma cell line the proteins remained exposed on the cell surface. In contrast, on human dendritic cells the proteins were internalized into early endosomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Atomistic simulation of the coupled adsorption and unfolding of protein GB1 on the polystyrenes nanoparticle surface

    Science.gov (United States)

    Xiao, HuiFang; Huang, Bin; Yao, Ge; Kang, WenBin; Gong, Sheng; Pan, Hai; Cao, Yi; Wang, Jun; Zhang, Jian; Wang, Wei

    2018-03-01

    Understanding the processes of protein adsorption/desorption on nanoparticles' surfaces is important for the development of new nanotechnology involving biomaterials; however, an atomistic resolution picture for these processes and for the simultaneous protein conformational change is missing. Here, we report the adsorption of protein GB1 on a polystyrene nanoparticle surface using atomistic molecular dynamic simulations. Enabled by metadynamics, we explored the relevant phase space and identified three protein states, each involving both the adsorbed and desorbed modes. We also studied the change of the secondary and tertiary structures of GB1 during adsorption and the dominant interactions between the protein and surface in different adsorption stages. The results we obtained from simulation were found to be more adequate and complete than the previous one. We believe the model presented in this paper, in comparison with the previous ones, is a better theoretical model to understand and explain the experimental results.

  1. Iodo-gen-catalysed iodination for identification of surface-exposed outer membrane proteins of Escherichia coli K12

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, L C.S.; Almeida, D.F. de

    1987-12-01

    Surface proteins of Escherichia coli K12 were identified by radiolabelling using 1,3,4,6 - tatrachloro, 3-alpha, 6-alpha - diphenylgycoluryl (Iodo-Gen) and /sup 131/I. Labelled proteins were localized in the outer membrane of the cells. Using this technique it has been possible to observe technique it has been possible to observe that the eletrophoretic pattern of surface proteins changes according to the growth phases in culture. Radiolabelling of E.coli cells inculbated at 42/sup 0/C showed that the syntheses of two surface proteins were temperature-inducible. At least one such protein may be involved in the process of cell division in E.coli K12.

  2. Effects of surface proteins and lipids on molecular structure, thermal properties, and enzymatic hydrolysis of rice starch

    Directory of Open Access Journals (Sweden)

    Pan HU

    Full Text Available Abstract Rice starches with different amylose contents were treated with sodium dodecyl sulfate (SDS to deplete surface proteins and lipids, and the changes in molecular structure, thermal properties, and enzymatic hydrolysis were evaluated. SDS treatment did not significantly change the molecular weight distribution, crystalline structure, short-range ordered degree, and gelatinization properties of starch, but significantly altered the pasting properties and increased the swelling power of starch. The removal of surface proteins and lipids increased the enzymatic hydrolysis and in vitro digestion of starch. The influences of removing surface proteins and lipids from starch on swelling power, pasting properties, and enzymatic hydrolysis were different among the various starches because of the differences in molecular structures of different starch styles. The aforementioned results indicated that removing the surface proteins and lipids from starch did not change the molecular structure but had significant effects on some functional properties.

  3. The effect of amorphous silicon surface hydrogenation on morphology, wettability and its implication on the adsorption of proteins

    Energy Technology Data Exchange (ETDEWEB)

    Filali, Larbi, E-mail: larbifilali5@gmail.com [Laboratoire de Physique des Couches Minces et Matériaux pour l' Electronique, Université d' Oran 1, Ahmed Ben Bella, BP 1524, El M' naouar 31100 Oran (Algeria); Brahmi, Yamina; Sib, Jamal Dine [Laboratoire de Physique des Couches Minces et Matériaux pour l' Electronique, Université d' Oran 1, Ahmed Ben Bella, BP 1524, El M' naouar 31100 Oran (Algeria); Bouhekka, Ahmed [Laboratoire de Physique des Couches Minces et Matériaux pour l' Electronique, Université d' Oran 1, Ahmed Ben Bella, BP 1524, El M' naouar 31100 Oran (Algeria); Département de Physique, Université Hassiba Ben Bouali, 02000 Chlef (Algeria); Benlakehal, Djamel; Bouizem, Yahya; Kebab, Aissa; Chahed, Larbi [Laboratoire de Physique des Couches Minces et Matériaux pour l' Electronique, Université d' Oran 1, Ahmed Ben Bella, BP 1524, El M' naouar 31100 Oran (Algeria)

    2016-10-30

    Highlights: • Hydrogenation of the surfaces had the effect of reducing the roughness by way of shadow etching. • Roughness was the driving factor affecting the wettability of the hydrogenated surfaces. • Bovine Serum Albumin proteins favored the surfaces with highest hydrogen content. • Surface modification induced secondary structure change of adsorbed proteins. - Abstract: We study the effect of amorphous silicon (a-Si) surface hydrogenation on Bovine Serum Albumin (BSA) adsorption. A set of (a-Si) films was prepared by radio frequency magnetron sputtering (RFMS) and after deposition; they were treated in molecular hydrogen ambient at different pressures (1–3 Pa). Fourier transform infrared attenuated total reflection (FTIR-ATR) spectroscopy and spectroscopic ellipsometry (SE) were used to study the hydrogenation effect and BSA adsorption. Atomic force microscopy (AFM) was used to evaluate morphological changes caused by hydrogenation. The wettability of the films was measured using contact angle measurement, and in the case of the hydrogenated surfaces, it was found to be driven by surface roughness. FTIR-ATR spectroscopy and SE measurements show that proteins had the strongest affinity toward the surfaces with the highest hydrogen content and their secondary structure was affected by a significant decrease of the α-helix component (-27%) compared with the proteins adsorbed on the un-treated surface, which had a predominantly α-helix (45%) structure. The adsorbed protein layer was found to be densely packed with a large thickness (30.9 nm) on the hydrogen-rich surfaces. The most important result is that the surface hydrogen content was the dominant factor, compared to wettability and morphology, for protein adsorption.

  4. Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

    Directory of Open Access Journals (Sweden)

    Aino L K Liukko

    Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

  5. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  6. The promotion of osseointegration of titanium surfaces by coating with silk protein sericin.

    Science.gov (United States)

    Nayak, Sunita; Dey, Tuli; Naskar, Deboki; Kundu, Subhas C

    2013-04-01

    A promising strategy to influence the osseointegration process around orthopaedic titanium implants is the immobilization of bioactive molecules. This recruits appropriate interaction between the surface and the tissue by directing cells adhesion, proliferation, differentiation and active matrix remodelling. In this study, we aimed to investigate the functionalization of metallic implant titanium with silk protein sericin. Titanium surface was immobilized with non-mulberry Antheraea mylitta sericin using glutaraldehyde as crosslinker. To analyse combinatorial effects the sericin immobilized titanium was further conjugated with integrin binding peptide sequence Arg-Gly-Asp (RGD) using ethyl (dimethylaminopropyl) carbodiimide and N-hydroxysulfosuccinimide as coupling agents. The surface of sericin immobilized titanium was characterized biophysically. Osteoblast-like cells were cultured on sericin and sericin/RGD functionalized titanium and found to be more viable than those on pristine titanium. The enhanced adhesion, proliferation, and differentiation of osteoblast cells were observed. RT-PCR analysis showed that mRNA expressions of bone sialoprotein, osteocalcin and alkaline phosphatase were upregulated in osteoblast cells cultured on sericin and sericin/RGD immobilized titanium substrates. Additionally, no significant amount of pro-inflammatory cytokines TNF-α, IL-1β and nitric oxide production were recorded when macrophages cells and osteoblast-macrophages co culture cells were grown on sericin immobilized titanium. The findings demonstrate that the sericin immobilized titanium surfaces are potentially useful bioactive coated materials for titanium-based medical implants. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Electrophoresis in ice surface grooves for probing protein affinity to a specific plane of ice crystal.

    Science.gov (United States)

    Inagawa, Arinori; Okada, Yusuke; Okada, Tetsuo

    2018-06-01

    Channel-like grooves are formed on the surface of frozen aqueous sucrose. They are filled with a freeze concentrated solution (FCS) and act as an efficient size-tunable separation field for micro and nanoparticles. The width of the channel can be easily varied by changing the temperature. Because the channel width decreases with decreasing temperature, particles become immobilized due to physical interference from the ice wall when the temperature reaches a threshold point specific to the particle size. Surface modification of particles can add a factor of chemical interaction between the particles and ice walls. In this study, anti-freeze proteins (AFPs) are anchored on 1µm-polystyrene (PS) particles, and their behavior in the surface grooves on the ice is studied. The threshold temperature is an effective criterion for evaluating chemical interactions between particles and ice walls. The AFP binding on 1µm PS particles lowers the threshold temperature by 2.5°C, indicating interactions between AFPs on the PS particles and the ice wall. Because the AFPs studied here show selectivity towards the prism plane, it is critical that the prism plane of the ice crystal is in contact with the FCS in the surface grooves. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. PL-PatchSurfer: a novel molecular local surface-based method for exploring protein-ligand interactions.

    Science.gov (United States)

    Hu, Bingjie; Zhu, Xiaolei; Monroe, Lyman; Bures, Mark G; Kihara, Daisuke

    2014-08-27

    Structure-based computational methods have been widely used in exploring protein-ligand interactions, including predicting the binding ligands of a given protein based on their structural complementarity. Compared to other protein and ligand representations, the advantages of a surface representation include reduced sensitivity to subtle changes in the pocket and ligand conformation and fast search speed. Here we developed a novel method named PL-PatchSurfer (Protein-Ligand PatchSurfer). PL-PatchSurfer represents the protein binding pocket and the ligand molecular surface as a combination of segmented surface patches. Each patch is characterized by its geometrical shape and the electrostatic potential, which are represented using the 3D Zernike descriptor (3DZD). We first tested PL-PatchSurfer on binding ligand prediction and found it outperformed the pocket-similarity based ligand prediction program. We then optimized the search algorithm of PL-PatchSurfer using the PDBbind dataset. Finally, we explored the utility of applying PL-PatchSurfer to a larger and more diverse dataset and showed that PL-PatchSurfer was able to provide a high early enrichment for most of the targets. To the best of our knowledge, PL-PatchSurfer is the first surface patch-based method that treats ligand complementarity at protein binding sites. We believe that using a surface patch approach to better understand protein-ligand interactions has the potential to significantly enhance the design of new ligands for a wide array of drug-targets.

  9. The role of Listeria monocytogenes cell wall surface anchor protein LapB in virulence, adherence, and intracellular replication

    Science.gov (United States)

    Lmof2365_2117 is a Listeria monocytogenes putative cell wall surface anchor protein with a conserved domain found in collagen binding proteins. We constructed a deletion mutation in lmof2365_2117 in serotype 4b strain F2365, evaluated its virulence, and determined its ability to adhere and invade co...

