WorldWideScience

Sample records for surface hopping method

  1. Analysis of the trajectory surface hopping method from the Markov state model perspective

    International Nuclear Information System (INIS)

    Akimov, Alexey V.; Wang, Linjun; Prezhdo, Oleg V.; Trivedi, Dhara

    2015-01-01

    We analyze the applicability of the seminal fewest switches surface hopping (FSSH) method of Tully to modeling quantum transitions between electronic states that are not coupled directly, in the processes such as Auger recombination. We address the known deficiency of the method to describe such transitions by introducing an alternative definition for the surface hopping probabilities, as derived from the Markov state model perspective. We show that the resulting transition probabilities simplify to the quantum state populations derived from the time-dependent Schrödinger equation, reducing to the rapidly switching surface hopping approach of Tully and Preston. The resulting surface hopping scheme is simple and appeals to the fundamentals of quantum mechanics. The computational approach is similar to the FSSH method of Tully, yet it leads to a notably different performance. We demonstrate that the method is particularly accurate when applied to superexchange modeling. We further show improved accuracy of the method, when applied to one of the standard test problems. Finally, we adapt the derived scheme to atomistic simulation, combine it with the time-domain density functional theory, and show that it provides the Auger energy transfer timescales which are in good agreement with experiment, significantly improving upon other considered techniques. (author)

  2. On the inclusion of the diagonal Born-Oppenheimer correction in surface hopping methods

    Energy Technology Data Exchange (ETDEWEB)

    Gherib, Rami; Ryabinkin, Ilya G.; Izmaylov, Artur F. [Department of Physical and Environmental Sciences, University of Toronto Scarborough, Toronto, Ontario M1C 1A4 (Canada); Chemical Physics Theory Group, Department of Chemistry, University of Toronto, Toronto, Ontario M5S 3H6 (Canada); Ye, Liyuan [Department of Physical and Environmental Sciences, University of Toronto Scarborough, Toronto, Ontario M1C 1A4 (Canada)

    2016-04-21

    The diagonal Born-Oppenheimer correction (DBOC) stems from the diagonal second derivative coupling term in the adiabatic representation, and it can have an arbitrary large magnitude when a gap between neighbouring Born-Oppenheimer (BO) potential energy surfaces (PESs) is closing. Nevertheless, DBOC is typically neglected in mixed quantum-classical methods of simulating nonadiabatic dynamics (e.g., fewest-switch surface hopping (FSSH) method). A straightforward addition of DBOC to BO PESs in the FSSH method, FSSH+D, has been shown to lead to numerically much inferior results for models containing conical intersections. More sophisticated variation of the DBOC inclusion, phase-space surface-hopping (PSSH) was more successful than FSSH+D but on model problems without conical intersections. This work comprehensively assesses the role of DBOC in nonadiabatic dynamics of two electronic state problems and the performance of FSSH, FSSH+D, and PSSH methods in variety of one- and two-dimensional models. Our results show that the inclusion of DBOC can enhance the accuracy of surface hopping simulations when two conditions are simultaneously satisfied: (1) nuclei have kinetic energy lower than DBOC and (2) PESs are not strongly nonadiabatically coupled. The inclusion of DBOC is detrimental in situations where its energy scale becomes very high or even diverges, because in these regions PESs are also very strongly coupled. In this case, the true quantum formalism heavily relies on an interplay between diagonal and off-diagonal nonadiabatic couplings while surface hopping approaches treat diagonal terms as PESs and off-diagonal ones stochastically.

  3. Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2016-06-07

    Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

  4. Hops

    Science.gov (United States)

    ... deodorant that contains hops and a specific zinc salt to the underarm can reduce body odor. Insomnia. ... that applying a cream containing bladderwrack, English ivy, horse chestnut, gotu kola, butcher’s broom, horsetail, and hops ( ...

  5. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  6. Two-surface Monte Carlo with basin hopping: quantum mechanical trajectory and multiple stationary points of water cluster.

    Science.gov (United States)

    Bandyopadhyay, Pradipta

    2008-04-07

    The efficiency of the two-surface monte carlo (TSMC) method depends on the closeness of the actual potential and the biasing potential used to propagate the system of interest. In this work, it is shown that by combining the basin hopping method with TSMC, the efficiency of the method can be increased by several folds. TSMC with basin hopping is used to generate quantum mechanical trajectory and large number of stationary points of water clusters.

