
Sample records for surface hopping method

  1. Implementation of surface hopping molecular dynamics using semiempirical methods

    International Nuclear Information System (INIS)

    Fabiano, E.; Keal, T.W.; Thiel, W.


    A molecular dynamics driver and surface hopping algorithm for nonadiabatic dynamics has been implemented in a development version of the MNDO semiempirical electronic structure package. The required energies, gradients and nonadiabatic couplings are efficiently evaluated on the fly using semiempirical configuration interaction methods. The choice of algorithms for the time evolution of the nuclear motion and quantum amplitudes is discussed, and different schemes for the computation of nonadiabatic couplings are analysed. The importance of molecular orbital tracking and electronic state following is underlined in the context of configuration interaction calculations. The method is applied to three case studies (ethylene, methaniminium ion, and methanimine) using the orthogonalization corrected OM2 Hamiltonian. In all three cases decay times and dynamics paths similar to high-level ab initio results are obtained

  2. Analysis of the trajectory surface hopping method from the Markov state model perspective

    International Nuclear Information System (INIS)

    Akimov, Alexey V.; Wang, Linjun; Prezhdo, Oleg V.; Trivedi, Dhara


    We analyze the applicability of the seminal fewest switches surface hopping (FSSH) method of Tully to modeling quantum transitions between electronic states that are not coupled directly, in the processes such as Auger recombination. We address the known deficiency of the method to describe such transitions by introducing an alternative definition for the surface hopping probabilities, as derived from the Markov state model perspective. We show that the resulting transition probabilities simplify to the quantum state populations derived from the time-dependent Schrödinger equation, reducing to the rapidly switching surface hopping approach of Tully and Preston. The resulting surface hopping scheme is simple and appeals to the fundamentals of quantum mechanics. The computational approach is similar to the FSSH method of Tully, yet it leads to a notably different performance. We demonstrate that the method is particularly accurate when applied to superexchange modeling. We further show improved accuracy of the method, when applied to one of the standard test problems. Finally, we adapt the derived scheme to atomistic simulation, combine it with the time-domain density functional theory, and show that it provides the Auger energy transfer timescales which are in good agreement with experiment, significantly improving upon other considered techniques. (author)

  3. Collective probabilities algorithm for surface hopping calculations

    International Nuclear Information System (INIS)

    Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto


    General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

  4. Surface hopping simulation of vibrational predissociation of methanol dimer (United States)

    Jiang, Ruomu; Sibert, Edwin L.


    The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

  5. Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)


    Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

  6. Hops (United States)

    ... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...

  7. Interplay of radiative and nonradiative transitions in surface hopping with radiation-molecule interactions

    Energy Technology Data Exchange (ETDEWEB)

    Bajo, Juan José [Departamento de Química-Física I, Universidad Complutense de Madrid, 28040 Madrid (Spain); Granucci, Giovanni, E-mail:; Persico, Maurizio [Università di Pisa, Dipartimento di Chimica e Chimica Industriale, via Risorgimento 35, 56126 Pisa (Italy)


    We implemented a method for the treatment of field induced transitions in trajectory surface hopping simulations, in the framework of the local diabatization scheme, especially suited for on-the-fly dynamics. The method is applied to a simple one-dimensional model with an avoided crossing and compared with quantum wavepacket dynamics. The results show the importance of introducing a proper decoherence correction to surface hopping, in order to obtain meaningful results. Also the energy conservation policy of standard surface hopping must be revised: in fact, the quantum wavepacket energetics is well reproduced if energy absorption/emission is allowed for in the hops determined by radiation-molecule coupling. To our knowledge, this is the first time the issues of decoherence and energy conservation have been analyzed in depth to devise a mixed quantum-classical method for dynamics with molecule-field interactions.

  8. An analysis of the accuracy of an initial value representation surface hopping wave function in the interaction and asymptotic regions

    International Nuclear Information System (INIS)

    Sergeev, Alexey; Herman, Michael F.


    The behavior of an initial value representation surface hopping wave function is examined. Since this method is an initial value representation for the semiclassical solution of the time independent Schroedinger equation for nonadiabatic problems, it has computational advantages over the primitive surface hopping wave function. The primitive wave function has been shown to provide transition probabilities that accurately compare with quantum results for model problems. The analysis presented in this work shows that the multistate initial value representation surface hopping wave function should approach the primitive result in asymptotic regions and provide transition probabilities with the same level of accuracy for scattering problems as the primitive method

  9. Mixed quantum-classical equilibrium in global flux surface hopping

    International Nuclear Information System (INIS)

    Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.


    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors

  10. Communication devices for network-hopping communications and methods of network-hopping communications (United States)

    Buttles, John W


    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  11. Two-surface Monte Carlo with basin hopping: quantum mechanical trajectory and multiple stationary points of water cluster. (United States)

    Bandyopadhyay, Pradipta


    The efficiency of the two-surface monte carlo (TSMC) method depends on the closeness of the actual potential and the biasing potential used to propagate the system of interest. In this work, it is shown that by combining the basin hopping method with TSMC, the efficiency of the method can be increased by several folds. TSMC with basin hopping is used to generate quantum mechanical trajectory and large number of stationary points of water clusters.

  12. Generalization of fewest-switches surface hopping for coherences (United States)

    Tempelaar, Roel; Reichman, David R.


    Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

  13. Frequency Hopping Method for Audio Watermarking

    Directory of Open Access Journals (Sweden)

    A. Anastasijević


    Full Text Available This paper evaluates the degradation of audio content for a perceptible removable watermark. Two different approaches to embedding the watermark in the spectral domain were investigated. The frequencies for watermark embedding are chosen according to a pseudorandom sequence making the methods robust. Consequentially, the lower quality audio can be used for promotional purposes. For a fee, the watermark can be removed with a secret watermarking key. Objective and subjective testing was conducted in order to measure degradation level for the watermarked music samples and to examine residual distortion for different parameters of the watermarking algorithm and different music genres.

  14. A new method of hybrid frequency hopping signals selection and blind parameter estimation (United States)

    Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian


    Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

  15. Method Development and Validation for UHPLC-MS-MS Determination of Hop Prenylflavonoids in Human Serum


    Yuan, Yang; Qiu, Xi; Nikolic, Dejan; Dahl, Jeffrey H.; van Breemen, Richard B.


    Hops (Humulus lupulus L.) are used in the brewing of beer, and hop extracts containing prenylated compounds such as xanthohumol and 8-prenylnaringenin are under investigation as dietary supplements for cancer chemoprevention and for the management of hot flashes in menopausal women. To facilitate clinical studies of hop safety and efficacy, a selective, sensitive, and fast ultra-high pressure liquid chromatography tandem mass spectrometry (UHPLC-MS-MS) method was developed and validated for t...

  16. Surface hopping, transition state theory and decoherence. I. Scattering theory and time-reversibility. (United States)

    Jain, Amber; Herman, Michael F; Ouyang, Wenjun; Subotnik, Joseph E


    We provide an in-depth investigation of transmission coefficients as computed using the augmented-fewest switches surface hopping algorithm in the low energy regime. Empirically, microscopic reversibility is shown to hold approximately. Furthermore, we show that, in some circumstances, including decoherence on top of surface hopping calculations can help recover (as opposed to destroy) oscillations in the transmission coefficient as a function of energy; these oscillations can be studied analytically with semiclassical scattering theory. Finally, in the spirit of transition state theory, we also show that transmission coefficients can be calculated rather accurately starting from the curve crossing point and running trajectories forwards and backwards.

  17. Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Amber; Subotnik, Joseph E., E-mail: [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)


    We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

  18. An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping (United States)

    Bai, Xin; Qiu, Jing; Wang, Linjun


    We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.

  19. Accelerated sampling by infinite swapping of path integral molecular dynamics with surface hopping (United States)

    Lu, Jianfeng; Zhou, Zhennan


    To accelerate the thermal equilibrium sampling of multi-level quantum systems, the infinite swapping limit of a recently proposed multi-level ring polymer representation is investigated. In the infinite swapping limit, the ring polymer evolves according to an averaged Hamiltonian with respect to all possible surface index configurations of the ring polymer and thus connects the surface hopping approach to the mean-field path-integral molecular dynamics. A multiscale integrator for the infinite swapping limit is also proposed to enable efficient sampling based on the limiting dynamics. Numerical results demonstrate the huge improvement of sampling efficiency of the infinite swapping compared with the direct simulation of path-integral molecular dynamics with surface hopping.

  20. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai


    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  1. Simulation of the photodynamics of azobenzene on its first excited state: Comparison of full multiple spawning and surface hopping treatments

    International Nuclear Information System (INIS)

    Toniolo, A.; Ciminelli, C.; Persico, M.; Martinez, T.J.


    We have studied the cis→trans and trans→cis photoisomerization of azobenzene after n→π* excitation using the full multiple spawning (FMS) method for nonadiabatic wave-packet dynamics with potential-energy surfaces and couplings determined 'on the fly' from a reparametrized multiconfigurational semiempirical method. We compare the FMS results with a previous direct dynamics treatment using the same potential-energy surfaces and couplings, but with the nonadiabatic dynamics modeled using a semiclassical surface hopping (SH) method. We concentrate on the dynamical effects that determine the photoisomerization quantum yields, namely, the rate of radiationless electronic relaxation and the character of motion along the reaction coordinate. The quantal and semiclassical results are in good general agreement, confirming our previous analysis of the photodynamics. The SH method slightly overestimates the rate of excited state decay, leading in this case to lower quantum yields

  2. Nonlinear absorption dynamics using field-induced surface hopping: zinc porphyrin in water. (United States)

    Röhr, Merle I S; Petersen, Jens; Wohlgemuth, Matthias; Bonačić-Koutecký, Vlasta; Mitrić, Roland


    We wish to present the application of our field-induced surface-hopping (FISH) method to simulate nonlinear absorption dynamics induced by strong nonresonant laser fields. We provide a systematic comparison of the FISH approach with exact quantum dynamics simulations on a multistate model system and demonstrate that FISH allows for accurate simulations of nonlinear excitation processes including multiphoton electronic transitions. In particular, two different approaches for simulating two-photon transitions are compared. The first approach is essentially exact and involves the solution of the time-dependent Schrödinger equation in an extended manifold of excited states, while in the second one only transiently populated nonessential states are replaced by an effective quadratic coupling term, and dynamics is performed in a considerably smaller manifold of states. We illustrate the applicability of our method to complex molecular systems by simulating the linear and nonlinear laser-driven dynamics in zinc (Zn) porphyrin in the gas phase and in water. For this purpose, the FISH approach is connected with the quantum mechanical-molecular mechanical approach (QM/MM) which is generally applicable to large classes of complex systems. Our findings that multiphoton absorption and dynamics increase the population of higher excited states of Zn porphyrin in the nonlinear regime, in particular in solution, provides a means for manipulating excited-state properties, such as transient absorption dynamics and electronic relaxation. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Thermal equilibrium properties of surface hopping with an implicit Langevin bath

    International Nuclear Information System (INIS)

    Sherman, M. C.; Corcelli, S. A.


    The ability of fewest switches surface hopping (FSSH) approach, where the classical degrees of freedom are coupled to an implicit Langevin bath, to establish and maintain an appropriate thermal equilibrium was evaluated in the context of a three site model for electron transfer. The electron transfer model consisted of three coupled diabatic states that each depends harmonically on the collective bath coordinate. This results in three states with increasing energy in the adiabatic representation. The adiabatic populations and distributions of the collective solvent coordinate were monitored during the course of 250 ns FSSH-Langevin (FSSH-L) simulations performed at a broad range of temperatures and for three different nonadiabatic coupling strengths. The agreement between the FSSH-L simulations and numerically exact results for the adiabatic population ratios and solvent coordinate distributions was generally favorable. The FSSH-L method produces a correct Boltzmann distribution of the solvent coordinate on each of the adiabats, but the integrated populations are slightly incorrect because FSSH does not rigorously obey detailed balance. The overall agreement is better at high temperatures and for high nonadiabatic coupling, which agrees with a previously reported analytical and simulation analysis [J. R. Schmidt, P. V. Parandekar, and J. C. Tully, J. Chem. Phys. 129, 044104 (2008)] on a two-level system coupled to a classical bath

  4. An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

    Directory of Open Access Journals (Sweden)

    Zheng Zhao


    Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

  5. How to calculate linear absorption spectra with lifetime broadening using fewest switches surface hopping trajectories: A simple generalization of ground-state Kubo theory

    International Nuclear Information System (INIS)

    Petit, Andrew S.; Subotnik, Joseph E.


    In this paper, we develop a surface hopping approach for calculating linear absorption spectra using ensembles of classical trajectories propagated on both the ground and excited potential energy surfaces. We demonstrate that our method allows the dipole-dipole correlation function to be determined exactly for the model problem of two shifted, uncoupled harmonic potentials with the same harmonic frequency. For systems where nonadiabatic dynamics and electronic relaxation are present, preliminary results show that our method produces spectra in better agreement with the results of exact quantum dynamics calculations than spectra obtained using the standard ground-state Kubo formalism. As such, our proposed surface hopping approach should find immediate use for modeling condensed phase spectra, especially for expensive calculations using ab initio potential energy surfaces

  6. Development of aromatic hop compounds and bitterness in beer during room temperature- and cold storage based on three different hopping methods


    Torgals, Ann Elisabeth


    The main objective of this study was to determine whether storage temperature or hopping method had influence on the aroma and bitterness in beer. The focus was set on the aroma that comes from hops, and not from yeast. The secondary objective to this study was to explore the development of the alcohol, CO2 and bitterness in the beer after priming and bottling. The thesis’ main perspective is that of home brewers, and to some extent that of microbreweries. Beer was brewed with 100 % pilsn...

  7. An On-the-Fly Surface-Hopping Program JADE for Nonadiabatic Molecular Dynamics of Polyatomic Systems: Implementation and Applications. (United States)

    Du, Likai; Lan, Zhenggang


    Nonadiabatic dynamics simulations have rapidly become an indispensable tool for understanding ultrafast photochemical processes in complex systems. Here, we present our recently developed on-the-fly nonadiabatic dynamics package, JADE, which allows researchers to perform nonadiabatic excited-state dynamics simulations of polyatomic systems at an all-atomic level. The nonadiabatic dynamics is based on Tully's surface-hopping approach. Currently, several electronic structure methods (CIS, TDHF, TDDFT(RPA/TDA), and ADC(2)) are supported, especially TDDFT, aiming at performing nonadiabatic dynamics on medium- to large-sized molecules. The JADE package has been interfaced with several quantum chemistry codes, including Turbomole, Gaussian, and Gamess (US). To consider environmental effects, the Langevin dynamics was introduced as an easy-to-use scheme into the standard surface-hopping dynamics. The JADE package is mainly written in Fortran for greater numerical performance and Python for flexible interface construction, with the intent of providing open-source, easy-to-use, well-modularized, and intuitive software in the field of simulations of photochemical and photophysical processes. To illustrate the possible applications of the JADE package, we present a few applications of excited-state dynamics for various polyatomic systems, such as the methaniminium cation, fullerene (C20), p-dimethylaminobenzonitrile (DMABN) and its primary amino derivative aminobenzonitrile (ABN), and 10-hydroxybenzo[h]quinoline (10-HBQ).

  8. A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications. (United States)

    Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto


    Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.

  9. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials (United States)

    Spencer, J.; Gajdos, F.; Blumberger, J.


    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  10. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Energy Technology Data Exchange (ETDEWEB)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)


    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  11. Attractor hopping between polarization dynamical states in a vertical-cavity surface-emitting laser subject to parallel optical injection (United States)

    Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc


    We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.

  12. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    Energy Technology Data Exchange (ETDEWEB)

    Kowalewski, Markus, E-mail:; Mukamel, Shaul, E-mail: [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States)


    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings.

  13. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    International Nuclear Information System (INIS)

    Kowalewski, Markus; Mukamel, Shaul


    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings

  14. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

    Energy Technology Data Exchange (ETDEWEB)

    Dou, Wenjie; Subotnik, Joseph E. [Department of Chemistry, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States); Nitzan, Abraham [School of Chemistry, The Sackler Faculty of Science, Tel Aviv University, Tel Aviv 69978 (Israel)


    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case of out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.

  15. Surface-hopping trajectories for OH(A{sup 2}Σ{sup +}) + Kr: Extension to the 1A″ state

    Energy Technology Data Exchange (ETDEWEB)

    Perkins, T.; McCrudden, G.; Brouard, M., E-mail: [The Department of Chemistry, The Physical and Theoretical Chemistry Laboratory, University of Oxford, South Parks Road, Oxford OX1 3QZ (United Kingdom); Herráez-Aguilar, D.; Aoiz, F.J., E-mail: [Departamento de Química Física, Facultad de Química, Universidad Complutense, 28040 Madrid (Spain); Kłos, J., E-mail: [Department of Chemistry and Biochemistry, University of Maryland, College Park, Maryland 20742 (United States)


    We present a new trajectory surface hopping study of the rotational energy transfer and collisional quenching of electronically excited OH(A) radicals by Kr. The trajectory surface hopping calculations include both electronic coupling between the excited 2{sup 2}A′ and ground 1{sup 2}A′ electronic states, as well as Renner-Teller and Coriolis roto-electronic couplings between the 1{sup 2}A′ and 1{sup 2}A″, and the 2{sup 2}A′ and 1{sup 2}A″ electronic states, respectively. The new calculations are shown to lead to a noticeable improvement in the agreement between theory and experiment in this system, particularly with respect to the OH(X) rotational and Λ-doublet quantum state populations, compared with a simpler two-state treatment, which only included the electronic coupling between the 2{sup 2}A′ and 1{sup 2}A′ states. Discrepancies between the predictions of theory and experiment do however remain, and could arise either due to errors in the potential energy surfaces and couplings employed, or due to the limitations in the classical treatment of non-adiabatic effects.

  16. Transmembrane and ubiquitin-like domain-containing protein 1 (Tmub1/HOPS facilitates surface expression of GluR2-containing AMPA receptors.

    Directory of Open Access Journals (Sweden)

    Hyunjeong Yang

    Full Text Available Some ubiquitin-like (UBL domain-containing proteins are known to play roles in receptor trafficking. Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptors (AMPARs undergo constitutive cycling between the intracellular compartment and the cell surface in the central nervous system. However, the function of UBL domain-containing proteins in the recycling of the AMPARs to the synaptic surface has not yet been reported.Here, we report that the Transmembrane and ubiquitin-like domain-containing 1 (Tmub1 protein, formerly known as the Hepatocyte Odd Protein Shuttling (HOPS protein, which is abundantly expressed in the brain and which exists in a synaptosomal membrane fraction, facilitates the recycling of the AMPAR subunit GluR2 to the cell surface. Neurons transfected with Tmub1/HOPS-RNAi plasmids showed a significant reduction in the AMPAR current as compared to their control neurons. Consistently, the synaptic surface expression of GluR2, but not of GluR1, was significantly decreased in the neurons transfected with the Tmub1/HOPS-RNAi and increased in the neurons overexpressing EGFP-Tmub1/HOPS. The altered surface expression of GluR2 was speculated to be due to the altered surface-recycling of the internalized GluR2 in our recycling assay. Eventually, we found that GluR2 and glutamate receptor interacting protein (GRIP were coimmunoprecipitated by the anti-Tmub1/HOPS antibody from the mouse brain. Taken together, these observations show that the Tmub1/HOPS plays a role in regulating basal synaptic transmission; it contributes to maintain the synaptic surface number of the GluR2-containing AMPARs by facilitating the recycling of GluR2 to the plasma membrane.

  17. Development of preparative and analytical methods of the hop bitter acid oxide fraction and chemical properties of its components. (United States)

    Taniguchi, Yoshimasa; Matsukura, Yasuko; Taniguchi, Harumi; Koizumi, Hideki; Katayama, Mikio


    The bitter acids in hops (Humulus lupulus L.) and beer, such as α-, β-, and iso-α-acids, are known to affect beer quality and display various physiological effects. However, these compounds readily oxidize, and the effect of the oxides on the properties of beer or their potential health benefits are not well understood. In this study, we developed a simple preparative method for the bitter acid oxide fraction derived from hops and designated the constituents as matured hop bitter acids (MHBA). HPLC-PDA-ESI/HRMS and MS(2) revealed that MHBA are primarily composed of α-acid-derived oxides, which possess a common β-tricarbonyl moiety in their structures similar to α-, β-, and iso-α-acids. We also developed a quantitative analytical method of whole MHBA by HPLC, which showed high precision and reproducibility. Using our newly developed method, the concentration of whole MHBA in several commercial beers was evaluated. Our results will promote the study of bitter acid oxides.

  18. Ultra-high-performance liquid chromatography profiling method for chemical screening of proanthocyanidins in Czech hops

    Czech Academy of Sciences Publication Activity Database

    Olšovská, J.; Kameník, Zdeněk; Čejka, P.; Jurková, M.; Mikyška, A.


    Roč. 116, NOV (2013), s. 919-926 ISSN 0039-9140 R&D Projects: GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Flavan-3-ol * Catechin * Hops Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.511, year: 2013

  19. Frequency hopping due to acousto-electric interaction in ZnO based surface acoustic wave oscillator (United States)

    Dasgupta, Daipayan; Sreenivas, K.


    A 36 MHz surface acoustic wave delay line based oscillator has been used to study the effect of acousto-electric interaction due to photo generated charge carriers in rf sputtered ZnO film under UV illumination (λ = 365 nm, 20-100 μW/cm2). Design aspects for developing a delay line based SAW oscillator are specified. The observed linear downshift in frequency (2.2 to 19.0 kHz) with varying UV intensity (20-100 μW/cm2) is related to the fractional velocity change due to acousto-electric interaction. UV illumination level of 100 μW/cm2 leads to a characteristic frequency hopping behavior arising due to a change in the oscillation criteria, and is attributed to the complex interplay between the increased attenuation and velocity shift.

  20. Model-driven harmonic parameterization of the cortical surface: HIP-HOP. (United States)

    Auzias, G; Lefèvre, J; Le Troter, A; Fischer, C; Perrot, M; Régis, J; Coulon, O


    In the context of inter subject brain surface matching, we present a parameterization of the cortical surface constrained by a model of cortical organization. The parameterization is defined via an harmonic mapping of each hemisphere surface to a rectangular planar domain that integrates a representation of the model. As opposed to previous landmark-based registration methods we do not match folds between individuals but instead optimize the fit between cortical sulci and specific iso-coordinate axis in the model. This strategy overcomes some limitation to sulcus-based registration techniques such as topological variability in sulcal landmarks across subjects. Experiments on 62 subjects with manually traced sulci are presented and compared with the result of the Freesurfer software. The evaluation involves a measure of dispersion of sulci with both angular and area distortions. We show that the model-based strategy can lead to a natural, efficient and very fast (less than 5 min per hemisphere) method for defining inter subjects correspondences. We discuss how this approach also reduces the problems inherent to anatomically defined landmarks and open the way to the investigation of cortical organization through the notion of orientation and alignment of structures across the cortex.

  1. Communication: Fully coherent quantum state hopping

    Energy Technology Data Exchange (ETDEWEB)

    Martens, Craig C., E-mail: [University of California, Irvine, California 92697-2025 (United States)


    In this paper, we describe a new and fully coherent stochastic surface hopping method for simulating mixed quantum-classical systems. We illustrate the approach on the simple but unforgiving problem of quantum evolution of a two-state quantum system in the limit of unperturbed pure state dynamics and for dissipative evolution in the presence of both stationary and nonstationary random environments. We formulate our approach in the Liouville representation and describe the density matrix elements by ensembles of trajectories. Population dynamics are represented by stochastic surface hops for trajectories representing diagonal density matrix elements. These are combined with an unconventional coherent stochastic hopping algorithm for trajectories representing off-diagonal quantum coherences. The latter generalizes the binary (0,1) “probability” of a trajectory to be associated with a given state to allow integers that can be negative or greater than unity in magnitude. Unlike existing surface hopping methods, the dynamics of the ensembles are fully entangled, correctly capturing the coherent and nonlocal structure of quantum mechanics.

  2. Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations (United States)

    Zhang, Wei; Gan, Jie; Li, Qian; Gao, Kun; Sun, Jian; Xu, Ning; Ying, Zhifeng; Wu, Jiada


    The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

  3. Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations

    International Nuclear Information System (INIS)

    Zhang Wei; Gan Jie; Li Qian; Gao Kun; Sun Jian; Xu Ning; Ying Zhifeng; Wu Jiada


    The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

  4. Parallel deposition, sorting, and reordering methods in the Hybrid Ordered Plasma Simulation (HOPS) code

    International Nuclear Information System (INIS)

    Anderson, D.V.; Shumaker, D.E.


    From a computational standpoint, particle simulation calculations for plasmas have not adapted well to the transitions from scalar to vector processing nor from serial to parallel environments. They have suffered from inordinate and excessive accessing of computer memory and have been hobbled by relatively inefficient gather-scatter constructs resulting from the use of indirect indexing. Lastly, the many-to-one mapping characteristic of the deposition phase has made it difficult to perform this in parallel. The authors' code sorts and reorders the particles in a spatial order. This allows them to greatly reduce the memory references, to run in directly indexed vector mode, and to employ domain decomposition to achieve parallelization. In this hybrid simulation the electrons are modeled as a fluid and the field equations solved are obtained from the electron momentum equation together with the pre-Maxwell equations (displacement current neglected). Either zero or finite electron mass can be used in the electron model. The resulting field equations are solved with an iteratively explicit procedure which is thus trivial to parallelize. Likewise, the field interpolations and the particle pushing is simple to parallelize. The deposition, sorting, and reordering phases are less simple and it is for these that the authors present detailed algorithms. They have now successfully tested the parallel version of HOPS in serial mode and it is now being readied for parallel execution on the Cray C-90. They will then port HOPS to a massively parallel computer, in the next year

  5. Precision Hopping/Rolling Robotic Surface Probe Based on Tensegrity Structures (United States)

    National Aeronautics and Space Administration — We propose to overcome the limitations of wheeled surface rovers by combining recent advances in ball-shaped soft-robots based on tensegrity structures (a tension...

  6. Azobenzene as a photoregulator covalently attached to RNA: a quantum mechanics/molecular mechanics-surface hopping dynamics study. (United States)

    Mondal, Padmabati; Granucci, Giovanni; Rastädter, Dominique; Persico, Maurizio; Burghardt, Irene


    The photoregulation of nucleic acids by azobenzene photoswitches has recently attracted considerable interest in the context of emerging biotechnological applications. To understand the mechanism of photoinduced isomerisation and conformational control in these complex biological environments, we employ a Quantum Mechanics/Molecular Mechanics (QM/MM) approach in conjunction with nonadiabatic Surface Hopping (SH) dynamics. Two representative RNA-azobenzene complexes are investigated, both of which contain the azobenzene chromophore covalently attached to an RNA double strand via a β-deoxyribose linker. Due to the pronounced constraints of the local RNA environment, it is found that trans -to- cis isomerization is slowed down to a time scale of ∼10-15 picoseconds, in contrast to 500 femtoseconds in vacuo , with a quantum yield reduced by a factor of two. By contrast, cis -to- trans isomerization remains in a sub-picosecond regime. A volume-conserving isomerization mechanism is found, similarly to the pedal-like mechanism previously identified for azobenzene in solution phase. Strikingly, the chiral RNA environment induces opposite right-handed and left-handed helicities of the ground-state cis -azobenzene chromophore in the two RNA-azobenzene complexes, along with an almost completely chirality conserving photochemical pathway for these helical enantiomers.

  7. The surface analysis methods

    International Nuclear Information System (INIS)

    Deville, J.P.


    Nowadays, there are a lot of surfaces analysis methods, each having its specificity, its qualities, its constraints (for instance vacuum) and its limits. Expensive in time and in investment, these methods have to be used deliberately. This article appeals to non specialists. It gives some elements of choice according to the studied information, the sensitivity, the use constraints or the answer to a precise question. After having recalled the fundamental principles which govern these analysis methods, based on the interaction between radiations (ultraviolet, X) or particles (ions, electrons) with matter, two methods will be more particularly described: the Auger electron spectroscopy (AES) and x-rays photoemission spectroscopy (ESCA or XPS). Indeed, they are the most widespread methods in laboratories, the easier for use and probably the most productive for the analysis of surface of industrial materials or samples submitted to treatments in aggressive media. (O.M.)

  8. Supercritical fluid extraction of hops

    Directory of Open Access Journals (Sweden)



    Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

  9. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates (United States)

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro


    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  10. A novel peak-hopping stepwise feature selection method with application to Raman spectroscopy

    International Nuclear Information System (INIS)

    McShane, M.J.; Cameron, B.D.; Cote, G.L.; Motamedi, M.; Spiegelman, C.H.


    A new stepwise approach to variable selection for spectroscopy that includes chemical information and attempts to test several spectral regions producing high ranking coefficients has been developed to improve on currently available methods. Existing selection techniques can, in general, be placed into two groups: the first, time-consuming optimization approaches that ignore available information about sample chemistry and require considerable expertise to arrive at appropriate solutions (e.g. genetic algorithms), and the second, stepwise procedures that tend to select many variables in the same area containing redundant information. The algorithm described here is a fast stepwise procedure that uses multiple ranking chains to identify several spectral regions correlated with known sample properties. The multiple-chain approach allows the generation of a final ranking vector that moves quickly away from the initial selection point, testing several areas exhibiting correlation between spectra and composition early in the stepping procedure. Quantitative evidence of the success of this approach as applied to Raman spectroscopy is given in terms of processing speed, number of selected variables, and prediction error in comparison with other selection methods. In this respect, the procedure described here may be considered as a significant evolutionary step in variable selection algorithms. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  11. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma. (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David


    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Wheeled hopping robot (United States)

    Fischer, Gary J [Albuquerque, NM


    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  13. A stable high-order perturbation of surfaces method for numerical simulation of diffraction problems in triply layered media

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Youngjoon, E-mail:; Nicholls, David P., E-mail:


    The accurate numerical simulation of linear waves interacting with periodic layered media is a crucial capability in engineering applications. In this contribution we study the stable and high-order accurate numerical simulation of the interaction of linear, time-harmonic waves with a periodic, triply layered medium with irregular interfaces. In contrast with volumetric approaches, High-Order Perturbation of Surfaces (HOPS) algorithms are inexpensive interfacial methods which rapidly and recursively estimate scattering returns by perturbation of the interface shape. In comparison with Boundary Integral/Element Methods, the stable HOPS algorithm we describe here does not require specialized quadrature rules, periodization strategies, or the solution of dense non-symmetric positive definite linear systems. In addition, the algorithm is provably stable as opposed to other classical HOPS approaches. With numerical experiments we show the remarkable efficiency, fidelity, and accuracy one can achieve with an implementation of this algorithm.

  14. Hopping transport in solids

    CERN Document Server

    Pollak, M


    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  15. Beer spoilage bacteria and hop resistance. (United States)

    Sakamoto, Kanta; Konings, Wil N


    For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

  16. Multi-state nonadiabatic deactivation mechanism of coumarin revealed by ab initio on-the-fly trajectory surface hopping dynamic simulation. (United States)

    Gan, Yanzhen; Yue, Ling; Guo, Xugeng; Zhu, Chaoyuan; Cao, Zexing


    An on-the-fly trajectory surface hopping dynamic simulation has been performed for revealing the multi-state nonadiabatic deactivation mechanism of coumarin. The mechanism involves three adiabatic excited states, S 3 (ππ*L b ), S 2 (nπ*, ππ*L a ) and S 1 (ππ*L a , nπ*), and the ground state S 0 at the four state-averaged complete active space self-consistent field, SA4-CASSCF(12,10)/6-31G* level of theory. Upon photoexcitation to the third excited state S 3 (ππ*L b ) in the Franck-Condon region, 80% sampling trajectories decay to the dark S 2 (nπ*) state within an average of 5 fs via the conical intersection S 3 (ππ*L b )/S 2 (nπ*), while 20% decay to the S 2 (ππ*L a ) state within an average of 11 fs via the conical intersection S 3 (ππ*L b )/S 2 (ππ*L a ). Then, sampling trajectories via S 2 (nπ*)/S 1 (ππ*L a ) continue with ultrafast decay processes to give a final distribution of quantum yields as follows: 42% stay on the dark S 1 (nπ*) state, 43.3% go back to the ground S 0 state, 12% undergo a ring-opening reaction to the Z-form S 0 (Z) state, and 2.7% go to the E-form S 0 (E) state. The lifetimes of the excited states are estimated as follows: the S 3 state is about 12 fs on average, the S 2 state is about 80 fs, and the S 1 state has a fast component of about 160 fs and a slow component of 15 ps. The simulated ultrafast radiationless deactivation pathways of photoexcited coumarin immediately interpret the experimentally observed weak fluorescence emission.

  17. Method of measuring surface density

    International Nuclear Information System (INIS)

    Gregor, J.


    A method is described of measuring surface density or thickness, preferably of coating layers, using radiation emitted by a suitable radionuclide, e.g., 241 Am. The radiation impinges on the measured material, e.g., a copper foil and in dependence on its surface density or thickness part of the flux of impinging radiation is reflected and part penetrates through the material. The radiation which has penetrated through the material excites in a replaceable adjustable backing characteristic radiation of an energy close to that of the impinging radiation (within +-30 keV). Part of the flux of the characteristic radiation spreads back to the detector, penetrates through the material in which in dependence on surface density or thickness of the coating layer it is partly absorbed. The flux of the penetrated characteristic radiation impinging on the face of the detector is a function of surface density or thickness. Only that part of the energy is evaluated of the energy spectrum which corresponds to the energy of characteristic radiation. (B.S.)

  18. Crossed Molecular Beams and Quasiclassical Trajectory Surface Hopping Studies of the Multichannel Nonadiabatic O((3)P) + Ethylene Reaction at High Collision Energy. (United States)

    Balucani, Nadia; Leonori, Francesca; Casavecchia, Piergiorgio; Fu, Bina; Bowman, Joel M


    The combustion relevant O((3)P) + C2H4 reaction stands out as a prototypical multichannel nonadiabatic reaction involving both triplet and singlet potential energy surfaces (PESs), which are strongly coupled. Crossed molecular beam (CMB) scattering experiments with universal soft electron ionization mass spectrometric detection have been used to characterize the dynamics of this reaction at the relatively high collision energy Ec of 13.7 kcal/mol, attained by crossing the reactant beams at an angle of 135°. This work is a full report of the data at the highest Ec investigated for this reaction. From laboratory product angular and velocity distribution measurements, angular and translational energy distributions in the center-of-mass system have been obtained for the five observed exothermic competing reaction channels leading to H + CH2CHO, H + CH3CO, CH3 + HCO, CH2 + H2CO, and H2 + CH2CO. The product branching ratios (BRs) have been derived. The elucidation of the reaction dynamics is assisted by synergic full-dimensional quasiclassical trajectory surface-hopping calculations of the reactive differential cross sections on coupled ab initio triplet/singlet PESs. This joint experimental/theoretical study extends and complements our previous combined CMB and theoretical work at the lower collision energy of 8.4 kcal/mol. The theoretically derived BRs and extent of intersystem crossing (ISC) are compared with experimental results. In particular, the predictions of the QCT results for the three main channels (those leading to vinoxy + H, methyl + HCO and methylene + H2CO formation) are compared directly with the experimental data in the laboratory frame. Good overall agreement is noted between theory and experiment, although some small, yet significant shortcomings of the theoretical differential cross section are noted. Both experiment and theory find almost an equal contribution from the triplet and singlet surfaces to the reaction, with a clear tendency of the

  19. Climate, weather, and hops (United States)

    As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

  20. Electron hopping through proteins

    Czech Academy of Sciences Publication Activity Database

    Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.


    Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

  1. Basin Hopping Graph

    DEFF Research Database (Denmark)

    Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter


    of the folding free energy landscape, however, can provide the relevant information. Results We introduce the basin hopping graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect...