  10. On the lipid head group hydration of floating surface monolayers bound to self-assembled molecular protein layers

    DEFF Research Database (Denmark)

    Lösche, M.; Erdelen, C.; Rump, E.

    1994-01-01

    kept at low surface pressure before protein adsorption. The introduction of dipole moments at the interface by the admixture of phospholipids or the application of lateral pressure on the lipid monolayer before protein adsorption were found to impose an extension of the spacer moieties. The biotin...

  11. Characterization of sperm surface protein patterns of ejaculated and capacitated boar sperm, with the detection of ZP binding candidates

    Czech Academy of Sciences Publication Activity Database

    Zigo, Michal; Jonáková, Věra; Šulc, Miroslav; Maňásková-Postlerová, Pavla

    2013-01-01

    Roč. 61, oct (2013), s. 322-328 ISSN 0141-8130 R&D Projects: GA ČR GAP503/12/1834 Institutional research plan: CEZ:AV0Z50520701 Institutional support: RVO:61388971 Keywords : Sperm surface protein * Zona pellucida-binding receptors * PKDREJ protein Subject RIV: CE - Biochemistry Impact factor: 3.096, year: 2013

  12. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d

    Directory of Open Access Journals (Sweden)

    Moffatt Barbara A

    2010-08-01

    Full Text Available Abstract Background Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB for coplanar aromatic motifs similar to those found in known glycan-binding proteins. Results The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192 in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Conclusions Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  13. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

    Science.gov (United States)

    Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

    2010-08-03

    Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  14. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  15. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  16. Quantitative Analysis of Hepatitis C NS5A Viral Protein Dynamics on the ER Surface

    Science.gov (United States)

    Nägel, Arne; Reiter, Sebastian; Vogel, Andreas; McLauchlan, John; Herrmann, Eva; Wittum, Gabriel

    2018-01-01

    Exploring biophysical properties of virus-encoded components and their requirement for virus replication is an exciting new area of interdisciplinary virological research. To date, spatial resolution has only rarely been analyzed in computational/biophysical descriptions of virus replication dynamics. However, it is widely acknowledged that intracellular spatial dependence is a crucial component of virus life cycles. The hepatitis C virus-encoded NS5A protein is an endoplasmatic reticulum (ER)-anchored viral protein and an essential component of the virus replication machinery. Therefore, we simulate NS5A dynamics on realistic reconstructed, curved ER surfaces by means of surface partial differential equations (sPDE) upon unstructured grids. We match the in silico NS5A diffusion constant such that the NS5A sPDE simulation data reproduce experimental NS5A fluorescence recovery after photobleaching (FRAP) time series data. This parameter estimation yields the NS5A diffusion constant. Such parameters are needed for spatial models of HCV dynamics, which we are developing in parallel but remain qualitative at this stage. Thus, our present study likely provides the first quantitative biophysical description of the movement of a viral component. Our spatio-temporal resolved ansatz paves new ways for understanding intricate spatial-defined processes central to specfic aspects of virus life cycles. PMID:29316722

  17. Quantitative Analysis of Hepatitis C NS5A Viral Protein Dynamics on the ER Surface

    KAUST Repository

    Knodel, Markus

    2018-01-08

    Exploring biophysical properties of virus-encoded components and their requirement for virus replication is an exciting new area of interdisciplinary virological research. To date, spatial resolution has only rarely been analyzed in computational/biophysical descriptions of virus replication dynamics. However, it is widely acknowledged that intracellular spatial dependence is a crucial component of virus life cycles. The hepatitis C virus-encoded NS5A protein is an endoplasmatic reticulum (ER)-anchored viral protein and an essential component of the virus replication machinery. Therefore, we simulate NS5A dynamics on realistic reconstructed, curved ER surfaces by means of surface partial differential equations (sPDE) upon unstructured grids. We match the in silico NS5A diffusion constant such that the NS5A sPDE simulation data reproduce experimental NS5A fluorescence recovery after photobleaching (FRAP) time series data. This parameter estimation yields the NS5A diffusion constant. Such parameters are needed for spatial models of HCV dynamics, which we are developing in parallel but remain qualitative at this stage. Thus, our present study likely provides the first quantitative biophysical description of the movement of a viral component. Our spatio-temporal resolved ansatz paves new ways for understanding intricate spatial-defined processes central to specfic aspects of virus life cycles.

  18. Quantitative Analysis of Hepatitis C NS5A Viral Protein Dynamics on the ER Surface

    Directory of Open Access Journals (Sweden)

    Markus M. Knodel

    2018-01-01

    Full Text Available Exploring biophysical properties of virus-encoded components and their requirement for virus replication is an exciting new area of interdisciplinary virological research. To date, spatial resolution has only rarely been analyzed in computational/biophysical descriptions of virus replication dynamics. However, it is widely acknowledged that intracellular spatial dependence is a crucial component of virus life cycles. The hepatitis C virus-encoded NS5A protein is an endoplasmatic reticulum (ER-anchored viral protein and an essential component of the virus replication machinery. Therefore, we simulate NS5A dynamics on realistic reconstructed, curved ER surfaces by means of surface partial differential equations (sPDE upon unstructured grids. We match the in silico NS5A diffusion constant such that the NS5A sPDE simulation data reproduce experimental NS5A fluorescence recovery after photobleaching (FRAP time series data. This parameter estimation yields the NS5A diffusion constant. Such parameters are needed for spatial models of HCV dynamics, which we are developing in parallel but remain qualitative at this stage. Thus, our present study likely provides the first quantitative biophysical description of the movement of a viral component. Our spatio-temporal resolved ansatz paves new ways for understanding intricate spatial-defined processes central to specfic aspects of virus life cycles.

  19. Quantitative Analysis of Hepatitis C NS5A Viral Protein Dynamics on the ER Surface.

    Science.gov (United States)

    Knodel, Markus M; Nägel, Arne; Reiter, Sebastian; Vogel, Andreas; Targett-Adams, Paul; McLauchlan, John; Herrmann, Eva; Wittum, Gabriel

    2018-01-08

    Exploring biophysical properties of virus-encoded components and their requirement for virus replication is an exciting new area of interdisciplinary virological research. To date, spatial resolution has only rarely been analyzed in computational/biophysical descriptions of virus replication dynamics. However, it is widely acknowledged that intracellular spatial dependence is a crucial component of virus life cycles. The hepatitis C virus-encoded NS5A protein is an endoplasmatic reticulum (ER)-anchored viral protein and an essential component of the virus replication machinery. Therefore, we simulate NS5A dynamics on realistic reconstructed, curved ER surfaces by means of surface partial differential equations (sPDE) upon unstructured grids. We match the in silico NS5A diffusion constant such that the NS5A sPDE simulation data reproduce experimental NS5A fluorescence recovery after photobleaching (FRAP) time series data. This parameter estimation yields the NS5A diffusion constant. Such parameters are needed for spatial models of HCV dynamics, which we are developing in parallel but remain qualitative at this stage. Thus, our present study likely provides the first quantitative biophysical description of the movement of a viral component. Our spatio-temporal resolved ansatz paves new ways for understanding intricate spatial-defined processes central to specfic aspects of virus life cycles.

  20. Antibody Competition Reveals Surface Location of HPV L2 Minor Capsid Protein Residues 17–36

    Directory of Open Access Journals (Sweden)

    Stephanie M. Bywaters

    2017-11-01

    Full Text Available The currently available nonavalent human papillomavirus (HPV vaccine exploits the highly antigenic L1 major capsid protein to promote high-titer neutralizing antibodies, but is limited to the HPV types included in the vaccine since the responses are highly type-specific. The limited cross-protection offered by the L1 virus-like particle (VLP vaccine warrants further investigation into cross-protective L2 epitopes. The L2 proteins are yet to be fully characterized as to their precise placement in the virion. Adding to the difficulties in localizing L2, studies have suggested that L2 epitopes are not well exposed on the surface of the mature capsid prior to cellular engagement. Using a series of competition assays between previously mapped anti-L1 monoclonal antibodies (mAbs (H16.V5, H16.U4 and H16.7E and novel anti-L2 mAbs, we probed the capsid surface for the location of an L2 epitope (aa17–36. The previously characterized L1 epitopes together with our competition data is consistent with a proposed L2 epitope within the canyons of pentavalent capsomers.

  1. Antibody Competition Reveals Surface Location of HPV L2 Minor Capsid Protein Residues 17-36.

    Science.gov (United States)

    Bywaters, Stephanie M; Brendle, Sarah A; Tossi, Kerstin P; Biryukov, Jennifer; Meyers, Craig; Christensen, Neil D

    2017-11-10

    The currently available nonavalent human papillomavirus (HPV) vaccine exploits the highly antigenic L1 major capsid protein to promote high-titer neutralizing antibodies, but is limited to the HPV types included in the vaccine since the responses are highly type-specific. The limited cross-protection offered by the L1 virus-like particle (VLP) vaccine warrants further investigation into cross-protective L2 epitopes. The L2 proteins are yet to be fully characterized as to their precise placement in the virion. Adding to the difficulties in localizing L2, studies have suggested that L2 epitopes are not well exposed on the surface of the mature capsid prior to cellular engagement. Using a series of competition assays between previously mapped anti-L1 monoclonal antibodies (mAbs) (H16.V5, H16.U4 and H16.7E) and novel anti-L2 mAbs, we probed the capsid surface for the location of an L2 epitope (aa17-36). The previously characterized L1 epitopes together with our competition data is consistent with a proposed L2 epitope within the canyons of pentavalent capsomers.

  2. On the computation of molecular surface correlations for protein docking using fourier techniques.

    Science.gov (United States)

    Sakk, Eric

    2007-08-01

    The computation of surface correlations using a variety of molecular models has been applied to the unbound protein docking problem. Because of the computational complexity involved in examining all possible molecular orientations, the fast Fourier transform (FFT) (a fast numerical implementation of the discrete Fourier transform (DFT)) is generally applied to minimize the number of calculations. This approach is rooted in the convolution theorem which allows one to inverse transform the product of two DFTs in order to perform the correlation calculation. However, such a DFT calculation results in a cyclic or "circular" correlation which, in general, does not lead to the same result as the linear correlation desired for the docking problem. In this work, we provide computational bounds for constructing molecular models used in the molecular surface correlation problem. The derived bounds are then shown to be consistent with various intuitive guidelines previously reported in the protein docking literature. Finally, these bounds are applied to different molecular models in order to investigate their effect on the correlation calculation.