  7. Detailed balance, internal consistency, and energy conservation in fragment orbital-based surface hopping

    Science.gov (United States)

    Carof, Antoine; Giannini, Samuele; Blumberger, Jochen

    2017-12-01

    We have recently introduced an efficient semi-empirical non-adiabatic molecular dynamics method for the simulation of charge transfer/transport in molecules and molecular materials, denoted fragment orbital-based surface hopping (FOB-SH) [J. Spencer et al., J. Chem. Phys. 145, 064102 (2016)]. In this method, the charge carrier wavefunction is expanded in a set of charge localized, diabatic electronic states and propagated in the time-dependent potential due to classical nuclear motion. Here we derive and implement an exact expression for the non-adiabatic coupling vectors between the adiabatic electronic states in terms of nuclear gradients of the diabatic electronic states. With the non-adiabatic coupling vectors (NACVs) available, we investigate how different flavours of fewest switches surface hopping affect detailed balance, internal consistency, and total energy conservation for electron hole transfer in a molecular dimer with two electronic states. We find that FOB-SH satisfies detailed balance across a wide range of diabatic electronic coupling strengths provided that the velocities are adjusted along the direction of the NACV to satisfy total energy conservation upon a surface hop. This criterion produces the right fraction of energy-forbidden (frustrated) hops, which is essential for correct population of excited states, especially when diabatic couplings are on the order of the thermal energy or larger, as in organic semiconductors and DNA. Furthermore, we find that FOB-SH is internally consistent, that is, the electronic surface population matches the average quantum amplitudes, but only in the limit of small diabatic couplings. For large diabatic couplings, inconsistencies are observed as the decrease in excited state population due to frustrated hops is not matched by a corresponding decrease in quantum amplitudes. The derivation provided here for the NACV should be generally applicable to any electronic structure approach where the electronic

  8. Analytical methods for quantitation of prenylated flavonoids from hops

    Science.gov (United States)

    Nikolić, Dejan; van Breemen, Richard B.

    2013-01-01

    The female flowers of hops (Humulus lupulus L.) are used as a flavoring agent in the brewing industry. There is growing interest in possible health benefits of hops, particularly as estrogenic and chemopreventive agents. Among the possible active constituents, most of the attention has focused on prenylated flavonoids, which can chemically be classified as prenylated chalcones and prenylated flavanones. Among chalcones, xanthohumol (XN) and desmethylxanthohumol (DMX) have been the most studied, while among flavanones, 8-prenylnaringenin (8-PN) and 6-prenylnaringenin (6-PN) have received the most attention. Because of the interest in medicinal properties of prenylated flavonoids, there is demand for accurate, reproducible and sensitive analytical methods to quantify these compounds in various matrices. Such methods are needed, for example, for quality control and standardization of hop extracts, measurement of the content of prenylated flavonoids in beer, and to determine pharmacokinetic properties of prenylated flavonoids in animals and humans. This review summarizes currently available analytical methods for quantitative analysis of the major prenylated flavonoids, with an emphasis on the LC-MS and LC-MS-MS methods and their recent applications to biomedical research on hops. This review covers all methods in which prenylated flavonoids have been measured, either as the primary analytes or as a part of a larger group of analytes. The review also discusses methodological issues relating to the quantitative analysis of these compounds regardless of the chosen analytical approach. PMID:24077106

  9. Generalization of fewest-switches surface hopping for coherences

    Science.gov (United States)

    Tempelaar, Roel; Reichman, David R.

    2018-03-01

    Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

  10. SHARC: ab Initio Molecular Dynamics with Surface Hopping in the Adiabatic Representation Including Arbitrary Couplings.

    Science.gov (United States)

    Richter, Martin; Marquetand, Philipp; González-Vázquez, Jesús; Sola, Ignacio; González, Leticia

    2011-05-10

    We present a semiclassical surface-hopping method which is able to treat arbitrary couplings in molecular systems including all degrees of freedom. A reformulation of the standard surface-hopping scheme in terms of a unitary transformation matrix allows for the description of interactions like spin-orbit coupling or transitions induced by laser fields. The accuracy of our method is demonstrated in two systems. The first one, consisting of two model electronic states, validates the semiclassical approach in the presence of an electric field. In the second one, the dynamics in the IBr molecule in the presence of spin-orbit coupling after laser excitation is investigated. Due to an avoided crossing that originates from spin-orbit coupling, IBr dissociates into two channels: I + Br((2)P3/2) and I + Br*((2)P1/2). In both systems, the obtained results are in very good agreement with those calculated from exact quantum dynamical simulations.

  11. Low-coverage surface diffusion in complex periodic energy landscapes. II. Analytical solution for systems with asymmetric hops

    Science.gov (United States)

    Gosálvez, Miguel A.; Otrokov, Mikhail M.; Ferrando, Nestor; Ryabishchenkova, Anastasia G.; Ayuela, Andres; Echenique, Pedro M.; Chulkov, Evgueni V.