  2. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng


    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  3. Plasmodium falciparum Hop (PfHop Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

    Directory of Open Access Journals (Sweden)

    Tawanda Zininga

    Full Text Available Heat shock proteins (Hsps play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70 is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90 facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop. We previously characterised the Hop protein from Plasmodium falciparum (PfHop. We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we

  4. Scaffold hopping in drug discovery using inductive logic programming. (United States)

    Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H


    In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

  5. Hip-Hop Education Resources (United States)

    Hall, Marcella Runell


    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…


    Directory of Open Access Journals (Sweden)

    DANAILA Ligia


    Full Text Available The paper work presents two practical methods to draw the development of a surface unable to be developed applying classical methods of Descriptive Geometry, the toroidal surface, frequently met in technical practice. The described methods are approximate ones; the development is obtained with the help of points. The accuracy of the methods is given by the number of points used when drawing. As for any other approximate method, when practically manufactured the development may need to be adjusted on site.

  7. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková


    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79−1 and total content of tocols (up to 76.31−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  8. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

    Directory of Open Access Journals (Sweden)

    Haejoon Jung


    Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  9. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics. (United States)

    Jung, Haejoon; Lee, In-Ho


    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  10. Signaling induced by hop/STI-1 depends on endocytosis

    International Nuclear Information System (INIS)

    Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael


    The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP C ), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP C and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling induced by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP C by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases

  11. A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination. (United States)

    Yu, Hua-Gen


    A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

  12. Hall effect in hopping regime

    International Nuclear Information System (INIS)

    Avdonin, A.; Skupiński, P.; Grasza, K.


    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  13. Hall effect in hopping regime

    Energy Technology Data Exchange (ETDEWEB)

    Avdonin, A., E-mail: [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)


    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  14. Monte Carlo method for random surfaces

    International Nuclear Information System (INIS)

    Berg, B.


    Previously two of the authors proposed a Monte Carlo method for sampling statistical ensembles of random walks and surfaces with a Boltzmann probabilistic weight. In the present paper we work out the details for several models of random surfaces, defined on d-dimensional hypercubic lattices. (orig.)

  15. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar (United States)

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika


    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.


    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik


    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  17. Surface physics theoretical models and experimental methods

    CERN Document Server

    Mamonova, Marina V; Prudnikova, I A


    The demands of production, such as thin films in microelectronics, rely on consideration of factors influencing the interaction of dissimilar materials that make contact with their surfaces. Bond formation between surface layers of dissimilar condensed solids-termed adhesion-depends on the nature of the contacting bodies. Thus, it is necessary to determine the characteristics of adhesion interaction of different materials from both applied and fundamental perspectives of surface phenomena. Given the difficulty in obtaining reliable experimental values of the adhesion strength of coatings, the theoretical approach to determining adhesion characteristics becomes more important. Surface Physics: Theoretical Models and Experimental Methods presents straightforward and efficient approaches and methods developed by the authors that enable the calculation of surface and adhesion characteristics for a wide range of materials: metals, alloys, semiconductors, and complex compounds. The authors compare results from the ...

  18. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying


    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  19. Surface modifying method for metal member

    International Nuclear Information System (INIS)

    Amano, Kazuo; Enomoto, Kunio; Hirano, Akihiko; Hirano, Atsuya; Hattori, Shigeo; Hayashi, Eisaku; Ueyama, Toshiharu; Hayashi, Makoto


    A surface of a metal member such as carbon steel to be used in a corrosion circumstance such as in a nuclear power plant and a thermoelectric plant are polished. A printing method is conducted for removing obstacles on the surface of the member. Namely, a photographing printing paper immersed in a diluted sulfuric acid solution is appended tightly to the portion with its surface polished smoothly. Sulfur present in the form of an obstacle of MnS or present alone in the material reacts with the sulfuric acid to form a sulfuric acid gas, and reacts with Ag of the printing paper to discolor the printing paper to brown. When a peeled printing paper is discolored to brown, sulfur printing is repeated. After conforming that the peeled printing paper is white, the surface is washed. Subsequently, surface plasticization is conducted by water jet peening or shot peening. (I.N.)

  20. Supercritical carbon dioxide hop extraction

    Directory of Open Access Journals (Sweden)

    Pfaf-Šovljanski Ivana I.


    Full Text Available The hop of Magnum cultivar was extracted using supercritical carbon dioxide (SFE-as extractant. Extraction was carried out in the two steps: the first one being carried out at 150 bar and 40°C for 2.5 h (Extract A, and the second was the extraction of the same hop sample at 300 bar and 40°C for 2.5 h (Extract B. Extraction kinetics of the system hop-SFE-CO2 was investigated. Two of four most common compounds of hop aroma (α-humulene and β-caryophyllene were detected in Extract A. Isomerised α-acids and β-acids were detected too. a-Acid content in Extract B was high (that means it is a bitter variety of hop. Mathematical modeling using empirical model characteristic time model and simple single sphere model has been performed on Magnum cultivar extraction experimental results. Characteristic time model equations, best fitted experimental results. Empirical model equation, fitted results well, while simple single sphere model equation poorly approximated the results.

  1. Surface Hopping Dynamics with Correlated Single-Reference Methods: 9H-Adenine as a Case Study

    Czech Academy of Sciences Publication Activity Database

    Plasser, F.; Crespo-Otero, R.; Pederzoli, Marek; Pittner, Jiří; Lischka, H.; Barbatti, M.


    Roč. 10, č. 4 (2014), s. 1395-1405 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/12/0559 Institutional support: RVO:61388955 Keywords : density-functional theory * resolved photoelectron spectroscopy * nonadiabatic molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.498, year: 2014

  2. Optimized method for manufacturing large aspheric surfaces (United States)

    Zhou, Xusheng; Li, Shengyi; Dai, Yifan; Xie, Xuhui


    Aspheric optics are being used more and more widely in modern optical systems, due to their ability of correcting aberrations, enhancing image quality, enlarging the field of view and extending the range of effect, while reducing the weight and volume of the system. With optical technology development, we have more pressing requirement to large-aperture and high-precision aspheric surfaces. The original computer controlled optical surfacing (CCOS) technique cannot meet the challenge of precision and machining efficiency. This problem has been thought highly of by researchers. Aiming at the problem of original polishing process, an optimized method for manufacturing large aspheric surfaces is put forward. Subsurface damage (SSD), full aperture errors and full band of frequency errors are all in control of this method. Lesser SSD depth can be gained by using little hardness tool and small abrasive grains in grinding process. For full aperture errors control, edge effects can be controlled by using smaller tools and amendment model with material removal function. For full band of frequency errors control, low frequency errors can be corrected with the optimized material removal function, while medium-high frequency errors by using uniform removing principle. With this optimized method, the accuracy of a K9 glass paraboloid mirror can reach rms 0.055 waves (where a wave is 0.6328μm) in a short time. The results show that the optimized method can guide large aspheric surface manufacturing effectively.

  3. Surface wave velocity tracking by bisection method

    International Nuclear Information System (INIS)

    Maeda, T.


    Calculation of surface wave velocity is a classic problem dating back to the well-known Haskell's transfer matrix method, which contributes to solutions of elastic wave propagation, global subsurface structure evaluation by simulating observed earthquake group velocities, and on-site evaluation of subsurface structure by simulating phase velocity dispersion curves and/or H/V spectra obtained by micro-tremor observation. Recently inversion analysis on micro-tremor observation requires efficient method of generating many model candidates and also stable, accurate, and fast computation of dispersion curves and Raleigh wave trajectory. The original Haskell's transfer matrix method has been improved in terms of its divergence tendency mainly by the generalized transmission and reflection matrix method with formulation available for surface wave velocity; however, root finding algorithm has not been fully discussed except for the one by setting threshold to the absolute value of complex characteristic functions. Since surface wave number (reciprocal to the surface wave velocity multiplied by frequency) is a root of complex valued characteristic function, it is intractable to use general root finding algorithm. We will examine characteristic function in phase plane to construct two dimensional bisection algorithm with consideration on a layer to be evaluated and algorithm for tracking roots down along frequency axis. (author)

  4. Quantitation of 4-Methyl-4-sulfanylpentan-2-one (4MSP) in Hops by a Stable Isotope Dilution Assay in Combination with GC×GC-TOFMS: Method Development and Application To Study the Influence of Variety, Provenance, Harvest Year, and Processing on 4MSP Concentrations. (United States)

    Reglitz, Klaas; Steinhaus, Martin


    A stable isotope dilution assay was developed for quantitation of 4-methyl-4-sulfanylpentan-2-one (4MSP) in hops. The approach included the use of 4-( 13 C)methyl-4-sulfanyl(1,3,5- 13 C 3 )pentan-2-one as internal standard, selective isolation of hop thiols by mercurated agarose, and GC×GC-TOFMS analysis. Application of the method to 53 different hop samples revealed 4MSP concentrations between <1 and 114 μg/kg. Notably high concentrations were associated with United States varieties such as Citra, Eureka, Simcoe, and Apollo, whereas 4MSP was absent from traditional German and English varieties. Further experiments showed that besides the variety, also harvest year and storage vitally influenced 4MSP concentrations, whereas the impact of provenance was less pronounced. Hop processing such as drying and pelletizing had only a minor impact on 4MSP concentrations. Like the majority of other hop volatiles, 4MSP is predominantly located in the lupulin glands.

  5. Hip-Hop and the Academic Canon (United States)

    Abe, Daudi


    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  6. Computational method for free surface hydrodynamics

    International Nuclear Information System (INIS)

    Hirt, C.W.; Nichols, B.D.


    There are numerous flow phenomena in pressure vessel and piping systems that involve the dynamics of free fluid surfaces. For example, fluid interfaces must be considered during the draining or filling of tanks, in the formation and collapse of vapor bubbles, and in seismically shaken vessels that are partially filled. To aid in the analysis of these types of flow phenomena, a new technique has been developed for the computation of complicated free-surface motions. This technique is based on the concept of a local average volume of fluid (VOF) and is embodied in a computer program for two-dimensional, transient fluid flow called SOLA-VOF. The basic approach used in the VOF technique is briefly described, and compared to other free-surface methods. Specific capabilities of the SOLA-VOF program are illustrated by generic examples of bubble growth and collapse, flows of immiscible fluid mixtures, and the confinement of spilled liquids

  7. Hip-Hop Pop Art (United States)

    Talley, Clarence, Sr.


    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  8. Teaching Controversal Topics in Contemporary German Culture through Hip-Hop (United States)

    Putnam, Michael


    This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

  9. Computational efficiency for the surface renewal method (United States)

    Kelley, Jason; Higgins, Chad


    Measuring surface fluxes using the surface renewal (SR) method requires programmatic algorithms for tabulation, algebraic calculation, and data quality control. A number of different methods have been published describing automated calibration of SR parameters. Because the SR method utilizes high-frequency (10 Hz+) measurements, some steps in the flux calculation are computationally expensive, especially when automating SR to perform many iterations of these calculations. Several new algorithms were written that perform the required calculations more efficiently and rapidly, and that tested for sensitivity to length of flux averaging period, ability to measure over a large range of lag timescales, and overall computational efficiency. These algorithms utilize signal processing techniques and algebraic simplifications that demonstrate simple modifications that dramatically improve computational efficiency. The results here complement efforts by other authors to standardize a robust and accurate computational SR method. Increased speed of computation time grants flexibility to implementing the SR method, opening new avenues for SR to be used in research, for applied monitoring, and in novel field deployments.

  10. Surface analytical methods in nuclear technology

    International Nuclear Information System (INIS)

    Baumgaertner, F.


    Application of SEM-EDX, AES, XPS are exemplarily demonstrated for highly radioactive materials with ionizing dose rates of about 1 Sv near the surface. The samples studied are aerosols from the high level waste vitrification process, postprecipitation in a pretreated fuel solution and emulsifying sludge from a solvent extraction process. The results of the chemical composition differentiated down to microscopic level reveal much more information about the history of a sample than those available from the integral macro-methods analysing. Elucidication of chemical composition and body structure in micrometer level may give insight into the origin and generation processes of samples under investigation. (orig.)

  11. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas


    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  12. Hopping system control with an approximated dynamics model and upper-body motion

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)


    A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

  13. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu


    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  14. Wireless Multi Hop Access Networks and Protocols


    Nilsson Plymoth, Anders


    As more and more applications and services in our society now depend on the Internet, it is important that dynamically deployed wireless multi hop networks are able to gain access to the Internet and other infrastructure networks and services. This thesis proposes and evaluates solutions for providing multi hop Internet Access. It investigates how ad hoc networks can be combined with wireless and mesh networks in order to create wireless multi hop access networks. When several access points t...

  15. The surface analysis methods; Les methodes d`analyse des surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Deville, J.P. [Institut de Physique et Chimie, 67 - Strasbourg (France)


    Nowadays, there are a lot of surfaces analysis methods, each having its specificity, its qualities, its constraints (for instance vacuum) and its limits. Expensive in time and in investment, these methods have to be used deliberately. This article appeals to non specialists. It gives some elements of choice according to the studied information, the sensitivity, the use constraints or the answer to a precise question. After having recalled the fundamental principles which govern these analysis methods, based on the interaction between radiations (ultraviolet, X) or particles (ions, electrons) with matter, two methods will be more particularly described: the Auger electron spectroscopy (AES) and x-rays photoemission spectroscopy (ESCA or XPS). Indeed, they are the most widespread methods in laboratories, the easier for use and probably the most productive for the analysis of surface of industrial materials or samples submitted to treatments in aggressive media. (O.M.) 11 refs.

  16. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire


    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  17. Method for surface treatment by electron beams

    International Nuclear Information System (INIS)

    Panzer, S.; Doehler, H.; Bartel, R.; Ardenne, T. von.


    The invention has been aimed at simplifying the technology and saving energy in modifying surfaces with the aid of electron beams. The described beam-object geometry allows to abandon additional heat treatments. It can be used for surface hardening

  18. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya


    Yanuar, Sandy


    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  19. Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus). (United States)

    Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B


    Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

  20. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho


    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  1. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba


    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  2. How Does a Hopping Kangaroo Breathe? (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.


    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  3. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.


    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  4. Hopping Conductivity Enhanced by Microwave Radiation

    International Nuclear Information System (INIS)

    Ovadyahu, Z


    Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

  5. The SAHR Setup-Controlling Hopping Speed and Height Using a Single Actuator

    Directory of Open Access Journals (Sweden)

    N. Cherouvim


    Full Text Available In this paper we present and experimentally validate a control method for regulating both the forward speed and the apex height of a one-legged hopping robot, using only a single actuator. The control method is based on a dynamic model of the hopping robot and makes use of the dynamic coupling of the vertical and forward motions of the robot. The control is applied first to a simulated model of the robot and shown to track a desired forward robot speed and a desired apex height. Then the SAHR (single actuator hopping robot hardware is introduced and is used as an experimental platform with which to evaluate the performance of the control method. The control method is applied to the physical setup and is shown to lead to a stable hopping gait with a desired forward speed and apex height, despite the unmodelled disturbances met on the laboratory floor.

  6. The iterative hopping expansion algorithm for Monte Carlo calculations with very light fermions

    International Nuclear Information System (INIS)

    Montvay, I.


    The number of numerical operations necessary for a Monte Carlo simulation with very light fermions (like u- and d-quarks in quantum chromodynamics) is estimated within the iterative hopping expansion method. (orig.)

  7. Nowcasting Surface Meteorological Parameters Using Successive Correction Method

    National Research Council Canada - National Science Library

    Henmi, Teizi


    The successive correction method was examined and evaluated statistically as a nowcasting method for surface meteorological parameters including temperature, dew point temperature, and horizontal wind vector components...

  8. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková


    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  9. System and method for free-boundary surface extraction

    KAUST Repository

    Algarni, Marei


    A method of extracting surfaces in three-dimensional data includes receiving as inputs three-dimensional data and a seed point p located on a surface to be extracted. The method further includes propagating a front outwardly from the seed point p and extracting a plurality of ridge curves based on the propagated front. A surface boundary is detected based on a comparison of distances between adjacent ridge curves and the desired surface is extracted based on the detected surface boundary.

  10. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry; von Glehn, Ingrid; Macdonald, Colin B.; Marz, Thomas


    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  11. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry


    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  12. Method for the traveling salesman problem by controlling two parameters of the Hopfield neural network; Parameter seigyogata hop field net ni yoru junkai salesman mondai no kaiho

    Energy Technology Data Exchange (ETDEWEB)

    Setsu, N.; Murakami, K.; Ohori, T.; Watanabe, K. [Hokkaido Institute of Technology, Sapporo (Japan)


    For solving the traveling salesman problem (TSP) by using a continuous value outputting neural net (NN), an investigation was given on the accuracy of solution and the possibility on traveling routes by using the penalty coefficient and temperature as the parameters for energy functions. The parameter range to obtain high-quality traveling routes was shown by a numerical experiment. The experimental result revealed that, when the penalty coefficient `r` is large, the traveling route possibility tends to become higher, but the route length increases, and when the `r` is small, the traveling route possibility becomes lower, but the route length decreases, also in the continuous value outputting NN as in the two-value outputting NN. Noticing this fact, and in order to improve the traveling route possibility as well as the solution quality, a method was proposed to expand the penalty control method which was proposed previously by the authors on the two-value outputting NN, into the continuous value outputting NN. In addition, a proposal was also made on a method to derive an optimal temperature efficiently by using the golden section method. It was found that the relative error has been reduced by 48% on the average as compared with that in the conventional method in which the temperature is fixed. 6 refs., 5 figs.

  13. Surface analysis methods in materials science

    CERN Document Server

    Sexton, Brett; Smart, Roger


    The idea for this book stemmed from a remark by Philip Jennings of Murdoch University in a discussion session following a regular meeting of the Australian Surface Science group. He observed that a text on surface analysis and applica­ tions to materials suitable for final year undergraduate and postgraduate science students was not currently available. Furthermore, the members of the Australian Surface Science group had the research experience and range of coverage of sur­ face analytical techniques and applications to provide a text for this purpose. A of techniques and applications to be included was agreed at that meeting. The list intended readership of the book has been broadened since the early discussions, particularly to encompass industrial users, but there has been no significant alter­ ation in content. The editors, in consultation with the contributors, have agreed that the book should be prepared for four major groups of readers: - senior undergraduate students in chemistry, physics, metallur...

  14. Hopping models for ion conduction in noncrystals

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas


    semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

  15. Variable range hopping in ZnO films (United States)

    Ali, Nasir; Ghosh, Subhasis


    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  16. Application of the B.F.S. Method to Metallic Surfaces: Surface Alloys and Alloy Surfaces

    International Nuclear Information System (INIS)

    Bozzolo, Gullermo


    These notes introduce the BFS (Bozzolo-Ferrante-Smith) method for alloys, in the framework of what is available today in terms of computationally efficient and physically sound techniques for modeling of atomic systems. The BFS method belongs to the family of semi-empirical methods, which aim to balance scientific rigour with practical applications. The goal is to provide a tool that aids in the process of material analysis and development, supplementing the experimental work which by itself has limitations in terms of time, money, technology and human resources. One of the main advantages of the BFS method, basically tailored to assist in the problem of alloy design, is that it is easily applicable to the analysis of surface structure, with a satisfactory degree of accuracy. In these notes, first the role of semiempirical methods among the available tools for atomistic simulations is reviewed, followed by a description of the BFS method and a simple application in order to understand the operational procedure, and conclude reviewing some of the topics of current interest where techniques such as the BFS method play an important role in furthering the understanding os fundamental issues

  17. Surface control alloy substrates and methods of manufacture therefor

    Energy Technology Data Exchange (ETDEWEB)

    Fritzemeier, Leslie G. (Mendon, MA); Li, Qi (Marlborough, MA); Rupich, Martin W. (Framingham, MA); Thompson, Elliott D. (Coventry, RI); Siegal, Edward J. (Malden, MA); Thieme, Cornelis Leo Hans (Westborough, MA); Annavarapu, Suresh (Brookline, MA); Arendt, Paul N. (Los Alamos, NM); Foltyn, Stephen R. (Los Alamos, NM)


    Methods and articles for controlling the surface of an alloy substrate for deposition of an epitaxial layer. The invention includes the use of an intermediate layer to stabilize the substrate surface against oxidation for subsequent deposition of an epitaxial layer.

  18. Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

    Directory of Open Access Journals (Sweden)

    Wang Xue-Wen


    Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

  19. Hopping absorption edge in silicon inversion layers

    International Nuclear Information System (INIS)

    Kostadinov, I.Z.


    The low frequency gap observed in the absorption spectrum of silicon inversion layers is related to the AC variable range hopping. The frequency dependence of the absorption coefficient is calculated. (author)

  20. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-


    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  1. Degradation of hop bitter acids by fungi

    International Nuclear Information System (INIS)

    Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw


    Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

  2. Synthesis of biocompatible surfaces by nanotechnology methods


    Alekhin , A. ,; Boleiko , G. ,; Gudkova , S. ,; Markeev , A. ,; Sigarev , A. ,; Toknova , V. ,; Kirilenko , A. ,; Lapshin , R. ,; Kozlov , E. ,; Tetyukhin , D. ,


    International audience; The modification of the surface of low-density polyethylene (LDPE) and polyurethane (PU) by means of the pulsed ion-plasma deposition of nanostructural carbon coatings at 20–60°C has been studied. The effect of this low-temperature treatment on the biocompatibility of the LDPE and PU has been assessed. Optimum technological parameters for the formation of mosaic carbon nanostructures with a thickness of 0.3–15 nm and a cluster lateral size of 10–500 nm are determined. ...

  3. Surface structure analysis by means of Rutherford scattering: methods to study surface relaxation

    International Nuclear Information System (INIS)

    Turkenburg, W.C.; Soszka, W.; Saris, F.W.; Kersten, H.H.; Colenbrander, B.G.


    The use of Rutherford backscattering for structural analysis of single crystal surfaces is reviewed, and a new method is introduced. With this method, which makes use of the channeling and blocking phenomenon of light ions of medium energy, surface atoms can be located with a precision of 0.02 A. This is demonstrated in a measurement of surface relaxation for the Cu(110) surface. (Auth.)

  4. Method of predicting surface deformation in the form of sinkholes

    Energy Technology Data Exchange (ETDEWEB)

    Chudek, M.; Arkuszewski, J.


    Proposes a method for predicting probability of sinkhole shaped subsidence, number of funnel-shaped subsidences and size of individual funnels. The following factors which influence the sudden subsidence of the surface in the form of funnels are analyzed: geologic structure of the strata between mining workings and the surface, mining depth, time factor, and geologic disolocations. Sudden surface subsidence is observed only in the case of workings situated up to a few dozen meters from the surface. Using the proposed method is explained with some examples. It is suggested that the method produces correct results which can be used in coal mining and in ore mining. (1 ref.) (In Polish)

  5. Recent characterization of steel by surface analysis methods

    International Nuclear Information System (INIS)

    Suzuki, Shigeru


    Surface analysis methods, such as Auger electron spectroscopy, X-ray photoelectron spectroscopy, secondary ion mass spectrometry, glow discharge optical emission spectrometry and so on, have become indispensable to characterize surface and interface of many kinds of steel. Although a number of studies on characterization of steel by these methods have been carried out, several problems still remain in quantification and depth profiling. Nevertheless, the methods have provided essential information on the concentration and chemical state of elements at the surface and interface. Recent results on characterization of oxide layers, coated films, etc. on the surface of steel are reviewed here. (author). 99 refs

  6. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.


    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  7. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein


    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  8. Modern methods of studying surfaces and their application to glasses

    International Nuclear Information System (INIS)

    Rauschenbach, B.; Haehnert, M.


    In the works are demonstrated modern methods for study of solid surfaces and its use of glasses. Study of the interaction of ions, electrons and photons with the glass surface provides information about the composition of the surface and its structure on an atomic scale. A qualitative analysis of a surface can be made with the aid of the Auger electron spectroscopy (AES) and the electron spectroscopy for chemical analysis (ESCA) and with the ion scattering (ISS and RBS) and the secondary ion mass spectrometry (SIMS). The structure of a surface can be studied by means of ion scattering and low-energy electron diffraction (LEED) and the topography of a surface by means of scanning electron microscopy (SEM). The ellipsometry is generally confined to measuring the thickness of very thin layers. The application these methods to the glass surfaces is demonstrated on series of examples. (author)



    Marić, Sanja


    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  10. Sliding surface searching method for slopes containing a potential weak structural surface

    Directory of Open Access Journals (Sweden)

    Aijun Yao


    Full Text Available Weak structural surface is one of the key factors controlling the stability of slopes. The stability of rock slopes is in general concerned with set of discontinuities. However, in soft rocks, failure can occur along surfaces approaching to a circular failure surface. To better understand the position of potential sliding surface, a new method called simplex-finite stochastic tracking method is proposed. This method basically divides sliding surface into two parts: one is described by smooth curve obtained by random searching, the other one is polyline formed by the weak structural surface. Single or multiple sliding surfaces can be considered, and consequently several types of combined sliding surfaces can be simulated. The paper will adopt the arc-polyline to simulate potential sliding surface and analyze the searching process of sliding surface. Accordingly, software for slope stability analysis using this method was developed and applied in real cases. The results show that, using simplex-finite stochastic tracking method, it is possible to locate the position of a potential sliding surface in the slope.


    Directory of Open Access Journals (Sweden)

    SCURTU Liviu-Iacob


    Full Text Available In this paper there are presented the graphical methods to determine the parameters of an helicoidal stairs. The first part of this paper shows the used methods to generate the helicoidal curves using descriptive geometry methods. It has represented the state of the art of the generation of a helical surface studies. The second part of this study shows the helical stairs surface representation using descriptive geometry methods. For the representation of the helicoidal stairs are used two projections, the front and top view. A method of the stairs representation is solved using CAD modelling dedicated software. Following the helical surface representation in both methods, has been achieved a comparative study by using two representation methods. Conclusions about these two representation methods are presented in the end of this paper.

  12. Evaluation of surface sampling method performance for Bacillus Spores on clean and dirty outdoor surfaces.

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Mollye C.; Einfeld, Wayne; Boucher, Raymond M.; Brown, Gary Stephen; Tezak, Matthew Stephen


    Recovery of Bacillus atrophaeous spores from grime-treated and clean surfaces was measured in a controlled chamber study to assess sampling method performance. Outdoor surfaces investigated by wipe and vacuum sampling methods included stainless steel, glass, marble and concrete. Bacillus atrophaeous spores were used as a surrogate for Bacillus anthracis spores in this study designed to assess whether grime-coated surfaces significantly affected surface sampling method performance when compared to clean surfaces. A series of chamber tests were carried out in which known amounts of spores were allowed to gravitationally settle onto both clean and dirty surfaces. Reference coupons were co-located with test coupons in all chamber experiments to provide a quantitative measure of initial surface concentrations of spores on all surfaces, thereby allowing sampling recovery calculations. Results from these tests, carried out under both low and high humidity conditions, show that spore recovery from grime-coated surfaces is the same as or better than spore recovery from clean surfaces. Statistically significant differences between method performance for grime-coated and clean surfaces were observed in only about half of the chamber tests conducted.

  13. Estimating surface acoustic impedance with the inverse method. (United States)

    Piechowicz, Janusz


    Sound field parameters are predicted with numerical methods in sound control systems, in acoustic designs of building and in sound field simulations. Those methods define the acoustic properties of surfaces, such as sound absorption coefficients or acoustic impedance, to determine boundary conditions. Several in situ measurement techniques were developed; one of them uses 2 microphones to measure direct and reflected sound over a planar test surface. Another approach is used in the inverse boundary elements method, in which estimating acoustic impedance of a surface is expressed as an inverse boundary problem. The boundary values can be found from multipoint sound pressure measurements in the interior of a room. This method can be applied to arbitrarily-shaped surfaces. This investigation is part of a research programme on using inverse methods in industrial room acoustics.

  14. Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS). (United States)

    Hartmann, Richard; Strunz, Walter T


    We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

  15. A Level Set Discontinuous Galerkin Method for Free Surface Flows

    DEFF Research Database (Denmark)

    Grooss, Jesper; Hesthaven, Jan


    We present a discontinuous Galerkin method on a fully unstructured grid for the modeling of unsteady incompressible fluid flows with free surfaces. The surface is modeled by embedding and represented by a levelset. We discuss the discretization of the flow equations and the level set equation...

  16. Method for Surface Scanning in Medical Imaging and Related Apparatus

    DEFF Research Database (Denmark)


    A method and apparatus for surface scanning in medical imaging is provided. The surface scanning apparatus comprises an image source, a first optical fiber bundle comprising first optical fibers having proximal ends and distal ends, and a first optical coupler for coupling an image from the image...

  17. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications. (United States)

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C


    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

  18. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenyang [Department of Bioengineering, University of California, Los Angeles, California 90095 (United States); Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J.; Sawant, Amit [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas 75390 (United States); Ruan, Dan, E-mail: [Department of Bioengineering, University of California, Los Angeles, California 90095 and Department of Radiation Oncology, University of California, Los Angeles, California 90095 (United States)


    Purpose: To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). Methods: The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. Results: On phantom point clouds, their method

  19. Performance evaluation of sea surface simulation methods for target detection (United States)

    Xia, Renjie; Wu, Xin; Yang, Chen; Han, Yiping; Zhang, Jianqi


    With the fast development of sea surface target detection by optoelectronic sensors, machine learning has been adopted to improve the detection performance. Many features can be learned from training images by machines automatically. However, field images of sea surface target are not sufficient as training data. 3D scene simulation is a promising method to address this problem. For ocean scene simulation, sea surface height field generation is the key point to achieve high fidelity. In this paper, two spectra-based height field generation methods are evaluated. Comparison between the linear superposition and linear filter method is made quantitatively with a statistical model. 3D ocean scene simulating results show the different features between the methods, which can give reference for synthesizing sea surface target images with different ocean conditions.

  20. Research on synchronization technology of frequency hopping communication system (United States)

    Zhao, Xiangwu; Quan, Houde; Cui, Peizhang


    Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

  1. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system. (United States)

    Liu, Wenyang; Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J; Sawant, Amit; Ruan, Dan


    To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. On phantom point clouds, their method achieved submillimeter

  2. Surface Treatment And Protection Method For Cadium Zinc Telluride Crystals (United States)

    Wright, Gomez W.; James, Ralph B.; Burger, Arnold; Chinn, Douglas A.


    A method for treatment of the surface of a CdZnTe (CZT) crystal that provides a native dielectric coating to reduce surface leakage currents and thereby, improve the resolution of instruments incorporating detectors using CZT crystals. A two step process is disclosed, etching the surface of a CZT crystal with a solution of the conventional bromine/methanol etch treatment, and after attachment of electrical contacts, passivating the CZT crystal surface with a solution of 10 w/o NH4F and 10 w/o H2O2 in water.

  3. Study on a resource allocation scheme in multi-hop MIMO-OFDM systems over lognormal-rayleigh compound channels

    Directory of Open Access Journals (Sweden)

    LIU Jun


    Full Text Available For new generation wireless communication networks,this paper studies the optimization of the capacity and end-to-end throughput of the MIMO-OFDM based multi-hop relay systems.A water-filling power allocation method is proposed to improve the channel capacity and the throughput of the MIMO-OFDM system based multi-hop relay system in the Lognormal-Rayleigh shadowing compound channels.Simulations on the capacity and throughput show that the water-filling algorithm can improve the system throughput effectively in the MIMO-OFDM multi-hop relay system.

  4. Hip-Hopping across China: Intercultural Formulations of Local Identities (United States)

    Barrett, Catrice


    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  5. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.


    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  6. Revolutionizing Environmental Education through Indigenous Hip Hop Culture (United States)

    Gorlewski, Julie; Porfilio, Brad J.


    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  7. Performance analysis of multi-hop wireless packet networks

    Directory of Open Access Journals (Sweden)

    Lim J.-T.


    Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

  8. Laser method of acoustical emission control from vibrating surfaces (United States)

    Motyka, Zbigniew


    For limitation of the noise in environment, the necessity occurs of determining and location of sources of sounds emitted from surfaces of many machines and devices, assuring in effect the possibility of suitable constructional changes implementation, targeted at decreasing of their nuisance. In the paper, the results of tests and calculations are presented for plane surface sources emitting acoustic waves. The tests were realized with the use of scanning laser vibrometer which enabled remote registration and the spectral analysis of the surfaces vibrations. The known hybrid digital method developed for determination of sound wave emission from such surfaces divided into small finite elements was slightly modified by distinguishing the phase correlations between such vibrating elements. The final method being developed may find use in wide range of applications for different forms of vibrations of plane surfaces.

  9. A GPU-based mipmapping method for water surface visualization (United States)

    Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan


    Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

  10. In situ surface roughness measurement using a laser scattering method (United States)

    Tay, C. J.; Wang, S. H.; Quan, C.; Shang, H. M.


    In this paper, the design and development of an optical probe for in situ measurement of surface roughness are discussed. Based on this light scattering principle, the probe which consists of a laser diode, measuring lens and a linear photodiode array, is designed to capture the scattered light from a test surface with a relatively large scattering angle ϕ (=28°). This capability increases the measuring range and enhances repeatability of the results. The coaxial arrangement that incorporates a dual-laser beam and a constant compressed air stream renders the proposed system insensitive to movement or vibration of the test surface as well as surface conditions. Tests were conducted on workpieces which were mounted on a turning machine that operates with different cutting speeds. Test specimens which underwent different machining processes and of different surface finish were also studied. The results obtained demonstrate the feasibility of surface roughness measurement using the proposed method.

  11. Detecting mode hopping in single-longitudinal-mode fiber ring lasers based on an unbalanced fiber Michelson interferometer. (United States)

    Ma, Mingxiang; Hu, Zhengliang; Xu, Pan; Wang, Wei; Hu, Yongming


    A method of detecting mode hopping for single-longitudinal-mode (SLM) fiber ring lasers has been proposed and experimentally demonstrated. The method that is based on an unbalanced Michelson interferometer (MI) utilizing phase generated carrier modulation instantly transforms mode-hopping dynamics into steep phase changes of the interferometer. Multiform mode hops in an SLM erbium-doped fiber ring laser with an 18.6 MHz mode spacing have been detected exactly in real-time domain and discussed in detail. Numerical results show that the MI-based method has a high testing sensitivity for identifying mode hopping, which will play a significant role in evaluating the output stability of SLM fiber lasers.

  12. Facile Method for Fabricating Superhydrophobic Surface on Magnesium

    Energy Technology Data Exchange (ETDEWEB)

    Han, Mun Hee; Park, Yeon Hwa; Hyun, June Won; Ahn, Yong Hyun [Dankook Univ., Yongin (Korea, Republic of)


    In conclusion, we have developed a simple and inexpensive method for fabricating a superhydrophobic surface of magnesium by metal deposition and stearic acid coating. We fabricated a superhydrophobic surface on magnesium by nickel deposition and surface coating of stearic acid. The fabricated surfaces were stable against acidic and basic solutions. In recent times, technologies based on the imitation of nature have attracted considerable attention. Lotus leaves are known for their self-cleaning effect. The micrometer-scale papillae structure and the epicuticular wax on the lotus leaf contribute to this effect. In a manner similar to the self-cleaning property of lotus leaves, the wettability of solid surfaces is of great interest in daily life and industry.1-4 Wettability is controlled by both the geometrical structure of a surface and a low surface energy material coating. A superhydrophobic surface is satisfied with a water contact angle of more than 150 .deg. and a sliding angle of less than 10 .deg. On such a surface, a water drop has a perfectly spherical shape and it easily rolls off and removes deposited contaminants. A superhydrophobic surface thus protects a material from contamination, fogging, and snow deposition.

  13. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae


    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  14. Injury incidence in hip hop dance. (United States)

    Ojofeitimi, S; Bronner, S; Woo, H


    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  15. The Philippine "Hip Hop Stick Dance" (United States)

    Lewis, Lisa


    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  16. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop (United States)

    Soderman, Johan


    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  17. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom (United States)

    Kruse, Adam J.