  3. N-Terminal Plasmodium vivax Merozoite Surface Protein-1, a Potential Subunit for Malaria Vivax Vaccine

    Directory of Open Access Journals (Sweden)

    Fernanda G. Versiani

    2013-01-01

    Full Text Available The human malaria is widely distributed in the Middle East, Asia, the western Pacific, and Central and South America. Plasmodium vivax started to have the attention of many researchers since it is causing diseases to millions of people and several reports of severe malaria cases have been noticed in the last few years. The lack of in vitro cultures for P. vivax represents a major delay in developing a functional malaria vaccine. One of the major candidates to antimalarial vaccine is the merozoite surface protein-1 (MSP1, which is expressed abundantly on the merozoite surface and capable of activating the host protective immunity. Studies have shown that MSP-1 possesses highly immunogenic fragments, capable of generating immune response and protection in natural infection in endemic regions. This paper shows humoral immune response to different proteins of PvMSP1 and the statement of N-terminal to be added to the list of potential candidates for malaria vivax vaccine.

  4. Experimental approach to controllably vary protein oxidation while minimizing electrode adsorption for boron-doped diamond electrochemical surface mapping applications.

    Science.gov (United States)

    McClintock, Carlee S; Hettich, Robert L

    2013-01-02

    Oxidative protein surface mapping has become a powerful approach for measuring the solvent accessibility of folded protein structures. A variety of techniques exist for generating the key reagent (i.e., hydroxyl radicals) for these measurements; however, these approaches range significantly in their complexity and expense of operation. This research expands upon earlier work to enhance the controllability of boron-doped diamond (BDD) electrochemistry as an easily accessible tool for producing hydroxyl radicals in order to oxidize a range of intact proteins. Efforts to modulate the oxidation level while minimizing the adsorption of protein to the electrode involved the use of relatively high flow rates to reduce protein residence time inside the electrochemical flow chamber. Additionally, a different cell activation approach using variable voltage to supply a controlled current allowed us to precisely tune the extent of oxidation in a protein-dependent manner. In order to gain perspective on the level of protein adsorption onto the electrode surface, studies were conducted to monitor protein concentration during electrolysis and gauge changes in the electrode surface between cell activation events. This report demonstrates the successful use of BDD electrochemistry for greater precision in generating a target number of oxidation events upon intact proteins.

  5. Screening for Glycosylphosphatidylinositol-Modified Cell Wall Proteins in Pichia pastoris and Their Recombinant Expression on the Cell Surface

    Science.gov (United States)

    Zhang, Li; Liang, Shuli; Zhou, Xinying; Jin, Zi; Jiang, Fengchun; Han, Shuangyan; Zheng, Suiping

    2013-01-01

    Glycosylphosphatidylinositol (GPI)-anchored glycoproteins have various intrinsic functions in yeasts and different uses in vitro. In the present study, the genome of Pichia pastoris GS115 was screened for potential GPI-modified cell wall proteins. Fifty putative GPI-anchored proteins were selected on the basis of (i) the presence of a C-terminal GPI attachment signal sequence, (ii) the presence of an N-terminal signal sequence for secretion, and (iii) the absence of transmembrane domains in mature protein. The predicted GPI-anchored proteins were fused to an alpha-factor secretion signal as a substitute for their own N-terminal signal peptides and tagged with the chimeric reporters FLAG tag and mature Candida antarctica lipase B (CALB). The expression of fusion proteins on the cell surface of P. pastoris GS115 was determined by whole-cell flow cytometry and immunoblotting analysis of the cell wall extracts obtained by β-1,3-glucanase digestion. CALB displayed on the cell surface of P. pastoris GS115 with the predicted GPI-anchored proteins was examined on the basis of potential hydrolysis of p-nitrophenyl butyrate. Finally, 13 proteins were confirmed to be GPI-modified cell wall proteins in P. pastoris GS115, which can be used to display heterologous proteins on the yeast cell surface. PMID:23835174

  6. The regulated synthesis of a Bacillus anthracis spore coat protein that affects spore surface properties.

    Science.gov (United States)

    Aronson, A; Goodman, B; Smith, Z

    2014-05-01

    Examine the regulation of a spore coat protein and the effects on spore properties. A c. 23 kDa band in coat/exosporial extracts of Bacillus anthracis Sterne spores varied in amount depending upon the conditions of sporulation. It was identified by MALDI as a likely orthologue of ExsB of Bacillus cereus. Little if any was present in an exosporial preparation with a location to the inner coat/cortex region established by spore fractionation and immunogold labelling of electron micrograph sections. Because of its predominant location in the inner coat, it has been renamed Cotγ. It was relatively deficient in spores produced at 37°C and when acidic fermentation products were produced a difference attributable to transcriptional regulation. The deficiency or absence of Cotγ resulted in a less robust exosporium positioned more closely to the coat. These spores were less hydrophobic and germinated somewhat more rapidly. Hydrophobicity and appearance were rescued in the deletion strain by introduction of the cotγ gene. The deficiency or lack of a protein largely found in the inner coat altered spore hydrophobicity and surface appearance. The regulated synthesis of Cotγ may be a paradigm for other spore coat proteins with unknown functions that modulate spore properties in response to environmental conditions. © 2014 The Society for Applied Microbiology.

  7. Rapid generation of protein aerosols and nanoparticles via surface acoustic wave atomization

    International Nuclear Information System (INIS)

    Alvarez, Mar; Friend, James; Yeo, Leslie Y

    2008-01-01

    We describe the fabrication of a surface acoustic wave (SAW) atomizer and show its ability to generate monodisperse aerosols and particles for drug delivery applications. In particular, we demonstrate the generation of insulin liquid aerosols for pulmonary delivery and solid protein nanoparticles for transdermal and gastrointestinal delivery routes using 20 MHz SAW devices. Insulin droplets around 3 μm were obtained, matching the optimum range for maximizing absorption in the alveolar region. A new approach is provided to explain these atomized droplet diameters by returning to fundamental physical analysis and considering viscous-capillary and inertial-capillary force balance rather than employing modifications to the Kelvin equation under the assumption of parametric forcing that has been extended to these frequencies in past investigations. In addition, we consider possible mechanisms by which the droplet ejections take place with the aid of high-speed flow visualization. Finally, we show that nanoscale protein particles (50-100 nm in diameter) were obtained through an evaporative process of the initial aerosol, the final size of which could be controlled merely by modifying the initial protein concentration. These results illustrate the feasibility of using SAW as a novel method for rapidly producing particles and droplets with a controlled and narrow size distribution.

  8. High fidelity nanopatterning of proteins onto well-defined surfaces through subtractive contact printing.

    Science.gov (United States)

    García, José R; Singh, Ankur; García, Andrés J

    2014-01-01

    In the pursuit to develop enhanced technologies for cellular bioassays as well as understand single cell interactions with its underlying substrate, the field of biotechnology has extensively utilized lithographic techniques to spatially pattern proteins onto surfaces in user-defined geometries. Microcontact printing (μCP) remains an incredibly useful patterning method due to its inexpensive nature, scalability, and the lack of considerable use of specialized clean room equipment. However, as new technologies emerge that necessitate various nano-sized areas of deposited proteins, traditional μCP methods may not be able to supply users with the needed resolution size. Recently, our group developed a modified "subtractive μCP" method which still retains many of the benefits offered by conventional μCP. Using this technique, we have been able to reach resolution sizes of fibronectin as small as 250 nm in largely spaced arrays for cell culture. In this communication, we present a detailed description of our subtractive μCP procedure that expands on many of the little tips and tricks that together make this procedure an easy and effective method for controlling protein patterning. © 2014 Elsevier Inc. All rights reserved.

  9. Intestinal epithelial cell surface glycosylation in mice. I. Effect of high-protein diet.

    Science.gov (United States)

    Gupta, R; Jaswal, V M; Meenu Mahmood, A

    1992-01-01

    The effects of variation in dietary protein content have been investigated on brush border glycosylation and enzyme activities in mice small intestine. The comparison of different parameters was made between the mice fed 30% (high protein, HP) and 18% protein (pair-fed, PF, and ad libitum-fed) for 21 days. The activities of brush border sucrase, lactase, p-nitrophenyl (PNP)-beta-D-glucosidase and PNP-beta-D-galactosidase were reduced in the HP diet-fed mice compared to PF and ad libitum-fed controls. Alkaline phosphatase and leucine amino-peptidase activities were significantly enhanced while gamma-glutamyl transpeptidase activity was unaltered under these conditions. Total hexoses and sialic acid content in the brush borders were reduced significantly in the test group compared to the controls while hexosamine and fucose contents remained essentially similar in different groups. The results on the binding of wheat germ agglutinin and Ulex europaeus agglutininI to microvillus membranes corroborated the chemical analysis data on sialic acid and fucose contents of the membranes. Peanut agglutinin binding was enhanced in mice from the HP group. Incorporation of (14C)-mannose into membranes was significantly less in HP diet-fed mice. These results indicate that the feeding of HP diet to mice brings about marked alterations in small intestinal epithelial cell surface glycosylation and enzyme functions.

  10. GPI-anchored protein organization and dynamics at the cell surface.

    Science.gov (United States)

    Saha, Suvrajit; Anilkumar, Anupama Ambika; Mayor, Satyajit

    2016-02-01

    The surface of eukaryotic cells is a multi-component fluid bilayer in which glycosylphosphatidylinositol (GPI)-anchored proteins are an abundant constituent. In this review, we discuss the complex nature of the organization and dynamics of GPI-anchored proteins at multiple spatial and temporal scales. Different biophysical techniques have been utilized for understanding this organization, including fluorescence correlation spectroscopy, fluorescence recovery after photobleaching, single particle tracking, and a number of super resolution methods. Major insights into the organization and dynamics have also come from exploring the short-range interactions of GPI-anchored proteins by fluorescence (or Förster) resonance energy transfer microscopy. Based on the nanometer to micron scale organization, at the microsecond to the second time scale dynamics, a picture of the membrane bilayer emerges where the lipid bilayer appears inextricably intertwined with the underlying dynamic cytoskeleton. These observations have prompted a revision of the current models of plasma membrane organization, and suggest an active actin-membrane composite. Copyright © 2016 by the American Society for Biochemistry and Molecular Biology, Inc.

  11. Majority of cellular fatty acid acylated proteins are localized to the cytoplasmic surface of the plasma membrane

    International Nuclear Information System (INIS)

    Wilcox, C.A.; Olson, E.N.