    2016-05-01

    This is part II in a series of two papers that introduce a general expression for the tracer diffusivity in complex, periodic energy landscapes with M distinct hop rates in one-, two-, and three-dimensional diluted systems (low coverage, single-tracer limit). While Part I [Gosálvez et al., Phys. Rev. B 93, 075429 (2016), 10.1103/PhysRevB.93.075429] focuses on the analysis of diffusion in systems where the end sites of the hops are located symmetrically with respect to the hop origins (symmetric hops), as encountered in many ideal surfaces and bulk materials, this report (Part II) presents a more general approach to determining the tracer diffusivity in systems where the end sites can be located asymmetrically with respect to the hop origins (asymmetric hops), as observed in reconstructed and/or chemically modified surfaces and/or bulk materials. The obtained diffusivity formulas for numerous systems are validated against kinetic Monte Carlo simulations and previously reported analytical expressions based on the continuous-time random walk (CTRW) method. The proposed method corrects some of the CTRW formulas and provides new expressions for difficult cases that have not been solved earlier. This demonstrates the ability of the proposed formalism to describe tracer diffusion.

  12. Path integral molecular dynamics with surface hopping for thermal equilibrium sampling of nonadiabatic systems.

    Science.gov (United States)

    Lu, Jianfeng; Zhou, Zhennan

    2017-04-21

    In this work, a novel ring polymer representation for a multi-level quantum system is proposed for thermal average calculations. The proposed representation keeps the discreteness of the electronic states: besides position and momentum, each bead in the ring polymer is also characterized by a surface index indicating the electronic energy surface. A path integral molecular dynamics with surface hopping (PIMD-SH) dynamics is also developed to sample the equilibrium distribution of the ring polymer configurational space. The PIMD-SH sampling method is validated theoretically and by numerical examples.

  13. Frequency Hopping Method for Audio Watermarking

    Directory of Open Access Journals (Sweden)

    A. Anastasijević

    2012-11-01

    Full Text Available This paper evaluates the degradation of audio content for a perceptible removable watermark. Two different approaches to embedding the watermark in the spectral domain were investigated. The frequencies for watermark embedding are chosen according to a pseudorandom sequence making the methods robust. Consequentially, the lower quality audio can be used for promotional purposes. For a fee, the watermark can be removed with a secret watermarking key. Objective and subjective testing was conducted in order to measure degradation level for the watermarked music samples and to examine residual distortion for different parameters of the watermarking algorithm and different music genres.

  14. Surface hopping, transition state theory and decoherence. I. Scattering theory and time-reversibility.

    Science.gov (United States)

    Jain, Amber; Herman, Michael F; Ouyang, Wenjun; Subotnik, Joseph E

    2015-10-07

    We provide an in-depth investigation of transmission coefficients as computed using the augmented-fewest switches surface hopping algorithm in the low energy regime. Empirically, microscopic reversibility is shown to hold approximately. Furthermore, we show that, in some circumstances, including decoherence on top of surface hopping calculations can help recover (as opposed to destroy) oscillations in the transmission coefficient as a function of energy; these oscillations can be studied analytically with semiclassical scattering theory. Finally, in the spirit of transition state theory, we also show that transmission coefficients can be calculated rather accurately starting from the curve crossing point and running trajectories forwards and backwards.

  15. Surface hopping dynamics of direct trans --> cis photoswitching of an azobenzene derivative in constrained adsorbate geometries

    Science.gov (United States)

    Floß, Gereon; Granucci, Giovanni; Saalfrank, Peter

    2012-12-01

    With ongoing miniaturization of electronic devices, the need for individually addressable, switchable molecules arises. An example are azobenzenes on surfaces which have been shown to be switchable between trans and cis forms. Here, we examine the "direct" (rather than substrate-mediated) channel of the trans → cis photoisomerization after ππ* excitation of tetra-tert-butyl-azobenzene physisorbed on surfaces mimicking Au(111) and Bi(111), respectively. In spirit of the direct channel, the electronic structure of the surface is neglected, the latter merely acting as a rigid platform which weakly interacts with the molecule via Van-der-Waals forces. Starting from thermal ensembles which represent the trans-form, sudden excitations promote the molecules to ππ*-excited states which are non-adiabatically coupled among themselves and to a nπ*-excited and the ground state, respectively. After excitation, relaxation to the ground state by internal conversion takes place, possibly accompanied by isomerization. The process is described here by "on the fly" semiclassical surface hopping dynamics in conjunction with a semiempirical Hamiltonian (AM1) and configuration-interaction type methods. It is found that steric constraints imposed by the substrate lead to reduced but non-vanishing, trans → cis reaction yields and longer internal conversion times than for the isolated molecule. Implications for recent experiments for azobenzenes on surfaces are discussed.

  16. An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping

    Science.gov (United States)

    Bai, Xin; Qiu, Jing; Wang, Linjun

    2018-03-01

    We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.