    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  18. SHOP: scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Linusson, Anna; Zamora, Ismael


    A new GRID-based method for scaffold hopping (SHOP) is presented. In a fully automatic manner, scaffolds were identified in a database based on three types of 3D-descriptors. SHOP's ability to recover scaffolds was assessed and validated by searching a database spiked with fragments of known...... scaffolds were in the 31 top-ranked scaffolds. SHOP also identified new scaffolds with substantially different chemotypes from the queries. Docking analysis indicated that the new scaffolds would have similar binding modes to those of the respective query scaffolds observed in X-ray structures...

  19. Free-surface viscous flow solution methods for ship hydrodynamics

    NARCIS (Netherlands)

    Wackers, J.; Koren, B.; Raven, H.C.; Ploeg, van der A.; Starke, A.R.; Deng, G.; Queutey, P.; Visonneau, M.; Hino, T.; Ohashi, K.


    The simulation of viscous free-surface water flow is a subject that has reached a certain maturity and is nowadays used in industrial applications, like the simulation of the flow around ships. While almost all methods used are based on the Navier-Stokes equations, the discretisation methods for the

  20. Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction. (United States)

    Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L


    Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

  1. Quantifying Uncertainty in Near Surface Electromagnetic Imaging Using Bayesian Methods (United States)

    Blatter, D. B.; Ray, A.; Key, K.


    Geoscientists commonly use electromagnetic methods to image the Earth's near surface. Field measurements of EM fields are made (often with the aid an artificial EM source) and then used to infer near surface electrical conductivity via a process known as inversion. In geophysics, the standard inversion tool kit is robust and can provide an estimate of the Earth's near surface conductivity that is both geologically reasonable and compatible with the measured field data. However, standard inverse methods struggle to provide a sense of the uncertainty in the estimate they provide. This is because the task of finding an Earth model that explains the data to within measurement error is non-unique - that is, there are many, many such models; but the standard methods provide only one "answer." An alternative method, known as Bayesian inversion, seeks to explore the full range of Earth model parameters that can adequately explain the measured data, rather than attempting to find a single, "ideal" model. Bayesian inverse methods can therefore provide a quantitative assessment of the uncertainty inherent in trying to infer near surface conductivity from noisy, measured field data. This study applies a Bayesian inverse method (called trans-dimensional Markov chain Monte Carlo) to transient airborne EM data previously collected over Taylor Valley - one of the McMurdo Dry Valleys in Antarctica. Our results confirm the reasonableness of previous estimates (made using standard methods) of near surface conductivity beneath Taylor Valley. In addition, we demonstrate quantitatively the uncertainty associated with those estimates. We demonstrate that Bayesian inverse methods can provide quantitative uncertainty to estimates of near surface conductivity.

  2. An Optimization Method for Virtual Globe Ocean Surface Dynamic Visualization

    Directory of Open Access Journals (Sweden)

    HUANG Wumeng


    Full Text Available The existing visualization method in the virtual globe mainly uses the projection grid to organize the ocean grid. This special grid organization has the defects in reflecting the difference characteristics of different ocean areas. The method of global ocean visualization based on global discrete grid can make up the defect of the projection grid method by matching with the discrete space of the virtual globe, so it is more suitable for the virtual ocean surface simulation application.But the available global discrete grids method has many problems which limiting its application such as the low efficiency of rendering and loading, the need of repairing grid crevices. To this point, we propose an optimization for the global discrete grids method. At first, a GPU-oriented multi-scale grid model of ocean surface which develops on the foundation of global discrete grids was designed to organize and manage the ocean surface grids. Then, in order to achieve the wind-drive wave dynamic rendering, this paper proposes a dynamic wave rendering method based on the multi-scale ocean surface grid model to support real-time wind field updating. At the same time, considering the effect of repairing grid crevices on the system efficiency, this paper presents an efficient method for repairing ocean surface grid crevices based on the characteristics of ocean grid and GPU technology. At last, the feasibility and validity of the method are verified by the comparison experiment. The experimental results show that the proposed method is efficient, stable and fast, and can compensate for the lack of function of the existing methods, so the application range is more extensive.

  3. Optical description and design method with annularly stitched aspheric surface. (United States)

    Cheng, De-Wen; Chen, Xue-Jiao; Xu, Chen; Hu, Yuan; Wang, Yong-Tian


    The relentless pressure for designs with new optical functions, small volume, and light weight has greatly increased the importance of aspheric surfaces. In this paper, we propose an annularly stitched aspheric surface (ASAS) description method to increase the freedom and flexibility of imaging system design. The rotationally symmetric ASAS consists of a circular central zone and one or more annular zones. Two neighboring zones are constrained to have the same derivatives on their joint curve, and this means the ASAS is C1 continuous. This finding is proved and verified by the mathematical deduction of the surface formulas. Two optimization strategies and two design methods with the C1 continuous constraints are also discussed. This surface can greatly facilitate the design and even achieve some previously impossible designs without increasing the fabrication difficulty. Two different systems with the proposed ASAS are optimized and the results are presented. The design results verified the practicability of the ASAS.

  4. Experimental Method for Measuring Dust Load on Surfaces in Rooms

    DEFF Research Database (Denmark)

    Lengweiler, Philip; Nielsen, Peter V.; Moser, Alfred

    A new experimental setup to investigate the physical process of dust deposition and resuspension on and from surfaces is introduced. Dust deposition can reduce the airborne dust concentration considerably. As a basis for developing methods to eliminate dust-related problems in rooms, there is a n......A new experimental setup to investigate the physical process of dust deposition and resuspension on and from surfaces is introduced. Dust deposition can reduce the airborne dust concentration considerably. As a basis for developing methods to eliminate dust-related problems in rooms......, there is a need for better understanding of the mechanism of dust deposition and resuspension. With the presented experimental setup, the dust load on surfaces in a channel can be measured as a function of the environmental and surface conditions and the type of particles under controlled laboratory conditions....

  5. Cascading Multi-Hop Reservation and Transmission in Underwater Acoustic Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jae-Won Lee


    Full Text Available The long propagation delay in an underwater acoustic channel makes designing an underwater media access control (MAC protocol more challenging. In particular, handshaking-based MAC protocols widely used in terrestrial radio channels have been known to be inappropriate in underwater acoustic channels, because of the inordinately large latency involved in exchanging control packets. Furthermore, in the case of multi-hop relaying in a hop-by-hop handshaking manner, the end-to-end delay significantly increases. In this paper, we propose a new MAC protocol named cascading multi-hop reservation and transmission (CMRT. In CMRT, intermediate nodes between a source and a destination may start handshaking in advance for the next-hop relaying before handshaking for the previous node is completed. By this concurrent relaying, control packet exchange and data delivery cascade down to the destination. In addition, to improve channel utilization, CMRT adopts a packet-train method where multiple data packets are sent together by handshaking once. Thus, CMRT reduces the time taken for control packet exchange and accordingly increases the throughput. The performance of CMRT is evaluated and compared with that of two conventional MAC protocols (multiple-access collision avoidance for underwater (MACA-U and MACA-U with packet trains (MACA-UPT. The results show that CMRT outperforms other MAC protocols in terms of both throughput and end-to-end delay.

  6. Multi-hop localization algorithm based on grid-scanning for wireless sensor networks. (United States)

    Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian


    For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

  7. Jumping and Hopping in Elite and Amateur Orienteering Athletes and Correlations to Sprinting and Running

    DEFF Research Database (Denmark)

    Hébert-Losier, Kim; Jensen, Kurt; Holmberg, Hans-Christer


    PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlatio...... and rapid generation of high relative maximal forces, especially vertically. These functional measures were more closely related to sprinting and/or running abilities, indicating benefits of lower-body training in orienteering.......PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlations...... with sprinting and/or running have been examined in orienteering athletes. METHODS: We investigated squat jump (SJ), countermovement jump (CMJ), standing long jump (SLJ), and hopping performed by 8 elite and 8 amateur male foot-orienteering athletes (29 ± 7 y, 183 ± 5 cm, 73 ± 7 kg) and possible correlations...

  8. Multiscale Finite Element Methods for Flows on Rough Surfaces

    KAUST Repository

    Efendiev, Yalchin


    In this paper, we present the Multiscale Finite Element Method (MsFEM) for problems on rough heterogeneous surfaces. We consider the diffusion equation on oscillatory surfaces. Our objective is to represent small-scale features of the solution via multiscale basis functions described on a coarse grid. This problem arises in many applications where processes occur on surfaces or thin layers. We present a unified multiscale finite element framework that entails the use of transformations that map the reference surface to the deformed surface. The main ingredients of MsFEM are (1) the construction of multiscale basis functions and (2) a global coupling of these basis functions. For the construction of multiscale basis functions, our approach uses the transformation of the reference surface to a deformed surface. On the deformed surface, multiscale basis functions are defined where reduced (1D) problems are solved along the edges of coarse-grid blocks to calculate nodalmultiscale basis functions. Furthermore, these basis functions are transformed back to the reference configuration. We discuss the use of appropriate transformation operators that improve the accuracy of the method. The method has an optimal convergence if the transformed surface is smooth and the image of the coarse partition in the reference configuration forms a quasiuniform partition. In this paper, we consider such transformations based on harmonic coordinates (following H. Owhadi and L. Zhang [Comm. Pure and Applied Math., LX(2007), pp. 675-723]) and discuss gridding issues in the reference configuration. Numerical results are presented where we compare the MsFEM when two types of deformations are used formultiscale basis construction. The first deformation employs local information and the second deformation employs a global information. Our numerical results showthat one can improve the accuracy of the simulations when a global information is used. © 2013 Global-Science Press.

  9. Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute (United States)

    Beyer, Eric W.

    The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions

  10. 3D electric field calculation with surface charge method

    International Nuclear Information System (INIS)

    Yamada, S.


    This paper describes an outline and some examples of three dimensional electric field calculations with a computer code developed at NIRS. In the code, a surface charge method is adopted because of it's simplicity in the mesh establishing procedure. The charge density in a triangular mesh is assumed to distribute with a linear function of the position. The electric field distribution is calculated for a pair of drift tubes with the focusing fingers on the opposing surfaces. The field distribution in an acceleration gap is analyzed with a Fourier-Bessel series expansion method. The calculated results excellently reproduces the measured data with a magnetic model. (author)

  11. Electronic transport of molecular nanowires by considering of electron hopping energy between the second neighbors

    Directory of Open Access Journals (Sweden)

    H Rabani


    Full Text Available In this paper, we study the electronic conductance of molecular nanowires by considering the electron hopping between the first and second neighbors with the help Green’s function method at the tight-binding approach. We investigate three types of structures including linear uniform and periodic chains as well as poly(p-phenylene molecule which are embedded between two semi-infinite metallic leads. The results show that in the second neighbor approximation, the resonance, anti-resonance and Fano phenomena occur in the conductance spectra of these structures. Moreover, a new gap is observed at edge of the lead energy band wich its width depends on the value of the electron hopping energy between the second neighbors. In the systems including intrinsic gap, this hopping energy shifts the gap in the energy spectra.

  12. Hip-Hop Fight Club: Radical Theory, Education, and Practice in and beyond the Classroom

    Directory of Open Access Journals (Sweden)

    Jared A. Ball


    Full Text Available Hip-hop remains a viable method for the teaching of radical theory, emancipatory journalism and Africana Media Theory.  Fight Club is an emergent model that builds from existing hip-hop traditions of freetyle battling where critical thought and intellectual challenges of hueristic norms are upended.  This article argues in favor of bringing the Fight Club model into the classroom which allows for heightened student engagement and the inclusion of radical theoretical approaches to the study of mass media, communication and journalism.

  13. The crossover between tunnel and hopping conductivity in granulated films of noble metals (United States)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey


    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  14. Designing Pulse Laser Surface Modification of H13 Steel Using Response Surface Method (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.


    This paper presents a design of experiment (DOE) for laser surface modification process of AISI H13 tool steel in achieving the maximum hardness and minimum surface roughness at a range of modified layer depth. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 tool steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, overlap percentage and pulse repetition frequency (PRF). The response surface method with Box-Behnken design approach in Design Expert 7 software was used to design the H13 laser surface modification process. Metallographic study and image analysis were done to measure the modified layer depth. The modified surface roughness was measured using two-dimensional surface profilometer. The correlation of the three laser processing parameters and the modified surface properties was specified by plotting three-dimensional graph. The hardness properties were tested at 981 mN force. From metallographic study, the laser modified surface depth was between 37 μm and 150 μm. The average surface roughness recorded from the 2D profilometry was at a minimum value of 1.8 μm. The maximum hardness achieved was between 728 and 905 HV0.1. These findings are significant to modern development of hard coatings for wear resistant applications.

  15. Primena savremenih metoda izviđanja signala sa frekvencijskim skakanjem za formiranje elektronske slike bojišta / Advanced methods for frequency hopping signal reconnaissance for the purpose of constructing electronic order of battle

    Directory of Open Access Journals (Sweden)

    Desimir Vučić


    Full Text Available Sve veća zastupljenost savremenih tehnika digitalnih komunikacija koje primenjuju signale sa malom verovatnoćom presretanja, kao što su signali sa frekvencijskim skakanjem, nameće razvoj novih metoda i algoritama za njihovo izviđanje radi formiranja elektronske slike bojišta. U ovom radu razmatraju se principi i dostignuća u razvoju novih metoda u detekciji, karakterizaciji identifikaciji i eksploataciji ovih sofisticiranih komunikacionih signala u kontekstu elektronskog rata. / The extensive use of modern low probability-of-intercept digital communication signals, such as frequency hopping signals, requires development of new theory and algorithms for their reconnaissance for the purpose of constructing an electronic order of battle. This paper presents some principles and advances in signal processing and analysis technology for the signal interception, characterization, identification and exploitation in the context of electronic warfare.

  16. Specific surface area evaluation method by using scanning electron microscopy

    International Nuclear Information System (INIS)

    Petrescu, Camelia; Petrescu, Cristian; Axinte, Adrian


    Ceramics are among the most interesting materials for a large category of applications, including both industry and health. Among the characteristic of the ceramic materials, the specific surface area is often difficult to evaluate.The paper presents a method of evaluation for the specific surface area of two ceramic powders by means of scanning electron microscopy measurements and an original method of computing the specific surface area.Cumulative curves are used to calculate the specific surface area under assumption that the values of particles diameters follow a normal logarithmic distribution. For two powder types, X7R and NPO the results are the following: - for the density ρ (g/cm 2 ), 5.5 and 6.0, respectively; - for the average diameter D bar (μm), 0.51 and 0.53, respectively; - for σ, 1.465 and 1.385, respectively; - for specific surface area (m 2 /g), 1.248 and 1.330, respectively. The obtained results are in good agreement with the values measured by conventional methods. (authors)

  17. Diffusion accessibility as a method for visualizing macromolecular surface geometry. (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O


    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is © 2015 The Protein Society.

  18. Comparison of Transmission Line Methods for Surface Acoustic Wave Modeling (United States)

    Wilson, William; Atkinson, Gary


    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method (a first order model), and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices. Keywords: Surface Acoustic Wave, SAW, transmission line models, Impulse Response Method.

  19. Method and Apparatus for Creating a Topography at a Surface (United States)

    Adams, David P.; Sinclair, Michael B.; Mayer, Thomas M.; Vasile, Michael J.; Sweatt, William C.


    Methods and apparatus whereby an optical interferometer is utilized to monitor and provide feedback control to an integrated energetic particle column, to create desired topographies, including the depth, shape and/or roughness of features, at a surface of a specimen. Energetic particle columns can direct energetic species including, ions, photons and/or neutral particles to a surface to create features having in-plane dimensions on the order of 1 micron, and a height or depth on the order of 1 nanometer. Energetic processes can include subtractive processes such as sputtering, ablation, focused ion beam milling and, additive processes, such as energetic beam induced chemical vapor deposition. The integration of interferometric methods with processing by energetic species offers the ability to create desired topographies at surfaces, including planar and curved shapes.

  20. Multi-phase-field method for surface tension induced elasticity (United States)

    Schiedung, Raphael; Steinbach, Ingo; Varnik, Fathollah


    A method, based on the multi-phase-field framework, is proposed that adequately accounts for the effects of a coupling between surface free energy and elastic deformation in solids. The method is validated via a number of analytically solvable problems. In addition to stress states at mechanical equilibrium in complex geometries, the underlying multi-phase-field framework naturally allows us to account for the influence of surface energy induced stresses on phase transformation kinetics. This issue, which is of fundamental importance on the nanoscale, is demonstrated in the limit of fast diffusion for a solid sphere, which melts due to the well-known Gibbs-Thompson effect. This melting process is slowed down when coupled to surface energy induced elastic deformation.

  1. Temperature sensitive surfaces and methods of making same (United States)

    Liang, Liang [Richland, WA; Rieke, Peter C [Pasco, WA; Alford, Kentin L [Pasco, WA


    Poly-n-isopropylacrylamide surface coatings demonstrate the useful property of being able to switch charateristics depending upon temperature. More specifically, these coatings switch from being hydrophilic at low temperature to hydrophobic at high temperature. Research has been conducted for many years to better characterize and control the properties of temperature sensitive coatings. The present invention provides novel temperature sensitive coatings on articles and novel methods of making temperature sensitive coatings that are disposed on the surfaces of various articles. These novel coatings contain the reaction products of n-isopropylacrylamide and are characterized by their properties such as advancing contact angles. Numerous other characteristics such as coating thickness, surface roughness, and hydrophilic-to-hydrophobic transition temperatures are also described. The present invention includes articles having temperature-sensitve coatings with improved properties as well as improved methods for forming temperature sensitive coatings.

  2. Localized surface plasmon resonance mercury detection system and methods (United States)

    James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.


    A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.

  3. Epigenetic changes detected in micropropagated hop plants. (United States)

    Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles


    Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.

  4. Direct methods for surface X-ray diffraction

    International Nuclear Information System (INIS)

    Saldin, D. K.; Harder, R.; Shneerson, V. L.; Vogler, H.; Moritz, W.


    We develop of a direct method for surface X-ray diffraction that exploits the holographic feature of a known reference wave from the substrate. A Bayesian analysis of the optimal inference to be made from an incomplete data set suggests a maximum entropy algorithm that balances agreement with the data and other statistical considerations

  5. Response surface method to optimize the low cost medium for ...

    African Journals Online (AJOL)

    A protease producing Bacillus sp. GA CAS10 was isolated from ascidian Phallusia arabica, Tuticorin, Southeast coast of India. Response surface methodology was employed for the optimization of different nutritional and physical factors for the production of protease. Plackett-Burman method was applied to identify ...

  6. Surface sterilization method for reducing microbial contamination of ...

    African Journals Online (AJOL)

    An effective disinfection method for strawberry (Fragaria x ananassa Duch.) cv. Senga Sengana micropropagation using runner tips and nodal segments as explants was developed. The explants were surface sterilized with different sterilants for different durations. The present studies on the effect of different regimes of ...

  7. Assessment methods of injection moulded nano-patterned surfaces

    DEFF Research Database (Denmark)

    Menotti, S.; Bisacco, G.; Hansen, H. N.


    algorithm for feature recognition. To compare the methods, the mould insert and a number of replicated nano-patterned surfaces, injection moulded with an induction heating aid, were measured on nominally identical locations by means of an atomic force microscope mounted on a manual CMM....

  8. Surface zwitterionization: Effective method for preventing oral bacterial biofilm formation on hydroxyapatite surfaces (United States)

    Lee, Myoungjin; Kim, Heejin; Seo, Jiae; Kang, Minji; Kang, Sunah; Jang, Joomyung; Lee, Yan; Seo, Ji-Hun


    In this study, we conducted surface zwitterionization of hydroxyapatite (HA) surfaces by immersing them in the zwitterionic polymer solutions to provide anti-bacterial properties to the HA surface. Three different monomers containing various zwitterionic groups, i.e., phosphorylcholine (PC), sulfobetaine (SB), and carboxybetaine (CB), were copolymerized with the methacrylic monomer containing a Ca2+-binding moiety, using the free radical polymerization method. As a control, functionalization of the copolymer containing the Ca2+-binding moiety was synthesized using a hydroxy group. The stable immobilization of the zwitterionic functional groups was confirmed by water contact angle analysis and X-ray photoelectron spectroscopy (XPS) measurement conducted after the sonication process. The zwitterionized HA surface showed significantly decreased protein adsorption, whereas the hydroxyl group-coated HA surface showed limited efficacy. The anti-bacterial adhesion property was confirmed by conducting Streptococcus mutans (S. mutans) adhesion tests for 6 h and 24 h. When furanone C-30, a representative anti-quorum sensing molecule for S. mutans, was used, only a small amount of bacteria adhered after 6 h and the population did not increase after 24 h. In contrast, zwitterionized HA surfaces showed almost no bacterial adhesion after 6 h and the effect was retained for 24 h, resulting in the lowest level of oral bacterial adhesion. These results confirm that surface zwitterionization is a promising method to effectively prevent oral bacterial adhesion on HA-based materials.

  9. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar


    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  10. Radio resource management scheme and outage analysis for network-assisted multi-hop D2D communications

    Directory of Open Access Journals (Sweden)

    Leila Melki


    Full Text Available In a cellular network it's very difficult to make spectrum resource more efficiently. Device-to-Device (D2D technology enables new service opportunities, and provides high throughput and reliable communication while reducing the base station load. For better total performance, short-range D2D links and cellular links share the same radio resource and the management of interference becomes a crucial task. Here we argue that single-hop D2D technology can be used to further improve cellular networks performance if the key D2D radio resource management algorithms are suitably extended to support multi-hop D2D communications. Aiming to establish a new paradigm for the analysis and design of multi-hop D2D communications, We propose a radio resource allocation for multi-hop D2D routes based on interference avoidance approach in LTE-A networks. On top of that, we investigate the outage probability of D2D communication. We first introduce a new definition of outage probability by considering the maximum distance to be allowable for single-hop transmission. Then we study and analyze the outage performance of a multi-hop D2D route. We derive the general closed form expression of outage probability of the multi-hop D2D routes. The results demonstrate that the D2D radio, sharing the same resources as the cellular network, provide higher capacity compared to pure cellular communication where all the data is transmitted through the base station. They also demonstrate that the new method of calculation of D2D multi hop outage probability has better performance than classical method defined in the literature.

  11. A novel test method for quantifying surface tack of polypropylene compound surfaces

    Directory of Open Access Journals (Sweden)


    Full Text Available While adhesiveness is required for polymer surfaces in special applications, tacky surfaces are generally undesirable in many applications like automotive interior parts. The tackiness of polymer surface results from a combination of composition and additivation, and it can change significantly in natural or accelerated ageing. Since there is no established, uniform method to characterize surface tack, the major focus of the present work was on the development of an objective quantification method. A setup having a soft die tip attached to a standard tensile tester was developed aiming for correlation to the human sense of touch. Three different model thermoplastic polyolefin (TPO compound formulations based on a high-impact isotactic polypropylene (iPP composition with varying amounts and types of anti-scratch additives were used for these investigations. As the surface tack phenomenon is related to ageing and weathering, the material’s examination was also performed after various intervals of weathering. The developed method allows a fast assessment of the effect of polymer composition variations and different additive formulations on surface tack and gives identical rankings as the standardized haptic panel.

  12. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae


    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  13. Small polaron hopping in magnetic semiconductors

    International Nuclear Information System (INIS)

    Emin, D.; Liu, N.L.H.


    In a number of magnetic insulators it has been hypothesized that the charge carriers form small polarons. The transfer of an electron between magnetic sites and how the magnetic nature of the material affects the rate which characterizes small-polaron hops between magnetic sites were studied. The basic transfer processes are addressed from a many-electron point in which the itinerant electron is treated as indistinguishable from those which contribute unpaired spins at the magnetic sites

  14. The method of synthesizing of superhydrophobic surfaces by PECVD (United States)

    Orazbayev, Sagi; Gabdullin, Maratbek; Ramazanov, Tlekkabul; Dosbolayev, Merlan; Zhunisbekov, Askar; Omirbekov, Dulat; Otarbay, Zhuldyz


    The aim of this work was to obtain superhydrophobic surfaces in a plasma medium. The experiment was carried out using the PECVD method in two different modes: constant and pulsing. The surface roughness was obtained by applying nanoparticles synthesized in plasma in a mixture of argon and methane. The resulting particles were deposited on the surface of silicon and glass materials. The contact angle increased linearly depending on the number of cycles, until it reached 160° at 150-160th cycles, after that the increase in cycles does not affect the contact angle, since the saturation process is in progress. Also the effect of the working gas composition on the hydrophobicity of the surface was studied. At low concentrations of methane (1%) only particles are synthesized in the working gas, and hydrophobicity is unstable, with an increase in methane concentration (7%) nanofilms are synthesized from nanoclusters, and surface hydrophobicity is relatively stable. In addition, a pulsing plasma mode was used to obtain superhydrophobic surfaces. The hydrophobicity of the sample showed that the strength of the nanofilm was stable in comparison with the sample obtained in the first mode, but the contact angle was lower. The obtained samples were examined using SEM, SPM, optical analysis, and their contact angles were determined.

  15. Pedagogical Ideas on Sonic, Mediated, and Virtual Musical Landscapes: Teaching Hip Hop in a University Classroom (United States)

    Dhokai, Niyati


    Based on the experience of teaching the history of American hip hop music to a classroom of Canadian university students, the author considers the disjuncture between the cultural orientations of herself and her students. The author considers teaching methods to solve the place-based disjuncture that often occurs when teaching genres such as hip…

  16. Advances in the Surface Renewal Flux Measurement Method (United States)

    Shapland, T. M.; McElrone, A.; Paw U, K. T.; Snyder, R. L.


    The measurement of ecosystem-scale energy and mass fluxes between the planetary surface and the atmosphere is crucial for understanding geophysical processes. Surface renewal is a flux measurement technique based on analyzing the turbulent coherent structures that interact with the surface. It is a less expensive technique because it does not require fast-response velocity measurements, but only a fast-response scalar measurement. It is therefore also a useful tool for the study of the global cycling of trace gases. Currently, surface renewal requires calibration against another flux measurement technique, such as eddy covariance, to account for the linear bias of its measurements. We present two advances in the surface renewal theory and methodology that bring the technique closer to becoming a fully independent flux measurement method. The first advance develops the theory of turbulent coherent structure transport associated with the different scales of coherent structures. A novel method was developed for identifying the scalar change rate within structures at different scales. Our results suggest that for canopies less than one meter in height, the second smallest coherent structure scale dominates the energy and mass flux process. Using the method for resolving the scalar exchange rate of the second smallest coherent structure scale, calibration is unnecessary for surface renewal measurements over short canopies. This study forms the foundation for analysis over more complex surfaces. The second advance is a sensor frequency response correction for measuring the sensible heat flux via surface renewal. Inexpensive fine-wire thermocouples are frequently used to record high frequency temperature data in the surface renewal technique. The sensible heat flux is used in conjunction with net radiation and ground heat flux measurements to determine the latent heat flux as the energy balance residual. The robust thermocouples commonly used in field experiments

  17. Continuum damage mechanics method for fatigue growth of surface cracks

    International Nuclear Information System (INIS)

    Feng Xiqiao; He Shuyan


    With the background of leak-before-break (LBB) analysis of pressurized vessels and pipes in nuclear plants, the fatigue growth problem of either circumferential or longitudinal semi-elliptical surface cracks subjected to cyclic loading is studied by using a continuum damage mechanics method. The fatigue damage is described by a scalar damage variable. From the damage evolution equation at the crack tip, a crack growth equation similar to famous Paris' formula is derived, which shows the physical meaning of Paris' formula. Thereby, a continuum damage mechanics approach is developed to analyze the configuration evolution of surface cracks during fatigue growth

  18. The new fabrication method of standard surface sources

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Yasushi E-mail:; Hino, Yoshio; Yamada, Takahiro; Matsumoto, Mikio


    We developed a new fabrication method for standard surface sources by using an inkjet printer with inks in which a radioactive material is mixed to print on a sheet of paper. Three printed test patterns have been prepared: (1) 100 mmx100 mm uniformity-test patterns, (2) positional-resolution test patterns with different widths and intervals of straight lines, and (3) logarithmic intensity test patterns with different radioactive intensities. The results revealed that the fabricated standard surface sources had high uniformity, high positional resolution, arbitrary shapes and a broad intensity range.

  19. Robust hopping based on virtual pendulum posture control

    International Nuclear Information System (INIS)

    Sharbafi, Maziar A; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Maufroy, Christophe; Seyfarth, Andre


    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved. (paper)

  20. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom (United States)

    Adjapong, Edmund S.; Emdin, Christopher


    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  1. A density gradient theory based method for surface tension calculations

    DEFF Research Database (Denmark)

    Liang, Xiaodong; Michelsen, Michael Locht; Kontogeorgis, Georgios


    The density gradient theory has been becoming a widely used framework for calculating surface tension, within which the same equation of state is used for the interface and bulk phases, because it is a theoretically sound, consistent and computationally affordable approach. Based on the observation...... that the optimal density path from the geometric mean density gradient theory passes the saddle point of the tangent plane distance to the bulk phases, we propose to estimate surface tension with an approximate density path profile that goes through this saddle point. The linear density gradient theory, which...... assumes linearly distributed densities between the two bulk phases, has also been investigated. Numerical problems do not occur with these density path profiles. These two approximation methods together with the full density gradient theory have been used to calculate the surface tension of various...

  2. Simulating condensation on microstructured surfaces using Lattice Boltzmann Method (United States)

    Alexeev, Alexander; Vasyliv, Yaroslav


    We simulate a single component fluid condensing on 2D structured surfaces with different wettability. To simulate the two phase fluid, we use the athermal Lattice Boltzmann Method (LBM) driven by a pseudopotential force. The pseudopotential force results in a non-ideal equation of state (EOS) which permits liquid-vapor phase change. To account for thermal effects, the athermal LBM is coupled to a finite volume discretization of the temperature evolution equation obtained using a thermal energy rate balance for the specific internal energy. We use the developed model to probe the effect of surface structure and surface wettability on the condensation rate in order to identify microstructure topographies promoting condensation. Financial support is acknowledged from Kimberly-Clark.

  3. Determination of the Geographical and Botanical Origin of Hops (Humulus lupulus L.) Using Stable Isotopes of C, N, and S. (United States)

    Ocvirk, Miha; Ogrinc, Nives; Košir, Iztok Jože


    A need exists for a reliable method to determine the geographical and botanical origin of hops. For this study, three sets of samples were collected: the first set comprised 5 German samples; the second set comprised samples of hops from 10 of the world's major hop-growing regions; and the third comprised the 4 main Slovenian regions. The samples were analyzed using isotope ratio mass spectrometry (IRMS) to obtain δ 13 C, δ 15 N, and δ 34 S values. The δ 15 N (2.2 ‰ to 8.4 ‰) and δ 34 S (0.7 ‰ to 12.3 ‰) values were the most discriminating parameters for classifying hop according to geographical origin. ANOVA showed distinct groupings for 8 out of the 10 hop-growing regions. Although it was not possible to distinguish the geographical origin of hops based on δ 13 C (-28.9 ‰ to -24.7 ‰), in the case of botanical origin, δ 13 C values proved to be the most discriminative albeit with limited success.

  4. A Comparison of Vertical Stiffness Values Calculated from Different Measures of Center of Mass Displacement in Single-Leg Hopping. (United States)

    Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J


    This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.

  5. Full surface inspection methods regarding reinforcement corrosion of concrete structures

    International Nuclear Information System (INIS)

    Reichling, K.; Raupach, M.; Broomfield, J.; Gulikers, J.; L'Hostis, Valerie


    For reinforced concrete structures a localisation of all significant critical areas can only be done by a full surface inspection. The economic advantages are obvious: uncritical areas have not to be repaired expensively.The first step of the assessment should always be a visual inspection. The range of deterioration causes can be limited and the degree of deterioration may be estimated roughly. The inspection program can be adjusted to the requirements. By means of a full surface potential mapping areas with a high risk for chloride induced reinforcement corrosion can be localised, although no deteriorations are visually detectable at the concrete surface. In combination with concrete cover depth and resistivity measurements areas with corrosion promoting exposure conditions can be localised even if the reinforcement is not yet de-passivated. The following publication gives an overview about the essential full surface investigation methods to localise critical areas regarding corrosion of steel in concrete. The selection of methods is based on the inspection procedure given in reference 2. (authors)

  6. Comparison of optical methods for surface roughness characterization

    DEFF Research Database (Denmark)

    Feidenhans'l, Nikolaj Agentoft; Hansen, Poul Erik; Pilny, Lukas


    We report a study of the correlation between three optical methods for characterizing surface roughness: a laboratory scatterometer measuring the bi-directional reflection distribution function (BRDF instrument), a simple commercial scatterometer (rBRDF instrument), and a confocal optical profiler....... For each instrument, the effective range of spatial surface wavelengths is determined, and the common bandwidth used when comparing the evaluated roughness parameters. The compared roughness parameters are: the root-mean-square (RMS) profile deviation (Rq), the RMS profile slope (Rdq), and the variance...... of the scattering angle distribution (Aq). The twenty-two investigated samples were manufactured with several methods in order to obtain a suitable diversity of roughness patterns.Our study shows a one-to-one correlation of both the Rq and the Rdq roughness values when obtained with the BRDF and the confocal...

  7. Theoretical studies of potential energy surfaces and computational methods

    Energy Technology Data Exchange (ETDEWEB)

    Shepard, R. [Argonne National Laboratory, IL (United States)


    This project involves the development, implementation, and application of theoretical methods for the calculation and characterization of potential energy surfaces involving molecular species that occur in hydrocarbon combustion. These potential energy surfaces require an accurate and balanced treatment of reactants, intermediates, and products. This difficult challenge is met with general multiconfiguration self-consistent-field (MCSCF) and multireference single- and double-excitation configuration interaction (MRSDCI) methods. In contrast to the more common single-reference electronic structure methods, this approach is capable of describing accurately molecular systems that are highly distorted away from their equilibrium geometries, including reactant, fragment, and transition-state geometries, and of describing regions of the potential surface that are associated with electronic wave functions of widely varying nature. The MCSCF reference wave functions are designed to be sufficiently flexible to describe qualitatively the changes in the electronic structure over the broad range of geometries of interest. The necessary mixing of ionic, covalent, and Rydberg contributions, along with the appropriate treatment of the different electron-spin components (e.g. closed shell, high-spin open-shell, low-spin open shell, radical, diradical, etc.) of the wave functions, are treated correctly at this level. Further treatment of electron correlation effects is included using large scale multireference CI wave functions, particularly including the single and double excitations relative to the MCSCF reference space. This leads to the most flexible and accurate large-scale MRSDCI wave functions that have been used to date in global PES studies.