    1987-01-01

    The BC 2 Hl muscle cell line was previously reported to contain a broad array of fatty acid acylated proteins. Palmitate was shown to be attached to membrane proteins posttranslationally through thiol ester linkages, whereas myristate was attached cotranslationally, or within seconds thereafter, to soluble and membrane-bound proteins through amide linkages. The temporal and subcellular differences between palmitate and myristate acylation suggested that these two classes of acyl proteins might follow different intracellular pathways to distinct subcellular membrane systems or organelles. In this study, the authors examined the subcellular localization of the major fatty acylated proteins in BC 4 Hl cells. Palmitate-containing proteins were localized to the plasma membrane, but only a subset of myristate-containing proteins was localized to this membrane fraction. The majority of acyl proteins were nonglycosylated and resistant to digestion with extracellular proteases, suggesting that they were not exposed to the external surface of the plasma membrane. Many proteins were, however, digested during incubation of isolated membranes with proteases, which indicates that these proteins were, however, digested during incubation of isolated membranes with proteases, which indicates that these proteins face the cytoplasm. Two-dimensional gel electrophoresis of proteins labeled with [ 3 H]palmitate and [ 3 H]myristate revealed that individual proteins were modified by only one of the two fatty acids and did not undergo both N-linked myristylation and ester-linked palmitylation. Together, these results suggest that the majority of cellular acyl proteins are routed to the cytoplasmic surface of the plasma membrane, and they raise the possibility that fatty acid acylation may play a role in intracellular sorting of nontransmembranous, nonglycosylated membrane proteins

  12. Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

    2016-10-21

    An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

  13. A novel typing method for Streptococcus pneumoniae using selected surface proteins

    Directory of Open Access Journals (Sweden)

    Arnau eDomenech

    2016-03-01

    Full Text Available The diverse pneumococcal diseases are associated with different pneumococcal lineages, or clonal complexes. Nevertheless, intra-clonal genomic variability, which influences pathogenicity, has been reported for surface virulence factors. These factors constitute the communication interface between the pathogen and its host and their corresponding genes are subjected to strong selective pressures affecting functionality and immunogenicity. First, the presence and allelic dispersion of 97 outer protein families were screened in 19 complete pneumococcal genomes. Seventeen families were deemed variable and were then examined in 216 draft genomes. This procedure allowed the generation of binary vectors with 17 positions and the classification of strains into surfotypes. They represent the outer protein subsets with the highest inter-strain discriminative power. A total of 116 non-redundant surfotypes were identified. Those sharing a critical number of common protein features were hierarchically clustered into 18 surfogroups. Most clonal complexes with comparable epidemiological characteristics belonged to the same or similar surfogroups. However, the very large CC156 clonal complex was dispersed over several surfogroups. In order to establish a relationship between surfogroup and pathogenicity, the surfotypes of 95 clinical isolates with different serogroup/serotype combinations were analysed. We found a significant correlation between surfogroup and type of pathogenic behaviour (primary invasive, opportunistic invasive and non-invasive. We conclude that the virulent behaviour of S. pneumoniae is related to the activity of collections of, rather than individual, surface virulence factors. Since surfotypes evolve faster than MLSTs and directly reflect virulence potential, this novel typing protocol is appropriate for the identification of emerging clones.

  14. A comparison of the adsorption of saliva proteins and some typical proteins onto the surface of hydroxyapatite

    NARCIS (Netherlands)

    Kawasaki, K; Kambara, M; Matsumura, H; Norde, W

    2003-01-01

    Adsorption of protein from saliva on hydroxyapatite was compared with adsorption of several typical proteins with different electric charges, i.e. lysozyme, human serum albumin, beta-lactoglobulin and ovalbumin. Adsorbed amounts of these proteins were determined and electrophoretic mobilities of

  15. A comparison of the adsorption of saliva proteins and some typical proteins onto the surface of hydroxyapatite

    NARCIS (Netherlands)

    Kawasaki, K.; Kambara, M.; Matsumura, H.; Norde, W.

    2003-01-01

    Adsorption of protein from saliva on hydroxyapatite was compared with adsorption of several typical proteins with different electric charges, i.e. lysozyme, human serum albumin, @b-lactoglobulin and ovalbumin. Adsorbed amounts of these proteins were determined and electrophoretic mobilities of

  16. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  17. ProFASTA: a pipeline web server for fungal protein scanning with integration of cell surface prediction software

    NARCIS (Netherlands)

    de Groot, P.W.J.; Brandt, B.W.

    2012-01-01

    Surface proteins, such as those located in the cell wall of fungi, play an important role in the interaction with the surrounding environment. For instance, they mediate primary host-pathogen interactions and are crucial to the establishment of biofilms and fungal infections. Surface localization of

  18. Binding characteristics of thrombin-activatable fibrinolysis inhibitor to streptococcal surface collagen-like proteins A and B

    NARCIS (Netherlands)

    Seron, Mercedes Valls; Plug, Tom; Marquart, J. Arnoud; Marx, Pauline F.; Herwald, Heiko; de Groot, Philip G.; Meijers, Joost C. M.

    2011-01-01

    Streptococcus pyogenes is the causative agent in a wide range of diseases in humans. Thrombin-activatable fibrinolysis inhibitor (TAFI) binds to collagen-like proteins ScIA and ScIB at the surface of S. pyogenes. Activation of TAFI at this surface redirects inflammation from a transient to chronic

  19. Surface properties of heat-induced soluble soy protein aggregates of different molecular masses.

    Science.gov (United States)

    Guo, Fengxian; Xiong, Youling L; Qin, Fang; Jian, Huajun; Huang, Xiaolin; Chen, Jie

    2015-02-01

    Suspensions (2% and 5%, w/v) of soy protein isolate (SPI) were heated at 80, 90, or 100 °C for different time periods to produce soluble aggregates of different molecular sizes to investigate the relationship between particle size and surface properties (emulsions and foams). Soluble aggregates generated in these model systems were characterized by gel permeation chromatography and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Heat treatment increased surface hydrophobicity, induced SPI aggregation via hydrophobic interaction and disulfide bonds, and formed soluble aggregates of different sizes. Heating of 5% SPI always promoted large-size aggregate (LA; >1000 kDa) formation irrespective of temperature, whereas the aggregate size distribution in 2% SPI was temperature dependent: the LA fraction progressively rose with temperature (80→90→100 °C), corresponding to the attenuation of medium-size aggregates (MA; 670 to 1000 kDa) initially abundant at 80 °C. Heated SPI with abundant LA (>50%) promoted foam stability. LA also exhibited excellent emulsifying activity and stabilized emulsions by promoting the formation of small oil droplets covered with a thick interfacial protein layer. However, despite a similar influence on emulsion stability, MA enhanced foaming capacity but were less capable of stabilizing emulsions than LA. The functionality variation between heated SPI samples is clearly related to the distribution of aggregates that differ in molecular size and surface activity. The findings may encourage further research to develop functional SPI aggregates for various commercial applications. © 2015 Institute of Food Technologists®

  20. Surface functionalization of superparamagnetic nanoparticles encapsulated by chitosan for protein immobilization

    International Nuclear Information System (INIS)

    Sousa, Jose Silva de

    2010-01-01

    Nanoscience and nanotechnology have opened up numerous developments of devices and systems on the nanometer scale, with new molecular organization, properties and functions. In this context, the polymeric magnetic nanoparticles are composites formed by magnetic materials with a particle size between 1 and 100 nm combined with functional polymers. They are well-known and have been widely studied because of its applications in various technology areas. Applications on the biological and medical areas include separation and immobilization of enzymes and proteins, improved techniques of magnetic resonance imaging and diagnostic systems for controlled drug delivery. In this work, proteins were immobilized on the surface of a biopolymer combined with superparamagnetic particles of magnetite. The biopolymer chitosan was used, cross-linked and functionalized with glutaraldehyde, applicable to the biological assays. Three types of magnetic composites were obtained, which were called QM1Glu, QM2NaGlu and QM3Glu. They were characterized by X-ray diffraction, scanning electron microscopy, vibrating sample magnetometry, differential scanning calorimetry, thermogravimetry and infrared spectroscopy. They were evaluated concerning the immobilization of the proteins bovine serum albumin (BSA), collagen and trypsin. The study showed that the immobilization of proteins on the biopolymer occurred in 30 min of incubation. The magnetic composite of non functionalized chitosan (QM3) was also evaluated. For trypsin, it was found that the immobilization potential of QM3 was higher than that observed for QM3Glu. After 30 days, the trypsin of the QM3-Trip and QM3Glu-Trip was still with activity. The activity and the enzyme kinetics of the QM3Glu-Trip with the substrate BApNA were demonstrated. (author)

  1. The Surface-Exposed Protein SntA Contributes to Complement Evasion in Zoonotic Streptococcus suis.

    Science.gov (United States)

    Deng, Simin; Xu, Tong; Fang, Qiong; Yu, Lei; Zhu, Jiaqi; Chen, Long; Liu, Jiahui; Zhou, Rui

    2018-01-01

    Streptococcus suis is an emerging zoonotic pathogen causing streptococcal toxic shock like syndrome (STSLS), meningitis, septicemia, and even sudden death in human and pigs. Serious septicemia indicates this bacterium can evade the host complement surveillance. In our previous study, a functionally unknown protein SntA of S. suis has been identified as a heme-binding protein, and contributes to virulence in pigs. SntA can interact with the host antioxidant protein AOP2 and consequently inhibit its antioxidant activity. In the present study, SntA is identified as a cell wall anchored protein that functions as an important player in S. suis complement evasion. The C3 deposition and membrane attack complex (MAC) formation on the surface of sntA -deleted mutant strain Δ sntA are demonstrated to be significantly higher than the parental strain SC-19 and the complementary strain CΔ sntA . The abilities of anti-phagocytosis, survival in blood, and in vivo colonization of Δ sntA are obviously reduced. SntA can interact with C1q and inhibit hemolytic activity via the classical pathway. Complement activation assays reveal that SntA can also directly activate classical and lectin pathways, resulting in complement consumption. These two complement evasion strategies may be crucial for the pathogenesis of this zoonotic pathogen. Concerning that SntA is a bifunctional 2',3'-cyclic nucleotide 2'-phosphodiesterase/3'-nucleotidase in many species of Gram-positive bacteria, these complement evasion strategies may have common biological significance.