  17. Accelerated sampling by infinite swapping of path integral molecular dynamics with surface hopping

    Science.gov (United States)

    Lu, Jianfeng; Zhou, Zhennan

    2018-02-01

    To accelerate the thermal equilibrium sampling of multi-level quantum systems, the infinite swapping limit of a recently proposed multi-level ring polymer representation is investigated. In the infinite swapping limit, the ring polymer evolves according to an averaged Hamiltonian with respect to all possible surface index configurations of the ring polymer and thus connects the surface hopping approach to the mean-field path-integral molecular dynamics. A multiscale integrator for the infinite swapping limit is also proposed to enable efficient sampling based on the limiting dynamics. Numerical results demonstrate the huge improvement of sampling efficiency of the infinite swapping compared with the direct simulation of path-integral molecular dynamics with surface hopping.

  18. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai

    2012-10-01

    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  19. Ultra-high-performance liquid chromatography profiling method for chemical screening of proanthocyanidins in Czech hops.

    Science.gov (United States)

    Olšovská, J; Kameník, Z; Čejka, P; Jurková, M; Mikyška, A

    2013-11-15

    Hops represent an important natural source of bioactive polyphenols, particularly proanthocyanidins, which can contribute to prevention of several civilization diseases, owing to their antioxidant and radical scavenging activity. We have developed a high-throughput ultra-high-performance liquid chromatography time-of-flight mass spectrometry profiling method, which can be used for monitoring of bioactive proanthocyanidins in hops. The method was applied for analysis of hops of four Czech varieties (Saaz, Sladek, Preminat and Agnus) from the 2011 crop (9 localities, 11 samples) and the 2012 crop (24 localities, 40 samples). Hop samples were extracted by acetone and the analytes were separated on the Acquity UPLC BEH Shield RP18 column. Partial validation of the method revealed a satisfactory intra-day repeatability of the method for retention times (relative standard deviation within 1.39%) as well as areas under the peaks (within 9.89%). Experimental data were evaluated using principal component analysis and cluster analysis. Significant amounts of di-, tri- and tetramer proanthocyanidins consisting of (epi)catechin and (epi)gallocatechin were found in the hop samples. The dependence of the proantocyanidin composition on both the variety and the growing locality was observed. Specifically, the traditional Saaz variety contained more frequently oligomers formed by (epi)catechin units only, whereas the varieties Premiant and Agnus produced oligomers consisting of (epi)catechin as well as (epi)gallocatechin units. The relative abundance of proanthocyanidins in studied hop varieties from the two crops, 2011 and 2012, did correspond to each other. In the further perspective, the method may also be used for prediction of qualitative marks or authenticity verification of hops. © 2013 Elsevier B.V. All rights reserved.

  20. Simulation of the photodynamics of azobenzene on its first excited state: Comparison of full multiple spawning and surface hopping treatments

    International Nuclear Information System (INIS)

    Toniolo, A.; Ciminelli, C.; Persico, M.; Martinez, T.J.

    2005-01-01

    We have studied the cis→trans and trans→cis photoisomerization of azobenzene after n→π* excitation using the full multiple spawning (FMS) method for nonadiabatic wave-packet dynamics with potential-energy surfaces and couplings determined 'on the fly' from a reparametrized multiconfigurational semiempirical method. We compare the FMS results with a previous direct dynamics treatment using the same potential-energy surfaces and couplings, but with the nonadiabatic dynamics modeled using a semiclassical surface hopping (SH) method. We concentrate on the dynamical effects that determine the photoisomerization quantum yields, namely, the rate of radiationless electronic relaxation and the character of motion along the reaction coordinate. The quantal and semiclassical results are in good general agreement, confirming our previous analysis of the photodynamics. The SH method slightly overestimates the rate of excited state decay, leading in this case to lower quantum yields

  1. Thermal equilibrium properties of surface hopping with an implicit Langevin bath.

    Science.gov (United States)

    Sherman, M C; Corcelli, S A

    2015-01-14

    The ability of fewest switches surface hopping (FSSH) approach, where the classical degrees of freedom are coupled to an implicit Langevin bath, to establish and maintain an appropriate thermal equilibrium was evaluated in the context of a three site model for electron transfer. The electron transfer model consisted of three coupled diabatic states that each depends harmonically on the collective bath coordinate. This results in three states with increasing energy in the adiabatic representation. The adiabatic populations and distributions of the collective solvent coordinate were monitored during the course of 250 ns FSSH-Langevin (FSSH-L) simulations performed at a broad range of temperatures and for three different nonadiabatic coupling strengths. The agreement between the FSSH-L simulations and numerically exact results for the adiabatic population ratios and solvent coordinate distributions was generally favorable. The FSSH-L method produces a correct Boltzmann distribution of the solvent coordinate on each of the adiabats, but the integrated populations are slightly incorrect because FSSH does not rigorously obey detailed balance. The overall agreement is better at high temperatures and for high nonadiabatic coupling, which agrees with a previously reported analytical and simulation analysis [J. R. Schmidt, P. V. Parandekar, and J. C. Tully, J. Chem. Phys. 129, 044104 (2008)] on a two-level system coupled to a classical bath.

  2. An On-the-Fly Surface-Hopping Program JADE for Nonadiabatic Molecular Dynamics of Polyatomic Systems: Implementation and Applications.