  8. Comparison of optical methods for surface roughness characterization

    International Nuclear Information System (INIS)

    Feidenhans’l, Nikolaj A; Hansen, Poul-Erik; Madsen, Morten H; Petersen, Jan C; Pilný, Lukáš; Bissacco, Giuliano; Taboryski, Rafael


    We report a study of the correlation between three optical methods for characterizing surface roughness: a laboratory scatterometer measuring the bi-directional reflection distribution function (BRDF instrument), a simple commercial scatterometer (rBRDF instrument), and a confocal optical profiler. For each instrument, the effective range of spatial surface wavelengths is determined, and the common bandwidth used when comparing the evaluated roughness parameters. The compared roughness parameters are: the root-mean-square (RMS) profile deviation (Rq), the RMS profile slope (Rdq), and the variance of the scattering angle distribution (Aq). The twenty-two investigated samples were manufactured with several methods in order to obtain a suitable diversity of roughness patterns.Our study shows a one-to-one correlation of both the Rq and the Rdq roughness values when obtained with the BRDF and the confocal instruments, if the common bandwidth is applied. Likewise, a correlation is observed when determining the Aq value with the BRDF and the rBRDF instruments.Furthermore, we show that it is possible to determine the Rq value from the Aq value, by applying a simple transfer function derived from the instrument comparisons. The presented method is validated for surfaces with predominantly 1D roughness, i.e. consisting of parallel grooves of various periods, and a reflectance similar to stainless steel. The Rq values are predicted with an accuracy of 38% at the 95% confidence interval. (paper)

  9. Novel titration method for surface-functionalised silica

    Energy Technology Data Exchange (ETDEWEB)

    Hofen, Kai; Weber, Siegfried [Department of Biotechnology, University of Applied Sciences, Mannheim (Germany); Chan, Chiu Ping Candace [School of Advanced Manufacturing and Mechanical Engineering, Mawson Institute, University of South Australia, Mawson Lakes Blvd, Mawson Lakes 5095 (Australia); Majewski, Peter, E-mail: [School of Advanced Manufacturing and Mechanical Engineering, Mawson Institute, University of South Australia, Mawson Lakes Blvd, Mawson Lakes 5095 (Australia)


    This paper describes three inexpensive and fast analytical methods to characterise grafted particle surfaces. The reaction of silica with (3-aminopropyl)triethoxysilane, (3-mercaptopropyl)trimethoxysilane and N-(phosphonomethyl)iminodiacetic acid hydrate, respectively, leads to NH{sub 2}-, SO{sub 3}H- or COOH-functionalised silica, which were characterised by X-ray photoelectron spectrometry and titration in nonaqueous media as well as with two titration methods in a water-based environment. In the work presented, factors influencing the titrations are pointed out and solutions are presented to overcome these limiting factors are shown.

  10. Novel titration method for surface-functionalised silica

    International Nuclear Information System (INIS)

    Hofen, Kai; Weber, Siegfried; Chan, Chiu Ping Candace; Majewski, Peter


    This paper describes three inexpensive and fast analytical methods to characterise grafted particle surfaces. The reaction of silica with (3-aminopropyl)triethoxysilane, (3-mercaptopropyl)trimethoxysilane and N-(phosphonomethyl)iminodiacetic acid hydrate, respectively, leads to NH 2 -, SO 3 H- or COOH-functionalised silica, which were characterised by X-ray photoelectron spectrometry and titration in nonaqueous media as well as with two titration methods in a water-based environment. In the work presented, factors influencing the titrations are pointed out and solutions are presented to overcome these limiting factors are shown.


    Directory of Open Access Journals (Sweden)

    L. Jiang


    Full Text Available Complete urban surface temperature (TC is a key parameter for evaluating the energy exchange between the urban surface and atmosphere. At the present stage, the estimation of TC still needs detailed 3D structure information of the urban surface, however, it is often difficult to obtain the geometric structure and composition of the corresponding temperature of urban surface, so that there is still lack of concise and efficient method for estimating the TC by remote sensing. Based on the four typical urban surface scale models, combined with the Envi-met model, thermal radiant directionality forward modeling and kernel model, we analyzed a complete day and night cycle hourly component temperature and radiation temperature in each direction of two seasons of summer and winter, and calculated hemispherical integral temperature and TC. The conclusion is obtained by examining the relationship of directional radiation temperature, hemispherical integral temperature and TC: (1 There is an optimal angle of radiation temperature approaching the TC in a single observation direction when viewing zenith angle is 45–60°, the viewing azimuth near the vertical surface of the sun main plane, the average absolute difference is about 1.1 K in the daytime. (2 There are several (3–5 times directional temperatures of different view angle, under the situation of using the thermal radiation directionality kernel model can more accurately calculate the hemispherical integral temperature close to TC, the mean absolute error is about 1.0 K in the daytime. This study proposed simple and effective strategies for estimating TC by remote sensing, which are expected to improve the quantitative level of remote sensing of urban thermal environment.

  12. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians (United States)

    Sulé, V. Thandi


    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  13. Extraction of bitter acids from hops and hop products using pressurized solvent extraction (PSE)

    Czech Academy of Sciences Publication Activity Database

    Čulík, J.; Jurková, M.; Horák, T.; Čejka, P.; Kellner, V.; Dvořák, J.; Karásek, Pavel; Roth, Michal


    Roč. 115, č. 3 (2009), s. 220-225 ISSN 0046-9750 R&D Projects: GA ČR GA203/08/1536; GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : hops * bitter acids * pressurized solvent extraction Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.000, year: 2009

  14. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play (United States)

    Broughton, Anthony


    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  15. Repairability of Compomers with Different Methods of Surface Conditioning

    Directory of Open Access Journals (Sweden)



    Full Text Available Statement of Problem: Considering the cost and amount of time and also the quantity of tooth loss in the process of cavity preparation, repair of the restoration instead of itsreplacement would be much more efficient.Purpose: The aim of this study was to determine the effect of different methods of surface conditioning on the shear bond strength of repaired compomers.Materials and Methods: Sixty blocks of compomer were prepared in acrylic molds and then they were randomly divided into five groups of 12. Group I (control groupreceived no treatment. The remaining samples were immersed in 37 ºC distilled water for one week, then the surfaces were roughened with a coarse diamond bur. Samples ineach group were prepared by different surface treatment and conditioning: In group II specimens were conditioned with 35% phosphoric acid for 20s. Specimens in group III were etched with 10% polyacrylic acid for 20s. In group IV 1.23% acidulated phosphatefluoride was applied for 30s, and compomer surfaces were sandblasted with 50μm Al2O3 powder in group V. After the initial preparations, all groups were treated with silane and resin before bonding of the second mix of compomer. Shear forces were applied with a universal testing machine at a cross-head speed of 5mm/min. The data were analyzed using one-way ANOVA and Duncan's multiple range tests.Results: The mean shear bond strengths and standard deviations (in parentheses for groups I to V were 31.56(10.86, 20.02(5.49, 17.74(7.34, 19.31(4.31 and 27.7(6.33MPa, respectively. The mean bond strengths for Groups I and V were significantly higher than that of the other groups (P<0.05.Conclusion: The results showed that among the surface treatments used in this study,sandblasting with alumina could be the best surface preparation method for repairing compomer restorations.

  16. Non thermal plasma surface cleaner and method of use

    KAUST Repository

    Neophytou, Marios


    Described herein are plasma generation devices and methods of use of the devices. The devices can be used for the cleaning of various surfaces and/or for inhibiting or preventing the accumulation of particulates, such as dust, or moisture on various surfaces. The devices can be used to remove dust and other particulate contaminants from solar panels and windows, or to avoid or minimize condensation on various surfaces. In an embodiment a plasma generation device is provided. The plasma generation device can comprise: a pair of electrodes (1,2) positioned in association with a surface of a dielectric substrate (3). The pair of electrodes (1,2) can comprise a first electrode (1) and a second electrode (2). The first electrode and second electrode can be of different sizes, one of the electrodes being smaller than the other of the electrodes. The first electrode and second electrode can be separated by a distance and electrically connected to a voltage source (4,5).

  17. Non thermal plasma surface cleaner and method of use

    KAUST Repository

    Neophytou, Marios; Lacoste, Deanna A.; Kirkus, Mindaugas


    Described herein are plasma generation devices and methods of use of the devices. The devices can be used for the cleaning of various surfaces and/or for inhibiting or preventing the accumulation of particulates, such as dust, or moisture on various surfaces. The devices can be used to remove dust and other particulate contaminants from solar panels and windows, or to avoid or minimize condensation on various surfaces. In an embodiment a plasma generation device is provided. The plasma generation device can comprise: a pair of electrodes (1,2) positioned in association with a surface of a dielectric substrate (3). The pair of electrodes (1,2) can comprise a first electrode (1) and a second electrode (2). The first electrode and second electrode can be of different sizes, one of the electrodes being smaller than the other of the electrodes. The first electrode and second electrode can be separated by a distance and electrically connected to a voltage source (4,5).

  18. Surface charge method for molecular surfaces with curved areal elements I. Spherical triangles (United States)

    Yu, Yi-Kuo


    Parametrizing a curved surface with flat triangles in electrostatics problems creates a diverging electric field. One way to avoid this is to have curved areal elements. However, charge density integration over curved patches appears difficult. This paper, dealing with spherical triangles, is the first in a series aiming to solve this problem. Here, we lay the ground work for employing curved patches for applying the surface charge method to electrostatics. We show analytically how one may control the accuracy by expanding in powers of the the arc length (multiplied by the curvature). To accommodate not extremely small curved areal elements, we have provided enough details to include higher order corrections that are needed for better accuracy when slightly larger surface elements are used.

  19. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.


    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  20. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A


    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  1. Investigation of synthetic aperture methods in ultrasound surface imaging using elementary surface types. (United States)

    Kerr, W; Pierce, S G; Rowe, P


    Synthetic aperture imaging methods have been employed widely in recent research in non-destructive testing (NDT), but uptake has been more limited in medical ultrasound imaging. Typically offering superior focussing power over more traditional phased array methods, these techniques have been employed in NDT applications to locate and characterise small defects within large samples, but have rarely been used to image surfaces. A desire to ultimately employ ultrasonic surface imaging for bone surface geometry measurement prior to surgical intervention motivates this research, and results are presented for initial laboratory trials of a surface reconstruction technique based on global thresholding of ultrasonic 3D point cloud data. In this study, representative geometry artefacts were imaged in the laboratory using two synthetic aperture techniques; the Total Focusing Method (TFM) and the Synthetic Aperture Focusing Technique (SAFT) employing full and narrow synthetic apertures, respectively. Three high precision metallic samples of known geometries (cuboid, sphere and cylinder) which featured a range of elementary surface primitives were imaged using a 5MHz, 128 element 1D phased array employing both SAFT and TFM approaches. The array was manipulated around the samples using a precision robotic positioning system, allowing for repeatable ultrasound derived 3D surface point clouds to be created. A global thresholding technique was then developed that allowed the extraction of the surface profiles, and these were compared with the known geometry samples to provide a quantitative measure of error of 3D surface reconstruction. The mean errors achieved with optimised SAFT imaging for the cuboidal, spherical and cylindrical samples were 1.3mm, 2.9mm and 2.0mm respectively, while those for TFM imaging were 3.7mm, 3.0mm and 3.1mm, respectively. These results were contrary to expectations given the higher information content associated with the TFM images. However, it was

  2. A Comparison of Surface Acoustic Wave Modeling Methods (United States)

    Wilson, W. c.; Atkinson, G. M.


    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method a first order model, and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices.

  3. New method to design stellarator coils without the winding surface (United States)

    Zhu, Caoxiang; Hudson, Stuart R.; Song, Yuntao; Wan, Yuanxi


    Finding an easy-to-build coils set has been a critical issue for stellarator design for decades. Conventional approaches assume a toroidal ‘winding’ surface, but a poorly chosen winding surface can unnecessarily constrain the coil optimization algorithm, This article presents a new method to design coils for stellarators. Each discrete coil is represented as an arbitrary, closed, one-dimensional curve embedded in three-dimensional space. A target function to be minimized that includes both physical requirements and engineering constraints is constructed. The derivatives of the target function with respect to the parameters describing the coil geometries and currents are calculated analytically. A numerical code, named flexible optimized coils using space curves (FOCUS), has been developed. Applications to a simple stellarator configuration, W7-X and LHD vacuum fields are presented.

  4. Corrosion protection of ENIG surface finishing using electrochemical methods

    International Nuclear Information System (INIS)

    Bui, Q.V.; Nam, N.D.; Choi, D.H.; Lee, J.B.; Lee, C.Y.; Kar, A.; Kim, J.G.; Jung, S.B.


    Four types of thin film coating were carried out on copper for electronic materials by the electroless plating method at a pH range from 3 to 9. The coating performance was evaluated by electrochemical impedance spectroscopy and potentiodynamic polarization testing in a 3.5 wt.% NaCl solution. In addition, atomic force microscopy and X-ray diffraction were also used to analyze the coating surfaces. The electrochemical behavior of the coatings was improved using the electroless nickel plating solution of pH 5. The electroless nickel/immersion gold on the copper substrate exhibited high protective efficiency, charge transfer resistance and very low porosity, indicating an increase in corrosion resistance. Atomic force microscopy and X-ray diffraction analyses confirmed the surface uniformity and the formation of the crystalline-refined NiP {1 2 2} phase at pH 5.

  5. Apparatus and method for carbon fiber surface treatment (United States)

    Paulauskas, Felix L; Sherman, Daniel M


    An apparatus and method for enhancing the surface energy and/or surface chemistry of carbon fibers involves exposing the fibers to direct or indirect contact with atmospheric pressure plasma generated using a background gas containing at least some oxygen or other reactive species. The fiber may be exposed directly to the plasma, provided that the plasma is nonfilamentary, or the fiber may be exposed indirectly through contact with gases exhausting from a plasma discharge maintained in a separate volume. In either case, the process is carried out at or near atmospheric pressure, thereby eliminating the need for vacuum equipment. The process may be further modified by moistening the fibers with selected oxygen-containing liquids before exposure to the plasma.

  6. Economic method for helical gear flank surface characterisation (United States)

    Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.


    Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.

  7. An experimental method for making spectral emittance and surface temperature measurements of opaque surfaces

    International Nuclear Information System (INIS)

    Moore, Travis J.; Jones, Matthew R.; Tree, Dale R.; Daniel Maynes, R.; Baxter, Larry L.


    An experimental procedure has been developed to make spectral emittance and temperature measurements. The spectral emittance of an object is calculated using measurements of the spectral emissive power and of the surface temperature of the object obtained using a Fourier transform infrared (FTIR) spectrometer. A calibration procedure is described in detail which accounts for the temperature dependence of the detector. The methods used to extract the spectral emissive power and surface temperature from measured infrared spectra were validated using a blackbody radiator at known temperatures. The average error in the measured spectral emittance was 2.1% and the average difference between the temperature inferred from the recorded spectra and the temperature indicated on the blackbody radiator was 1.2%. The method was used to measure the spectral emittance of oxidized copper at various temperatures.

  8. The estimation of dynamic contact angle of ultra-hydrophobic surfaces using inclined surface and impinging droplet methods (United States)

    Jasikova, Darina; Kotek, Michal


    The development of industrial technology also brings with optimized surface quality, particularly where there is contact with food. Application ultra-hydrophobic surface significantly reduces the growth of bacteria and facilitates cleaning processes. Testing and evaluation of surface quality are used two methods: impinging droplet and inclined surface method optimized with high speed shadowgraphy, which give information about dynamic contact angle. This article presents the results of research into new methods of measuring ultra-hydrophobic patented technology.

  9. Roman sophisticated surface modification methods to manufacture silver counterfeited coins (United States)

    Ingo, G. M.; Riccucci, C.; Faraldi, F.; Pascucci, M.; Messina, E.; Fierro, G.; Di Carlo, G.


    By means of the combined use of X-ray photoelectron spectroscopy (XPS), optical microscopy (OM) and scanning electron microscopy (SEM) coupled with energy dispersive X-ray spectroscopy (EDS) the surface and subsurface chemical and metallurgical features of silver counterfeited Roman Republican coins are investigated to decipher some aspects of the manufacturing methods and to evaluate the technological ability of the Roman metallurgists to produce thin silver coatings. The results demonstrate that over 2000 ago important advances in the technology of thin layer deposition on metal substrates were attained by Romans. The ancient metallurgists produced counterfeited coins by combining sophisticated micro-plating methods and tailored surface chemical modification based on the mercury-silvering process. The results reveal that Romans were able systematically to chemically and metallurgically manipulate alloys at a micro scale to produce adherent precious metal layers with a uniform thickness up to few micrometers. The results converge to reveal that the production of forgeries was aimed firstly to save expensive metals as much as possible allowing profitable large-scale production at a lower cost. The driving forces could have been a lack of precious metals, an unexpected need to circulate coins for trade and/or a combinations of social, political and economic factors that requested a change in money supply. Finally, some information on corrosion products have been achieved useful to select materials and methods for the conservation of these important witnesses of technology and economy.

  10. Being Hip-Hop: Beyond Skills and Songs (United States)

    Kruse, Adam J.


    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  11. Framing Hip Hop: New Methodologies for New Times (United States)

    Dimitriadis, Greg


    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  12. Christian Hip Hop as Pedagogy: A South African Case Study (United States)

    Abraham, Ibrahim


    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  13. Hip-Hop, the "Obama Effect," and Urban Science Education (United States)

    Emdin, Christopher; Lee, Okhee


    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  14. Romani Music - Roma and the Hip-hop Culture


    Dočkal, Tomáš


    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  15. Hip Hop as Empowerment: Voices in El Alto, Bolivia (United States)

    Tarifa, Ariana


    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  16. Hop powdery mildew control through alteration of spring pruning practices (United States)

    Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

  17. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture (United States)

    Beachum, Floyd D.


    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  18. Toward Hip-Hop Pedagogies for Music Education (United States)

    Kruse, Adam J.


    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  19. Framing and Reviewing Hip-Hop Educational Research (United States)

    Petchauer, Emery


    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  20. Towards a Pedagogy of Hip Hop in Urban Teacher Education (United States)

    Bridges, Thurman


    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  1. Methods on estimation of the evaporation from water surface

    International Nuclear Information System (INIS)

    Trajanovska, Lidija; Tanushevska, Dushanka; Aleksovska, Nina


    The whole world water supply on the Earth is in close dependence on hydrological cycle connected with water circulation at Earth-Atmosphere route through evaporation, precipitation and water runoff. Evaporation exists worldwide where the atmosphere is unsatiated of water steam (when there is humidity in short supply) and it depends on climatic conditions in some regions. The purpose of this paper is to determine a method for estimation of evaporation of natural water surface in our areas, that means its determination as exact as possible. (Original)

  2. Measurement of annual dose on porcelain using surface TLD method

    International Nuclear Information System (INIS)

    Xia Junding; Wang Weida; Leung, P.L.


    In order to improve accuracy of TL authentication test for porcelain, a method of measurement of annual dose using ultrathin (CaSO 4 :Tm) dosage layer on porcelain was studied. The TLD was placed on the part of porcelain without glaze. A comparison of measurement of annual dose for surface TLD, inside TLD and alpha counting on porcelain was made. The results show that this technique is suitable for measuring annual dose and improving accuracy of TL authentication test for both porcelain and pottery

  3. Electronic and vibrational hopping transport in boron carbides

    International Nuclear Information System (INIS)

    Emin, D.


    General concepts of hopping-type transport and localization are reviewed. Disorder, electronic correlations and atomic displacements, effects ignored in electronic band structure calculations, foster localization of electronic charge carriers. Examples are given that illustrate the efficacy of these effects in producing localization. This introduction is followed by a brief discussion of the relation between hopping-type transport and localization. The fundamentals of the formation, localization, and hopping transport of small polarons and/or bipolarons is then described. Electronic transport in boron carbides is presented as an example of the adiabatic hopping of small bipolarons. Finally, the notion of vibrational hopping is introduced. The high-temperature thermal diffusion in boron carbides is presented as a potential application of this idea

  4. Vortex variable range hopping in a conventional superconducting film (United States)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.


    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  5. Methods To Identify Aptamers against Cell Surface Biomarkers

    Directory of Open Access Journals (Sweden)

    Frédéric Ducongé


    Full Text Available Aptamers are nucleic acid-based ligands identified through a process of molecular evolution named SELEX (Systematic Evolution of Ligands by Exponential enrichment. During the last 10-15 years, numerous aptamers have been developed specifically against targets present on or associated with the surface of human cells or infectious pathogens such as viruses, bacteria, fungi or parasites. Several of the aptamers have been described as potent probes, rivalling antibodies, for use in flow cytometry or microscopy. Some have also been used as drugs by inhibiting or activating functions of their targets in a manner similar to neutralizing or agonistic antibodies. Additionally, it is straightforward to conjugate aptamers to other agents without losing their affinity and they have successfully been used in vitro and in vivo to deliver drugs, siRNA, nanoparticles or contrast agents to target cells. Hence, aptamers identified against cell surface biomarkers represent a promising class of ligands. This review presents the different strategies of SELEX that have been developed to identify aptamers for cell surface-associated proteins as well as some of the methods that are used to study their binding on living cells.

  6. Slope failures in surface mines, methods of studying landslides

    Energy Technology Data Exchange (ETDEWEB)

    Flisiak, J; Korman, S; Mazurek, J


    This paper presents a review of methods of measuring landslide fissures, displacement of ground surface points in the landslide area and of points inside the landslide. An analysis of the landslide process is given, stressing various stages and phases of a landslide. Studies carried out by the Institute of Mining Geomechanics of the Technical University of Mining and Metallurgy in Cracow are evaluated. The studies concentrated on the final state of slopes in brown coal surface mines after a landslide occurs. The necessity of developing an apparatus for continuous recording of displacements of points on a landslide surface is stressed. An apparatus developed by the Institute and used for continuous measuring and recording of displacements is described. The apparatus is used to measure displacements of points during the initial phase of a landslide and during the phase of the largest displacements. The principle of the system consists in locating a number of observation points on the ground and a slope. The points are connected among themselves by flexible connectors. The connectors are equipped with potentiometric transmitters which transform the relative displacements into electric pulses. These pulses are recorded by a conventional recording apparatus. (55 refs.) (In Polish)

  7. A new surface resistance measurement method with ultrahigh sensitivity

    International Nuclear Information System (INIS)

    Liang, Changnian.


    A superconducting niobium triaxial cavity has been designed and fabricated to study residual surface resistance of planar superconducting materials. The edge of a 25.4 mm or larger diameter sample in the triaxial cavity is located outside the strong field region. Therefore, the edge effects and possible losses between the thin film and the substrate have been minimized, ensuring that induced RF losses are intrinsic to the test material. The fundamental resonant frequency of the cavity is the same as the working frequency of CEBAF cavities. The cavity has a compact size compared to its TE 011 counterpart, which makes it more sensitive to the sample's loss. For even higher sensitivity, a calorimetry method has been used to measure the RF losses on the superconducting sample. At 2 K, a 2 μK temperature change can be resolved by using carbon resistor sensors. The temperature distribution caused by RF heating is measured by 16 carbon composition resistor sensors. A 0.05 μW heating power can be detected as such a resolution, which translates to a surface resistance of 0.02 nΩ at a surface magnetic field of 52 Oe. This is the most sensitive device for surface resistance measurements to date. In addition, losses due to the indium seal, coupling probes, field emission sites other than the sample, and all of the high field resonator surface, are excluded in the measurement. Surface resistance of both niobium and high-Tc superconducting thin films has been measured. A low R s of 35.2 μΩ was measured for a 25.4 mm diameter YBa 2 Cu 3 O 7 thin film at 1.5 GHz and at 2 K. The measurement result is the first result for a large area epitaxially grown thin film sample at such a low RF frequency. The abrupt disappearance of multipacting between two parallel plates has been observed and monitored with the 16 temperature mapping sensors. Field emission or some field dependent anomalous RF losses on the niobium plate have also been observed

  8. A Method to Identify Flight Obstacles on Digital Surface Model

    Institute of Scientific and Technical Information of China (English)

    ZHAO Min; LIN Xinggang; SUN Shouyu; WANG Youzhi


    In modern low-altitude terrain-following guidance, a constructing method of the digital surface model (DSM) is presented in the paper to reduce the threat to flying vehicles of tall surface features for safe flight. The relationship between an isolated obstacle size and the intervals of vertical- and cross-section in the DSM model is established. The definition and classification of isolated obstacles are proposed, and a method for determining such isolated obstacles in the DSM model is given. The simulation of a typical urban district shows that when the vertical- and cross-section DSM intervals are between 3 m and 25 m, the threat to terrain-following flight at low-altitude is reduced greatly, and the amount of data required by the DSM model for monitoring in real time a flying vehicle is also smaller. Experiments show that the optimal results are for an interval of 12.5 m in the vertical- and cross-sections in the DSM model, with a 1:10 000 DSM scale grade.

  9. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences (United States)

    Buchanan, Ian P.


    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  10. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education (United States)

    Horton, Akesha Monique


    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  11. Comparison of different surface quantitative analysis methods. Application to corium

    International Nuclear Information System (INIS)

    Guilbaud, N.; Blin, D.; Perodeaud, Ph.; Dugne, O.; Gueneau, Ch.


    In case of a severe hypothetical accident in a pressurized water reactor, the reactor assembly melts partially or completely. The material formed, called corium, flows out and spreads at the bottom of the reactor. To limit and control the consequences of such an accident, the specifications of the O-U-Zr basic system must be known accurately. To achieve this goal, the corium mix was melted by electron bombardment at very high temperature (3000 K) followed by quenching of the ingot in the Isabel 1 evaporator. Metallographic analyses were then required to validate the thermodynamic databases set by the Thermo-Calc software. The study consists in defining an overall surface quantitative analysis method that is fast and reliable, in order to determine the overall corium composition. The analyzed ingot originated in a [U+Fe+Y+UO 2 +ZrO 2 ) mix, with a total mass of 2253.7 grams. Several successive heating with average power were performed before a very brief plateau at very high temperature, so that the ingot was formed progressively and without any evaporation liable to modify its initial composition. The central zone of the ingot was then analyzed by qualitative and quantitative global surface methods, to yield the volume composition of the analyzed zone. Corium sample analysis happens to be very complex because of the variety and number of elements present, and also because of the presence of oxygen in a heavy element like the uranium based matrix. Three different global quantitative surface analysis methods were used: global EDS analysis (Energy Dispersive Spectrometry), with SEM, global WDS analysis (Wavelength Dispersive Spectrometry) with EPMA, and coupling of image analysis with EDS or WDS point spectroscopic analyses. The difficulties encountered during the study arose from sample preparation (corium is very sensitive to oxidation), and the choice of acquisition parameters of the images and analyses. The corium sample studied consisted of two zones displaying


    Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung


    Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally

  13. Evaluation of Surface Treatment Methods on the Bond Strength of Zirconia Ceramics Systems, Resin Cements and Tooth Surface

    Directory of Open Access Journals (Sweden)

    Akkuş Emek


    Full Text Available Objectives: To compare the effects of airborne-particle abrasion (APA and tribochemical silica coating (TSC surface treatment methods on the shear bond strength of zirconia ceramics systems, resin cements and tooth surface

  14. Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis. (United States)

    Liu, Zechang; Wang, Liping; Liu, Yumei


    Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  15. Delta self-consistent field method to obtain potential energy surfaces of excited molecules on surfaces

    DEFF Research Database (Denmark)

    Gavnholt, Jeppe; Olsen, Thomas; Engelund, Mads


    is a density-functional method closely resembling standard density-functional theory (DFT), the only difference being that in Delta SCF one or more electrons are placed in higher lying Kohn-Sham orbitals instead of placing all electrons in the lowest possible orbitals as one does when calculating the ground......-state energy within standard DFT. We extend the Delta SCF method by allowing excited electrons to occupy orbitals which are linear combinations of Kohn-Sham orbitals. With this extra freedom it is possible to place charge locally on adsorbed molecules in the calculations, such that resonance energies can...... be estimated, which is not possible in traditional Delta SCF because of very delocalized Kohn-Sham orbitals. The method is applied to N2, CO, and NO adsorbed on different metallic surfaces and compared to ordinary Delta SCF without our modification, spatially constrained DFT, and inverse...

  16. Nuclear magnetic resonance and high-performance liquid chromatography techniques for the characterization of bioactive compounds from Humulus lupulus L. (hop). (United States)

    Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica


    Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.

  17. Comparison of parametric methods for modeling corneal surfaces (United States)

    Bouazizi, Hala; Brunette, Isabelle; Meunier, Jean


    Corneal topography is a medical imaging technique to get the 3D shape of the cornea as a set of 3D points of its anterior and posterior surfaces. From these data, topographic maps can be derived to assist the ophthalmologist in the diagnosis of disorders. In this paper, we compare three different mathematical parametric representations of the corneal surfaces leastsquares fitted to the data provided by corneal topography. The parameters obtained from these models reduce the dimensionality of the data from several thousand 3D points to only a few parameters and could eventually be useful for diagnosis, biometry, implant design etc. The first representation is based on Zernike polynomials that are commonly used in optics. A variant of these polynomials, named Bhatia-Wolf will also be investigated. These two sets of polynomials are defined over a circular domain which is convenient to model the elevation (height) of the corneal surface. The third representation uses Spherical Harmonics that are particularly well suited for nearly-spherical object modeling, which is the case for cornea. We compared the three methods using the following three criteria: the root-mean-square error (RMSE), the number of parameters and the visual accuracy of the reconstructed topographic maps. A large dataset of more than 2000 corneal topographies was used. Our results showed that Spherical Harmonics were superior with a RMSE mean lower than 2.5 microns with 36 coefficients (order 5) for normal corneas and lower than 5 microns for two diseases affecting the corneal shapes: keratoconus and Fuchs' dystrophy.

  18. Biological methods used to assess surface water quality

    Directory of Open Access Journals (Sweden)

    Szczerbiñska Natalia


    Full Text Available In accordance with the guidelines of the Water Framework Directive 2000/60 (WFD, both ecological and chemical statuses determine the assessment of surface waters. The profile of ecological status is based on the analysis of various biological components, and physicochemical and hydromorphological indicators complement this assessment. The aim of this article is to present the biological methods used in the assessment of water status with a special focus on bioassay, as well as to provide a review of methods of monitoring water status. Biological test methods include both biomonitoring and bioanalytics. Water biomonitoring is used to assess and forecast the status of water. These studies aim to collect data on water pollution and forecast its impact. Biomonitoring uses organisms which are characterized by particular vulnerability to contaminants. Bioindicator organisms are algae, fungi, bacteria, larval invertebrates, cyanobacteria, macroinvertebrates, and fish. Bioanalytics is based on the receptors of contaminants that can be biologically active substances. In bioanalytics, biosensors such as viruses, bacteria, antibodies, enzymes, and biotests are used to assess degrees of pollution.

  19. Definition of a critical confining zone using surface geophysical methods

    International Nuclear Information System (INIS)

    Eddy-Dilek, C.A.; Hoekstra, P.; Harthill, N.; Blohm, M.; Phillips, D.R.


    Definition of the hydrogeologic framework in layered sediments of fluvial and deltaic origin is a difficult challenge for environmental characterization and remediation programs due to the lithologic and stratigraphic heterogeneities inherent in these settings. These heterogeneties often control contaminant transport and the effectiveness of remediation alternatives, Surface geophysical surveys can be cost-effective methods for characterization, but individual methods have inherent limitations in resolution and sensitivity. A synergistic approach, utilizing two geophysical survey methods was applied, to define and examine the nature and extent of a deep confining zone of regulatory importance, the Crouch Branch Confining Unit, in Coastal Plain sediments at the Savannah River Site. TDEM accurately maps the overall conductance (product of thickness and electrical conductivity) of a confining zone clay facies; from variation in conductance, changes in lithology of the conforming zone can be inferred. Shear wave seismic reflection surveys map the depth to the clay layers, and the clay layer thickness, but provides little information on the lithologic nature of the confining zone. Integrated interpretation of the combined data set (including all available borehole logs) allows for delineation of the lateral and vertical extent of clay-dominated zones, sand-dominated zones, key stratigraphic horizons, and erosional features associated with unconformities. This approach has resulted in the collection of critical information that will be used to optimize remedial system design, representing a significant cost savings to environmental restoration programs at the Savannah River Site

  20. Direct current hopping conductance along DNA chain

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun


    This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.

  1. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli


    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  2. Integral methods for shallow free-surface flows with separation

    DEFF Research Database (Denmark)

    Watanabe, S.; Putkaradze, V.; Bohr, Tomas


    eddy and separated flow. Assuming a variable radial velocity profile as in Karman-Pohlhausen's method, we obtain a system of two ordinary differential equations for stationary states that can smoothly go through the jump. Solutions of the system are in good agreement with experiments. For the flow down...... an inclined plane we take a similar approach and derive a simple model in which the velocity profile is not restricted to a parabolic or self-similar form. Two types of solutions with large surface distortions are found: solitary, kink-like propagating fronts, obtained when the flow rate is suddenly changed......, and stationary jumps, obtained, for instance, behind a sluice gate. We then include time dependence in the model to study the stability of these waves. This allows us to distinguish between sub- and supercritical flows by calculating dispersion relations for wavelengths of the order of the width of the layer....

  3. Standardization method for alpha and beta surface sources

    Energy Technology Data Exchange (ETDEWEB)

    Sahagia, M; Grigorescu, E L; Razdolescu, A C; Ivan, C [Institute of Physics and Nuclear Engineering, Institute of Atomic Physics, PO Box MG-6, R-76900 Bucharest, (Romania)


    The installation and method of standardization of large surface alpha and beta sources are presented. A multiwire, flow-type proportional counter and the associated electronics is used. The counter is placed in a lead-shield. The response of the system in (s[sup -1]/Bq) or (s[sup -1]/(particle x s[sup -1])) was determined for [sup 241] Am, [sup 239] Pu, [sup 147] Pm, [sup 204] Tl, [sup 90](Sr+Y) and [sup 137] Cs using standard sources with different dimensions, from some mm[sup 2] to 180 x 220 mm[sup 2]. The system was legally attested for expanded uncertainties of +7%. (Author).

  4. Particle hopping vs. fluid-dynamical models for traffic flow

    Energy Technology Data Exchange (ETDEWEB)

    Nagel, K.


    Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

  5. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin. (United States)

    Woods, J L; Gent, D H


    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  6. Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network (United States)

    Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji

    In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.

  7. Hopping conductivity via deep impurity states in InP

    International Nuclear Information System (INIS)

    Kuznetsov, V.P.; Messerer, M.A.; Omel'yanovskij, Eh.M.


    Hopping (epsilon 3 ) and Mott conductivities via deep impurity compounds with localization radius below 10 A have been studied using as an example Mn in InP. It is shown, that the existing theory of hopping conductivity in low-alloyed semiconductors with Na 3 << 1 can be Used for the case of deep centres as successfully as for the case of insignificant hydrogen-like impurities. Fundamental parameters of the theory: localization radius of wave function of deep impurities, state density near the Fermi level, mean hop length, are determined

  8. Crossover in tunneling hops in systems of strongly localized electrons

    International Nuclear Information System (INIS)

    Lien Nguyen, V.; Gamietea, A.D.


    Accurate Monte-Carlo simulation data show a consistent crossover in different characters of tunneling hops in two-dimensional systems of strongly localized electrons in the presence of scattering and quantum interference of hopping paths. The results also suggest a negative answer to the question whether there is a two-dimensional sign phase transition. The fractal behaviour observed in the direction perpendicular to the hopping direction is found to be similar to that for eigenstates in one-dimensional localized systems. (author). 16 refs, 6 figs

  9. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis (United States)

    Lindsey, Treva B.


    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  10. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.


    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  11. Understanding Mott's law from scaling of variable-range-hopping currents and intrinsic current fluctuations

    NARCIS (Netherlands)

    Pasveer, W.F.; Michels, M.A.J.


    We have used the master equation to simulate variable-range hopping (VRH) of charges in a strongly disordered d-dimensional energy landscape (d=1,2,3). The current distribution over hopping distances and hopping energies gives a clear insight into the difference between hops that occur most

  12. Response surface reconciliation method of bolted joints structure

    Directory of Open Access Journals (Sweden)

    Yunus Mohd Azmi


    Full Text Available Structural joining methods such as bolted joints are commonly used for the assembly of structural components due to their simplicity and easy maintenance. Understandably, the dynamic characteristic of bolted joined structure is mainly influenced by the properties of their joints such as preload on the bolts and joints stiffness which alter the measured dynamics response of the structure. Therefore, the need to include the local effect of the bolted joints into the numerical model of the bolted joined structure is vitally important in order to represent the model accurately. In this paper, a few types of connector elements that can be used to represent the bolted joints such as CBAR, CBEAM and CELAS have been investigated numerically and experimentally. The initial numerical results of these element connectors are compared with the experimental results in term of natural frequencies and mode shapes. The comparative evaluation of numerical and the experimental data are performed in order to provide some insights of inaccuracies in the numerical model due to invalid assumption in the numerical modelling such as geometry, material properties, and boundary conditions. The discrepancies between both results (numerical and experimental data are then corrected using the response surface reconciliation method (RSRM through which the finite element model is altered in order to provide closer agreement with the measured data so that it can be used for subsequence analysis.