  2. Genetic diversity of three surface protein genes in Plasmodium malariae from three Asian countries.

    Science.gov (United States)

    Srisutham, Suttipat; Saralamba, Naowarat; Sriprawat, Kanlaya; Mayxay, Mayfong; Smithuis, Frank; Nosten, Francois; Pukrittayakamee, Sasithon; Day, Nicholas P J; Dondorp, Arjen M; Imwong, Mallika

    2018-01-11

    Genetic diversity of the three important antigenic proteins, namely thrombospondin-related anonymous protein (TRAP), apical membrane antigen 1 (AMA1), and 6-cysteine protein (P48/45), all of which are found in various developmental stages of Plasmodium parasites is crucial for targeted vaccine development. While studies related to the genetic diversity of these proteins are available for Plasmodium falciparum and Plasmodium vivax, barely enough information exists regarding Plasmodium malariae. The present study aims to demonstrate the genetic variations existing among these three genes in P. malariae by analysing their diversity at nucleotide and protein levels. Three surface protein genes were isolated from 45 samples collected in Thailand (N = 33), Myanmar (N = 8), and Lao PDR (N = 4), using conventional polymerase chain reaction (PCR) assay. Then, the PCR products were sequenced and analysed using BioEdit, MEGA6, and DnaSP programs. The average pairwise nucleotide diversities (π) of P. malariae trap, ama1, and p48/45 were 0.00169, 0.00413, and 0.00029, respectively. The haplotype diversities (Hd) of P. malariae trap, ama1, and p48/45 were 0.919, 0.946, and 0.130, respectively. Most of the nucleotide substitutions were non-synonymous, which indicated that the genetic variations of these genes were maintained by positive diversifying selection, thus, suggesting their role as a potential target of protective immune response. Amino acid substitutions of P. malariae TRAP, AMA1, and P48/45 could be categorized to 17, 20, and 2 unique amino-acid variants, respectively. For further vaccine development, carboxyl terminal of P48/45 would be a good candidate according to conserved amino acid at low genetic diversity (π = 0.2-0.3). High mutational diversity was observed in P. malariae trap and ama1 as compared to p48/45 in P. malariae samples isolated from Thailand, Myanmar, and Lao PDR. Taken together, these results suggest that P48/45 might be a good vaccine

  3. Radioiodination of surface proteins of bull spermatozoa and their characterization by sodium dodecyl sulphate-polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Vierula, M.

    1980-01-01

    Surface proteins of ejaculated bull spermatozoa were radioiodinated using Ma 125 I, solubilized and characterized by sodium dodecyl sulphate-polyacrylamide gel electrophoresis. The electron microscopic autoradiographs showed that the labelling was equally distributed to all parts of the spermatozoon and restricted to the sperm surface. The electrophoresis of solubilized radioactivity revealed 6 radioactive fractions with approximate molecular weights of 67 000-69 000, 47 000-50 000, 34 000-37 000, 25 000-28 000 and 14 000-16 000. The 6th fraction probably represented labelled lipids. The electrophoresis of radioiodinated seminal plasma proteins revealed only 2 radioactive protein peaks which coincided with the sperm surface protein fractions IV and V. (author)

  4. Plasma Surface Modification for Immobilization of Bone Morphogenic Protein-2 on Polycaprolactone Scaffolds

    Science.gov (United States)

    Kim, Byung Hoon; Myung, Sung Woon; Jung, Sang Chul; Ko, Yeong Mu

    2013-11-01

    The immobilization of recombinant human bone formation protein-2 (rhBMP-2) on polycaprolactone (PCL) scaffolds was performed by plasma polymerization. RhBMP-2, which induces osteoblast differentiation in various cell types, is a growth factor that plays an important role in bone formation and repair. The surface of the PCL scaffold was functionalized with the carboxyl groups of plasma-polymerized acrylic acid (PPAA) thin films. Plasma polymerization was carried out at a discharge power of 60 W at an acrylic acid flow rate of 7 sccm for 5 min. The PPAA thin film exhibited moderate hydrophilic properties and possessed a high density of carboxyl groups. Carboxyl groups and rhBMP-2 on the PCL scaffolds surface were identified by attenuated total reflection Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy, respectively. The alkaline phosphatase activity assay showed that the rhBMP-2 immobilized PCL scaffold increased the level of MG-63 cell differentiation. Plasma surface modification for the preparation of biomaterials, such as biofunctionalized polymer scaffolds, can be used for the binding of bioactive molecules in tissue engineering.

  5. Measuring the force of single protein molecule detachment from surfaces with AFM.

    Science.gov (United States)

    Tsapikouni, Theodora S; Missirlis, Yannis F

    2010-01-01

    Atomic force microscopy (AFM) was used to measure the non-specific detachment force of single fibrinogen molecules from glass surfaces. The identification of single unbinding events was based on the characteristics of the parabolic curves, recorded during the stretching of protein molecules. Fibrinogen molecules were covalently bound to Si(3)N(4) AFM tips, previously modified with 3-aminopropyl-dimethyl-ethoxysilane, through a homobifunctional poly(ethylene glycol) linker bearing two hydroxysulfosuccinimide esters. The most probable detachment force was found to be 210 pN, when the tip was retracting with a velocity of 1400 nm/s, while the distribution of the detachment distances indicated that the fibrinogen chain can be elongated beyond the length of the physical conformation before detachment. The dependence of the most probable detachment force on the loading rate was examined and the dynamics of fibrinogen binding to the surface were found amenable to the simple expression of the Bell-Evans theory. The theory's expansion, however, by incorporating the concept of the rupture of parallel residue-surface bonds could only describe the detachment of fibrinogen for a small number of such bonds. Finally, the mathematical expression of the Worm-Like Chain model was used to fit the stretching curves before rupture and two interpretations are suggested for the description of the AFM curves with multiple detachment events.

  6. Formation of protein/surfactant adsorption layer at the air/water interface as studied by dilational surface rheology.

    Science.gov (United States)

    Mikhailovskaya, A A; Noskov, B A; Lin, S-Y; Loglio, G; Miller, R

    2011-08-25

    The dynamic dilatational surface elasticity of mixed solutions of globular proteins (β-lactoglobulin (BLG) and bovine serum albumin (BSA)) with cationic (dodecyltrimethylammonium bromide (DTAB)) and anionic (sodium dodecyl sulfate (SDS)) surfactants was measured as a function of the surfactant concentration and surface age. If the cationic surfactant concentration exceeds a certain critical value, the kinetic dependencies of the dynamic surface elasticity of BLG/DTAB and BSA/DTAB solutions become nonmonotonous and resemble those of mixed solutions of proteins with guanidine hydrochloride. This result indicates not only the destruction of the protein tertiary structure in the surface layer of mixed solution but also a strong perturbation of the secondary structure. The corresponding kinetic dependencies for protein solutions with added anionic surfactants are always monotonous, thereby revealing a different mechanism of the adsorption layer formation. One can assume that the secondary structure is destroyed to a lesser extent in the latter case and hinders the formation of loops and tails at the interface. The increase of the solution's ionic strength by the addition of sodium chloride results in stronger changes of the protein conformations in the surface layer and the appearance of a local maximum in the kinetic dependencies of the dynamic surface elasticity in a relatively narrow range of SDS concentration. © 2011 American Chemical Society

  7. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  8. Methylation and in vivo expression of the surface-exposed Leptospira interrogans outer-membrane protein OmpL32.

    Science.gov (United States)

    Eshghi, Azad; Pinne, Marija; Haake, David A; Zuerner, Richard L; Frank, Ami; Cameron, Caroline E

    2012-03-01

    Recent studies have revealed that bacterial protein methylation is a widespread post-translational modification that is required for virulence in selected pathogenic bacteria. In particular, altered methylation of outer-membrane proteins has been shown to modulate the effectiveness of the host immune response. In this study, 2D gel electrophoresis combined with MALDI-TOF MS identified a Leptospira interrogans serovar Copenhageni strain Fiocruz L1-130 protein, corresponding to ORF LIC11848, which undergoes extensive and differential methylation of glutamic acid residues. Immunofluorescence microscopy implicated LIC11848 as a surface-exposed outer-membrane protein, prompting the designation OmpL32. Indirect immunofluorescence microscopy of golden Syrian hamster liver and kidney sections revealed expression of OmpL32 during colonization of these organs. Identification of methylated surface-exposed outer-membrane proteins, such as OmpL32, provides a foundation for delineating the role of this post-translational modification in leptospiral virulence.

  9. Protein adsorption resistance of PVP-modified polyurethane film prepared by surface-initiated atom transfer radical polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Huihui; Qian, Bin; Zhang, Wei [Shanghai Key Laboratory of Functional Materials Chemistry and Research Center of Analysis and Test, East China University of Science and Technology, Shanghai 200237 (China); Lan, Minbo, E-mail: minbolan@ecust.edu.cn [Shanghai Key Laboratory of Functional Materials Chemistry and Research Center of Analysis and Test, East China University of Science and Technology, Shanghai 200237 (China); State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237 (China)

    2016-02-15

    Highlights: • Antifouling PVP brushes were successfully grafted on PU films by SI-ATRP. • The effect of polymerization time on surface property and topography was studied. • Hydrophilicity and protein fouling resistance of PVP–PU films were greatly promoted. • Competitive adsorption of three proteins on PVP–PU films was evaluated. - Abstract: An anti-fouling surface of polyurethane (PU) film grafted with Poly(N-vinylpyrrolidone) (PVP) was prepared through surface-initiated atom transfer radical polymerization (SI-ATRP). And the polymerization time was investigated to obtain PU films with PVP brushes of different lengths. The surface properties and protein adsorption of modified PU films were evaluated. The results showed that the hydrophilicity of PU–PVP films were improved with the increase of polymerization time, which was not positive correlation with the surface roughness due to the brush structure. Additionally, the protein resistance performance was promoted when prolonging the polymerization time. The best antifouling PU–PVP (6.0 h) film reduced the adsoption level of bovine serum albumin (BSA), lysozyme (LYS), and brovin serum fibrinogen (BFG) by 93.4%, 68.3%, 85.6%, respectively, compared to the unmodified PU film. The competitive adsorption of three proteins indicated that LYS preferentially adsorbed on the modified PU film, while BFG had the lowest adsorption selectivity. And the amount of BFG on PU–PVP (6.0 h) film reduced greatly to 0.08 μg/cm{sup 2}, which was almost one-tenth of its adsorption from the single-protein system. Presented results suggested that both hydrophilicity and surface roughness might be the important factors in all cases of protein adsorption, and the competitive or selective adsorption might be related to the size of the proteins, especially on the non-charged films.

  10. Protein adsorption resistance of PVP-modified polyurethane film prepared by surface-initiated atom transfer radical polymerization

    International Nuclear Information System (INIS)

    Yuan, Huihui; Qian, Bin; Zhang, Wei; Lan, Minbo

    2016-01-01

    Highlights: • Antifouling PVP brushes were successfully grafted on PU films by SI-ATRP. • The effect of polymerization time on surface property and topography was studied. • Hydrophilicity and protein fouling resistance of PVP–PU films were greatly promoted. • Competitive adsorption of three proteins on PVP–PU films was evaluated. - Abstract: An anti-fouling surface of polyurethane (PU) film grafted with Poly(N-vinylpyrrolidone) (PVP) was prepared through surface-initiated atom transfer radical polymerization (SI-ATRP). And the polymerization time was investigated to obtain PU films with PVP brushes of different lengths. The surface properties and protein adsorption of modified PU films were evaluated. The results showed that the hydrophilicity of PU–PVP films were improved with the increase of polymerization time, which was not positive correlation with the surface roughness due to the brush structure. Additionally, the protein resistance performance was promoted when prolonging the polymerization time. The best antifouling PU–PVP (6.0 h) film reduced the adsoption level of bovine serum albumin (BSA), lysozyme (LYS), and brovin serum fibrinogen (BFG) by 93.4%, 68.3%, 85.6%, respectively, compared to the unmodified PU film. The competitive adsorption of three proteins indicated that LYS preferentially adsorbed on the modified PU film, while BFG had the lowest adsorption selectivity. And the amount of BFG on PU–PVP (6.0 h) film reduced greatly to 0.08 μg/cm"2, which was almost one-tenth of its adsorption from the single-protein system. Presented results suggested that both hydrophilicity and surface roughness might be the important factors in all cases of protein adsorption, and the competitive or selective adsorption might be related to the size of the proteins, especially on the non-charged films.