    Science.gov (United States)

    Du, Likai; Lan, Zhenggang

    2015-04-14

    Nonadiabatic dynamics simulations have rapidly become an indispensable tool for understanding ultrafast photochemical processes in complex systems. Here, we present our recently developed on-the-fly nonadiabatic dynamics package, JADE, which allows researchers to perform nonadiabatic excited-state dynamics simulations of polyatomic systems at an all-atomic level. The nonadiabatic dynamics is based on Tully's surface-hopping approach. Currently, several electronic structure methods (CIS, TDHF, TDDFT(RPA/TDA), and ADC(2)) are supported, especially TDDFT, aiming at performing nonadiabatic dynamics on medium- to large-sized molecules. The JADE package has been interfaced with several quantum chemistry codes, including Turbomole, Gaussian, and Gamess (US). To consider environmental effects, the Langevin dynamics was introduced as an easy-to-use scheme into the standard surface-hopping dynamics. The JADE package is mainly written in Fortran for greater numerical performance and Python for flexible interface construction, with the intent of providing open-source, easy-to-use, well-modularized, and intuitive software in the field of simulations of photochemical and photophysical processes. To illustrate the possible applications of the JADE package, we present a few applications of excited-state dynamics for various polyatomic systems, such as the methaniminium cation, fullerene (C20), p-dimethylaminobenzonitrile (DMABN) and its primary amino derivative aminobenzonitrile (ABN), and 10-hydroxybenzo[h]quinoline (10-HBQ).

  3. A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications.

    Science.gov (United States)

    Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto

    2018-02-23

    Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.

  4. Surface hopping study of the photodissociation dynamics of ICN- and BrCN-

    Science.gov (United States)

    Opoku-Agyeman, Bernice; McCoy, Anne B.

    2018-02-01

    In this work the efficacy of semi-classical surface hopping approaches is investigated through studies of the photodissociation dynamics of BrCN- and ICN-. BrCN- provides a challenging situation for semi-classical approaches as excitation to the first bright state yields both Br- + CN and Br∗ + CN- products. Further, this branching is highly sensitive to the amount of rotational energy in the CN0/- fragment. The results of semi-classical and quantum mechanical descriptions of the dynamics are compared when the classical dynamics are propagated in an adiabatic and diabatic representation. The implications of the differences between the classical and quantum treatments of J = 0 are also explored.

  5. Attractor hopping between polarization dynamical states in a vertical-cavity surface-emitting laser subject to parallel optical injection

    Science.gov (United States)

    Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc

    2018-03-01

    We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.

  6. A Hopping Height Control for Hopping Robot

    Science.gov (United States)

    Ohashi, Eijiro; Ohnishi, Kouhei

    In recent years, legged robots are progressed and able to walk just like human beings. Hopping has a possibility of moving faster and avoiding larger obstacles than walking. Thus hopping becomes more significant. In this paper, to take account of torque limits of motors, we propose the method of controlling the hopping height by changing the leg length at bottom. Considering an actual environment, the environment will change as the robot moves around. Therefore we describe the way to estimate an actual thrust force. Using the estimated thrust force, command value of leg length in the landing phase is determined. The effectiveness of proposed method is confirmed by simulative and experimental results.

  7. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    Energy Technology Data Exchange (ETDEWEB)

    Kowalewski, Markus, E-mail: mkowalew@uci.edu; Mukamel, Shaul, E-mail: smukamel@uci.edu [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States)

    2015-07-28

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings.

  8. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    International Nuclear Information System (INIS)

    Kowalewski, Markus; Mukamel, Shaul

    2015-01-01

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings

  9. Transmembrane and ubiquitin-like domain-containing protein 1 (Tmub1/HOPS facilitates surface expression of GluR2-containing AMPA receptors.

    Directory of Open Access Journals (Sweden)

    Hyunjeong Yang

    Full Text Available Some ubiquitin-like (UBL domain-containing proteins are known to play roles in receptor trafficking. Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptors (AMPARs undergo constitutive cycling between the intracellular compartment and the cell surface in the central nervous system. However, the function of UBL domain-containing proteins in the recycling of the AMPARs to the synaptic surface has not yet been reported.Here, we report that the Transmembrane and ubiquitin-like domain-containing 1 (Tmub1 protein, formerly known as the Hepatocyte Odd Protein Shuttling (HOPS protein, which is abundantly expressed in the brain and which exists in a synaptosomal membrane fraction, facilitates the recycling of the AMPAR subunit GluR2 to the cell surface. Neurons transfected with Tmub1/HOPS-RNAi plasmids showed a significant reduction in the AMPAR current as compared to their control neurons. Consistently, the synaptic surface expression of GluR2, but not of GluR1, was significantly decreased in the neurons transfected with the Tmub1/HOPS-RNAi and increased in the neurons overexpressing EGFP-Tmub1/HOPS. The altered surface expression of GluR2 was speculated to be due to the altered surface-recycling of the internalized GluR2 in our recycling assay. Eventually, we found that GluR2 and glutamate receptor interacting protein (GRIP were coimmunoprecipitated by the anti-Tmub1/HOPS antibody from the mouse brain. Taken together, these observations show that the Tmub1/HOPS plays a role in regulating basal synaptic transmission; it contributes to maintain the synaptic surface number of the GluR2-containing AMPARs by facilitating the recycling of GluR2 to the plasma membrane.