  13. Rapid surface enhanced Raman scattering detection method for chloramphenicol residues (United States)

    Ji, Wei; Yao, Weirong


    Chloramphenicol (CAP) is a widely used amide alcohol antibiotics, which has been banned from using in food producing animals in many countries. In this study, surface enhanced Raman scattering (SERS) coupled with gold colloidal nanoparticles was used for the rapid analysis of CAP. Density functional theory (DFT) calculations were conducted with Gaussian 03 at the B3LYP level using the 3-21G(d) and 6-31G(d) basis sets to analyze the assignment of vibrations. Affirmatively, the theoretical Raman spectrum of CAP was in complete agreement with the experimental spectrum. They both exhibited three strong peaks characteristic of CAP at 1104 cm-1, 1344 cm-1, 1596 cm-1, which were used for rapid qualitative analysis of CAP residues in food samples. The use of SERS as a method for the measurements of CAP was explored by comparing use of different solvents, gold colloidal nanoparticles concentration and absorption time. The method of the detection limit was determined as 0.1 μg/mL using optimum conditions. The Raman peak at 1344 cm-1 was used as the index for quantitative analysis of CAP in food samples, with a linear correlation of R2 = 0.9802. Quantitative analysis of CAP residues in foods revealed that the SERS technique with gold colloidal nanoparticles was sensitive and of a good stability and linear correlation, and suited for rapid analysis of CAP residue in a variety of food samples.

  14. Method for Qualification of Coatings Applied to Wet Surfaces (United States)


    The field application of a pipeline repair or rehabilitation coating usually cannot wait until ambient conditions become optimal. In a humid environment, water can condense on the pipe surface because the pipe surface is usually cooler than the ambie...

  15. Multi-hop amplify-and-forward relaying cooperation in the presence of I/Q imbalance

    KAUST Repository

    Qi, Jian; Aï ssa, Sonia; Alouini, Mohamed-Slim


    In this paper, multi-hop cooperative networks implementing channel state information (CSI)-assisted amplify-and-forward (AF) relaying in the presence of in-phase and quadrature-phase (I/Q) imbalance are investigated. We propose a compensation algorithm for the I/Q imbalance. The performance of the multi-hop CSI-assisted AF cooperative networks with and without compensation for I/Q imbalance in Nakagami-m fading environment is evaluated in terms of average symbol error probability. Numerical results are provided and show that the proposed compensation method can effectively mitigate the impact of I/Q imbalance. © 2013 IEEE.

  16. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair (United States)

    Sinurat, E. N.; Yudiarsah, E.


    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  17. Multi-hop amplify-and-forward relaying cooperation in the presence of I/Q imbalance

    KAUST Repository

    Qi, Jian


    In this paper, multi-hop cooperative networks implementing channel state information (CSI)-assisted amplify-and-forward (AF) relaying in the presence of in-phase and quadrature-phase (I/Q) imbalance are investigated. We propose a compensation algorithm for the I/Q imbalance. The performance of the multi-hop CSI-assisted AF cooperative networks with and without compensation for I/Q imbalance in Nakagami-m fading environment is evaluated in terms of average symbol error probability. Numerical results are provided and show that the proposed compensation method can effectively mitigate the impact of I/Q imbalance. © 2013 IEEE.

  18. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery




    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  19. A New Method Based on TOPSIS and Response Surface Method for MCDM Problems with Interval Numbers

    Directory of Open Access Journals (Sweden)

    Peng Wang


    Full Text Available As the preference of design maker (DM is always ambiguous, we have to face many multiple criteria decision-making (MCDM problems with interval numbers in our daily life. Though there have been some methods applied to solve this sort of problem, it is always complex to comprehend and sometimes difficult to implement. The calculation processes are always ineffective when a new alternative is added or removed. In view of the weakness like this, this paper presents a new method based on TOPSIS and response surface method (RSM for MCDM problems with interval numbers, RSM-TOPSIS-IN for short. The key point of this approach is the application of deviation degree matrix, which ensures that the DM can get a simple response surface (RS model to rank the alternatives. In order to demonstrate the feasibility and effectiveness of the proposed method, three illustrative MCMD problems with interval numbers are analysed, including (a selection of investment program, (b selection of a right partner, and (c assessment of road transport technologies. The contrast of ranking results shows that the RSM-TOPSIS-IN method is in good agreement with those derived by earlier researchers, indicating it is suitable to solve MCDM problems with interval numbers.

  20. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.


    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station

  1. Majorana edge States in atomic wires coupled by pair hopping. (United States)

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P


    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  2. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto (United States)

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan


    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  3. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto (United States)

    Bond, Tiziana C; Miles, Robin; Davidson, James; Liu, Gang Logan


    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  4. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto (United States)

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan


    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  5. Low Power Multi-Hop Networking Analysis in Intelligent Environments. (United States)

    Etxaniz, Josu; Aranguren, Gerardo


    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  6. Extreme Kinematics in Selected Hip Hop Dance Sequences. (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen


    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  7. The Hip-Hop club scene: Gender, grinding and sex. (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard


    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  8. Surface modification method for reactor incore structural component

    International Nuclear Information System (INIS)

    Obata, Minoru; Sudo, Akira.


    A large number of metal or ceramic small spheres accelerated by pressurized air are collided against a surface of a reactor incore structures or a welded surface of the structural components, and then finishing is applied by polishing to form compression stresses on the surface. This can change residual stresses into compressive stress without increasing the strength of the surface. Accordingly, stress corrosion crackings of the incore structural components or welded portions thereof can be prevented thereby enabling to extend the working life of equipments. (T.M.)

  9. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S


    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  10. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.


    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  11. What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education? (United States)

    Love, Bettina L.


    Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

  12. Analytical methods for the characterization of surface finishing in bricks

    International Nuclear Information System (INIS)

    Nardini, I.; Zendri, E.; Biscontin, G.; Brunetin, A.


    The recent restoration works of Santo Stefano Church Facade (XV century) in Venice have shown traces variously saved of different kind of surface finishes. These finishes were found on the brick's surface both in the masonry and in the decorative elements. Different brick's surface and decorative tile samples were investigated using several techniques: optical microscopy, scanning electron-microscopy, thermal analysis, infrared spectroscopy and reflectance Fourier transform infrared microspectroscopy. The evaluation of the reached results was used to understand the decorative techniques and to recognize the material employed

  13. Contribution of surface analysis spectroscopic methods to the lubrication field

    International Nuclear Information System (INIS)

    Blanc, C.


    The analytical surface technics such as ESCA, AES and SIMS are tested to be applied to a particular lubrication field. One deals with a 100 C 6 steel surface innumered in tricresylphosphate at 110 0 C for 15 days. The nature of the first layers is studied after relevant solvant cleaning. An iron oxide layer is produced on the bearing surface, namely αFe 2 -O 3 . ESCA, AES and SIMS studies show an overlayer of iron phosphate. The exact nature of iron phosphate is not clearly established but the formation of a ferrous phosphate coating can be assumed from ESCA analysis [fr

  14. Nonhazardous solvent composition and method for cleaning metal surfaces

    International Nuclear Information System (INIS)

    Googin, J.M.; Simandl, R.F.; Thompson, L.M.


    A solvent composition for displacing greasy and oily contaminants as well as water and/or aqueous residue from metallic surfaces, especially surfaces of radioactive materials so that such surfaces can be wiped clean of the displaced contaminants, water and/or aqueous residue. The solvent composition consists essentially of a blend of nonpolar aliphatic hydrocarbon solvent having a minimum flash point of about 140 F and 2 to 25 volume percent of a polar solvent having a flash point sufficiently high so as to provide the solvent composition with a minimum flash point of at least 140 F. The solvent composition is nonhazardous so that when it is used to clean the surfaces of radioactive materials the waste in the form of paper or cloth wipes, lab coats and the like used in the cleaning operation is not considered to be mixed waste composed of a hazardous solvent and a radioactive material

  15. A simple method to assess bacterial attachment to surfaces

    Digital Repository Service at National Institute of Oceanography (India)

    Sonak, S.; Bhosle, N.B.

    The crystal violet microplate adhension assay was modified to evaluate bacterial adhesion to metal and non-metal surfaces. Both viable cell count and the absorbance of the crystal violet stained cells attached to aluminium increased over the period...

  16. Method and coating composition for protecting and decontaminating surfaces (United States)

    Overhold, D C; Peterson, M D


    A protective coating useful in the decontamination of surfaces exposed to radioactive substances is described. This coating is placed on the surface before use and is soluble in water, allowing its easy removal in the event decontamination becomes necessary. Suitable coating compositions may be prepared by mixing a water soluble carbohydrate such as sucrose or dextrin, together with a hygroscopic agent such as calcium chloride or zinc chloride.

  17. Method For Creating Corrosion Resistant Surface On An Aluminum Copper Alloy (United States)

    Mansfeld, Florian B.; Wang, You; Lin, Simon H.


    A method for treating the surface of aluminum alloys hang a relatively high copper content is provided which includes the steps of removing substantially all of the copper from the surface, contacting the surface with a first solution containing cerium, electrically charging the surface while contacting the surface in an aqueous molybdate solution, and contacting the surface with a second solution containing cerium. The copper is substantially removed from the surface in the first step either by (i) contacting the surface with an acidic chromate solution or by (ii) contacting the surface with an acidic nitrate solution while subjecting the surface to an electric potential. The corrosion-resistant surface resulting from the invention is excellent, consistent and uniform throughout the surface. Surfaces treated by the invention may often be certified for use in salt-water services.

  18. Forensic Examination Using a Nondestructive Evaluation Method for Surface Metrology (United States)

    Eisenmann, David J.; Chumbley, L. Scott


    The objective of this paper is to describe the use of a new technique of optical profilometry in a nondestructive, non-contact fashion for the comparison of two metallic surfaces, one hard and one soft. When brought in contact with one another, the harder material (i.e. the tool) will impress its surface roughness onto the softer. It is understood that the resulting set of impressions left from a tool tip act in a manner similar to a photographic negative, in that it leaves a reverse, or negative impression on the surface of a plate. If properly inverted and reversed, measurements from the softer material should be identical to the harder indenting object with regard to surface texture and roughness. This assumption is inherent in the area of forensics, where bullets, cartridge cases, and toolmarked surfaces from crime scenes are compared to similar marks made under controlled conditions in the forensic laboratory. This paper will examine the methodology used to compare two surfaces for similarities and dissimilarities, and comment on the applicability of this technique to other studies.

  19. HapHop-Physio: a computer game to support cognitive therapies in children. (United States)

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S


    Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch ® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

  20. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

    Directory of Open Access Journals (Sweden)

    Zhongcheng Wei


    Full Text Available As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs. However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs.

  1. In Search of the Golden Age Hip-Hop Sound (1986–1996

    Directory of Open Access Journals (Sweden)

    Ben Duinker


    Full Text Available The notion of a musical repertoire's "sound" is frequently evoked in journalism and scholarship, but what parameters comprise such a sound? This question is addressed through a statistically-driven corpus analysis of hip-hop music released during the genre's Golden Age era. The first part of the paper presents a methodology for developing, transcribing, and analyzing a corpus of 100 hip-hop tracks released during the Golden Age. Eight categories of aurally salient musical and production parameters are analyzed: tempo, orchestration and texture, harmony, form, vocal and lyric profiles, global and local production effects, vocal doubling and backing, and loudness and compression. The second part of the paper organizes the analysis data into three trend categories: trends of change (parameters that change over time, trends of prevalence (parameters that remain generally constant across the corpus, and trends of similarity (parameters that are similar from song to song. These trends form a generalized model of the Golden Age hip-hop sound which considers both global (the whole corpus and local (unique songs within the corpus contexts. By operationalizing "sound" as the sum of musical and production parameters, aspects of popular music that are resistant to traditional music-analytical methods can be considered.

  2. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  3. Influence of various surface-conditioning methods on the bond strength of metal brackets to ceramic surfaces

    NARCIS (Netherlands)

    Schmage, P; Nergiz, [No Value; Herrmann, W; Ozcan, M; Nergiz, Ibrahim; �zcan, Mutlu

    With the increase in adult orthodontic treatment comes the need to find a reliable method for bonding orthodontic brackets onto metal or ceramic crowns and fixed partial dentures. In this study, shear bond strength and surface roughness tests were used to examine the effect of 4 different surface

  4. A novel surface cleaning method for chemical removal of fouling lead layer from chromium surfaces

    International Nuclear Information System (INIS)

    Gholivand, Kh.; Khosravi, M.; Hosseini, S.G.; Fathollahi, M.


    Most products especially metallic surfaces require cleaning treatment to remove surface contaminations that remain after processing or usage. Lead fouling is a general problem which arises from lead fouling on the chromium surfaces of bores and other interior parts of systems which have interaction with metallic lead in high temperatures and pressures. In this study, a novel chemical solution was introduced as a cleaner reagent for removing metallic lead pollution, as a fouling metal, from chromium surfaces. The cleaner aqueous solution contains hydrogen peroxide (H 2 O 2 ) as oxidizing agent of lead layer on the chromium surface and acetic acid (CH 3 COOH) as chelating agent of lead ions. The effect of some experimental parameters such as acetic acid concentration, hydrogen peroxide concentration and temperature of the cleaner solution during the operation on the efficiency of lead cleaning procedure was investigated. The results of scanning electron microscopy (SEM) showed that using this procedure, the lead pollution layer could be completely removed from real chromium surfaces without corrosion of the original surface. Finally, the optimum conditions for the complete and fast removing of lead pollution layer from chromium surfaces were proposed. The experimental results showed that at the optimum condition (acetic acid concentration 28% (V/V), hydrogen peroxide 8% (V/V) and temperature 35 deg. C), only 15-min time is needed for complete removal of 3 g fouling lead from a chromium surface.

  5. Group IV nanocrystals with ion-exchangeable surface ligands and methods of making the same (United States)

    Wheeler, Lance M.; Nichols, Asa W.; Chernomordik, Boris D.; Anderson, Nicholas C.; Beard, Matthew C.; Neale, Nathan R.


    Methods are described that include reacting a starting nanocrystal that includes a starting nanocrystal core and a covalently bound surface species to create an ion-exchangeable (IE) nanocrystal that includes a surface charge and a first ion-exchangeable (IE) surface ligand ionically bound to the surface charge, where the starting nanocrystal core includes a group IV element.

  6. Reducing Motional Decoherence in Ion Traps with Surface Science Methods (United States)

    Haeffner, Hartmut


    Many trapped ions experiments ask for low motional heating rates while trapping the ions close to trapping electrodes. However, in practice small ion-electrode distances lead to unexpected high heating rates. While the mechanisms for the heating is still unclear, it is now evident that surface contamination of the metallic electrodes is at least partially responsible for the elevated heating rates. I will discuss heating rate measurements in a microfabricated surface trap complemented with basic surface science studies. We monitor the elemental surface composition of the Cu-Al alloy trap with an Auger spectrometer. After bake-out, we find a strong Carbon and Oxygen contamination and heating rates of 200 quanta/s at 1 MHz trap frequency. After removing most of the Carbon and Oxygen with Ar-Ion sputtering, the heating rates drop to 4 quanta/s. Interestingly, we still measure the decreased heating rate even after the surface oxidized from the background gas throughout a 40-day waiting time in UHV.

  7. A new method of constructing scalar-flat Kaehler surfaces

    International Nuclear Information System (INIS)

    Kim, Jongsu; Pontecorvo, M.


    Building on the work of Donaldson-Friedman we present a geometric way of constructing anti-self-dual hermitian metrics on compact complex surfaces which is based on the relative complex deformations of singular 3-folds with divisors. Some of the consequences are that under a mild condition, fully described by LeBrun-Singer, any blow up of a scalar-flat Kaehler surface admits scalar-flat Kaehler metrics; this is used to prove that such extremal Kaehler metrics exists on an open dense subset of the moduli space of non-minimal ruled surfaces of genus g ≥ 2. Related results have been obtained by LeBrun-Singer. (author). 25 refs

  8. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  9. SDN-based path hopping communication against eavesdropping attack (United States)

    Zhang, Chuanhao; Bu, Youjun; Zhao, Zheng


    Network eavesdropping is one of the most popular means used by cyber attackers, which has been a severe threat to network communication security. Adversaries could capture and analyze network communication data from network nodes or links, monitor network status and steal sensitive data such as username and password etc. Traditional network usually uses static network configuration, and existing defense methods, including firewall, IDS, IPS etc., cannot prevent eavesdropping, which has no distinguishing characteristic. Network eavesdropping become silent during most of the time of the attacking process, which is why it is difficult to discover and to defend. But A successful eavesdropping attack also has its' precondition, which is the target path should be relatively stable and has enough time of duration. So, In order to resolve this problem, it has to work on the network architecture. In this paper, a path hopping communication(PHC) mechanism based on Software Define Network (SDN) was proposed to solve this problem. In PHC, Ends in communication packets as well as the routing paths were changed dynamically. Therefore, the traffic would be distributed to multiple flows and transmitted along different paths. so that Network eavesdropping attack could be prevented effectively. It was concluded that PHC was able to increase the overhead of Network eavesdropping, as well as the difficulty of communication data recovery.

  10. Particle trapping and hopping in an optofluidic fishnet (United States)

    Shi, Y. Z.; Xiong, S.; Zhang, Y.; Chin, L. K.; Wu, J. H.; Chen, T. N.; Liu, A. Q.


    Particle jumping between optical potentials has attracted much attention owing to its extensive involvement in many physical and biological experiments. In some circumstances, particle jumping indicates escaping from the optical trap, which is an issue people are trying to avoid. Nevertheless, particle jumping can facilitate the individual trap in each laser spot in the optical lattice and enable sorting and delivery of nanoparticles. Particle hopping has not been seen in fluid because Fluidic drag force dramatically reduce the dwell time of particle or break the potential well. Here, we observe particle hopping in the microchannel by three reasons, e.g., particle collision or aggregation, light disturbing by pretrapped particle and fake trapping position. We show that commonly ignored particle influence to the light could create a new isolated trapping position, where particle hops to the adjacent potential well. The hopping happens in an optofluidic fishnet which is comprised of discrete hotspots enabling 2D patterning of particles in the flow stream for the first time. We also achieve a 2D patterning of cryptosporidium in the microchannel. Our observed particle hopping in the flow stream completes the family of particle kinetics in potential wells and inspires new interests in the particle disturbed optical trapping. The 2D patterning of particles benefits the parallel study of biological samples in the flow stream and have potential on cell sorting and drug delivery.

  11. Hip Hop Dance Experience Linked to Sociocognitive Ability. (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C


    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  12. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  13. Membrane mimetic surface functionalization of nanoparticles: Methods and applications (United States)

    Weingart, Jacob; Vabbilisetty, Pratima; Sun, Xue-Long


    Nanoparticles (NPs), due to their size-dependent physical and chemical properties, have shown remarkable potential for a wide range of applications over the past decades. Particularly, the biological compatibilities and functions of NPs have been extensively studied for expanding their potential in areas of biomedical application such as bioimaging, biosensing, and drug delivery. In doing so, surface functionalization of NPs by introducing synthetic ligands and/or natural biomolecules has become a critical component in regards to the overall performance of the NP system for its intended use. Among known examples of surface functionalization, the construction of an artificial cell membrane structure, based on phospholipids, has proven effective in enhancing biocompatibility and has become a viable alternative to more traditional modifications, such as direct polymer conjugation. Furthermore, certain bioactive molecules can be immobilized onto the surface of phospholipid platforms to generate displays more reminiscent of cellular surface components. Thus, NPs with membrane-mimetic displays have found use in a range of bioimaging, biosensing, and drug delivery applications. This review herein describes recent advances in the preparations and characterization of integrated functional NPs covered by artificial cell membrane structures and their use in various biomedical applications. PMID:23688632

  14. Method for plasma surface treating and preparation of membrane layers

    NARCIS (Netherlands)


    The invention relates to an apparatus suitable for plasma surface treating (e.g. forming a membrane layer on a substrate) which comprises a plasma generation section (2) which is in communication via at least one plasma inlet means (4) (e.g. a nozzle) with an enclosed plasma treating section (3)

  15. A Method of Retrieving BRDF from Surface-Reflected Radiance Using Decoupling of Atmospheric Radiative Transfer and Surface Reflection

    Directory of Open Access Journals (Sweden)

    Alexander Radkevich


    Full Text Available Bi-directional reflection distribution function (BRDF defines anisotropy of the surface reflection. It is required to specify the boundary condition for radiative transfer (RT modeling used in aerosol retrievals, cloud retrievals, atmospheric modeling, and other applications. Ground based measurements of reflected radiance draw increasing attention as a source of information about anisotropy of surface reflection. Derivation of BRDF from surface radiance requires atmospheric correction. This study develops a new method of retrieving BRDF on its whole domain, making it immediately suitable for further atmospheric RT modeling applications. The method is based on the integral equation relating surface-reflected radiance, BRDF, and solutions of two auxiliary atmosphere-only RT problems. The method requires kernel-based BRDF. The weights of the kernels are obtained with a quickly converging iterative procedure. RT modeling has to be done only one time before the start of iterative process.

  16. A comparative study of different methods for calculating electronic transition rates (United States)

    Kananenka, Alexei A.; Sun, Xiang; Schubert, Alexander; Dunietz, Barry D.; Geva, Eitan


    We present a comprehensive comparison of the following mixed quantum-classical methods for calculating electronic transition rates: (1) nonequilibrium Fermi's golden rule, (2) mixed quantum-classical Liouville method, (3) mean-field (Ehrenfest) mixed quantum-classical method, and (4) fewest switches surface-hopping method (in diabatic and adiabatic representations). The comparison is performed on the Garg-Onuchic-Ambegaokar benchmark charge-transfer model, over a broad range of temperatures and electronic coupling strengths, with different nonequilibrium initial states, in the normal and inverted regimes. Under weak to moderate electronic coupling, the nonequilibrium Fermi's golden rule rates are found to be in good agreement with the rates obtained via the mixed quantum-classical Liouville method that coincides with the fully quantum-mechanically exact results for the model system under study. Our results suggest that the nonequilibrium Fermi's golden rule can serve as an inexpensive yet accurate alternative to Ehrenfest and the fewest switches surface-hopping methods.

  17. New surface modification method of bio-titanium alloy by EB polishing

    International Nuclear Information System (INIS)

    Okada, Akira; Uno, Yoshiyuki; Iio, Atsuo; Fujiwara, Kunihiko; Doi, Kenji


    A new surface modification for bio-titanium alloy products by electron beam (EB) polishing is proposed. In this EB polishing method, high energy density EB can be irradiated without concentrating the beam. Therefore, large-area EB with a maximum diameter of 60 mm can be used for instantaneously melting or evaporating metal surface. Experimental results made it clear that surface characteristics, such as repellency, corrosion resistance and coefficient of friction could be improved simultaneously with the surface smoothing in a few minutes under a proper condition. Therefore, EB polishing method has a possibility of high efficient surface smoothing and surface modification process for bio-titanium alloy. (author)

  18. Hopping control channel MAC protocol for opportunistic spectrum access networks

    Institute of Scientific and Technical Information of China (English)

    FU Jing-tuan; JI Hong; MAO Xu


    Opportunistic spectrum access (OSA) is considered as a promising approach to mitigate spectrum scarcity by allowing unlicensed users to exploit spectrum opportunities in licensed frequency bands. Derived from the existing channel-hopping multiple access (CHMA) protocol,we introduce a hopping control channel medium access control (MAC) protocol in the context of OSA networks. In our proposed protocol,all nodes in the network follow a common channel-hopping sequence; every frequency channel can be used as control channel and data channel. Considering primary users' occupancy of the channel,we use a primary user (PU) detection model to calculate the channel availability for unlicensed users' access. Then,a discrete Markov chain analytical model is applied to describe the channel states and deduce the system throughput. Through simulation,we present numerical results to demonstrate the throughput performance of our protocol and thus validate our work.

  19. Comparison of Rheological Properties of Hopped Wort and Malt Wort

    Directory of Open Access Journals (Sweden)

    Petr Trávníček


    Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

  20. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine


    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  1. Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance. (United States)

    Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V


    In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

  2. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian


    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed...... contributes to the early EMG burst, then advancing or delaying the touch-down without the subject's knowledge should similarly advance or delay the burst. This was indeed the case when touch-down was advanced or delayed by shifting the height of a programmable platform up or down between two hops...... and this resulted in a correspondent shift of the early EMG burst. Our second hypothesis was that the motor cortex contributes to the first EMG burst during hopping. If so, inhibition of the motor cortex would reduce the magnitude of the burst. By applying a low-intensity magnetic stimulus it was possible...

  3. Imaging method of brain surface anatomy structures using conventional T2-weighted MR images

    International Nuclear Information System (INIS)

    Hatanaka, Masahiko; Machida, Yoshio; Yoshida, Tadatoki; Katada, Kazuhiro.


    As a non-invasive technique for visualizing the brain surface structure by MRI, surface anatomy scanning (SAS) and the multislice SAS methods have been developed. Both techniques require additional MRI scanning to obtain images for the brain surface. In this paper, we report an alternative method to obtain the brain surface image using conventional T2-weighted multislice images without any additional scanning. The power calculation of the image pixel values, which is incorporated in the routine processing, has been applied in order to enhance the cerebrospinal fluid (CSF) contrast. We think that this method is one of practical approaches for imaging the surface anatomy of the brain. (author)

  4. Analysis of multi lobe journal bearings with surface roughness using finite difference method (United States)

    PhaniRaja Kumar, K.; Bhaskar, SUdaya; Manzoor Hussain, M.


    Multi lobe journal bearings are used for high operating speeds and high loads in machines. In this paper symmetrical multi lobe journal bearings are analyzed to find out the effect of surface roughnessduring non linear loading. Using the fourth order RungeKutta method, time transient analysis was performed to calculate and plot the journal centre trajectories. Flow factor method is used to evaluate the roughness and the finite difference method (FDM) is used to predict the pressure distribution over the bearing surface. The Transient analysis is done on the multi lobe journal bearings for threedifferent surface roughness orientations. Longitudinal surface roughness is more effective when compared with isotopic and traverse surface roughness.

  5. The orthogonal gradients method: A radial basis functions method for solving partial differential equations on arbitrary surfaces

    KAUST Repository

    Piret, Cécile


    Much work has been done on reconstructing arbitrary surfaces using the radial basis function (RBF) method, but one can hardly find any work done on the use of RBFs to solve partial differential equations (PDEs) on arbitrary surfaces. In this paper, we investigate methods to solve PDEs on arbitrary stationary surfaces embedded in . R3 using the RBF method. We present three RBF-based methods that easily discretize surface differential operators. We take advantage of the meshfree character of RBFs, which give us a high accuracy and the flexibility to represent the most complex geometries in any dimension. Two out of the three methods, which we call the orthogonal gradients (OGr) methods are the result of our work and are hereby presented for the first time. © 2012 Elsevier Inc.

  6. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage

    Directory of Open Access Journals (Sweden)

    Ziola Barry


    Full Text Available Abstract Background Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol. Use of antimicrobial compounds (e.g., hop-compounds, Penicillin by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Results Lactic acid bacteria susceptibility test broth medium (LSM used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Conclusion Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  7. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage. (United States)

    Haakensen, Monique; Vickers, David M; Ziola, Barry


    Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol). Use of antimicrobial compounds (e.g., hop-compounds, Penicillin) by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Lactic acid bacteria susceptibility test broth medium (LSM) used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  8. A method of non-destructive quantitative analysis of the ancient ceramics with curved surface

    International Nuclear Information System (INIS)

    He Wenquan; Xiong Yingfei


    Generally the surface of the sample should be smooth and flat in XRF analysis, but the ancient ceramics and hardly match this condition. Two simple methods are put forward in fundamental method and empirical correction method of XRF analysis, so the analysis of little sample or the sample with curved surface can be easily completed

  9. Advances in surface wave methods: Cascaded MASW-SASW

    NARCIS (Netherlands)

    Westerhoff, R.S.; Brouwer, J.H.; Meekes, J.A.C.


    The application of the MASW method in areas that show strong lateral variations in subsurface properties is limited. Traditional SASW may yield a better lateral resolution but the dispersion curves (and thus the subsurface models) obtained with the method may be poor. The joint application of MASW

  10. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)


    ABSTRACT: The theory and practice of electrical and gravity methods of geophysics for groundwater exploration was reviewed with illustrations and data examples. With the goal of reducing cases of borehole/water-well failure attributed to the lack of the knowledge of the methods of geophysics for groundwater exploration ...

  11. Photoswitchable method for the ordered attachment of proteins to surfaces (United States)

    Camarero, Julio A.; De Yoreo, James J.; Kwon, Youngeun


    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  12. Photoswitchable method for the ordered attachment of proteins to surfaces (United States)

    Camarero, Julio A [Livermore, CA; DeYoreo, James J [Clayton, CA; Kwon, Youngeun [Livermore, CA


    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  13. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer; Yang, Hong-Chuan; Gebali, Fayez; Alouini, Mohamed-Slim


    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different

  14. Ernst Equation and Riemann Surfaces: Analytical and Numerical Methods

    International Nuclear Information System (INIS)

    Ernst, Frederick J


    metric tensor components. The first two chapters of this book are devoted to some basic ideas: in the introductory chapter 1 the authors discuss the concept of integrability, comparing the integrability of the vacuum Ernst equation with the integrability of nonlinear equations of Korteweg-de Vries (KdV) type, while in chapter 2 they describe various circumstances in which the vacuum Ernst equation has been determined to be relevant, not only in connection with gravitation but also, for example, in the construction of solutions of the self-dual Yang-Mills equations. It is also in this chapter that one of several equivalent linear systems for the Ernst equation is described. The next two chapters are devoted to Dmitry Korotkin's concept of algebro-geometric solutions of a linear system: in chapter 3 the structure of such solutions of the vacuum Ernst equation, which involve Riemann theta functions of hyperelliptic algebraic curves of any genus, is contrasted with the periodic structure of such solutions of the KdV equation. How such solutions can be obtained, for example, by solving a matrix Riemann-Hilbert problem and how the metric tensor of the associated spacetime can be evaluated is described in detail. In chapter 4 the asymptotic behaviour and the similarity structure of the general algebro-geometric solutions of the Ernst equation are described, and the relationship of such solutions to the perhaps more familiar multi-soliton solutions is discussed. The next three chapters are based upon the authors' own published research: in chapter 5 it is shown that a problem involving counter-rotating infinitely thin disks of matter can be solved in terms of genus two Riemann theta functions, while in chapter 6 the authors describe numerical methods that facilitate the construction of such solutions, and in chapter 7 three-dimensional graphs are displayed that depict all metrical fields of the associated spacetime. Finally, in chapter 8, the difficulties associated with

  15. From Broken Glass to Ruf Diamonds: Manchester Hip Hop


    de Paor-Evans, Adam


    When one considers music culture in Manchester during the 1980s and 1990s, Hip Hop is not an obvious cultural arena for discussion. However, amidst the spectacle of The Haçienda, the pop boom of Factory Records and the evolution of rave subculture and form of dance music which produced the pop cultural phenomenon of Madchester; in the space of music between The Fall and The Charlatans where brief stardom was found by Inspiral Carpets, Northside and Candyflip, Mancunian Hip Hop was also evolvi...

  16. A new method for background rejection with surface sensitive bolometers

    International Nuclear Information System (INIS)

    Nones, C.; Foggetta, L.; Giuliani, A.; Pedretti, M.; Salvioni, C.; Sangiorgio, S.


    We report the performance of three prototype TeO 2 macrobolometers, able to identify events due to energy deposited at the detector surface. This capability is obtained by thermally coupling thin active layers to the main absorber of the bolometer, and is proved by irradiating the detectors with alpha particles. This technique can be very useful in view of background study and reduction for the CUORE experiment, a next generation Double Beta Decay search based on TeO 2 macrobolometers and to be installed in the Laboratori Nazionali del Gran Sasso

  17. Soil bioengineering methods for abandoned mine land surface drainage channels

    Energy Technology Data Exchange (ETDEWEB)

    Sotir, R.B.; Simms, A.P.; Sweigard, R.J.; Hammer, P.; Graves, D.H.; Adkins, M. [Robbin B. Sotir & Associates, Marietta, GA (USA)


    Research to determine the suitability of soil bioengineering for slope stabilization at abandoned surface mining sites is described. The technology uses live woody plant material as a structural component, in this case live fascine with coir erosion control fabric made from coconut. A large water collection pond draining to nine channels on the slope below was constructed as a test site. The pond has drainage channels for testing at low, intermediate, and steep slope grades. Each group of three channels is composed of one riprap rock channel, one gabion channel, and one soil bioengineering channel. The channels will be tested summer 1999. 11 refs., 5 figs., 2 tabs., 8 photos.

  18. Experimental innovations in surface science a guide to practical laboratory methods and instruments

    CERN Document Server

    Yates, John T


    This book is a new edition of a classic text on experimental methods and instruments in surface science. It offers practical insight useful to chemists, physicists, and materials scientists working in experimental surface science. This enlarged second edition contains almost 300 descriptions of experimental methods. The more than 50 active areas with individual scientific and measurement concepts and activities relevant to each area are presented in this book. The key areas covered are: Vacuum System Technology, Mechanical Fabrication Techniques, Measurement Methods, Thermal Control, Delivery of Adsorbates to Surfaces, UHV Windows, Surface Preparation Methods, High Area Solids, Safety. The book is written for researchers and graduate students.

  19. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice (United States)

    Petchauer, Emery


    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  20. An alternative safer and cost effective surface sterilization method for ...

    African Journals Online (AJOL)



    Oct 30, 2013 ... 110 countries and 50% of the production occurs in Brazil and India (FAO, 2008). ... capital formation, agriculture and other industries develop- ment, urbanization and ... Moreover, the method requires large nursery space: one.

  1. Using of the surface activation method for enhancement of machine realibility

    International Nuclear Information System (INIS)

    Postnikov, V.I.; Garbar, I.N.


    A surface activation method is described for controlling the wear of units and details, allowing one to measure the wear at continuous operation of the mechanism by any program. The main advantages of the surface activation method for the wear tests are shown. By means of that method it was possible to develop a simultaneous controlling conjugate detail wear, and a method of different-activity brands, as well as the method for repeated activation of details. Development of theory for the engineering and technology of engine wear control by the surface activation method allowed one to improve the efficiency and reduce the time of research in the field of friction and wear

  2. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Directory of Open Access Journals (Sweden)

    María Pilar Castañeda-Ojeda


    Full Text Available The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts.

  3. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2 (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia


    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  4. Definition of a critical confining zone using surface geophysical methods

    International Nuclear Information System (INIS)

    Eddy-Dilek, C.A.; Looney, B.B.; Hoekstra, P.; Harthill, N.; Blohm, M.; Phillips, D.R.