  11. Immunization of dogs with a canine herpesvirus vector expressing Neospora caninum surface protein, NcSRS2.

    Science.gov (United States)

    Nishikawa, Y; Ikeda, H; Fukumoto, S; Xuan, X; Nagasawa, H; Otsuka, H; Mikami, T

    2000-10-01

    In order to develop a vaccine against Neospora caninum in dogs, we constructed recombinant canine herpesvirus (CHV) expressing N. caninum surface protein, NcSRS2. Indirect immunofluorescence indicated that the antigenic structure of the recombinant NcSRS2 was similar to the authentic parasite protein. The dogs immunised with recombinant virus produced IgG antibody to N. caninum, and their sera recognised the parasite protein on Western blot. The dogs inoculated with recombinant virus showed no clinical symptoms and infectious CHV was not recovered from the dogs, suggesting that recombinant CHV expressing N. caninum proteins may lead to a vaccine against neosporosis in dogs.

  12. Stop codons in the hepatitis B surface proteins are enriched during antiviral therapy and are associated with host cell apoptosis

    International Nuclear Information System (INIS)

    Colledge, Danielle; Soppe, Sally; Yuen, Lilly; Selleck, Lucy; Walsh, Renae; Locarnini, Stephen; Warner, Nadia

    2017-01-01

    Premature stop codons in the hepatitis B virus (HBV) surface protein can be associated with nucleos(t)ide analogue resistance due to overlap of the HBV surface and polymerase genes. The aim of this study was to determine the effect of the replication of three common surface stop codon variants on the hepatocyte. Cell lines were transfected with infectious HBV clones encoding surface stop codons rtM204I/sW196*, rtA181T/sW172*, rtV191I/sW182*, and a panel of substitutions in the surface proteins. HBsAg was measured by Western blotting. Proliferation and apoptosis were measured using flow cytometry. All three surface stop codon variants were defective in HBsAg secretion. Cells transfected with these variants were less proliferative and had higher levels of apoptosis than those transfected with variants that did not encode surface stop codons. The most cytopathic variant was rtM204I/sW196*. Replication of HBV encoding surface stop codons was toxic to the cell and promoted apoptosis, exacerbating disease progression. - Highlights: •Under normal circumstances, HBV replication is not cytopathic. •Premature stop codons in the HBV surface protein can be selected and enriched during nucleos(t)ide analogue therapy. •Replication of these variants can be cytopathic to the cell and promote apoptosis. •Inadequate antiviral therapy may actually promote disease progression.

  13. Facilitated receptor-recognition and enhanced bioactivity of bone morphogenetic protein-2 on magnesium-substituted hydroxyapatite surface

    Science.gov (United States)

    Huang, Baolin; Yuan, Yuan; Li, Tong; Ding, Sai; Zhang, Wenjing; Gu, Yuantong; Liu, Changsheng

    2016-01-01

    Biomaterial surface functionalized with bone morphogenetic protein-2 (BMP-2) is a promising approach to fabricating successful orthopedic implants/scaffolds. However, the bioactivity of BMP-2 on material surfaces is still far from satisfactory and the mechanism of related protein-surface interaction remains elusive. Based on the most widely used bone-implants/scaffolds material, hydroxyapatite (HAP), we developed a matrix of magnesium-substituted HAP (Mg-HAP, 2.2 at% substitution) to address these issues. Further, we investigated the adsorption dynamics, BMPRs-recruitment, and bioactivity of recombinant human BMP-2 (rhBMP-2) on the HAP and Mg-HAP surfaces. To elucidate the mechanism, molecular dynamic simulations were performed to calculate the preferred orientations, conformation changes, and cysteine-knot stabilities of adsorbed BMP-2 molecules. The results showed that rhBMP-2 on the Mg-HAP surface exhibited greater bioactivity, evidenced by more facilitated BMPRs-recognition and higher ALP activity than on the HAP surface. Moreover, molecular simulations indicated that BMP-2 favoured distinct side-on orientations on the HAP and Mg-HAP surfaces. Intriguingly, BMP-2 on the Mg-HAP surface largely preserved the active protein structure evidenced by more stable cysteine-knots than on the HAP surface. These findings explicitly clarify the mechanism of BMP-2-HAP/Mg-HAP interactions and highlight the promising application of Mg-HAP/BMP-2 matrixes in bone regeneration implants/scaffolds. PMID:27075233

  14. Stop codons in the hepatitis B surface proteins are enriched during antiviral therapy and are associated with host cell apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Colledge, Danielle; Soppe, Sally; Yuen, Lilly; Selleck, Lucy; Walsh, Renae; Locarnini, Stephen, E-mail: stephen.locarnini@mh.org.au; Warner, Nadia

    2017-01-15

    Premature stop codons in the hepatitis B virus (HBV) surface protein can be associated with nucleos(t)ide analogue resistance due to overlap of the HBV surface and polymerase genes. The aim of this study was to determine the effect of the replication of three common surface stop codon variants on the hepatocyte. Cell lines were transfected with infectious HBV clones encoding surface stop codons rtM204I/sW196*, rtA181T/sW172*, rtV191I/sW182*, and a panel of substitutions in the surface proteins. HBsAg was measured by Western blotting. Proliferation and apoptosis were measured using flow cytometry. All three surface stop codon variants were defective in HBsAg secretion. Cells transfected with these variants were less proliferative and had higher levels of apoptosis than those transfected with variants that did not encode surface stop codons. The most cytopathic variant was rtM204I/sW196*. Replication of HBV encoding surface stop codons was toxic to the cell and promoted apoptosis, exacerbating disease progression. - Highlights: •Under normal circumstances, HBV replication is not cytopathic. •Premature stop codons in the HBV surface protein can be selected and enriched during nucleos(t)ide analogue therapy. •Replication of these variants can be cytopathic to the cell and promote apoptosis. •Inadequate antiviral therapy may actually promote disease progression.

  15. Surface engineering on mesoporous silica chips for enriching low molecular weight phosphorylated proteins

    Science.gov (United States)

    Hu, Ye; Peng, Yang; Lin, Kevin; Shen, Haifa; Brousseau, Louis C., III; Sakamoto, Jason; Sun, Tong; Ferrari, Mauro

    2011-02-01

    Phosphorylated peptides and proteins play an important role in normal cellular activities, e.g., gene expression, mitosis, differentiation, proliferation, and apoptosis, as well as tumor initiation, progression and metastasis. However, technical hurdles hinder the use of common fractionation methods to capture phosphopeptides from complex biological fluids such as human sera. Herein, we present the development of a dual strategy material that offers enhanced capture of low molecular weight phosphoproteins: mesoporous silica thin films with precisely engineered pore sizes that sterically select for molecular size combined with chemically selective surface modifications (i.e. Ga3+, Ti4+ and Zr4+) that target phosphoroproteins. These materials provide high reproducibility (CV = 18%) and increase the stability of the captured proteins by excluding degrading enzymes, such as trypsin. The chemical and physical properties of the composite mesoporous thin films were characterized by X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, energy dispersive X-ray spectroscopy and ellipsometry. Using mass spectroscopy and biostatistics analysis, the enrichment efficiency of different metal ions immobilized on mesoporous silica chips was investigated. The novel technology reported provides a platform capable of efficiently profiling the serum proteome for biomarker discovery, forensic sampling, and routine diagnostic applications.Phosphorylated peptides and proteins play an important role in normal cellular activities, e.g., gene expression, mitosis, differentiation, proliferation, and apoptosis, as well as tumor initiation, progression and metastasis. However, technical hurdles hinder the use of common fractionation methods to capture phosphopeptides from complex biological fluids such as human sera. Herein, we present the development of a dual strategy material that offers enhanced capture of low molecular weight phosphoproteins: mesoporous

  16. Identification of Salp15 homologues in Ixodes ricinus ticks

    NARCIS (Netherlands)

    Hovius, J. W. R.; Ramamoorthi, N.; van't Veer, C.; de Groot, K. A.; Nijhof, A. M.; Jongejan, F.; van Dam, A. P.; Fikrig, E.

    2007-01-01

    The 15-kDa Ixodes scapularis salivary gland protein Salp15 protects Borrelia burgdorferi sensu stricto from antibody-mediated killing and facilitates infection of the mammalian host. In addition, Salp 15 has been shown to inhibit T-cell activation. We determined whether Ixodes ricinus, the major

  17. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  18. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  19. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  20. The effect of physiological conditions on the surface structure of proteins: Setting the scene for human digestion of emulsions

    Science.gov (United States)

    Maldonado-Valderrama, J.; Gunning, A. P.; Ridout, M. J.; Wilde, P. J.; Morris, V. J.

    2009-10-01

    Understanding and manipulating the interfacial mechanisms that control human digestion of food emulsions is a crucial step towards improved control of dietary intake. This article reports initial studies on the effects of the physiological conditions within the stomach on the properties of the film formed by the milk protein ( β -lactoglobulin) at the air-water interface. Atomic force microscopy (AFM), surface tension and surface rheology techniques were used to visualize and examine the effect of gastric conditions on the network structure. The effects of changes in temperature, pH and ionic strength on a pre-formed interfacial structure were characterized in order to simulate the actual digestion process. Changes in ionic strength had little effect on the surface properties. In isolation, acidification reduced both the dilatational and the surface shear modulus, mainly due to strong repulsive electrostatic interactions within the surface layer and raising the temperature to body temperature accelerated the rearrangements within the surface layer, resulting in a decrease of the dilatational response and an increase of surface pressure. Together pH and temperature display an unexpected synergism, independent of the ionic strength. Thus, exposure of a pre-formed interfacial β -lactoglobulin film to simulated gastric conditions reduced the surface dilatational modulus and surface shear moduli. This is attributed to a weakening of the surface network in which the surface rearrangements of the protein prior to exposure to gastric conditions might play a crucial role.