  10. Development of preparative and analytical methods of the hop bitter acid oxide fraction and chemical properties of its components.

    Science.gov (United States)

    Taniguchi, Yoshimasa; Matsukura, Yasuko; Taniguchi, Harumi; Koizumi, Hideki; Katayama, Mikio

    2015-01-01

    The bitter acids in hops (Humulus lupulus L.) and beer, such as α-, β-, and iso-α-acids, are known to affect beer quality and display various physiological effects. However, these compounds readily oxidize, and the effect of the oxides on the properties of beer or their potential health benefits are not well understood. In this study, we developed a simple preparative method for the bitter acid oxide fraction derived from hops and designated the constituents as matured hop bitter acids (MHBA). HPLC-PDA-ESI/HRMS and MS(2) revealed that MHBA are primarily composed of α-acid-derived oxides, which possess a common β-tricarbonyl moiety in their structures similar to α-, β-, and iso-α-acids. We also developed a quantitative analytical method of whole MHBA by HPLC, which showed high precision and reproducibility. Using our newly developed method, the concentration of whole MHBA in several commercial beers was evaluated. Our results will promote the study of bitter acid oxides.

  11. Ultra-high-performance liquid chromatography profiling method for chemical screening of proanthocyanidins in Czech hops

    Czech Academy of Sciences Publication Activity Database

    Olšovská, J.; Kameník, Zdeněk; Čejka, P.; Jurková, M.; Mikyška, A.

    2013-01-01

    Roč. 116, NOV (2013), s. 919-926 ISSN 0039-9140 R&D Projects: GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Flavan-3-ol * Catechin * Hops Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.511, year: 2013

  12. Model-driven harmonic parameterization of the cortical surface: HIP-HOP.

    Science.gov (United States)

    Auzias, G; Lefèvre, J; Le Troter, A; Fischer, C; Perrot, M; Régis, J; Coulon, O

    2013-05-01

    In the context of inter subject brain surface matching, we present a parameterization of the cortical surface constrained by a model of cortical organization. The parameterization is defined via an harmonic mapping of each hemisphere surface to a rectangular planar domain that integrates a representation of the model. As opposed to previous landmark-based registration methods we do not match folds between individuals but instead optimize the fit between cortical sulci and specific iso-coordinate axis in the model. This strategy overcomes some limitation to sulcus-based registration techniques such as topological variability in sulcal landmarks across subjects. Experiments on 62 subjects with manually traced sulci are presented and compared with the result of the Freesurfer software. The evaluation involves a measure of dispersion of sulci with both angular and area distortions. We show that the model-based strategy can lead to a natural, efficient and very fast (less than 5 min per hemisphere) method for defining inter subjects correspondences. We discuss how this approach also reduces the problems inherent to anatomically defined landmarks and open the way to the investigation of cortical organization through the notion of orientation and alignment of structures across the cortex.

  13. Surface hopping dynamics using a locally diabatic formalism: Charge transfer in the ethylene dimer cation and excited state dynamics in the 2- pyridone dimer

    Czech Academy of Sciences Publication Activity Database

    Plasser, F.; Granucci, G.; Pittner, Jiří; Barbatti, M.; Persico, M.; Lischka, H.

    2012-01-01

    Roč. 137, č. 22 (2012), 22A514 ISSN 0021-9606 R&D Projects: GA ČR(CZ) GAP208/12/0559 Institutional support: RVO:61388955 Keywords : surface hopping dynamics * molecular dynamics * electron transfer Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.164, year: 2012

  14. Parallel deposition, sorting, and reordering methods in the Hybrid Ordered Plasma Simulation (HOPS) code

    International Nuclear Information System (INIS)

    Anderson, D.V.; Shumaker, D.E.