    Definition of the hydrologic framework in layered sediments of fluvial and deltaic origin is a difficult challenge for environmental characterization and remediation programs due to the lithologic and stratigraphic heterogeneities inherent in these settings. The authors set out to use complementary geophysical surveys to determine the nature and extent of a deep confining unit at the Savannah River Site, South Carolina. Time Domain Electromagnetic (TDEM) soundings were used to define the electrical conductance of the clayey confining unit (aquitard), and shear-wave reflection seismic was used to define the stratigraphic framework. Based on correlations with borehole geophysical logs and sieve data, the shear-wave seismic proved capable of defining relatively fine layering in the coastal plain sediments, the upper and lower surfaces of a critical confining unit, and erosional features on the surface of the confining unit. The TDEM surveys defined the presence or absence of the clay facies of the confining unit. Moreover, by constraining the interpretation of the TDEM data with the thickness of the confining unit derived from the seismic data, the authors mapped the extent of the unit, showing where the clay is thicker, where it probably was never deposited, and where it was eroded by downcutting channels. These results have significant implications on the design and optimization of remedial systems

  5. A surface refractive index scanning system and method

    DEFF Research Database (Denmark)


    The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction, and a s......The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction...... a grating period Λ2 in the longitudinal direction, where the longitudinal direction is orthogonal to the transverse direction. A grating period spacing ΔΛ = Λ1 - Λ2 is finite. Further, the first and second grating periods are chosen to provide optical resonances for light respectively in a first...... wavelength band and a second wavelength band, light is being emitted, transmitted, or reflected in an out-of-plane direction, wherein the first wavelength band and the second wavelength band are at least partially non-overlapping in wavelength. The system further comprises a light source for illuminating...

  6. Method and system for formation and withdrawal of a sample from a surface to be analyzed (United States)

    Van Berkel, Gary J.; Kertesz, Vilmos


    A method and system for formation and withdrawal of a sample from a surface to be analyzed utilizes a collection instrument having a port through which a liquid solution is conducted onto the surface to be analyzed. The port is positioned adjacent the surface to be analyzed, and the liquid solution is conducted onto the surface through the port so that the liquid solution conducted onto the surface interacts with material comprising the surface. An amount of material is thereafter withdrawn from the surface. Pressure control can be utilized to manipulate the solution balance at the surface to thereby control the withdrawal of the amount of material from the surface. Furthermore, such pressure control can be coordinated with the movement of the surface relative to the port of the collection instrument within the X-Y plane.

  7. Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

    NARCIS (Netherlands)

    van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène


    Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

  8. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education (United States)

    Tobias, Evan S.


    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  9. Energy management that generates terrain following versus apex-preserving hopping in man and machine. (United States)

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten


    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  10. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture (United States)

    Callahan, J. Sean; Grantham, Tarek C.


    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  11. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace (United States)

    Durham, Aisha S.


    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  12. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity (United States)

    Hill, Marc Lamont


    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  13. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3 (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.


    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  14. Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

    National Research Council Canada - National Science Library

    Roberts, Christopher


    .... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

  15. Validation of a laboratory method for evaluating dynamic properties of reconstructed equine racetrack surfaces.

    Directory of Open Access Journals (Sweden)

    Jacob J Setterbo

    Full Text Available Racetrack surface is a risk factor for racehorse injuries and fatalities. Current research indicates that race surface mechanical properties may be influenced by material composition, moisture content, temperature, and maintenance. Race surface mechanical testing in a controlled laboratory setting would allow for objective evaluation of dynamic properties of surface and factors that affect surface behavior.To develop a method for reconstruction of race surfaces in the laboratory and validate the method by comparison with racetrack measurements of dynamic surface properties.Track-testing device (TTD impact tests were conducted to simulate equine hoof impact on dirt and synthetic race surfaces; tests were performed both in situ (racetrack and using laboratory reconstructions of harvested surface materials. Clegg Hammer in situ measurements were used to guide surface reconstruction in the laboratory. Dynamic surface properties were compared between in situ and laboratory settings. Relationships between racetrack TTD and Clegg Hammer measurements were analyzed using stepwise multiple linear regression.Most dynamic surface property setting differences (racetrack-laboratory were small relative to surface material type differences (dirt-synthetic. Clegg Hammer measurements were more strongly correlated with TTD measurements on the synthetic surface than the dirt surface. On the dirt surface, Clegg Hammer decelerations were negatively correlated with TTD forces.Laboratory reconstruction of racetrack surfaces guided by Clegg Hammer measurements yielded TTD impact measurements similar to in situ values. The negative correlation between TTD and Clegg Hammer measurements confirms the importance of instrument mass when drawing conclusions from testing results. Lighter impact devices may be less appropriate for assessing dynamic surface properties compared to testing equipment designed to simulate hoof impact (TTD.Dynamic impact properties of race surfaces

  16. Evaluation of chemical surface treatment methods for mitigation of PWSCC

    International Nuclear Information System (INIS)

    Dame, C.; Marks, C.; Olender, A.; Farias, J.


    As part of its mission to propose innovative and safe technologies to mitigate Primary Water Stress Corrosion Cracking (PWSCC) in Pressurized Water Reactors (PWR), EPRI recently initiated a program to evaluate potential new chemical surface treatments that might delay the occurrence of PWSCC such that no failure of components would be observed during their lifetime. Among the initial screening of more than thirty technologies, seven were selected for a more detailed review. The selected technologies were: nickel and nickel alloy plating, organic inhibitors, chromium-based inhibitors, silicon carbide, titanium-based inhibitors, rare earth metal (REM)-based inhibitors and encapsulation. The conclusions of the review of these technologies were that two of them were worth pursuing, titanium-based and REM-based inhibitors, and that evaluating the radiological consequences of injecting these products in the primary system, as well as assessing their efficacy to mitigate PWSCC, should be prioritized as the next required steps in qualification for implementation. (authors)

  17. Seismic data enhancement with Common Reflection Surface (CRS) stack method

    Energy Technology Data Exchange (ETDEWEB)

    Baykulov, M.; Brink, H.J.; Gajewski, D.; Yoon, Mi-Kyung [Hamburg Univ. (Germany). Inst. fuer Geophysik


    We present the results of partial stacking of prestack seismic reflection data based on the kinematic wavefield attributes computed during the automatic CRS stack. The resulting CRS supergathers are more regularised and have better signal to noise ratio compared to original CMP gathers. The improved data can be used in any conventional processing tool instead of the original data, providing enhanced images of better quality. The CRS supergather method is especially suited for low fold seismic reflection data. Application of the new method to synthetic and real low fold data shows a clear improvement of seismograms as well as time and depth-migrated sections. (orig.)

  18. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)


    In every big city, dozen of new boreholes or hand-dug wells are .... This paper is a review of the electrical and gravity methods of ... audience/readership. II. ..... W. W. Northon and Company, New York. Butler ... McGraw Hill Books Co. New York ...

  19. The modal surface interpolation method for damage localization (United States)

    Pina Limongelli, Maria


    The Interpolation Method (IM) has been previously proposed and successfully applied for damage localization in plate like structures. The method is based on the detection of localized reductions of smoothness in the Operational Deformed Shapes (ODSs) of the structure. The IM can be applied to any type of structure provided the ODSs are estimated accurately in the original and in the damaged configurations. If the latter circumstance fails to occur, for example when the structure is subjected to an unknown input(s) or if the structural responses are strongly corrupted by noise, both false and missing alarms occur when the IM is applied to localize a concentrated damage. In order to overcome these drawbacks a modification of the method is herein investigated. An ODS is the deformed shape of a structure subjected to a harmonic excitation: at resonances the ODS are dominated by the relevant mode shapes. The effect of noise at resonance is usually lower with respect to other frequency values hence the relevant ODS are estimated with higher reliability. Several methods have been proposed to reliably estimate modal shapes in case of unknown input. These two circumstances can be exploited to improve the reliability of the IM. In order to reduce or eliminate the drawbacks related to the estimation of the ODSs in case of noisy signals, in this paper is investigated a modified version of the method based on a damage feature calculated considering the interpolation error relevant only to the modal shapes and not to all the operational shapes in the significant frequency range. Herein will be reported the comparison between the results of the IM in its actual version (with the interpolation error calculated summing up the contributions of all the operational shapes) and in the new proposed version (with the estimation of the interpolation error limited to the modal shapes).

  20. The orthogonal gradients method: A radial basis functions method for solving partial differential equations on arbitrary surfaces

    KAUST Repository

    Piret, Cé cile


    Much work has been done on reconstructing arbitrary surfaces using the radial basis function (RBF) method, but one can hardly find any work done on the use of RBFs to solve partial differential equations (PDEs) on arbitrary surfaces. In this paper

  1. The calculation of surface free energy based on embedded atom method for solid nickel

    International Nuclear Information System (INIS)

    Luo Wenhua; Hu Wangyu; Su Kalin; Liu Fusheng


    Highlights: ► A new solution for accurate prediction of surface free energy based on embedded atom method was proposed. ► The temperature dependent anisotropic surface energy of solid nickel was obtained. ► In isotropic environment, the approach does not change most predictions of bulk material properties. - Abstract: Accurate prediction of surface free energy of crystalline metals is a challenging task. The theory calculations based on embedded atom method potentials often underestimate surface free energy of metals. With an analytical charge density correction to the argument of the embedding energy of embedded atom method, an approach to improve the prediction for surface free energy is presented. This approach is applied to calculate the temperature dependent anisotropic surface energy of bulk nickel and surface energies of nickel nanoparticles, and the obtained results are in good agreement with available experimental data.

  2. Design of Compressed Sensing Algorithm for Coal Mine IoT Moving Measurement Data Based on a Multi-Hop Network and Total Variation

    Directory of Open Access Journals (Sweden)

    Gang Wang


    Full Text Available As the application of a coal mine Internet of Things (IoT, mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.

  3. Design of Compressed Sensing Algorithm for Coal Mine IoT Moving Measurement Data Based on a Multi-Hop Network and Total Variation. (United States)

    Wang, Gang; Zhao, Zhikai; Ning, Yongjie


    As the application of a coal mine Internet of Things (IoT), mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH) is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.

  4. Experimental Study in Taguchi Method on Surface Quality Predication of HSM (United States)

    Ji, Yan; Li, Yueen


    Based on the study of ball milling mechanism and machining surface formation mechanism, the formation of high speed ball-end milling surface is a time-varying and cumulative Thermos-mechanical coupling process. The nature of this problem is that the uneven stress field and temperature field affect the machined surface Process, the performance of the processing parameters in the processing interaction in the elastic-plastic materials produced by the elastic recovery and plastic deformation. The surface quality of machining surface is characterized by multivariable nonlinear system. It is still an indispensable and effective method to study the surface quality of high speed ball milling by experiments.

  5. Comparison of two methods of surface profile extraction from multiple ultrasonic range measurements

    NARCIS (Netherlands)

    Barshan, B; Baskent, D

    Two novel methods for surface profile extraction based on multiple ultrasonic range measurements are described and compared. One of the methods employs morphological processing techniques, whereas the other employs a spatial voting scheme followed by simple thresholding. Morphological processing

  6. Detecting surface runoff location in a small catchment using distributed and simple observation method (United States)

    Dehotin, Judicaël; Breil, Pascal; Braud, Isabelle; de Lavenne, Alban; Lagouy, Mickaël; Sarrazin, Benoît


    Surface runoff is one of the hydrological processes involved in floods, pollution transfer, soil erosion and mudslide. Many models allow the simulation and the mapping of surface runoff and erosion hazards. Field observations of this hydrological process are not common although they are crucial to evaluate surface runoff models and to investigate or assess different kinds of hazards linked to this process. In this study, a simple field monitoring network is implemented to assess the relevance of a surface runoff susceptibility mapping method. The network is based on spatially distributed observations (nine different locations in the catchment) of soil water content and rainfall events. These data are analyzed to determine if surface runoff occurs. Two surface runoff mechanisms are considered: surface runoff by saturation of the soil surface horizon and surface runoff by infiltration excess (also called hortonian runoff). The monitoring strategy includes continuous records of soil surface water content and rainfall with a 5 min time step. Soil infiltration capacity time series are calculated using field soil water content and in situ measurements of soil hydraulic conductivity. Comparison of soil infiltration capacity and rainfall intensity time series allows detecting the occurrence of surface runoff by infiltration-excess. Comparison of surface soil water content with saturated water content values allows detecting the occurrence of surface runoff by saturation of the soil surface horizon. Automatic records were complemented with direct field observations of surface runoff in the experimental catchment after each significant rainfall event. The presented observation method allows the identification of fast and short-lived surface runoff processes at a small spatial and temporal resolution in natural conditions. The results also highlight the relationship between surface runoff and factors usually integrated in surface runoff mapping such as topography, rainfall


    Directory of Open Access Journals (Sweden)

    H. А. Vershina


    Full Text Available The paper presents investigations of processes pertaining to surface charge accumulation and running of fluoropolymer-4 products using vibrating capacitor method. Modification of a measurement technique allowing to register distribution of dielectric surface potential without disturbance of the surface charged state has been described in the paper. The paper contains graphics of spatial distribution of surface potential of fluoropolymer-4 products after various treatments. The paper reveals that thermal treatment (tempering reduces static characteristics of fluoropolymer-4.

  8. Costs and returns of producing hops in established tree plantations (United States)

    Kim Ha; Shadi Atallah; Tamara Benjamin; Lori Hoagland; Lenny Farlee; Keith. Woeste


    This article is the first of two publications that analyzes economic opportunities in forest farming for Indiana forest plantation owners. This study explores growing hops along the fence lines of newly established forest stands, while the second study investigates producing American ginseng in older (20- to 30-year-old) forests. The economic analysis presented in this...

  9. Range and energetics of charge hopping in organic semiconductors (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn


    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  10. Wireless multi-hop networks with stealing : large buffer asymptotics

    NARCIS (Netherlands)

    Guillemin, F.; Knessl, C.; Leeuwaarden, van J.S.H.


    Wireless networks equipped with CSMA are scheduled in a fully distributed manner. A disadvantage of such distributed control in multi-hop networks is the hidden node problem that causes the effect of stealing, in which a downstream node steals the channel from an upstream node with probability p.

  11. Examining Hip-Hop as Culturally Relevant Pedagogy (United States)

    Kim, Jung; Pulido, Isaura


    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  12. Crossing the Lexicon: Anglicisms in the German Hip Hop Community (United States)

    Garley, Matthew E.


    The influence of English on German has been an ongoing subject of intense popular and academic interest in the German sphere. In order to better understand this language contact situation, this research project investigates anglicisms--instances of English language material in a German language context--in the German hip hop community, where the…

  13. Powdery mildew reaction of hop cultivars and USDA germplasm, 2015 (United States)

    This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...

  14. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz; Svensson, Tommy; Brandt-Pearce, Maite; Alouini, Mohamed-Slim


    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking

  15. Correlated Hopping in the 1D Falicov--Kimball Model (United States)

    Gajek, Z.; Lemanski, R.


    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

  16. Correlated Hopping in the 1d Falicov-Kimball Model

    International Nuclear Information System (INIS)

    Gajek, Z.; Lemanski, R.


    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle-hole symmetry. (author)

  17. Young Children Manifest Spiritualities in Their Hip-Hop Writing (United States)

    Norton, Nadjwa E. L.


    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  18. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.


    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  19. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière


    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  20. High Order Differential Frequency Hopping: Design and Analysis

    Directory of Open Access Journals (Sweden)

    Yong Li


    Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

  1. A New Method to Simulate Free Surface Flows for Viscoelastic Fluid

    Directory of Open Access Journals (Sweden)

    Yu Cao


    Full Text Available Free surface flows arise in a variety of engineering applications. To predict the dynamic characteristics of such problems, specific numerical methods are required to accurately capture the shape of free surface. This paper proposed a new method which combined the Arbitrary Lagrangian-Eulerian (ALE technique with the Finite Volume Method (FVM to simulate the time-dependent viscoelastic free surface flows. Based on an open source CFD toolbox called OpenFOAM, we designed an ALE-FVM free surface simulation platform. In the meantime, the die-swell flow had been investigated with our proposed platform to make a further analysis of free surface phenomenon. The results validated the correctness and effectiveness of the proposed method for free surface simulation in both Newtonian fluid and viscoelastic fluid.

  2. Studies of non-contact methods for roughness measurements on wood surfaces

    International Nuclear Information System (INIS)

    Lundberg, I.A.S.; Porankiewicz, B.


    The quality of wood surfaces after different kinds of machining processes is a property of great importance for the wood processing industries. Present work is a study, whose objective was to evaluate different non-contact methods, for measurement of the quality of the wood surfaces by correlating them with stylus tracing. A number of Scots Pine samples were prepared by different kinds of wood machining processing. Surface roughness measurements were performed, utilizing two optical noncontact methods. The results indicate that the laser scan method can measure surface roughness on sawn wood with a sufficient degree of accuracy. (author) [de

  3. Stress intensity evaluation for surface crack with use of boundary element method and influence function method and the surface crack extension analysis

    International Nuclear Information System (INIS)

    Yuuki, R.; Ejima, K.


    In this study, three-dimensional boundary element elastostatic analysis is carried out on various surface crack problems. The present BEM uses a Mindlin's solution as well as a Kelvin's solution as a fundamental solution. So we can obtain accurate solutions for a surface crack just before or after a penetration. The obtained solutions for various shapes of surface cracks are stored as the data base, based on the influence function method. We develop the surface crack extension analysis system using the stress intensity factor data base and also the fatigue crack growth law. Our system seems to be useful especially for the analysis of the surface crack just before or after the penetration and also under the residual stresses

  4. Low temperature resistivity studies of SmB6: Observation of two-dimensional variable-range hopping conductivity (United States)

    Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir


    We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.

  5. Determination of optimum "multi-channel surface wave method" field parameters. (United States)


    Multi-channel surface wave methods (especially the multi-channel analyses of surface wave method; MASW) are routinely used to : determine the shear-wave velocity of the subsurface to depths of 100 feet for site classification purposes. Users are awar...

  6. Surface area of antimony oxide by isotope exchange and other methods

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Y.K.; Acharya, B.V.; Rangamannar, B.


    Specific surface areas of antimony oxide samples, one commercial, the other prepared from antimony trichloride were measured by heterogeneous isotope exchange, gas adsorption, air permeability and microscopic methods. Specific surface areas obtained by these four methods for the two samples were compared and the observed differences are explained.

  7. Developments of a bonding technique for optical materials by a surface activation method

    International Nuclear Information System (INIS)

    Sugiyama, Akira; Oda, Tomohiro; Abe, Tomoyuki; Kusunoki, Isao


    We started developing the laser crystal bounding by the surface activation method which can splice crystals together without using hydrogen bonding. For the surface activation, neutral argon beams were used for irradiation of specimens. In the bonding trials with sapphire crystals, we recognized possibility of the bonding method for optical elements. (author)

  8. Method of electrode printing on one or more surfaces of a dielectric substrate

    KAUST Repository

    Neophytou, Marios


    Described herein is a method for printing electrodes surfaces of a dielectric substrate. Provided herein is a new method of depositing electrically conductive electrodes of any shape on flexible and/or rigid dielectric substrates/surfaces and devices so produced. In various embodiments, the devices can generate ionic wind, for example to remove dust or other debris or contaminants or to remove ice or humidity from a surface.

  9. Method of electrode printing on one or more surfaces of a dielectric substrate

    KAUST Repository

    Neophytou, Marios; Kirkus, Mindaugas; Lacoste, Deanna A.


    Described herein is a method for printing electrodes surfaces of a dielectric substrate. Provided herein is a new method of depositing electrically conductive electrodes of any shape on flexible and/or rigid dielectric substrates/surfaces and devices so produced. In various embodiments, the devices can generate ionic wind, for example to remove dust or other debris or contaminants or to remove ice or humidity from a surface.

  10. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods


    Li, Xiaofan; Nie, Qing


    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  11. A Hop-Count Analysis Scheme for Avoiding Wormhole Attacks in MANET

    Directory of Open Access Journals (Sweden)

    Chi-Sung Laih


    Full Text Available MANET, due to the nature of wireless transmission, has more security issues compared to wired environments. A specific type of attack, the Wormhole attack does not require exploiting any nodes in the network and can interfere with the route establishment process. Instead of detecting wormholes from the role of administrators as in previous methods, we implement a new protocol, MHA, using a hop-count analysis from the viewpoint of users without any special environment assumptions. We also discuss previous works which require the role of administrator and their reliance on impractical assumptions, thus showing the advantages of MHA.

  12. Digital photography and transparency-based methods for measuring wound surface area. (United States)

    Bhedi, Amul; Saxena, Atul K; Gadani, Ravi; Patel, Ritesh


    To compare and determine a credible method of measurement of wound surface area by linear, transparency, and photographic methods for monitoring progress of wound healing accurately and ascertaining whether these methods are significantly different. From April 2005 to December 2006, 40 patients (30 men, 5 women, 5 children) admitted to the surgical ward of Shree Sayaji General Hospital, Baroda, had clean as well as infected wound following trauma, debridement, pressure sore, venous ulcer, and incision and drainage. Wound surface areas were measured by these three methods (linear, transparency, and photographic methods) simultaneously on alternate days. The linear method is statistically and significantly different from transparency and photographic methods (P value transparency and photographic methods (P value >0.05). Photographic and transparency methods provided measurements of wound surface area with equivalent result and there was no statistically significant difference between these two methods.

  13. Neutron radiative capture methods for surface elemental analysis (United States)

    Trombka, J.I.; Senftle, F.; Schmadebeck, R.


    Both an accelerator and a 252Cf neutron source have been used to induce characteristic gamma radiation from extended soil samples. To demonstrate the method, measurements of the neutron-induced radiative capture and activation gamma rays have been made with both Ge(Li) and NaI(Tl) detectors, Because of the possible application to space flight geochemical analysis, it is believed that NaI(Tl) detectors must be used. Analytical procedures have been developed to obtain both qualitative and semiquantitative results from an interpretation of the measured NaI(Tl) pulse-height spectrum. Experiment results and the analytic procedure are presented. ?? 1970.

  14. HapHop-Physio: a computer game to support cognitive therapies in children

    Directory of Open Access Journals (Sweden)

    Rico-Olarte C


    Full Text Available Carolina Rico-Olarte,1 Diego M López,1 Santiago Narváez,1 Charic D Farinango,1 Peter S Pharow2 1Faculty of Electronics and Telecommunications Engineering, Universidad del Cauca, Telematics Engineering Research Group, Popayán, Colombia; 2Fraunhofer Institute of Digital Media and Technology IDMT, Ilmenau, Germany Background: Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective: The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods: Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results: The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion: The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. Keywords: computer game, exer-games, cognitive therapies, rehabilitation

  15. A robust real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system

    International Nuclear Information System (INIS)

    Liu, Wenyang; Cheung, Yam; Sawant, Amit; Ruan, Dan


    Purpose: To develop a robust and real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system. Methods: The authors have developed a robust and fast surface reconstruction method on point clouds acquired by the photogrammetry system, without explicitly solving the partial differential equation required by a typical variational approach. Taking advantage of the overcomplete nature of the acquired point clouds, their method solves and propagates a sparse linear relationship from the point cloud manifold to the surface manifold, assuming both manifolds share similar local geometry. With relatively consistent point cloud acquisitions, the authors propose a sparse regression (SR) model to directly approximate the target point cloud as a sparse linear combination from the training set, assuming that the point correspondences built by the iterative closest point (ICP) is reasonably accurate and have residual errors following a Gaussian distribution. To accommodate changing noise levels and/or presence of inconsistent occlusions during the acquisition, the authors further propose a modified sparse regression (MSR) model to model the potentially large and sparse error built by ICP with a Laplacian prior. The authors evaluated the proposed method on both clinical point clouds acquired under consistent acquisition conditions and on point clouds with inconsistent occlusions. The authors quantitatively evaluated the reconstruction performance with respect to root-mean-squared-error, by comparing its reconstruction results against that from the variational method. Results: On clinical point clouds, both the SR and MSR models have achieved sub-millimeter reconstruction accuracy and reduced the reconstruction time by two orders of magnitude to a subsecond reconstruction time. On point clouds with inconsistent occlusions, the MSR model has demonstrated its advantage in achieving consistent and robust performance despite the introduced

  16. A robust real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenyang [Department of Bioengineering, University of California, Los Angeles, Los Angeles, California 90095 (United States); Cheung, Yam [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas 75390 (United States); Sawant, Amit [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas, 75390 and Department of Radiation Oncology, University of Maryland, College Park, Maryland 20742 (United States); Ruan, Dan, E-mail: [Department of Bioengineering, University of California, Los Angeles, Los Angeles, California 90095 and Department of Radiation Oncology, University of California, Los Angeles, Los Angeles, California 90095 (United States)


    Purpose: To develop a robust and real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system. Methods: The authors have developed a robust and fast surface reconstruction method on point clouds acquired by the photogrammetry system, without explicitly solving the partial differential equation required by a typical variational approach. Taking advantage of the overcomplete nature of the acquired point clouds, their method solves and propagates a sparse linear relationship from the point cloud manifold to the surface manifold, assuming both manifolds share similar local geometry. With relatively consistent point cloud acquisitions, the authors propose a sparse regression (SR) model to directly approximate the target point cloud as a sparse linear combination from the training set, assuming that the point correspondences built by the iterative closest point (ICP) is reasonably accurate and have residual errors following a Gaussian distribution. To accommodate changing noise levels and/or presence of inconsistent occlusions during the acquisition, the authors further propose a modified sparse regression (MSR) model to model the potentially large and sparse error built by ICP with a Laplacian prior. The authors evaluated the proposed method on both clinical point clouds acquired under consistent acquisition conditions and on point clouds with inconsistent occlusions. The authors quantitatively evaluated the reconstruction performance with respect to root-mean-squared-error, by comparing its reconstruction results against that from the variational method. Results: On clinical point clouds, both the SR and MSR models have achieved sub-millimeter reconstruction accuracy and reduced the reconstruction time by two orders of magnitude to a subsecond reconstruction time. On point clouds with inconsistent occlusions, the MSR model has demonstrated its advantage in achieving consistent and robust performance despite the introduced

  17. FJ-2207 measuring instrument detection pipe surface a level of pollution method

    International Nuclear Information System (INIS)

    Wang Jiangong


    On the pipe surface contamination were detected α level of pollution is a frequently encountered dose-detection work. Because the pipeline surface arc, while the measuring probe for the plane, which for accurate measurement difficult. In this paper, on the FJ-2207-type pipe surface contamination measuring instrument measuring pollution levels in the α method was studied. Introduced the FJ-2207 measuring instrument detection pipe surface α pollution levels. Studied this measuring instrument on the same sources of surface, plane α level of radioactivity measured differences in the results obtained control of the apparatus when the direct measurement of the surface correction factor, and gives 32-216 specifications commonly used pipe direct measurement of the amendment factor. Convenient method, test results are reliable for the accurate measurement of pipe pollution levels in the surface of α as a reference and learning. (authors)

  18. Measurement of the specific surface area of loose copper deposit by electrochemical methods

    Directory of Open Access Journals (Sweden)

    E. A. Dolmatova


    Full Text Available In the work the surface area of the electrode with dispersed copper deposit obtained within 30 seconds was evaluated by techniques of chronopotentiometry (CPM and impedance spectroscopy. In method CPM the electrode surface available for measurement depends on the value of the polarizing current. At high currents during the transition time there is a change of surface relief that can not determine the full surface of loose deposit. The electrochemical impedance method is devoid of this shortcoming since the measurements are carried out in indifferent electrolyte in the absence of current. The area measured by the impedance is tens of times higher than the value obtained by chronopotentiometry. It is found that from a solution containing sulfuric acid the deposits form with a high specific surface area. Based on these data it was concluded that the method of impedance spectroscopy can be used to measure in situ the surface area of the dispersed copper deposits.

  19. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area. (United States)

    Ku, Bon Ki; Kulkarni, Pramod


    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  20. Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks

    Directory of Open Access Journals (Sweden)

    Xiaowei Wang


    Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.

  1. A robust real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system. (United States)

    Liu, Wenyang; Cheung, Yam; Sawant, Amit; Ruan, Dan


    To develop a robust and real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system. The authors have developed a robust and fast surface reconstruction method on point clouds acquired by the photogrammetry system, without explicitly solving the partial differential equation required by a typical variational approach. Taking advantage of the overcomplete nature of the acquired point clouds, their method solves and propagates a sparse linear relationship from the point cloud manifold to the surface manifold, assuming both manifolds share similar local geometry. With relatively consistent point cloud acquisitions, the authors propose a sparse regression (SR) model to directly approximate the target point cloud as a sparse linear combination from the training set, assuming that the point correspondences built by the iterative closest point (ICP) is reasonably accurate and have residual errors following a Gaussian distribution. To accommodate changing noise levels and/or presence of inconsistent occlusions during the acquisition, the authors further propose a modified sparse regression (MSR) model to model the potentially large and sparse error built by ICP with a Laplacian prior. The authors evaluated the proposed method on both clinical point clouds acquired under consistent acquisition conditions and on point clouds with inconsistent occlusions. The authors quantitatively evaluated the reconstruction performance with respect to root-mean-squared-error, by comparing its reconstruction results against that from the variational method. On clinical point clouds, both the SR and MSR models have achieved sub-millimeter reconstruction accuracy and reduced the reconstruction time by two orders of magnitude to a subsecond reconstruction time. On point clouds with inconsistent occlusions, the MSR model has demonstrated its advantage in achieving consistent and robust performance despite the introduced occlusions. The authors have

  2. Method of driving liquid flow at or near the free surface using magnetic microparticles (United States)

    Snezhko, Oleksiy [Woodridge, IL; Aronson, Igor [Darien, IL; Kwok, Wai-Kwong [Evanston, IL; Belkin, Maxim V [Woodridge, IL


    The present invention provides a method of driving liquid flow at or near a free surface using self-assembled structures composed of magnetic particles subjected to an external AC magnetic field. A plurality of magnetic particles are supported at or near a free surface of liquid by surface tension or buoyancy force. An AC magnetic field traverses the free surface and dipole-dipole interaction between particles produces in self-assembled snake structures which oscillate at the frequency of the traverse AC magnetic field. The snake structures independently move across the free surface and may merge with other snake structures or break up and coalesce into additional snake structures experiencing independent movement across the liquid surface. During this process, the snake structures produce asymmetric flow vortices across substantially the entirety of the free surface, effectuating liquid flow across the free surface.

  3. Reliability Evaluation of Bridges Based on Nonprobabilistic Response Surface Limit Method


    Chen, Xuyong; Chen, Qian; Bian, Xiaoya; Fan, Jianping


    Due to many uncertainties in nonprobabilistic reliability assessment of bridges, the limit state function is generally unknown. The traditional nonprobabilistic response surface method is a lengthy and oscillating iteration process and leads to difficultly solving the nonprobabilistic reliability index. This article proposes a nonprobabilistic response surface limit method based on the interval model. The intention of this method is to solve the upper and lower limits of the nonprobabilistic ...

  4. An Intelligent Method for Structural Reliability Analysis Based on Response Surface

    Institute of Scientific and Technical Information of China (English)

    桂劲松; 刘红; 康海贵


    As water depth increases, the structural safety and reliability of a system become more and more important and challenging. Therefore, the structural reliability method must be applied in ocean engineering design such as offshore platform design. If the performance function is known in structural reliability analysis, the first-order second-moment method is often used. If the performance function could not be definitely expressed, the response surface method is always used because it has a very clear train of thought and simple programming. However, the traditional response surface method fits the response surface of quadratic polynomials where the problem of accuracy could not be solved, because the true limit state surface can be fitted well only in the area near the checking point. In this paper, an intelligent computing method based on the whole response surface is proposed, which can be used for the situation where the performance function could not be definitely expressed in structural reliability analysis. In this method, a response surface of the fuzzy neural network for the whole area should be constructed first, and then the structural reliability can be calculated by the genetic algorithm. In the proposed method, all the sample points for the training network come from the whole area, so the true limit state surface in the whole area can be fitted. Through calculational examples and comparative analysis, it can be known that the proposed method is much better than the traditional response surface method of quadratic polynomials, because, the amount of calculation of finite element analysis is largely reduced, the accuracy of calculation is improved,and the true limit state surface can be fitted very well in the whole area. So, the method proposed in this paper is suitable for engineering application.

  5. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing. (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K


    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  6. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)


    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  7. Preparing the generalized Harvey–Shack rough surface scattering method for use with the discrete ordinates method

    DEFF Research Database (Denmark)

    Johansen, Villads Egede


    The paper shows how to implement the generalized Harvey–Shack (GHS) method for isotropic rough surfaces discretized in a polar coordinate system and approximated using Fourier series. This is particularly relevant for the use of the GHS method as a boundary condition for radiative transfer proble...

  8. Role of transverse hopping in a two-coupled-chains model

    International Nuclear Information System (INIS)

    Fabrizio, M.


    We study the effect of a transverse hopping t perpendicular in two chains of both spinless and spinning repulsively interacting fermions, by means of renormalization group and bosonization techniques. We show that, independent of the presence of spin, t perpendicular strongly modifies the asymptotic long-wavelength behavior of the two chains, opening gaps in the excitation spectra. The origin of the instability of the gapless Luttinger-liquid behavior is identified in the flavor (==chain index) anisotropy induced by t perpendicular . In the case of spinning fermions, it leads to dominant pair fluctuations, in spite of the repulsive interaction. The role of spin is further analyzed in a model of two coupled chains showing, in the absence of t perpendicular , spin-charge separation without anomalous exponents. We solve this model exactly by the bosonization technique, and we find that the interesting analytical properties induced by spin-charge separation persist in the presence of transverse hopping, although t perpendicular does modify the shape of the Fermi surface. The asymptotic expression of the single-particle Green function is also obtained

  9. Predicting muscle forces during the propulsion phase of single leg triple hop test. (United States)

    Alvim, Felipe Costa; Lucareli, Paulo Roberto Garcia; Menegaldo, Luciano Luporini


    Functional biomechanical tests allow the assessment of musculoskeletal system impairments in a simple way. Muscle force synergies associated with movement can provide additional information for diagnosis. However, such forces cannot be directly measured noninvasively. This study aims to estimate muscle activations and forces exerted during the preparation phase of the single leg triple hop test. Two different approaches were tested: static optimization (SO) and computed muscle control (CMC). As an indirect validation, model-estimated muscle activations were compared with surface electromyography (EMG) of selected hip and thigh muscles. Ten physically healthy active women performed a series of jumps, and ground reaction forces, kinematics and EMG data were recorded. An existing OpenSim model with 92 musculotendon actuators was used to estimate muscle forces. Reflective markers data were processed using the OpenSim Inverse Kinematics tool. Residual Reduction Algorithm (RRA) was applied recursively before running the SO and CMC. For both, the same adjusted kinematics were used as inputs. Both approaches presented similar residuals amplitudes. SO showed a closer agreement between the estimated activations and the EMGs of some muscles. Due to inherent EMG methodological limitations, the superiority of SO in relation to CMC can be only hypothesized. It should be confirmed by conducting further studies comparing joint contact forces. The workflow presented in this study can be used to estimate muscle forces during the preparation phase of the single leg triple hop test and allows investigating muscle activation and coordination. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Surface functionalization of cyclic olefin copolymer with aryldiazonium salts: A covalent grafting method

    International Nuclear Information System (INIS)

    Brisset, Florian; Vieillard, Julien; Berton, Benjamin; Morin-Grognet, Sandrine; Duclairoir-Poc, Cécile; Le Derf, Franck


    Graphical abstract: - Highlights: • An effective method to modify cyclic olefin copolymer surface. • The surface of COC was modified by covalent grafting of aryl diazonium salts. • The wettability of COC surface was modulated by diazonium salts. • Photoinitiation and chemical reduction have to be combined to graft diazonium salt on COC surface. - Abstract: Covalent immobilization of biomolecules on the surface of cyclic olefin copolymer (COC) is still a tough challenge. We developed a robust method for COC surface grafting through reaction with aryldiazonium. Chemical diazonium reduction generated an aryl radical and the formation of a grafted film layer on the organic surface. We also demonstrated that the chemical reduction of diazonium salt was not sufficient to form a film on the COC surface. UV illumination had to be combined with chemical reduction to graft an aryl layer onto the COC surface. We optimized organic film deposition by using different chemical reducers, different reaction times and reagent proportions. We characterized surface modifications by fluorescence microscopy and contact angle measurements, infrared spectroscopy, X-ray photoemission spectroscopy and Raman spectroscopy, and assessed the topography of the aryl film by atomic force microscopy. This original strategy allowed us to evidence various organic functions to graft biomolecules onto COC surfaces with a fast and efficient technique

  11. Surface functionalization of cyclic olefin copolymer with aryldiazonium salts: A covalent grafting method

    Energy Technology Data Exchange (ETDEWEB)

    Brisset, Florian, E-mail: [UMR CNRS 6014 COBRA, FR 3038, Université de Rouen, 55 rue Saint Germain, 27000 Evreux (France); Vieillard, Julien, E-mail: [UMR CNRS 6014 COBRA, FR 3038, Université de Rouen, 55 rue Saint Germain, 27000 Evreux (France); Berton, Benjamin, E-mail: [EA 3233 SMS, Université de Rouen, 1 rue du 7ème Chasseurs, BP281, 27002 Evreux Cedex (France); Morin-Grognet, Sandrine, E-mail: [EA 3829 MERCI, Université de Rouen, 1 rue du 7ème Chasseurs, BP281, 27002 Evreux Cedex (France); Duclairoir-Poc, Cécile, E-mail: [EA 4312 LMSM, Université de Rouen, 55 rue Saint Germain, 27000 Evreux (France); Le Derf, Franck, E-mail: [UMR CNRS 6014 COBRA, FR 3038, Université de Rouen, 55 rue Saint Germain, 27000 Evreux (France)


    Graphical abstract: - Highlights: • An effective method to modify cyclic olefin copolymer surface. • The surface of COC was modified by covalent grafting of aryl diazonium salts. • The wettability of COC surface was modulated by diazonium salts. • Photoinitiation and chemical reduction have to be combined to graft diazonium salt on COC surface. - Abstract: Covalent immobilization of biomolecules on the surface of cyclic olefin copolymer (COC) is still a tough challenge. We developed a robust method for COC surface grafting through reaction with aryldiazonium. Chemical diazonium reduction generated an aryl radical and the formation of a grafted film layer on the organic surface. We also demonstrated that the chemical reduction of diazonium salt was not sufficient to form a film on the COC surface. UV illumination had to be combined with chemical reduction to graft an aryl layer onto the COC surface. We optimized organic film deposition by using different chemical reducers, different reaction times and reagent proportions. We characterized surface modifications by fluorescence microscopy and contact angle measurements, infrared spectroscopy, X-ray photoemission spectroscopy and Raman spectroscopy, and assessed the topography of the aryl film by atomic force microscopy. This original strategy allowed us to evidence various organic functions to graft biomolecules onto COC surfaces with a fast and efficient technique.