  1. Protein adsorption resistant surface on polymer composite based on 2D- and 3D-controlled grafting of phospholipid moieties

    International Nuclear Information System (INIS)

    Hoshi, Toru; Matsuno, Ryosuke; Sawaguchi, Takashi; Konno, Tomohiro; Takai, Madoka; Ishihara, Kazuhiko

    2008-01-01

    To prepare the biocompatible surface, a phosphorylcholine (PC) group was introduced on this hydroxyl group generated by surface hydrolysis on the polymer composite composed of polyethylene (PE) and poly (vinyl acetate) (PVAc) prepared by supercritical carbon dioxide. Two different procedures such as two-dimensional (2D) modification and three-dimensional (3D) modification were applied to obtain the steady biocompatible surface. 2D modification was that PC groups were directly anchored on the surface of the polymer composite. 3D modification was that phospholipid polymer was grafted from the surface of the polymer composite by surface-initiated atom transfer radical polymerization (SI-ATRP) of 2-methacryloyloxyethyl phosphorylcholine (MPC). The surfaces were characterized by X-ray photoelectron spectroscopy, dynamic water contact angle measurements, and atomic force microscope. The effects of the poly(MPC) chain length on the protein adsorption resistivity were investigated. The protein adsorption on the polymer composite surface with PC groups modified by 2D or 3D modification was significantly reduced as compared with that on the unmodified PE. Further, the amount of protein adsorbed on the 3D modified surface that is poly(MPC)-grafted surface decreased with an increase in the chain length of the poly(MPC). The surface with an arbitrary structure and the characteristic can be constructed by using 2D and 3D modification. We conclude that the polymer composites of PE/PVAc with PC groups on the surface are useful for fabricating biomedical devices due to their good mechanical and surface properties

  2. Surface Immobilization of Human Arginase-1 with an Engineered Ice Nucleation Protein Display System in E. coli.

    Directory of Open Access Journals (Sweden)

    Zhen Zhang

    Full Text Available Ice nucleation protein (INP is frequently used as a surface anchor for protein display in gram-negative bacteria. Here, MalE and TorA signal peptides, and three charged polypeptides, 6×Lys, 6×Glu and 6×Asp, were anchored to the N-terminus of truncated INP (InaK-N to improve its surface display efficiency for human Arginase1 (ARG1. Our results indicated that the TorA signal peptide increased the surface translocation of non-protein fused InaK-N and human ARG1 fused InaK-N (InaK-N/ARG1 by 80.7% and 122.4%, respectively. Comparably, the MalE signal peptide decreased the display efficiencies of both the non-protein fused InaK-N and InaK-N/ARG1. Our results also suggested that the 6×Lys polypeptide significantly increased the surface display efficiency of K6-InaK-N/ARG1 by almost 2-fold, while also practically abolishing the surface translocation of non-protein fused InaK-N, indicating the interesting roles of charged polypeptides in bacteria surface display systems. Cell surface-immobilized K6-InaK-N/ARG1 presented an arginase activity of 10.7 U/OD600 under the optimized conditions of 40°C, pH 10.0 and 1 mM Mn2+, which could convert more than 95% of L-Arginine (L-Arg to L-Ornithine (L-Orn in 16 hours. The engineered InaK-Ns expanded the INP surface display system, which aided in the surface immobilization of human ARG1 in E. coli cells.

  3. Functional display of ice nucleation protein InaZ on the surface of bacterial ghosts.

    Science.gov (United States)

    Kassmannhuber, Johannes; Rauscher, Mascha; Schöner, Lea; Witte, Angela; Lubitz, Werner

    2017-09-03

    In a concept study the ability to induce heterogeneous ice formation by Bacterial Ghosts (BGs) from Escherichia coli carrying ice nucleation protein InaZ from Pseudomonas syringae in their outer membrane was investigated by a droplet-freezing assay of ultra-pure water. As determined by the median freezing temperature and cumulative ice nucleation spectra it could be demonstrated that both the living recombinant E. coli and their corresponding BGs functionally display InaZ on their surface. Under the production conditions chosen both samples belong to type II ice-nucleation particles inducing ice formation at a temperature range of between -5.6 °C and -6.7 °C, respectively. One advantage for the application of such BGs over their living recombinant mother bacteria is that they are non-living native cell envelopes retaining the biophysical properties of ice nucleation and do no longer represent genetically modified organisms (GMOs).

  4. Radioimmunoassay for platelet activation specific protein GMP-140 on the platelet surface and in plasma

    International Nuclear Information System (INIS)

    Wu Guoxin; Li Jianyong; Ruan Changgeng

    1991-08-01

    Using monoclonal antibody (McAb) SZ-51 which is specific for an alpha-granule membrane protein (GMP-140) on the surface of human activated platelets, the platelet GMP-140 expression in fixed whole blood was measured by direct radioimmunoassay and GMP-140 microparticles in plasma was measured by sandwich method. The GMP-140 molecules per platelet or milliliter (mL) were calculated for the following subjects; acute myocardial infarction; cerebro thrombosis; diabetic mellitus; asthma attack; epidemic hemorrhagic fever etc.. By comparing with the concentration of thromboxane B 2 (TXB 2 ) and von Willebrand factor (vWF) in plasma, it is confirmed that the measurement of GMP-140 molecules is better than that of TXB 2 and vWF. It is a sensitive and specific method for evaluating the platelet activation degree in vivo. The establishment of this method will be useful to diagnosing the thrombotic disorders and studying the pathogenesis of some other diseases

  5. Precise Manipulation and Patterning of Protein Crystals for Macromolecular Crystallography Using Surface Acoustic Waves.

    Science.gov (United States)

    Guo, Feng; Zhou, Weijie; Li, Peng; Mao, Zhangming; Yennawar, Neela H; French, Jarrod B; Huang, Tony Jun

    2015-06-01

    Advances in modern X-ray sources and detector technology have made it possible for crystallographers to collect usable data on crystals of only a few micrometers or less in size. Despite these developments, sample handling techniques have significantly lagged behind and often prevent the full realization of current beamline capabilities. In order to address this shortcoming, a surface acoustic wave-based method for manipulating and patterning crystals is developed. This method, which does not damage the fragile protein crystals, can precisely manipulate and pattern micrometer and submicrometer-sized crystals for data collection and screening. The technique is robust, inexpensive, and easy to implement. This method not only promises to significantly increase efficiency and throughput of both conventional and serial crystallography experiments, but will also make it possible to collect data on samples that were previously intractable. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Direct protein quantification in complex sample solutions by surface-engineered nanorod probes

    KAUST Repository

    Schrittwieser, Stefan

    2017-06-30

    Detecting biomarkers from complex sample solutions is the key objective of molecular diagnostics. Being able to do so in a simple approach that does not require laborious sample preparation, sophisticated equipment and trained staff is vital for point-of-care applications. Here, we report on the specific detection of the breast cancer biomarker sHER2 directly from serum and saliva samples by a nanorod-based homogeneous biosensing approach, which is easy to operate as it only requires mixing of the samples with the nanorod probes. By careful nanorod surface engineering and homogeneous assay design, we demonstrate that the formation of a protein corona around the nanoparticles does not limit the applicability of our detection method, but on the contrary enables us to conduct in-situ reference measurements, thus further strengthening the point-of-care applicability of our method. Making use of sandwich assays on top of the nanorods, we obtain a limit of detection of 110 pM and 470 pM in 10-fold diluted spiked saliva and serum samples, respectively. In conclusion, our results open up numerous applications in direct protein biomarker quantification, specifically in point-of-care settings where resources are limited and ease-of-use is of essence.

  7. A single microfluidic chip with dual surface properties for protein drug delivery.

    Science.gov (United States)

    Bokharaei, Mehrdad; Saatchi, Katayoun; Häfeli, Urs O

    2017-04-15

    Principles of double emulsion generation were incorporated in a glass microfluidic chip fabricated with two different surface properties in order to produce protein loaded polymer microspheres. The microspheres were produced by integrating two microfluidic flow focusing systems and a multi-step droplet splitting and mixing system into one chip. The chip consists of a hydrophobic and a hydrophilic section with two different heights, 12μm and 45μm, respectively. As a result, the protein is homogenously distributed throughout the polymer microsphere matrix, not just in its center (which has been studied before). In our work, the inner phase was bovine serum albumin (BSA) in phosphate buffered saline, the disperse phase was poly (lactic acid) in chloroform and the continuous phase was an aqueous solution of poly(vinyl alcohol). After solvent removal, BSA loaded microspheres with an encapsulation efficiency of up to 96% were obtained. Our results show the feasibility of producing microspheres loaded with a hydrophilic drug in a microfluidic system that integrates different microfluidic units into one chip. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Oral treponeme major surface protein: Sequence diversity and distributions within periodontal niches.

    Science.gov (United States)

    You, M; Chan, Y; Lacap-Bugler, D C; Huo, Y-B; Gao, W; Leung, W K; Watt, R M

    2017-12-01

    Treponema denticola and other species (phylotypes) of oral spirochetes are widely considered to play important etiological roles in periodontitis and other oral infections. The major surface protein (Msp) of T. denticola is directly implicated in several pathological mechanisms. Here, we have analyzed msp sequence diversity across 68 strains of oral phylogroup 1 and 2 treponemes; including reference strains of T. denticola, Treponema putidum, Treponema medium, 'Treponema vincentii', and 'Treponema sinensis'. All encoded Msp proteins contained highly conserved, taxon-specific signal peptides, and shared a predicted 'three-domain' structure. A clone-based strategy employing 'msp-specific' polymerase chain reaction primers was used to analyze msp gene sequence diversity present in subgingival plaque samples collected from a group of individuals with chronic periodontitis (n=10), vs periodontitis-free controls (n=10). We obtained 626 clinical msp gene sequences, which were assigned to 21 distinct 'clinical msp genotypes' (95% sequence identity cut-off). The most frequently detected clinical msp genotype corresponded to T. denticola ATCC 35405 T , but this was not correlated to disease status. UniFrac and libshuff analysis revealed that individuals with periodontitis and periodontitis-free controls harbored significantly different communities of treponeme clinical msp genotypes (Pdiversity than periodontitis-free controls (Mann-Whitney U-test, Pdiversity of Treponema clinical msp genotypes within their subgingival niches. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. RBSURFpred: Modeling protein accessible surface area in real and binary space using regularized and optimized regression.