    1993-01-01

    From a computational standpoint, particle simulation calculations for plasmas have not adapted well to the transitions from scalar to vector processing nor from serial to parallel environments. They have suffered from inordinate and excessive accessing of computer memory and have been hobbled by relatively inefficient gather-scatter constructs resulting from the use of indirect indexing. Lastly, the many-to-one mapping characteristic of the deposition phase has made it difficult to perform this in parallel. The authors' code sorts and reorders the particles in a spatial order. This allows them to greatly reduce the memory references, to run in directly indexed vector mode, and to employ domain decomposition to achieve parallelization. In this hybrid simulation the electrons are modeled as a fluid and the field equations solved are obtained from the electron momentum equation together with the pre-Maxwell equations (displacement current neglected). Either zero or finite electron mass can be used in the electron model. The resulting field equations are solved with an iteratively explicit procedure which is thus trivial to parallelize. Likewise, the field interpolations and the particle pushing is simple to parallelize. The deposition, sorting, and reordering phases are less simple and it is for these that the authors present detailed algorithms. They have now successfully tested the parallel version of HOPS in serial mode and it is now being readied for parallel execution on the Cray C-90. They will then port HOPS to a massively parallel computer, in the next year

  15. Quantitation Method for Polyfunctional Thiols in Hops (Humulus lupulus L.) and Beer Using Specific Extraction of Thiols and Gas Chromatography-Tandem Mass Spectrometry.

    Science.gov (United States)

    Takazumi, Koji; Takoi, Kiyoshi; Koie, Koichiro; Tuchiya, Youichi

    2017-11-07

    A method for the quantitation of six polyfunctional thiols, 4-methyl-4-sulfanylpentan-2-one (4MSP), 3-sulfanyl-4-methylpentan-1-ol (3S4MP), 3-sulfanyl-4-methylpentyl acetate (3S4MPA), 3-sulfanyl-3-methylbutan-1-ol (3S3MB), 3-sulfanylhexan-1-ol (3SH), and 3-sulfanylhexyl acetate (3SHA), in hops and beer without organic mercury compounds was developed. The method employed specific extraction of thiols using a silver ion solid phase extraction (SPE) cartridge and gas chromatography-tandem mass spectrometry (GC-MS/MS). For all thiols analyzed, good linearity was achieved by adding thioglycerol as an analyte protectant. Recoveries for both hops (74-100%) and beer (79-113%) were acceptable, and the repeatability for both was also good (relative standard deviations of 2.8-8.4%). The limits of detection for the six polyfunctional thiols were below their odor thresholds in beer. The method was applied to quantitation of hops and beer flavored with thiol-containing hop varieties. Due to their detected levels and level variations in different beers, 4MSP and 3S4MP are thought to be important polyfunctional thiols for the characteristic flavor of hop varieties.

  16. Precision Hopping/Rolling Robotic Surface Probe Based on Tensegrity Structures

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to overcome the limitations of wheeled surface rovers by combining recent advances in ball-shaped soft-robots based on tensegrity structures (a tension...

  17. Supercritical fluid extraction of hops

    Directory of Open Access Journals (Sweden)

    ZORAN ZEKOVIC

    2007-01-01

    Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

  18. Aluminum Nitride Hydrolysis Enabled by Hydroxyl-Mediated Surface Proton Hopping.

    Science.gov (United States)

    Bartel, Christopher J; Muhich, Christopher L; Weimer, Alan W; Musgrave, Charles B

    2016-07-20

    Aluminum nitride (AlN) is used extensively in the semiconductor industry as a high-thermal-conductivity insulator, but its manufacture is encumbered by a tendency to degrade in the presence of water. The propensity for AlN to hydrolyze has led to its consideration as a redox material for solar thermochemical ammonia (NH3) synthesis applications where AlN would be intentionally hydrolyzed to produce NH3 and aluminum oxide (Al2O3), which could be subsequently reduced in nitrogen (N2) to reform AlN and reinitiate the NH3 synthesis cycle. No quantitative, atomistic mechanism by which AlN, and more generally, metal nitrides react with water to become oxidized and generate NH3 yet exists. In this work, we used density-functional theory (DFT) to examine the reaction mechanisms of the initial stages of AlN hydrolysis, which include: water adsorption, hydroxyl-mediated proton diffusion to form NH3, and NH3 desorption. We found activation barriers (Ea) for hydrolysis of 330 and 359 kJ/mol for the cases of minimal adsorbed water and additional adsorbed water, respectively, corroborating the high observed temperatures for the onset of steam AlN hydrolysis. We predict AlN hydrolysis to be kinetically limited by the dissociation of strong Al-N bonds required to accumulate protons on surface N atoms to form NH3. The hydrolysis mechanism we elucidate is enabled by the diffusion of protons across the AlN surface by a hydroxyl-mediated Grotthuss mechanism. A comparison between intrinsic (Ea = 331 kJ/mol) and mediated proton diffusion (Ea = 89 kJ/mol) shows that hydroxyl-mediated proton diffusion is the predominant mechanism in AlN hydrolysis. The large activation barrier for NH3 generation from AlN (Ea = 330 or 359 kJ/mol, depending on water coverage) suggests that in the design of materials for solar thermochemical ammonia synthesis, emphasis should be placed on metal nitrides with less covalent metal-nitrogen bonds and, thus, more-facile NH3 liberation.