  12. Method for Pre-Conditioning a Measured Surface Height Map for Model Validation (United States)

    Sidick, Erkin


    This software allows one to up-sample or down-sample a measured surface map for model validation, not only without introducing any re-sampling errors, but also eliminating the existing measurement noise and measurement errors. Because the re-sampling of a surface map is accomplished based on the analytical expressions of Zernike-polynomials and a power spectral density model, such re-sampling does not introduce any aliasing and interpolation errors as is done by the conventional interpolation and FFT-based (fast-Fourier-transform-based) spatial-filtering method. Also, this new method automatically eliminates the measurement noise and other measurement errors such as artificial discontinuity. The developmental cycle of an optical system, such as a space telescope, includes, but is not limited to, the following two steps: (1) deriving requirements or specs on the optical quality of individual optics before they are fabricated through optical modeling and simulations, and (2) validating the optical model using the measured surface height maps after all optics are fabricated. There are a number of computational issues related to model validation, one of which is the "pre-conditioning" or pre-processing of the measured surface maps before using them in a model validation software tool. This software addresses the following issues: (1) up- or down-sampling a measured surface map to match it with the gridded data format of a model validation tool, and (2) eliminating the surface measurement noise or measurement errors such that the resulted surface height map is continuous or smoothly-varying. So far, the preferred method used for re-sampling a surface map is two-dimensional interpolation. The main problem of this method is that the same pixel can take different values when the method of interpolation is changed among the different methods such as the "nearest," "linear," "cubic," and "spline" fitting in Matlab. The conventional, FFT-based spatial filtering method used to

  13. Porcelain surface alterations and refinishing after use of two orthodontic bonding methods. (United States)

    Herion, Drew T; Ferracane, Jack L; Covell, David A


    To compare porcelain surfaces at debonding after use of two surface preparation methods and to evaluate a method for restoring the surface. Lava Ceram feldspathic porcelain discs (n = 40) underwent one of two surface treatments prior to bonding orthodontic brackets. Half the discs had sandblasting, hydrofluoric acid, and silane (SB + HF + S), and the other half, phosphoric acid and silane (PA + S). Brackets were debonded using bracket removing pliers, and resin was removed with a 12-fluted carbide bur. The surface was refinished using a porcelain polishing kit, followed by diamond polishing paste. Measurements for surface roughness (Ra), gloss, and color were made before bonding (baseline), after debonding, and after each step of refinishing. Surfaces were also examined by scanning electron microscopy (SEM). Data was analyzed with 2-way ANOVA followed by Tukey HSD tests (alpha = 0.05). The SB + HF + S bonding method increased Ra (0.160 to 1.121 microm), decreased gloss (41.3 to 3.7) and altered color (DeltaE = 4.37; P gloss (41.7 to 38.0) and color (DeltaE = 0.50). The measurements and SEM observations showed that changes were fully restored to baseline with refinishing. The PA + S method caused significantly less damage to porcelain than the SB + HF + S method. The refinishing protocol fully restored the porcelain surfaces.

  14. Temperature Dependence of Arn+ Cluster Backscattering from Polymer Surfaces: a New Method to Determine the Surface Glass Transition Temperature. (United States)

    Poleunis, Claude; Cristaudo, Vanina; Delcorte, Arnaud


    In this work, time-of-flight secondary ion mass spectrometry (ToF-SIMS) was used to study the intensity variations of the backscattered Ar n + clusters as a function of temperature for several amorphous polymer surfaces (polyolefins, polystyrene, and polymethyl methacrylate). For all these investigated polymers, our results show a transition of the ratio Ar 2 + /(Ar 2 + + Ar 3 + ) when the temperature is scanned from -120 °C to +125 °C (the exact limits depend on the studied polymer). This transition generally spans over a few tens of degrees and the temperature of the inflection point of each curve is always lower than the bulk glass transition temperature (T g ) reported for the considered polymer. Due to the surface sensitivity of the cluster backscattering process (several nanometers), the presented analysis could provide a new method to specifically evaluate a surface transition temperature of polymers, with the same lateral resolution as the gas cluster beam. Graphical abstract ᅟ.

  15. A new capacitive/resistive probe method for studying magnetic surfaces

    International Nuclear Information System (INIS)

    Kitajima, Sumio; Takayama, Masakazu; Zama, Tatsuya; Takaya, Kazuhiro; Takeuchi, Nobunao; Watanabe, Hiroshige


    A new capacitive/resistive probe method for mapping the magnetic surfaces from resistance or capacitance between a magnetic surface and a vacuum vessel was developed and tested. Those resistances and capacitances can be regarded as components of a simple electrical bridge circuit. This method exploits electrical transient response of the bridge circuit for a square pulse. From equiresistance or equicapacitance points, the magnetic surface structure can be deduced. Measurements on the Tohoku University Heliac, which is a small-size standard heliac, show good agreement with numerical calculations. This method is particularly useful for pulse-operated machines. (author)

  16. A Method for Retrieving Daily Land Surface Albedo from Space at 30-m Resolution

    Directory of Open Access Journals (Sweden)

    Bo Gao


    Full Text Available Land surface albedo data with high spatio-temporal resolution are increasingly important for scientific studies addressing spatially and/or temporally small-scale phenomena, such as urban heat islands and urban land surface energy balance. Our previous study derived albedo data with 2–4-day and 30-m temporal and spatial resolution that have better spatio-temporal resolution than existing albedo data, but do not completely satisfy the requirements for monitoring high-frequency land surface changes at the small scale. Downscaling technology provides a chance to further improve the albedo data spatio-temporal resolution and accuracy. This paper introduces a method that combines downscaling technology for land surface reflectance with an empirical method of deriving land surface albedo. Firstly, downscaling daily MODIS land surface reflectance data (MOD09GA from 500 m to 30 m on the basis of HJ-1A/B BRDF data with 2–4-day and 30-m temporal and spatial resolution is performed: this is the key step in the improved method. Subsequently, the daily 30-m land surface albedo data are derived by an empirical method combining prior knowledge of the MODIS BRDF product and the downscaled daily 30-m reflectance. Validation of albedo data obtained using the proposed method shows that the new method has both improved spatio-temporal resolution and good accuracy (a total absolute accuracy of 0.022 and a total root mean squared error at six sites of 0.028.

  17. A Two-stage Improvement Method for Robot Based 3D Surface Scanning (United States)

    He, F. B.; Liang, Y. D.; Wang, R. F.; Lin, Y. S.


    As known that the surface of unknown object was difficult to measure or recognize precisely, hence the 3D laser scanning technology was introduced and used properly in surface reconstruction. Usually, the surface scanning speed was slower and the scanning quality would be better, while the speed was faster and the quality would be worse. In this case, the paper presented a new two-stage scanning method in order to pursuit the quality of surface scanning in a faster speed. The first stage was rough scanning to get general point cloud data of object’s surface, and then the second stage was specific scanning to repair missing regions which were determined by chord length discrete method. Meanwhile, a system containing a robotic manipulator and a handy scanner was also developed to implement the two-stage scanning method, and relevant paths were planned according to minimum enclosing ball and regional coverage theories.

  18. A New Approach to Bézier Surface Visualization by a Ray Tracing Method


    Glazs, A; Sisojevs, A


    Problem of free – form surfaces visualization is actual in various areas of a science and engineering. One of mathematical models used for this purpose is the mathematical description of a Bézier surface. Classical methods of computer graphics based on polygonal models use only polygonal interpolation of a Bézier surface. Such approach inevitably leads to occurrence of an error and as a consequence – to discrepancy of an image.

  19. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates. (United States)

    Haakensen, M; Schubert, A; Ziola, B


    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  20. Comparison of 3 methods on fabricating micro- /nano- structured surface on 3D mold cavity

    DEFF Research Database (Denmark)

    Zhang, Yang; Hansen, Hans Nørgaard; Bissacco, Giuliano


    The methods to manufacture micro- or nano- structures on surfaces have been an area of intense investigation. Demands are shown for technologies for surface structuring on real 3D parts in many fields. However, most technologies for the fabrication of micro-structured functional surfaces are still...... limited to flat or simple shaped geometries. In this paper, 3 approaches for fabricating micro and nano- structured surfaces on a mold cavity for injection moulding are investigated and compared. The first approach is to use pre-fabricated plate with micro-structured surface as an insert for the mold......, in this way micro holes (Ø4 μm) was obtained. The second approach is to produce the cavity part using anodizing process chain, and in this way sub-micro structures can be obtained all over the cavity surface. The third approach is to machine the surface inside the cavity directly by femtosecond laser combined...

  1. Fabrication of metallic surfaces with long-term superhydrophilic property using one-stop laser method

    International Nuclear Information System (INIS)

    Guan, Y.C.; Luo, F.F.; Lim, G.C.; Hong, M.H.; Zheng, H.Y.; Qi, Bojin


    Highlights: • One-stop laser method is presented to fabricate superhydrophilic surface on metals. • Wettability study shows the longest superhydrophilic duration as more than 1 month. • Water-soluble compounds, polar functional groups and dual-scale structures were formed. • Surface roughness shows an amplification effect of the wetting behavior. - Abstract: A simple method for fabricating stable superhydrophilic surface at metallic substrates is reported. This technique comprises irradiating the surface with multiple laser pulses. Surface wettability can be taylored through controlling laser parameters and processing conditions. The substrates were selected as aluminum alloy and stainless steel. Physical morphology and chemical composition of laser-textured surfaces were characterized by SEM, XPS, and 3D profiler measurements. Results showed that the longest wettability duration was achieved as more than 1 month for stainless steel and more than 200 h for Al alloy, respectively. The possible mechanism of hydrophilic behavior of laser-textured surfaces was discussed. The effect of surface topography on superhydrophilicity property was also evaluated. This study presents a promising method in fabricating long-term superhydrophilic surfaces, which is useful for improving adhesion or achieving water-assisted flow in industrial applications as well as developing cell-based technologies in biomedical applications

  2. Synthesis of present methods of surface contamination detection (skin, clothes, laboratories)

    International Nuclear Information System (INIS)

    Joudrier, P.


    The signification of the term ''contamination'' is briefly recalled. To measure the levels of contamination, there are only two methods: the direct method and the indirect method. Finally, the recent improvements in the surface contamination detection field are shortly reviewed [fr

  3. Method for the indication of failures on the surface of magnetizable workpieces

    International Nuclear Information System (INIS)


    Using the magnetic powder method as a quality test of ferromagnetic work pieces, solid iron powder, pigment and lac are put on the surface and the powder agglomeration sprayed with a solvent. This way the varnish softens and adheres the powder to the surface. A non-explosive solvent is used and with help of additives the contrast increases. (TK) [de

  4. Electronic interconnects and devices with topological surface states and methods for fabricating same (United States)

    Yazdani, Ali; Ong, N. Phuan; Cava, Robert J.


    An interconnect is disclosed with enhanced immunity of electrical conductivity to defects. The interconnect includes a material with charge carriers having topological surface states. Also disclosed is a method for fabricating such interconnects. Also disclosed is an integrated circuit including such interconnects. Also disclosed is a gated electronic device including a material with charge carriers having topological surface states.

  5. Determining surface areas of marine alga cells by acid-base titration method. (United States)

    Wang, X; Ma, Y; Su, Y


    A new method for determining the surface area of living marine alga cells was described. The method uses acid-base titration to measure the surface acid/base amount on the surface of alga cells and uses the BET (Brunauer, Emmett, and Teller) equation to estimate the maximum surface acid/base amount, assuming that hydrous cell walls have carbohydrates or other structural compounds which can behave like surface Brönsted acid-base sites due to coordination of environmental H2O molecules. The method was applied to 18 diverse alga species (including 7 diatoms, 2 flagellates, 8 green algae and 1 red alga) maintained in seawater cultures. For the species examined, the surface areas of individual cells ranged from 2.8 x 10(-8) m2 for Nannochloropsis oculata to 690 x 10(-8) m2 for Dunaliella viridis, specific surface areas from 1,030 m2.g-1 for Dunaliella salina to 28,900 m2.g-1 for Pyramidomonas sp. Measurement accuracy was 15.2%. Preliminary studies show that the method may be more promising and accurate than light/electron microscopic measurements for coarse estimation of the surface area of living algae.

  6. Methods for surface treating metals, ceramics, and plastics before adhesive bonding

    International Nuclear Information System (INIS)

    Althouse, L.P.


    Methods for pretreating the surfaces of metals, ceramics, and plastics before they are coated with adhesive and used in assembly are described. The treatments recommended have been used successfully in the laboratory at LLL. Many are used in the assembly of nuclear devices. However, an unusual alloy or complex configuration may require trials before a specific surface treatment is chosen

  7. Ion-step method for surface potential sensing of silicon nanowires

    NARCIS (Netherlands)

    Chen, S.; van Nieuwkasteele, Jan William; van den Berg, Albert; Eijkel, Jan C.T.


    This paper presents a novel stimulus-response method for surface potential sensing of silicon nanowire (Si NW) field-effect transistors. When an "ion-step" from low to high ionic strength is given as a stimulus to the gate oxide surface, an increase of double layer capacitance is therefore expected.

  8. Adhesion of resin composites to biomaterials in dentistry : an evaluation of surface conditioning methods

    NARCIS (Netherlands)

    Özcan, Mutlu


    Since previous investigations revealed that most clinical failures in adhesively luted ceramic restorations initiate from the cementation or internal surfaces, the study presented in Chapter II evaluated the effect of three different surface conditioning methods on the bond strength of a Bis-GMA

  9. Electronic interconnects and devices with topological surface states and methods for fabricating same

    Energy Technology Data Exchange (ETDEWEB)

    Yazdani, Ali; Ong, N. Phuan; Cava, Robert J.


    An interconnect is disclosed with enhanced immunity of electrical conductivity to defects. The interconnect includes a material with charge carriers having topological surface states. Also disclosed is a method for fabricating such interconnects. Also disclosed is an integrated circuit including such interconnects. Also disclosed is a gated electronic device including a material with charge carriers having topological surface states.

  10. Surface Nano Structures Manufacture Using Batch Chemical Processing Methods for Tooling Applications

    DEFF Research Database (Denmark)

    Tosello, Guido; Calaon, Matteo; Gavillet, J.


    The patterning of large surface areas with nano structures by using chemical batch processes to avoid using highenergy intensive nano machining processes was investigated. The capability of different surface treatment methods of creating micro and nano structured adaptable mould inserts for subse...

  11. Fast frequency hopping codes applied to SAC optical CDMA network (United States)

    Tseng, Shin-Pin


    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.


    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves


    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  13. Hopping mixed hybrid excitations in multiple composite quantum wire structures

    International Nuclear Information System (INIS)

    Nguyen Ba An; Tran Thai Hoa


    A structure consisting of N pairs of inorganic semiconductor and organic quantum wires is considered theoretically. In such an isolated pair of wires, while the intrawire coupling forms Wannier-Mott exciton in an inorganic semiconductor quantum wire and Frenkel exciton in an organic one, the interwire coupling gives rise to hybrid excitons residing within the pair. When N pairs of wires are packed together 2N new mixed hybrid modes appear that are the true elementary excitations and can hop throughout the whole structure. Energies and wave functions of such hopping mixed hybrid excitations are derived analytically in detail accounting for the global interwire coupling and the different polarization configurations. (author). 19 refs

  14. Rend og hop - Vi si´r stop

    DEFF Research Database (Denmark)

    Lund, Ole

    Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere dominere......Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere...

  15. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56 (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.


    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  16. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins. (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L


    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  17. Cross-layer optimization of wireless multi-hop networks


    Soldati, Pablo


    The interest in wireless communications has grown constantly for the past decades, leading to an enormous number of applications and services embraced by billions of users. In order to meet the increasing demand for mobile Internet access, several high data-rate radio networking technologies have been proposed to offer wide area high-speed wireless communications, eventually replacing fixed (wired) networks for many applications. This thesis considers cross-layer optimization of multi-hop rad...

  18. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.


    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  19. Calculation of parameter failure probability of thermodynamic system by response surface and importance sampling method

    International Nuclear Information System (INIS)

    Shang Yanlong; Cai Qi; Chen Lisheng; Zhang Yangwei


    In this paper, the combined method of response surface and importance sampling was applied for calculation of parameter failure probability of the thermodynamic system. The mathematics model was present for the parameter failure of physics process in the thermodynamic system, by which the combination arithmetic model of response surface and importance sampling was established, then the performance degradation model of the components and the simulation process of parameter failure in the physics process of thermodynamic system were also present. The parameter failure probability of the purification water system in nuclear reactor was obtained by the combination method. The results show that the combination method is an effective method for the calculation of the parameter failure probability of the thermodynamic system with high dimensionality and non-linear characteristics, because of the satisfactory precision with less computing time than the direct sampling method and the drawbacks of response surface method. (authors)

  20. Research on the method of improving the accuracy of CMM (coordinate measuring machine) testing aspheric surface (United States)

    Cong, Wang; Xu, Lingdi; Li, Ang


    Large aspheric surface which have the deviation with spherical surface are being used widely in various of optical systems. Compared with spherical surface, Large aspheric surfaces have lots of advantages, such as improving image quality, correcting aberration, expanding field of view, increasing the effective distance and make the optical system compact, lightweight. Especially, with the rapid development of space optics, space sensor resolution is required higher and viewing angle is requred larger. Aspheric surface will become one of the essential components in the optical system. After finishing Aspheric coarse Grinding surface profile error is about Tens of microns[1].In order to achieve the final requirement of surface accuracy,the aspheric surface must be quickly modified, high precision testing is the basement of rapid convergence of the surface error . There many methods on aspheric surface detection[2], Geometric ray detection, hartmann detection, ronchi text, knifeedge method, direct profile test, interferometry, while all of them have their disadvantage[6]. In recent years the measure of the aspheric surface become one of the import factors which are restricting the aspheric surface processing development. A two meter caliber industrial CMM coordinate measuring machine is avaiable, but it has many drawbacks such as large detection error and low repeatability precision in the measurement of aspheric surface coarse grinding , which seriously affects the convergence efficiency during the aspherical mirror processing. To solve those problems, this paper presents an effective error control, calibration and removal method by calibration mirror position of the real-time monitoring and other effective means of error control, calibration and removal by probe correction and the measurement mode selection method to measure the point distribution program development. This method verified by real engineer examples, this method increases the original industrial


    Directory of Open Access Journals (Sweden)

    JURCO Ancuta Nadia


    Full Text Available This work present two methods for determining the development of double-curved surface. The aims of this paper is to show a comparative study between methods for determination of the sheet metal requirements for complex roof cover shape. In first part of the paper are presented the basic sketch and information about the roof shape and some consecrated buildings, which have a complex roof shape. The second part of the paper shows two methods for determining the developed of the spherical roof. The graphical method is the first method used for developing of the spherical shape. In this method it used the poly-cylindrical method to develop the double-curved surface. The second method is accomplishing by using the dedicated CAD software method.

  2. A method of analyzing rectal surface area irradiated and rectal complications in prostate conformal radiotherapy

    International Nuclear Information System (INIS)

    Lu Yong; Song, Paul Y.; Li Shidong; Spelbring, Danny R.; Vijayakumar, Srinivasan; Haraf, Daniel J.; Chen, George T.Y.


    Purpose: To develop a method of analyzing rectal surface area irradiated and rectal complications in prostate conformal radiotherapy. Methods and Materials: Dose-surface histograms of the rectum, which state the rectal surface area irradiated to any given dose, were calculated for a group of 27 patients treated with a four-field box technique to a total (tumor minimum) dose ranging from 68 to 70 Gy. Occurrences of rectal toxicities as defined by the Radiation Therapy Oncology Group (RTOG) were recorded and examined in terms of dose and rectal surface area irradiated. For a specified end point of rectal complication, the complication probability was analyzed as a function of dose irradiated to a fixed rectal area, and as a function of area receiving a fixed dose. Lyman's model of normal tissue complication probability (NTCP) was used to fit the data. Results: The observed occurrences of rectal complications appear to depend on the rectal surface area irradiated to a given dose level. The patient distribution of each toxicity grade exhibits a maximum as a function of percentage surface area irradiated, and the maximum moves to higher values of percentage surface area as the toxicity grade increases. The dependence of the NTCP for the specified end point on dose and percentage surface area irradiated was fitted to Lyman's NTCP model with a set of parameters. The curvature of the NTCP as a function of the surface area suggests that the rectum is a parallel structured organ. Conclusions: The described method of analyzing rectal surface area irradiated yields interesting insight into understanding rectal complications in prostate conformal radiotherapy. Application of the method to a larger patient data set has the potential to facilitate the construction of a full dose-surface-complication relationship, which would be most useful in guiding clinical practice

  3. Condition Assessment for Wastewater Pipes: Method for Assessing Cracking and Surface Damage of Concrete Pipes


    Hauge, Petter


    The objective of the Master Thesis has been to provide an improved method for condition assessment, which will give a better correlation between Condition class and actual Condition of concrete pipes with cracking and/or surface damages. Additionally improvement of the characterization of cracking (SR) and surface (KO) damages was a sub goal.Based on the findings described in my Thesis and my Specialization Project (Hauge 2012), I recommend that the Norwegian condition assessment method based...

  4. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz


    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  5. The measurement of surface roughness to determine the suitability of different methods for stone cleaning

    International Nuclear Information System (INIS)

    Vazquez-Calvo, Carmen; Alvarez de Buergo, Monica; Fort, Rafael; Varas-Muriel, Maria Jose


    The roughness of stone surface was measured, before and after bead blasting-based cleaning methods, to select the most efficient one to be used in masonry and stonework of specific areas of the Cathedral of Segovia (Spain). These types of cleaning methods can, besides the removal of soiling and surface deposits, leave a rougher surface, which would mean higher and more rapid water retention and deposit accumulation due to a specific surface increase, therefore accelerating stone decay. Or, in contrast, the cleaning method can be so aggressive that it can smooth the surface by reducing its roughness, a fact that usually corresponds to excessive material removal—soot and deposits–-but also part of the stone substrate. Roughness results were complemented with scanning electron microscopy observations and analyses and colour measurements. Finally, it was possible to select the best cleaning method among the six that were analysed, for different areas and different stone materials. Therefore, this study confirms the measurement of surface roughness as a reliable test to determine the suitability of stone cleaning methods; it is a non-destructive technique, portable and friendly to use, which can help us to rapidly assess—together with other techniques—the efficacy and aggressiveness of the stone cleaning method. (paper)

  6. A hybrid 3D SEM reconstruction method optimized for complex geologic material surfaces. (United States)

    Yan, Shang; Adegbule, Aderonke; Kibbey, Tohren C G


    Reconstruction methods are widely used to extract three-dimensional information from scanning electron microscope (SEM) images. This paper presents a new hybrid reconstruction method that combines stereoscopic reconstruction with shape-from-shading calculations to generate highly-detailed elevation maps from SEM image pairs. The method makes use of an imaged glass sphere to determine the quantitative relationship between observed intensity and angles between the beam and surface normal, and the detector and surface normal. Two specific equations are derived to make use of image intensity information in creating the final elevation map. The equations are used together, one making use of intensities in the two images, the other making use of intensities within a single image. The method is specifically designed for SEM images captured with a single secondary electron detector, and is optimized to capture maximum detail from complex natural surfaces. The method is illustrated with a complex structured abrasive material, and a rough natural sand grain. Results show that the method is capable of capturing details such as angular surface features, varying surface roughness, and surface striations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. A method of reconstructing complex stratigraphic surfaces with multitype fault constraints (United States)

    Deng, Shi-Wu; Jia, Yu; Yao, Xing-Miao; Liu, Zhi-Ning


    The construction of complex stratigraphic surfaces is widely employed in many fields, such as petroleum exploration, geological modeling, and geological structure analysis. It also serves as an important foundation for data visualization and visual analysis in these fields. The existing surface construction methods have several deficiencies and face various difficulties, such as the presence of multitype faults and roughness of resulting surfaces. In this paper, a surface modeling method that uses geometric partial differential equations (PDEs) is introduced for the construction of stratigraphic surfaces. It effectively solves the problem of surface roughness caused by the irregularity of stratigraphic data distribution. To cope with the presence of multitype complex faults, a two-way projection algorithm between threedimensional space and a two-dimensional plane is proposed. Using this algorithm, a unified method based on geometric PDEs is developed for dealing with multitype faults. Moreover, the corresponding geometric PDE is derived, and an algorithm based on an evolutionary solution is developed. The algorithm proposed for constructing spatial surfaces with real data verifies its computational efficiency and its ability to handle irregular data distribution. In particular, it can reconstruct faulty surfaces, especially those with overthrust faults.

  8. The Soft-Confined Method for Creating Molecular Models of Amorphous Polymer Surfaces

    KAUST Repository

    Liu, Hongyi; Li, Yan; Krause, Wendy E.; Rojas, Orlando J.; Pasquinelli, Melissa A.


    The goal of this work was to use molecular dynamics (MD) simulations to build amorphous surface layers of polypropylene (PP) and cellulose and to inspect their physical and interfacial properties. A new method to produce molecular models for these surfaces was developed, which involved the use of a "soft" confining layer comprised of a xenon crystal. This method compacts the polymers into a density distribution and a degree of molecular surface roughness that corresponds well to experimental values. In addition, calculated properties such as density, cohesive energy density, coefficient of thermal expansion, and the surface energy agree with experimental values and thus validate the use of soft confining layers. The method can be applied to polymers with a linear backbone such as PP as well as those whose backbones contain rings, such as cellulose. The developed PP and cellulose surfaces were characterized by their interactions with water. It was found that a water nanodroplet spreads on the amorphous cellulose surfaces, but there was no significant change in the dimension of the droplet on the PP surface; the resulting MD water contact angles on PP and amorphous cellulose surfaces were determined to be 106 and 33°, respectively. © 2012 American Chemical Society.

  9. The Soft-Confined Method for Creating Molecular Models of Amorphous Polymer Surfaces

    KAUST Repository

    Liu, Hongyi


    The goal of this work was to use molecular dynamics (MD) simulations to build amorphous surface layers of polypropylene (PP) and cellulose and to inspect their physical and interfacial properties. A new method to produce molecular models for these surfaces was developed, which involved the use of a "soft" confining layer comprised of a xenon crystal. This method compacts the polymers into a density distribution and a degree of molecular surface roughness that corresponds well to experimental values. In addition, calculated properties such as density, cohesive energy density, coefficient of thermal expansion, and the surface energy agree with experimental values and thus validate the use of soft confining layers. The method can be applied to polymers with a linear backbone such as PP as well as those whose backbones contain rings, such as cellulose. The developed PP and cellulose surfaces were characterized by their interactions with water. It was found that a water nanodroplet spreads on the amorphous cellulose surfaces, but there was no significant change in the dimension of the droplet on the PP surface; the resulting MD water contact angles on PP and amorphous cellulose surfaces were determined to be 106 and 33°, respectively. © 2012 American Chemical Society.

  10. Use of modern methods of fibre surface modification to obtain the multifunctional properties of textile materials

    Directory of Open Access Journals (Sweden)

    Jocić Dragan


    Full Text Available The modern textile fibre treatments aim to obtain the required level of beneficial effect while attempting to confine the modification to the fibre surface. Recently, much attention has been focused on different physical methods of fibre surface modification, cold plasma treatment being considered as very useful. Moreover, there are efficient chemical methods available, such as peroxide, biopolymer and enzyme treatment. Some interesting combinations of these physical and chemical surface modification methods as means to modify fibre surface topography and thus controlling the surface-related properties of the fibre are presented in this paper. The properties obtained are discussed on the basis of the physico-chemical changes in the surface layer of the fibre, being assessed by wettability and contact angle measurements, as well as by FTIR-ATR and XPS analysis. The SEM and AFM technique are used to assess the changes in the fibre surface topography and to correlate these changes to the effectiveness, uniformity and severity of the textile fibre surface modification treatments.

  11. An Open-Label Randomized Control Trial of Hopping and Jumping Training versus Sensorimotor Rehabilitation Programme on Postural Capacities in Individuals with Intellectual Disabilities (United States)

    Borji, Rihab; Sahli, Sonia; Baccouch, Rym; Laatar, Rabeb; Kachouri, Hiba; Rebai, Haithem


    Background: This study aimed to compare the effectiveness of a hopping and jumping training programme (HJP) versus a sensorimotor rehabilitation programme (SRP) on postural performances in children with intellectual disability. Methods: Three groups of children with intellectual disability participated in the study: the HJP group, the SRP group…

  12. Fabricating superhydrophobic polymer surfaces with excellent abrasion resistance by a simple lamination templating method. (United States)

    Xu, Qian Feng; Mondal, Bikash; Lyons, Alan M


    Fabricating robust superhydrophobic surfaces for commercial applications is challenging as the fine-scale surface features, necessary to achieve superhydrophobicity, are susceptible to mechanical damage. Herein, we report a simple and inexpensive lamination templating method to create superhydrophobic polymer surfaces with excellent abrasion resistance and water pressure stability. To fabricate the surfaces, polyethylene films were laminated against woven wire mesh templates. After cooling, the mesh was peeled from the polymer creating a 3D array of ordered polymer microposts on the polymer surface. The resulting texture is monolithic with the polymer film and requires no chemical modification to exhibit superhydrophobicity. By controlling lamination parameters and mesh dimensions, polyethylene surfaces were fabricated that exhibit static contact angles of 160° and slip angles of 5°. Chemical and mechanical stability was evaluated using an array of manual tests as well as a standard reciprocating abraser test. Surfaces remained superhydrophobic after more than 5500 abrasion cycles at a pressure of 32.0 kPa. In addition, the surface remains dry after immersing into water for 5 h at 55 kPa. This method is environmental friendly, as it employs no solvents or harsh chemicals and may provide an economically viable path to manufacture large areas of mechanically robust superhydrophobic surfaces from inexpensive polymers and reusable templates.

  13. A method for the characterization of the reflectance of anisotropic functional surfaces

    DEFF Research Database (Denmark)

    Regi, Francesco; Nielsen, J B; Li, Dongya


    The functional properties of micro-structured surfaces have gained increasing interest thanks to many applications such as wetting, adhesion, thermal and/or electrical conductivity. In this study, directional optical properties, i.e. contrast between two regions of a surface, were achieved...... reflectance of the surface for a range of design-specific view-illumination configurations was determined using a method that involves a Hirox RH-2000 digital microscope, used as a gonioreflectometer. This method allows the empirical determination of the optimum surface microstructure for maximizing contrast...... between two horizontally orthogonal views. The results show that even if the uncertainty related to the instrumentation is up to 20% in some cases, this procedure is suitable for the characterization of the surface of both metal and plastic counterpart....

  14. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

  15. Different methods to alter surface morphology of high aspect ratio structures

    Energy Technology Data Exchange (ETDEWEB)

    Leber, M., E-mail: [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Shandhi, M.M.H. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Hogan, A. [Blackrock Microsystems, Salt Lake City, UT (United States); Solzbacher, F. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Bhandari, R.; Negi, S. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Blackrock Microsystems, Salt Lake City, UT (United States)


    Graphical abstract: Surface engineering of high aspect ratio silicon structures. - Highlights: • Multiple roughening techniques for high aspect ratio devices were investigated. • Modification of surface morphology of high aspect ratio silicon devices (1:15). • Decrease of 76% in impedance proves significant increase in surface area. - Abstract: In various applications such as neural prostheses or solar cells, there is a need to alter the surface morphology of high aspect ratio structures so that the real surface area is greater than geometrical area. The change in surface morphology enhances the devices functionality. One of the applications of altering the surface morphology is of neural implants such as the Utah electrode array (UEA) that communicate with single neurons by charge injection induced stimulation or by recording electrical neural signals. For high selectivity between single cells of the nervous system, the electrode surface area is required to be as small as possible, while the impedance is required to be as low as possible for good signal to noise ratios (SNR) during neural recording. For stimulation, high charge injection and charge transfer capacities of the electrodes are required, which increase with the electrode surface. Traditionally, researchers have worked with either increasing the roughness of the existing metallization (platinum grey, black) or other materials such as Iridium Oxide and PEDOT. All of these previously investigated methods lead to more complicated metal deposition processes that are difficult to control and often have a critical impact on the mechanical properties of the metal films. Therefore, a modification of the surface underneath the electrode's coating will increase its surface area while maintaining the standard and well controlled metal deposition process. In this work, the surfaces of the silicon micro-needles were engineered by creating a defined microstructure on the electrodes surface using several

  16. Hip-Hop to Health Jr. Randomized Effectiveness Trial (United States)

    Kong, Angela; Buscemi, Joanna; Stolley, Melinda R.; Schiffer, Linda A.; Kim, Yoonsang; Braunschweig, Carol L.; Gomez-Perez, Sandra L.; Blumstein, Lara B.; Van Horn, Linda; Dyer, Alan R.; Fitzgibbon, Marian L.