    Science.gov (United States)

    Tarafder, Sumit; Toukir Ahmed, Md; Iqbal, Sumaiya; Tamjidul Hoque, Md; Sohel Rahman, M

    2018-03-14

    Accessible surface area (ASA) of a protein residue is an effective feature for protein structure prediction, binding region identification, fold recognition problems etc. Improving the prediction of ASA by the application of effective feature variables is a challenging but explorable task to consider, specially in the field of machine learning. Among the existing predictors of ASA, REGAd 3 p is a highly accurate ASA predictor which is based on regularized exact regression with polynomial kernel of degree 3. In this work, we present a new predictor RBSURFpred, which extends REGAd 3 p on several dimensions by incorporating 58 physicochemical, evolutionary and structural properties into 9-tuple peptides via Chou's general PseAAC, which allowed us to obtain higher accuracies in predicting both real-valued and binary ASA. We have compared RBSURFpred for both real and binary space predictions with state-of-the-art predictors, such as REGAd 3 p and SPIDER2. We also have carried out a rigorous analysis of the performance of RBSURFpred in terms of different amino acids and their properties, and also with biologically relevant case-studies. The performance of RBSURFpred establishes itself as a useful tool for the community. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Direct protein quantification in complex sample solutions by surface-engineered nanorod probes

    KAUST Repository

    Schrittwieser, Stefan; Pelaz, Beatriz; Parak, Wolfgang J.; Lentijo Mozo, Sergio; Soulantica, Katerina; Dieckhoff, Jan; Ludwig, Frank; Schotter, Joerg

    2017-01-01

    Detecting biomarkers from complex sample solutions is the key objective of molecular diagnostics. Being able to do so in a simple approach that does not require laborious sample preparation, sophisticated equipment and trained staff is vital for point-of-care applications. Here, we report on the specific detection of the breast cancer biomarker sHER2 directly from serum and saliva samples by a nanorod-based homogeneous biosensing approach, which is easy to operate as it only requires mixing of the samples with the nanorod probes. By careful nanorod surface engineering and homogeneous assay design, we demonstrate that the formation of a protein corona around the nanoparticles does not limit the applicability of our detection method, but on the contrary enables us to conduct in-situ reference measurements, thus further strengthening the point-of-care applicability of our method. Making use of sandwich assays on top of the nanorods, we obtain a limit of detection of 110 pM and 470 pM in 10-fold diluted spiked saliva and serum samples, respectively. In conclusion, our results open up numerous applications in direct protein biomarker quantification, specifically in point-of-care settings where resources are limited and ease-of-use is of essence.

  11. Staphylococcus saprophyticus surface-associated protein (Ssp) is associated with lifespan reduction in Caenorhabditis elegans.

    Science.gov (United States)

    Szabados, Florian; Mohner, Amelie; Kleine, Britta; Gatermann, Sören G

    2013-10-01

    Staphylococcal lipases have been proposed as pathogenicity factors. In Staphylococcus saprophyticus the surface-associated protein (Ssp) has been previously characterized as a cell wall-associated true lipase. A S. saprophyticus Δssp::ermB mutant has been described as less virulent in an in vivo model of urinary tract infection compared with its wild-type. This is the first report showing that S. saprophyticus induced a lifespan reduction in Caenorhabditis elegans similar to that of S. aureus RN4220. In two S. saprophyticus Δssp::ermB mutants lifespan reduction in C. elegans was partly abolished. In order to attribute virulence to the lipase activity itself and distinguish this phenomenon from the presence of the Ssp-protein, the conserved active site of the lipase was modified by site-directed ligase-independent mutagenesis and lipase activity-deficient mutants were constructed. These results indicate that the Ssp is associated with pathogenicity in C. elegans and one could speculate that the lipase activity itself is responsible for this virulence.

  12. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  13. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  14. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  15. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  16. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  17. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  18. Platelet adhesion and plasma protein adsorption control of collagen surfaces by He+ ion implantation

    International Nuclear Information System (INIS)

    Kurotobi, K.; Suzuki, Y.; Nakajima, H.; Suzuki, H.; Iwaki, M.

    2003-01-01

    He + ion implanted collagen-coated tubes with a fluence of 1 x 10 14 ions/cm 2 were exhibited antithrombogenicity. To investigate the mechanisms of antithrombogenicity of these samples, plasma protein adsorption assay and platelet adhesion experiments were performed. The adsorption of fibrinogen (Fg) and von Willebrand factor (vWf) was minimum on the He + ion implanted collagen with a fluence of 1 x 10 14 ions/cm 2 . Platelet adhesion (using platelet rich plasma) was inhibited on the He + ion implanted collagen with a fluence of 1 x 10 14 ions/cm 2 and was accelerated on the untreated collagen and ion implanted collagen with fluences of 1 x 10 13 , 1 x 10 15 and 1 x 10 16 ions/cm 2 . Platelet activation with washed platelets was observed on untreated collagen and He + ion implanted collagen with a fluence of 1 x 10 14 ions/cm 2 and was inhibited with fluences of 1 x 10 13 , 1 x 10 15 and 1 x 10 16 ions/cm 2 . Generally, platelets can react with a specific ligand inside the collagen (GFOGER sequence). The results of platelets adhesion experiments using washed platelets indicated that there were no ligands such as GFOGER on the He + ion implanted collagen over a fluence of 1 x 10 13 ions/cm 2 . On the 1 x 10 14 ions/cm 2 implanted collagen, no platelet activation was observed due to the influence of plasma proteins. >From the above, it is concluded that the decrease of adsorbed Fg and vWf caused the antithrombogenicity of He + ion implanted collagen with a fluence of 1 x 10 14 ions/cm 2 and that plasma protein adsorption took an important role repairing the graft surface

  19. Validation of cold plasma treatment for protein inactivation: a surface plasmon resonance-based biosensor study

    International Nuclear Information System (INIS)

    Bernard, C; Leduc, A; Barbeau, J; Saoudi, B; Yahia, L'H; Crescenzo, G De

    2006-01-01

    Gas plasma is being proposed as an interesting and promising tool to achieve sterilization. The efficacy of gas plasma to destroy bacterial spores (the most resistant living microorganisms) has been demonstrated and documented over the last ten years. In addition to causing damage to deoxyribonucleic acid by UV radiation emitted by excited species originating from the plasma, gas plasma has been shown to promote erosion of the microorganism in addition to possible oxidation reactions within the microorganism. In this work, we used lysozyme as a protein model to assess the effect of gas plasma on protein inactivation. Lysozyme samples have been subjected to the flowing afterglow of a gas discharge achieved in a nitrogen-oxygen mixture. The efficiency of this plasma treatment on lysozyme has been tested by two different assays. These are an enzyme-linked immunosorbent assay (ELISA) and a surface plasmon resonance (SPR)-based biosensor assay. The two methods showed that exposure to gas plasma can abrogate lysozyme interactions with lysozyme-specific antibodies, more likely by destroying the epitopes responsible for the interaction. More specifically, two SPR-based assays were developed since our ELISA approach did not allow us to discriminate between background and low, but still intact, quantities of lysozyme epitope after plasma treatment. Our SPR results clearly demonstrated that significant protein destruction or desorption was achieved when amounts of lysozyme less than 12.5 ng had been deposited in polystyrene 96-well ELISA plates. At higher lysozyme amounts, traces of available lysozyme epitopes were detected by SPR through indirect measurements. Finally, we demonstrated that a direct SPR approach in which biosensor-immobilized lysozyme activity is directly measured prior and after plasma treatment is more sensitive, and thus, more appropriate to define plasma treatment efficacy with more certainty

  20. Validation of cold plasma treatment for protein inactivation: a surface plasmon resonance-based biosensor study

    Science.gov (United States)

    Bernard, C.; Leduc, A.; Barbeau, J.; Saoudi, B.; Yahia, L'H.; DeCrescenzo, G.

    2006-08-01

    Gas plasma is being proposed as an interesting and promising tool to achieve sterilization. The efficacy of gas plasma to destroy bacterial spores (the most resistant living microorganisms) has been demonstrated and documented over the last ten years. In addition to causing damage to deoxyribonucleic acid by UV radiation emitted by excited species originating from the plasma, gas plasma has been shown to promote erosion of the microorganism in addition to possible oxidation reactions within the microorganism. In this work, we used lysozyme as a protein model to assess the effect of gas plasma on protein inactivation. Lysozyme samples have been subjected to the flowing afterglow of a gas discharge achieved in a nitrogen-oxygen mixture. The efficiency of this plasma treatment on lysozyme has been tested by two different assays. These are an enzyme-linked immunosorbent assay (ELISA) and a surface plasmon resonance (SPR)-based biosensor assay. The two methods showed that exposure to gas plasma can abrogate lysozyme interactions with lysozyme-specific antibodies, more likely by destroying the epitopes responsible for the interaction. More specifically, two SPR-based assays were developed since our ELISA approach did not allow us to discriminate between background and low, but still intact, quantities of lysozyme epitope after plasma treatment. Our SPR results clearly demonstrated that significant protein destruction or desorption was achieved when amounts of lysozyme less than 12.5 ng had been deposited in polystyrene 96-well ELISA plates. At higher lysozyme amounts, traces of available lysozyme epitopes were detected by SPR through indirect measurements. Finally, we demonstrated that a direct SPR approach in which biosensor-immobilized lysozyme activity is directly measured prior and after plasma treatment is more sensitive, and thus, more appropriate to define plasma treatment efficacy with more certainty.

  1. Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry.

    Science.gov (United States)

    Siverino, Claudia; Tabisz, Barbara; Lühmann, Tessa; Meinel, Lorenz; Müller, Thomas; Walles, Heike; Nickel, Joachim

    2018-03-29

    Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present several limitations that have led to the use of biomaterials in combination with osteogenic growth factors, such as bone morphogenetic proteins (BMPs). Commonly used absorption or encapsulation methods require supra-physiological amounts of BMP2, typically resulting in a so-called initial burst release effect that provokes several severe adverse side effects. A possible strategy to overcome these problems would be to covalently couple the protein to the scaffold. Moreover, coupling should be performed in a site-specific manner in order to guarantee a reproducible product outcome. Therefore, we created a BMP2 variant, in which an artificial amino acid (propargyl-L-lysine) was introduced into the mature part of the BMP2 protein by codon usage expansion (BMP2-K3Plk). BMP2-K3Plk was coupled to functionalized beads through copper catalyzed azide-alkyne cycloaddition (CuAAC). The biological activity of the coupled BMP2-K3Plk was proven in vitro and the osteogenic activity of the BMP2-K3Plk-functionalized beads was proven in cell based assays. The functionalized beads in contact with C2C12 cells were able to induce alkaline phosphatase (ALP) expression in locally restricted proximity of the bead. Thus, by this technique, functionalized scaffolds can be produced that can trigger cell differentiation towards an osteogenic lineage. Additionally, lower BMP2 doses are sufficient due to the controlled orientation of site-directed coupled BMP2. With this method, BMPs are always exposed to their receptors on the cell surface in the appropriate orientation, which is not the case if the factors are coupled via non-site-directed coupling techniques. The product outcome is highly controllable and, thus, results in materials with homogeneous properties, improving their applicability for the repair of critical size bone defects.

  2. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sens