    Introduction The preschool years provide a unique window of opportunity to intervene on obesity-related lifestyle risk factors during the formative years of a child’s life. The purpose of this study was to assess the impact of a preschool-based obesity prevention effectiveness trial at 1-year follow-up. Design RCT. Settings/participants Primarily African American children (aged 3–5 years, N=618) attending Head Start preschool programs administered by Chicago Public Schools. Methods Eighteen preschools were randomly assigned in 2007–2008 to receive either: (1) a 14-week teacher-delivered intervention focused on healthy lifestyle behaviors; or (2) a 14-week teacher-delivered general health curriculum (control group). Main outcome measures The primary outcome, BMI, was measured at baseline, post-intervention, and 1-year follow-up. Diet and screen time behaviors were also assessed at these time points. Multilevel mixed effects models were used to test for between-group differences. Data were analyzed in 2014. Results Significant between-group differences were observed in diet, but not in BMI z-score or screen time at 1-year follow-up. Diet differences favored the intervention arm over controls in overall diet quality (p=0.02) and in subcomponents of diet quality, as measured by the Healthy Eating Index-2005, and in fruit intake (servings/day, excludes juice) (p=0.02). Diet quality worsened more among controls than the intervention group at 1-year follow-up. Conclusions The adaptation of Hip-Hop to Health Jr. produced modest benefits in diet quality, but did not significantly impact weight gain trajectory. Not unlike other effectiveness trials, this real-world version delivered by Head Start teachers produced fewer benefits than the more rigorous efficacy trial. It is important to understand and build upon the lessons learned from these types of trials so that we can design, implement, and disseminate successful evidence-based programs more widely and effectively

  17. Facile method to fabricate raspberry-like particulate films for superhydrophobic surfaces. (United States)

    Tsai, Hui-Jung; Lee, Yuh-Lang


    A facile method using layer-by-layer assembly of silica particles is proposed to prepare raspberry-like particulate films for the fabrication of superhydrophobic surfaces. Silica particles 0.5 microm in diameter were used to prepare a surface with a microscale roughness. Nanosized silica particles were then assembled on the particulate film to construct a finer structure on top of the coarse one. After surface modification with dodecyltrichlorosilane, the advancing and receding contact angles of water on the dual-sized structured surface were 169 and 165 degrees , respectively. The scale ratio of the micro/nano surface structure and the regularity of the particulate films on the superhydrophobic surface performance are discussed.

  18. Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

    Directory of Open Access Journals (Sweden)

    A. Lorenzana


    Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

  19. MCBT: Multi-Hop Cluster Based Stable Backbone Trees for Data Collection and Dissemination in WSNs

    Directory of Open Access Journals (Sweden)

    Tae-Jin Lee


    Full Text Available We propose a stable backbone tree construction algorithm using multi-hop clusters for wireless sensor networks (WSNs. The hierarchical cluster structure has advantages in data fusion and aggregation. Energy consumption can be decreased by managing nodes with cluster heads. Backbone nodes, which are responsible for performing and managing multi-hop communication, can reduce the communication overhead such as control traffic and minimize the number of active nodes. Previous backbone construction algorithms, such as Hierarchical Cluster-based Data Dissemination (HCDD and Multicluster, Mobile, Multimedia radio network (MMM, consume energy quickly. They are designed without regard to appropriate factors such as residual energy and degree (the number of connections or edges to other nodes of a node for WSNs. Thus, the network is quickly disconnected or has to reconstruct a backbone. We propose a distributed algorithm to create a stable backbone by selecting the nodes with higher energy or degree as the cluster heads. This increases the overall network lifetime. Moreover, the proposed method balances energy consumption by distributing the traffic load among nodes around the cluster head. In the simulation, the proposed scheme outperforms previous clustering schemes in terms of the average and the standard deviation of residual energy or degree of backbone nodes, the average residual energy of backbone nodes after disseminating the sensed data, and the network lifetime.

  20. Development and application of QM/MM methods to study the solvation effects and surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Dibya, Pooja Arora [Iowa State Univ., Ames, IA (United States)


    Quantum mechanical (QM) calculations have the advantage of attaining high-level accuracy, however QM calculations become computationally inefficient as the size of the system grows. Solving complex molecular problems on large systems and ensembles by using quantum mechanics still poses a challenge in terms of the computational cost. Methods that are based on classical mechanics are an inexpensive alternative, but they lack accuracy. A good trade off between accuracy and efficiency is achieved by combining QM methods with molecular mechanics (MM) methods to use the robustness of the QM methods in terms of accuracy and the MM methods to minimize the computational cost. Two types of QM combined with MM (QM/MM) methods are the main focus of the present dissertation: the application and development of QM/MM methods for solvation studies and reactions on the Si(100) surface. The solvation studies were performed using a discreet solvation model that is largely based on first principles called the effective fragment potential method (EFP). The main idea of combining the EFP method with quantum mechanics is to accurately treat the solute-solvent and solvent-solvent interactions, such as electrostatic, polarization, dispersion and charge transfer, that are important in correctly calculating solvent effects on systems of interest. A second QM/MM method called SIMOMM (surface integrated molecular orbital molecular mechanics) is a hybrid QM/MM embedded cluster model that mimics the real surface.3 This method was employed to calculate the potential energy surfaces for reactions of atomic O on the Si(100) surface. The hybrid QM/MM method is a computationally inexpensive approach for studying reactions on larger surfaces in a reasonably accurate and efficient manner. This thesis is comprised of four chapters: Chapter 1 describes the general overview and motivation of the dissertation and gives a broad background of the computational methods that have been employed in this work

  1. Reliability-based design optimization via high order response surface method

    International Nuclear Information System (INIS)

    Li, Hong Shuang


    To reduce the computational effort of reliability-based design optimization (RBDO), the response surface method (RSM) has been widely used to evaluate reliability constraints. We propose an efficient methodology for solving RBDO problems based on an improved high order response surface method (HORSM) that takes advantage of an efficient sampling method, Hermite polynomials and uncertainty contribution concept to construct a high order response surface function with cross terms for reliability analysis. The sampling method generates supporting points from Gauss-Hermite quadrature points, which can be used to approximate response surface function without cross terms, to identify the highest order of each random variable and to determine the significant variables connected with point estimate method. The cross terms between two significant random variables are added to the response surface function to improve the approximation accuracy. Integrating the nested strategy, the improved HORSM is explored in solving RBDO problems. Additionally, a sampling based reliability sensitivity analysis method is employed to reduce the computational effort further when design variables are distributional parameters of input random variables. The proposed methodology is applied on two test problems to validate its accuracy and efficiency. The proposed methodology is more efficient than first order reliability method based RBDO and Monte Carlo simulation based RBDO, and enables the use of RBDO as a practical design tool.

  2. Method and apparatus for reducing the drag of flows over surfaces (United States)

    Keefe, Laurence R. (Inventor)


    An apparatus, and its accompanying method, for reducing the drag of flows over a surface includes arrays of small disks and sensors. The arrays are embedded in the surface and may extend above, or be depressed below, the surface, provided they remain hydraulically smooth either when operating or when inactive. The disks are arranged in arrays of various shapes, and spaced according to the cruising speed of the vehicle on which the arrays are installed. For drag reduction at speeds of the order of 30 meters/second, preferred embodiments include disks that are 0.2 millimeter in diameter and spaced 0.4 millimeter apart. For drag reduction at speeds of the order of 300 meters/second, preferred embodiments include disks that are 0.045 millimeter in diameter and spaced 0.09 millimeter apart. Smaller and larger dimensions for diameter and spacing are also possible. The disks rotate in the plane of the surface, with their rotation axis substantially perpendicular to the surface. The rotating disks produce velocity perturbations parallel to the surface in the overlying boundary layer. The sensors sense the flow at the surface and connect to control circuitry that adjusts the rotation rates and duty cycles of the disks accordingly. Suction and blowing holes can be interspersed among, or made coaxial with, the disks for creating general three-component velocity perturbations in the near-surface region. The surface can be a flat, planar surface or a nonplanar surface, such as a triangular riblet surface. The present apparatus and method have potential applications in the field of aeronautics for improving performance and efficiency of commercial and military aircraft, and in other industries where drag is an obstacle, including gas and oil delivery through long-haul pipelines.

  3. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh


    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  4. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna


    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...... is less of an alternative public sphere and more a way of articulating and contextualizing the world in a specific locality, which produces connections and opportunities in the young rappers’ lives....

  5. Savage Vernacular: Performing Race, Memory, and Hip Hop in Filipino America


    Villegas, Mark


    By observing and analyzing live performances, music, visual art, interviews, television shows, and online discourse, this dissertation traces the ways in which Filipino American hip hop performance remembers the racialized histories of the Filipino body. Through both quotidian and spectacular performances in hip hop, Filipino Americans have been contributing to crucial forms of knowledge that help unpack the terms of Filipino and American culture. Hip hop culture, I argue, operates as a produ...

  6. Development of autoradiographic method for measuring sorption of radionuclides on natural fracture surfaces

    International Nuclear Information System (INIS)

    Muuronen, S.


    On the basis of positive results about sorption of radionuclides in rock thin sections an autoradiographic method applicable for measurement sorption of radionuclides on rough rock surfaces was developed. There is no method available because 1) a plane film cannot be used because due to the roughness of rock surfaces 2) rock samples used in this investigation cannot be studied with microscopes and 3) autoradiogram cannot be studied fixed on the surface of a rock sample because the colours of the minerals in the sample will interfere with the interpretation. This report discusses experimental work done to find an useful proedure. In the development of the method main emphasis was put on investigation of the following steps: 1) preparation of the sample for equilibration and spiking; 2) properties of the covering paint for the rock surface and 3) testing of autoradiographic methods using different nuclear emulsions. As the result of these experiments promising autoradiograms with gel emulsion for sawed rock surfaces and with stripping film for rough rock surfaces were obtained. The mineralogic disribution of sorbed activity is easily seen in autoradiograms. Much work must still be done to get reliable quantitative information from autoradiograms. For developing of the autoradiographic method sawed plane rock samples of quartz feldspar intergrowth, pegmatite and limestone were used. In addition core samples of tonalite and mica gneiss from Olkiluoto were utilized. The distribution coefficients (Ksub(a)) obtained for cesium were 560 x 10 -4 and 620 x 10 -4 m 3 /m 2 for tonalite and mica gneiss, respectively. The results are little higher but of the same order of magnitude as obtained by the autoradiographic method using rock thin sections and by the batch method using crused samples. The natural fracture surface sorption study is a logical step in determining the scaling factor from laboratory to field studies. Field data will be needed to determine whether laboratory

  7. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods. (United States)

    Li, Xiaofan; Nie, Qing


    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  8. Self-cleaning Foliar Surfaces Characterization using RIMAPS Technique and Variogram Method

    International Nuclear Information System (INIS)

    Rosi, Pablo E.


    Along the last ten years many important studies about characterization of self-cleaning foliar surfaces have been done and focused new interest on this kind of surfaces.These studies were possible due to the development of a novel preparation technique for this biological material that let us observe the delicate structures of a foliar surface under scanning electron microscope (S.E.M.).This technique consists of replacing the natural water of the specimen by glycerol. Digital S.E.M. images from both self-cleaning and non-self-cleaning foliar surfaces were obtained and analyzed using RIMAPS technique and Variograms method. Our results revealed the existence of a common and exclusive geometrical pattern that is found in species which present self-cleaning foliar surfaces.This pattern combines at least nine different directions.The results from the Variograms method showed that the stomata play a key role in the determination of foliar surface roughness. In addition, spectra from RIMAPS technique constitute a fingerprint of a foliar surface so they can be used to find evolutionary relationships among species.Further studies will provide more detailed information to fully elucidate the self-cleaning pattern, so it might be possible to reproduce it on an artificial surface and make it self-cleaning

  9. Pre-absorbed immunoproteomics: a novel method for the detection of Streptococcus suis surface proteins.

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    Full Text Available Streptococcus suis serotype 2 (SS2 is a zoonotic pathogen that can cause infections in pigs and humans. Bacterial surface proteins are often investigated as potential vaccine candidates and biomarkers of virulence. In this study, a novel method for identifying bacterial surface proteins is presented, which combines immunoproteomic and immunoserologic techniques. Critical to the success of this new method is an improved procedure for generating two-dimensional electrophoresis gel profiles of S. suis proteins. The S. suis surface proteins identified in this study include muramidase-released protein precursor (MRP and an ABC transporter protein, while MRP is thought to be one of the main virulence factors in SS2 located on the bacterial surface. Herein, we demonstrate that the ABC transporter protein can bind to HEp-2 cells, which strongly suggests that this protein is located on the bacterial cell surface and may be involved in pathogenesis. An immunofluorescence assay confirmed that the ABC transporter is localized to the bacterial outer surface. This new method may prove to be a useful tool for identifying surface proteins, and aid in the development of new vaccine subunits and disease diagnostics.

  10. An experimental method to determine the electrostatic field enhancement factor of a practical conductor surface

    DEFF Research Database (Denmark)

    McAllister, Iain Wilson; Crichton, George C


    A method of determining the field enhancement factor of a practical conductor is presented. The method is developed from a modified theory of discharge onset in a gaseous medium. This modification incorporates the influence of conductor surface roughness. Onset data from an experimental study...

  11. Pseudo forward ray-tracing: A new method for surface validation in cornea topography

    NARCIS (Netherlands)

    Sicam, V.; Snellenburg, J.J.; van der Heijde, R.G.; van Stokkum, I.H.M.


    PURPOSE. A pseudo forward ray-tracing (PFRT) algorithm is developed to evaluate surface reconstruction in corneal topography. The method can be applied to topographers where one-to-one correspondence between mire and image points can be established. METHODS. The PFRT algorithm was applied on a

  12. A surface capturing method for the efficient computation of steady water waves

    NARCIS (Netherlands)

    Wackers, J.; Koren, B.


    A surface capturing method is developed for the computation of steady water–air flow with gravity. Fluxes are based on artificial compressibility and the method is solved with a multigrid technique and line Gauss–Seidel smoother. A test on a channel flow with a bottom bump shows the accuracy of the

  13. Analyzing containment leakage from a sodium fire by the response surface method

    International Nuclear Information System (INIS)

    Person, L.W.


    The SPOOL-FIRE code has been used with the response surface method and a Monte Carlo simulation to study sodium fire accidents. The study provides a simple method of estimating the radioactive release via containment leakage; the sensitivity of the output consequences to the variations in the input parameters is also presented

  14. Study of the possibilities of using nuclear methods for characterizing the surface region of glasses

    International Nuclear Information System (INIS)

    Hsiung, P.


    Following a review of the different methods used for the analysis of surfaces, we give a detailed description of charged particle elastic backscattering and the experimental devices. We then apply this method to the study of the lixiviation of borosilicate glasses in aqueous media and to the characterization of two heavy elements, cerium and thorium and their possible interaction in simple borosilicates [fr

  15. A Multi-Hop Energy Neutral Clustering Algorithm for Maximizing Network Information Gathering in Energy Harvesting Wireless Sensor Networks. (United States)

    Yang, Liu; Lu, Yinzhi; Zhong, Yuanchang; Wu, Xuegang; Yang, Simon X


    Energy resource limitation is a severe problem in traditional wireless sensor networks (WSNs) because it restricts the lifetime of network. Recently, the emergence of energy harvesting techniques has brought with them the expectation to overcome this problem. In particular, it is possible for a sensor node with energy harvesting abilities to work perpetually in an Energy Neutral state. In this paper, a Multi-hop Energy Neutral Clustering (MENC) algorithm is proposed to construct the optimal multi-hop clustering architecture in energy harvesting WSNs, with the goal of achieving perpetual network operation. All cluster heads (CHs) in the network act as routers to transmit data to base station (BS) cooperatively by a multi-hop communication method. In addition, by analyzing the energy consumption of intra- and inter-cluster data transmission, we give the energy neutrality constraints. Under these constraints, every sensor node can work in an energy neutral state, which in turn provides perpetual network operation. Furthermore, the minimum network data transmission cycle is mathematically derived using convex optimization techniques while the network information gathering is maximal. Simulation results show that our protocol can achieve perpetual network operation, so that the consistent data delivery is guaranteed. In addition, substantial improvements on the performance of network throughput are also achieved as compared to the famous traditional clustering protocol LEACH and recent energy harvesting aware clustering protocols.

  16. A Large-Scale Multi-Hop Localization Algorithm Based on Regularized Extreme Learning for Wireless Networks. (United States)

    Zheng, Wei; Yan, Xiaoyong; Zhao, Wei; Qian, Chengshan


    A novel large-scale multi-hop localization algorithm based on regularized extreme learning is proposed in this paper. The large-scale multi-hop localization problem is formulated as a learning problem. Unlike other similar localization algorithms, the proposed algorithm overcomes the shortcoming of the traditional algorithms which are only applicable to an isotropic network, therefore has a strong adaptability to the complex deployment environment. The proposed algorithm is composed of three stages: data acquisition, modeling and location estimation. In data acquisition stage, the training information between nodes of the given network is collected. In modeling stage, the model among the hop-counts and the physical distances between nodes is constructed using regularized extreme learning. In location estimation stage, each node finds its specific location in a distributed manner. Theoretical analysis and several experiments show that the proposed algorithm can adapt to the different topological environments with low computational cost. Furthermore, high accuracy can be achieved by this method without setting complex parameters.

  17. A Multi-Hop Energy Neutral Clustering Algorithm for Maximizing Network Information Gathering in Energy Harvesting Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Liu Yang


    Full Text Available Energy resource limitation is a severe problem in traditional wireless sensor networks (WSNs because it restricts the lifetime of network. Recently, the emergence of energy harvesting techniques has brought with them the expectation to overcome this problem. In particular, it is possible for a sensor node with energy harvesting abilities to work perpetually in an Energy Neutral state. In this paper, a Multi-hop Energy Neutral Clustering (MENC algorithm is proposed to construct the optimal multi-hop clustering architecture in energy harvesting WSNs, with the goal of achieving perpetual network operation. All cluster heads (CHs in the network act as routers to transmit data to base station (BS cooperatively by a multi-hop communication method. In addition, by analyzing the energy consumption of intra- and inter-cluster data transmission, we give the energy neutrality constraints. Under these constraints, every sensor node can work in an energy neutral state, which in turn provides perpetual network operation. Furthermore, the minimum network data transmission cycle is mathematically derived using convex optimization techniques while the network information gathering is maximal. Simulation results show that our protocol can achieve perpetual network operation, so that the consistent data delivery is guaranteed. In addition, substantial improvements on the performance of network throughput are also achieved as compared to the famous traditional clustering protocol LEACH and recent energy harvesting aware clustering protocols.

  18. Organogenic nodule formation in hop: a tool to study morphogenesis in plants with biotechnological and medicinal applications. (United States)

    Fortes, Ana M; Santos, Filipa; Pais, Maria S


    The usage of Humulus lupulus for brewing increased the demand for high-quality plant material. Simultaneously, hop has been used in traditional medicine and recently recognized with anticancer and anti-infective properties. Tissue culture techniques have been reported for a wide range of species, and open the prospect for propagation of disease-free, genetically uniform and massive amounts of plants in vitro. Moreover, the development of large-scale culture methods using bioreactors enables the industrial production of secondary metabolites. Reliable and efficient tissue culture protocol for shoot regeneration through organogenic nodule formation was established for hop. The present review describes the histological, and biochemical changes occurring during this morphogenic process, together with an analysis of transcriptional and metabolic profiles. We also discuss the existence of common molecular factors among three different morphogenic processes: organogenic nodules and somatic embryogenesis, which strictly speaking depend exclusively on intrinsic developmental reprogramming, and legume nitrogen-fixing root nodules, which arises in response to symbiosis. The review of the key factors that participate in hop nodule organogenesis and the comparison with other morphogenic processes may have merit as a study presenting recent advances in complex molecular networks occurring during morphogenesis and together, these provide a rich framework for biotechnology applications.

  19. An adaptive finite element method for simulating surface tension with the gradient theory of fluid interfaces

    KAUST Repository

    Kou, Jisheng; Sun, Shuyu


    The gradient theory for the surface tension of simple fluids and mixtures is rigorously analyzed based on mathematical theory. The finite element approximation of surface tension is developed and analyzed, and moreover, an adaptive finite element method based on a physical-based estimator is proposed and it can be coupled efficiently with Newton's method as well. The numerical tests are carried out both to verify the proposed theory and to demonstrate the efficiency of the proposed method. © 2013 Elsevier B.V. All rights reserved.

  20. An adaptive finite element method for simulating surface tension with the gradient theory of fluid interfaces

    KAUST Repository

    Kou, Jisheng


    The gradient theory for the surface tension of simple fluids and mixtures is rigorously analyzed based on mathematical theory. The finite element approximation of surface tension is developed and analyzed, and moreover, an adaptive finite element method based on a physical-based estimator is proposed and it can be coupled efficiently with Newton\\'s method as well. The numerical tests are carried out both to verify the proposed theory and to demonstrate the efficiency of the proposed method. © 2013 Elsevier B.V. All rights reserved.

  1. Facile method to stain the bacterial cell surface for super-resolution fluorescence microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Gunsolus, Ian L.; Hu, Dehong; Mihai, Cosmin; Lohse, Samuel E.; Lee, Chang-Soo; Torelli, Marco; Hamers, Robert J.; Murphy, Catherine; Orr, Galya; Haynes, Christy L.


    A method to fluorescently stain the surfaces of both Gram-negative and Gram-positive bacterial cells compatible with super-resolution fluorescence microscopy is presented. This method utilizes a commercially-available fluorescent probe to label primary amines at the surface of the cell. We demonstrate efficient staining of two bacterial strains, the Gram-negative Shewanella oneidensis MR-1 and the Gram-positive Bacillus subtilis 168. Using structured illumination microscopy and stochastic optical reconstruction microscopy, which require high quantum yield or specialized dyes, we show that this staining method may be used to resolve the bacterial cell surface with sub-diffraction-limited resolution. We further use this method to identify localization patterns of nanomaterials, specifically cadmium selenide quantum dots, following interaction with bacterial cells.

  2. Bone surface enhancement in ultrasound images using a new Doppler-based acquisition/processing method (United States)

    Yang, Xu; Tang, Songyuan; Tasciotti, Ennio; Righetti, Raffaella


    Ultrasound (US) imaging has long been considered as a potential aid in orthopedic surgeries. US technologies are safe, portable and do not use radiations. This would make them a desirable tool for real-time assessment of fractures and to monitor fracture healing. However, image quality of US imaging methods in bone applications is limited by speckle, attenuation, shadow, multiple reflections and other imaging artifacts. While bone surfaces typically appear in US images as somewhat ‘brighter’ than soft tissue, they are often not easily distinguishable from the surrounding tissue. Therefore, US imaging methods aimed at segmenting bone surfaces need enhancement in image contrast prior to segmentation to improve the quality of the detected bone surface. In this paper, we present a novel acquisition/processing technique for bone surface enhancement in US images. Inspired by elastography and Doppler imaging methods, this technique takes advantage of the difference between the mechanical and acoustic properties of bones and those of soft tissues to make the bone surface more easily distinguishable in US images. The objective of this technique is to facilitate US-based bone segmentation methods and improve the accuracy of their outcomes. The newly proposed technique is tested both in in vitro and in vivo experiments. The results of these preliminary experiments suggest that the use of the proposed technique has the potential to significantly enhance the detectability of bone surfaces in noisy ultrasound images.

  3. Bone surface enhancement in ultrasound images using a new Doppler-based acquisition/processing method. (United States)

    Yang, Xu; Tang, Songyuan; Tasciotti, Ennio; Righetti, Raffaella


    Ultrasound (US) imaging has long been considered as a potential aid in orthopedic surgeries. US technologies are safe, portable and do not use radiations. This would make them a desirable tool for real-time assessment of fractures and to monitor fracture healing. However, image quality of US imaging methods in bone applications is limited by speckle, attenuation, shadow, multiple reflections and other imaging artifacts. While bone surfaces typically appear in US images as somewhat 'brighter' than soft tissue, they are often not easily distinguishable from the surrounding tissue. Therefore, US imaging methods aimed at segmenting bone surfaces need enhancement in image contrast prior to segmentation to improve the quality of the detected bone surface. In this paper, we present a novel acquisition/processing technique for bone surface enhancement in US images. Inspired by elastography and Doppler imaging methods, this technique takes advantage of the difference between the mechanical and acoustic properties of bones and those of soft tissues to make the bone surface more easily distinguishable in US images. The objective of this technique is to facilitate US-based bone segmentation methods and improve the accuracy of their outcomes. The newly proposed technique is tested both in in vitro and in vivo experiments. The results of these preliminary experiments suggest that the use of the proposed technique has the potential to significantly enhance the detectability of bone surfaces in noisy ultrasound images.

  4. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes (United States)

    Wu, Yahui; Deng, Su; Huang, Hongbin


    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

  5. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    International Nuclear Information System (INIS)

    Wu, Yahui; Deng, Su; Huang, Hongbin


    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

  6. Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests. (United States)

    Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E


    Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

  7. Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)* (United States)

    He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny


    Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

  8. Hip-hop as a resource for understanding the urban context (United States)

    Brown, Bryan


    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  9. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health. (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia


    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  10. Comparison of the surface wave method and the indentation method for measuring the elasticity of gelatin phantoms of different concentrations. (United States)

    Zhang, Xiaoming; Qiang, Bo; Greenleaf, James


    The speed of the surface Rayleigh wave, which is related to the viscoelastic properties of the medium, can be measured by noninvasive and noncontact methods. This technique has been applied in biomedical applications such as detecting skin diseases. Static spherical indentation, which quantifies material elasticity through the relationship between loading force and displacement, has been applied in various areas including a number of biomedical applications. This paper compares the results obtained from these two methods on five gelatin phantoms of different concentrations (5%, 7.5%, 10%, 12.5% and 15%). The concentrations are chosen because the elasticity of such gelatin phantoms is close to that of tissue types such as skin. The results show that both the surface wave method and the static spherical indentation method produce the same values for shear elasticity. For example, the shear elasticities measured by the surface wave method are 1.51, 2.75, 5.34, 6.90 and 8.40kPa on the five phantoms, respectively. In addition, by studying the dispersion curve of the surface wave speed, shear viscosity can be extracted. The measured shear viscosities are 0.00, 0.00, 0.13, 0.39 and 1.22Pa.s on the five phantoms, respectively. The results also show that the shear elasticity of the gelatin phantoms increases linearly with their prepared concentrations. The linear regressions between concentration and shear elasticity have R(2) values larger than 0.98 for both methods. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Evaluating polymer degradation with complex mixtures using a simplified surface area method. (United States)

    Steele, Kandace M; Pelham, Todd; Phalen, Robert N


    Chemical-resistant gloves, designed to protect workers from chemical hazards, are made from a variety of polymer materials such as plastic, rubber, and synthetic rubber. One material does not provide protection against all chemicals, thus proper polymer selection is critical. Standardized testing, such as chemical degradation tests, are used to aid in the selection process. The current methods of degradation ratings based on changes in weight or tensile properties can be expensive and data often do not exist for complex chemical mixtures. There are hundreds of thousands of chemical products on the market that do not have chemical resistance data for polymer selection. The method described in this study provides an inexpensive alternative to gravimetric analysis. This method uses surface area change to evaluate degradation of a polymer material. Degradation tests for 5 polymer types against 50 complex mixtures were conducted using both gravimetric and surface area methods. The percent change data were compared between the two methods. The resulting regression line was y = 0.48x + 0.019, in units of percent, and the Pearson correlation coefficient was r = 0.9537 (p ≤ 0.05), which indicated a strong correlation between percent weight change and percent surface area change. On average, the percent change for surface area was about half that of the weight change. Using this information, an equivalent rating system was developed for determining the chemical degradation of polymer gloves using surface area.

  12. Effects of storage methods on time-related changes of titanium surface properties and cellular response

    International Nuclear Information System (INIS)

    Lu Haibin; Zhou Lei; Wan Lei; Li Shaobing; Rong Mingdeng; Guo Zehong


    Titanium implants are sold in the market as storable medical devices. All the implants have a certain shelf life during which they maintain their sterility, but variations of the surface properties through this duration have not been subject to a comprehensive assessment. The aim of this study was to investigate the effects of storage methods on time-related changes of titanium surface properties. Acid-etched titanium discs (Sa = 0.82 µm) were placed in a sealed container (tradition method) or submerged in the ddH 2 O/NaCl solution (0.15 mol L −1 )/CaCl 2 solution (0.15 mol L −1 ), and new titanium discs were used as a control group. SEM and optical profiler showed that surface morphology and roughness did not change within different groups, but the XPS analysis confirmed that the surface chemistry altered by different storage protocols as the storage duration increased, and the contact angle also varied with storage methods. The storage method also affected the protein adsorption capacity and cellular response on the titanium surface. All titanium discs stored in the solution maintained their excellent bioactivity even after four weeks storage time, but titanium discs stored in a traditional manner decreased substantially in an age-dependent manner. Much effort is needed to improve the storage methods in order to maintain the bioactivity of a titanium dental implant. (paper)

  13. An Improved Local Gradient Method for Sea Surface Wind Direction Retrieval from SAR Imagery

    Directory of Open Access Journals (Sweden)

    Lizhang Zhou


    Full Text Available Sea surface wind affects the fluxes of energy, mass and momentum between the atmosphere and ocean, and therefore regional and global weather and climate. With various satellite microwave sensors, sea surface wind can be measured with large spatial coverage in almost all-weather conditions, day or night. Like any other remote sensing measurements, sea surface wind measurement is also indirect. Therefore, it is important to develop appropriate wind speed and direction retrieval models for different types of microwave instruments. In this paper, a new sea surface wind direction retrieval method from synthetic aperture radar (SAR imagery is developed. In the method, local gradients are computed in frequency domain by combining the operation of smoothing and computing local gradients in one step to simplify the process and avoid the difference approximation. This improved local gradients (ILG method is compared with the traditional two-dimensional fast Fourier transform (2D FFT method and local gradients (LG method, using interpolating wind directions from the European Centre for Medium-Range Weather Forecast (ECMWF reanalysis data and the Cross-Calibrated Multi-Platform (CCMP wind vector product. The sensitivities to the salt-and-pepper noise, the additive noise and the multiplicative noise are analyzed. The ILG method shows a better performance of retrieval wind directions than the other two methods.

  14. Prediction of surface tension of binary mixtures with the parachor method

    Directory of Open Access Journals (Sweden)

    Němec Tomáš


    Full Text Available The parachor method for the estimation of the surface tension of binary mixtures is modified by considering temperature-dependent values of the parachor parameters. The temperature dependence is calculated by a least-squares fit of pure-solvent surface tension data to the binary parachor equation utilizing the Peng-Robinson equation of state for the calculation of equilibrium densities. A very good agreement between experimental binary surface tension data and the predictions of the modified parachor method are found for the case of the mixtures of carbon dioxide and butane, benzene, and cyclohexane, respectively. The surface tension is also predicted for three refrigerant mixtures, i.e. propane, isobutane, and chlorodifluoromethane, with carbon dioxide.

  15. Methods for growth of relatively large step-free SiC crystal surfaces (United States)

    Neudeck, Philip G. (Inventor); Powell, J. Anthony (Inventor)


    A method for growing arrays of large-area device-size films of step-free (i.e., atomically flat) SiC surfaces for semiconductor electronic device applications is disclosed. This method utilizes a lateral growth process that better overcomes the effect of extended defects in the seed crystal substrate that limited the obtainable step-free area achievable by prior art processes. The step-free SiC surface is particularly suited for the heteroepitaxial growth of 3C (cubic) SiC, AlN, and GaN films used for the fabrication of both surface-sensitive devices (i.e., surface channel field effect transistors such as HEMT's and MOSFET's) as well as high-electric field devices (pn diodes and other solid-state power switching devices) that are sensitive to extended crystal defects.

  16. The impact of accelerometer mounting methods on the level of vibrations recorded at ground surface

    Directory of Open Access Journals (Sweden)

    Krzysztof Czech


    Full Text Available The paper presents the results of field research based on the measurements of accelerations recorded at ground surface. The source of the vibration characterized by high repetition rate of pulse parameters was light falling weight deflectometer ZFG-01. Measurements of vibrations have been carried out using top quality high-precision measuring system produced by Brüel&Kiær. Accelerometers were mounted on a sandy soil surface at the measuring points located radially at 5-m and 10-m distances from the source of vibration. The paper analyses the impact that the method of mounting accelerometers on the ground has on the level of the recorded values of accelerations of vibrations. It has been shown that the method of attaching the sensor to the surface of the ground is crucial for the credibility of the performed measurements.[b]Keywords[/b]: geotechnics, surface vibrations, ground, vibration measurement

  17. Analysis of WEDM Process Parameters on Surface Roughness and Kerf using Taguchi Method

    Directory of Open Access Journals (Sweden)

    Asfana Banu


    Full Text Available In obtaining the best quality of engineering parts, the quality of machined surface plays an essential role. The fatigue strength, wear resistance, and corrosion of workpiece are some of the aspects of the qualities that can be improved. This paper investigates the effect of wire electrical discharge machining (WEDM process parameters on surface roughness and kerf on stainless steel using distilled water as dielectric fluid and brass wire as tool electrode. The selected process parameters are voltage open, wire speed, wire tension, voltage gap, and off time. Empirical models using Taguchi method were developed for the estimation of surface roughness and kerf. The analysis revealed that off time has major influence on surface roughness and kerf. The optimum machining parameters for minimum surface roughness and kerf were found to be 10 V open voltage, 2.84 µs off time, 12 m/min wire speed, 6.3 N wire tension, and 54.91 V voltage gap.

  18. Effects of various debonding and adhesive clearance methods on enamel surface: an in vitro study


    Fan, Xiao-Chuan; Chen, Li; Huang, Xiao-Feng


    Background The purpose of this study was to evaluate orthodontic debonding methods by comparing the surface roughness and enamel morphology of teeth after applying two different debonding methods and three different polishing techniques. Methods Forty eight human maxillary premolars, extracted for orthodontic reasons, were randomly divided into three groups. Brackets were bonded to teeth with RMGIC (Fuji Ortho LC, GC, Tokyo, Japan) (two groups, n?=?18 each) after acid etching (30s), light cur...

  19. Surface states in crystals with low-index surfaces

    International Nuclear Information System (INIS)

    Wang Hui-Ping; Tao Rui-Bao


    For most of the conventional crystals with low-index surfaces, the hopping between the nearest neighbor (1NN) crystal planes (CPs) is dominant and the ones from the nNN (2 ≤ n < ∞) CPs are relatively weak, considered as small perturbations. The recent theoretical analysis [1] has demonstrated the absence of surface states at the level of the hopping approximation between the 1NN CPs when the original infinite crystal has the geometric reflection symmetry (GRS) for each CP. Meanwhile, based on the perturbation theory, it has also been shown that small perturbations from the hopping between the nNN (2 ≤ n < ∞) CPs and surface relaxation have no impact on the above conclusion. However, for the crystals with strong intrinsic spin-orbit coupling (SOC), the dominant terms of intrinsic SOC associate with two 1NN bond hoppings. Thus SOC will significantly contribute the hoppings from the 1NN and/or 2NN CPs except the ones within each CP. Here, we will study the effect of the hopping between the 2NN CPs on the surface states in model crystals with three different type structures (Type I: “···–P–P–P–P–···”, Type II: “···–P–Q–P–Q–···” and Type III: “···–P=Q–P=Q–···” where P and Q indicate CPs and the signs “−” and “=” mark the distance between the 1NN CPs). In terms of analytical and numerical calculations, we study the behavior of surface states in three types after the symmetric/asymmetric hopping from the 2NN CPs is added. We analytically prove that the symmetric hopping from the 2NN CPs cannot induce surface states in Type I when each CP has only one electron mode. The numerical calculations also provide strong support for the conclusion, even up to 5NN. However, in general, the coupling from the 2NN CPs (symmetric and asymmetric) is favorable to generate surface states except Type I with single electron mode only. (paper)

  20. Critical Assessment of the Surface Tension determined by the Maximum Pressure Bubble Method


    Benedetto, Franco Emmanuel; Zolotucho, Hector; Prado, Miguel Oscar


    The main factors that influence the value of surface tension of a liquid measured with the Maximum Pressure Bubble Method are critically evaluated. We present experimental results showing the effect of capillary diameter, capillary depth, bubble spheroidicity and liquid density at room temperature. We show that the decrease of bubble spheroidicity due to increase of capillary immersion depth is not sufficient to explain the deviations found in the measured surface tension values. Thus, we pro...