  19. Improving the sensitivity of the hop index in patients with an ACL deficient knee by transforming the hop distance scores

    Directory of Open Access Journals (Sweden)

    Thomas Scott G

    2006-02-01

    Full Text Available Abstract Background The one leg hop for distance is one of the most commonly employed functional tests utilized in the evaluation of the ACL deficient and reconstructed patient. While the reliability of the hop test scores has been well established, validity studies have revealed low sensitivity rates in detecting functional limitations using the hop index (the ratio or percentage of limb performance. However, the impact of the inherent limitations associated with the hop index have not been investigated to date. One specific limitation relates to the impact of the differences in the underlying hop distance scores. Therefore, this pilot study set out to determine: 1 the impact that between limb differences in hop distance has on the sensitivity of the hop index in detecting functional limitations and; 2 whether a logarithmic transformation of the underlying hop distance scores improves the sensitivity of the hop index. Methods A cross sectional design involving the evaluation of one leg hop for distance performance in a consecutive sample of 10 ACL deficient males with an isolated ACL tear awaiting reconstructive surgery and nine gender, age-matched controls. Results In the ACL deficient, the hop index was associated with the distance hopped on the non-injured limb (r = -0.66, p = 0.04 but not on the injured limb. Transformation (logarithmic of the hop distance scores and re-calculation of the hop index using the transformed scores increased the sensitivity of the hop index in the detection of functional limitations from 20 to 60% and 50 to 70% using the normal limb symmetry reference norms of ≥ 85% and 90% respectively. Conclusion The distance hopped on the non-injured limb is a critical factor in detecting functional limitations using the hop index in patients with an ACL deficient knee. Logarithmic transformation of the hop distance scores minimizes the effect of the arithmetic differences between limbs however; the sensitivity of the hop

  20. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    Science.gov (United States)

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  1. Hop crop wild relatives

    Science.gov (United States)

    The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...

  2. Evaluation of genetic variability of wild hops (Humulus lupulus L.) in Canada and the Caucasus region by chemical and molecular methods.

    Science.gov (United States)

    Patzak, Josef; Nesvadba, Vladimír; Krofta, Karel; Henychova, Alena; Marzoev, Arkady Inalovic; Richards, Ken

    2010-07-01

    Wild hops (Humulus lupulus L.) are potential new germplasms to expand the variability of genetic resources for hop breeding. We evaluated Canadian (62 plants) and Caucasian (58 plants) wild hops by their chemical characteristics and with molecular genetic analyses using sequence-tagged site and simple sequence repeat markers, in comparison with European (104 plants) and North American (27 plants) wild hops. The contents of alpha and beta acids varied from 0.36% to 5.11% and from 0.43% to 6.66% in Canadian wild hops, and from 0.85% to 3.65% and from 1.22% to 4.81% in Caucasian wild hops, respectively. The contents of cohumulone and colupulone distinctly differed between European and North American wild hops: the cohumulone level in alpha acids was in the range 46.1%-68.4% among North American wild hops and in the range 13.6%-30.6% among European wild hops. The high content of myrcene and the low contents of humulene, farnesene, and selinenes were typical for wild hops from Canada, in contrast to wild hops from the Caucasus region. We compared the chemical characteristics with molecular genetic data. Chemical characteristics differentiated wild hops into North American and Eurasian groups. Molecular genetic analysis was able to separate Caucasian wild hops from European wild hops. We proved a hop phylogeny by means of wide molecular analysis.

  3. Monitoring devices and systems for monitoring frequency hopping wireless communications, and related methods

    Science.gov (United States)

    Derr, Kurt W.; Richardson, John G.

    2017-05-02

    Monitoring devices and systems comprise a plurality of data channel modules coupled to processing circuitry. Each data channel module of the plurality of data channel modules is configured to capture wireless communications for a selected frequency channel. The processing circuitry is configured to receive captured wireless communications from the plurality of data channel modules and to organize received wireless communications according to at least one parameter. Related methods of monitoring wireless communications are also disclosed.

  4. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Quantitation of 4-Methyl-4-sulfanylpentan-2-one (4MSP) in Hops by a Stable Isotope Dilution Assay in Combination with GC×GC-TOFMS: Method Development and Application To Study the Influence of Variety, Provenance, Harvest Year, and Processing on 4MSP Concentrations.

    Science.gov (United States)

    Reglitz, Klaas; Steinhaus, Martin

    2017-03-22

    A stable isotope dilution assay was developed for quantitation of 4-methyl-4-sulfanylpentan-2-one (4MSP) in hops. The approach included the use of 4-( 13 C)methyl-4-sulfanyl(1,3,5- 13 C 3 )pentan-2-one as internal standard, selective isolation of hop thiols by mercurated agarose, and GC×GC-TOFMS analysis. Application of the method to 53 different hop samples revealed 4MSP concentrations between Hop processing such as drying and pelletizing had only a minor impact on 4MSP concentrations. Like the majority of other hop volatiles, 4MSP is predominantly located in the lupulin glands.

  6. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  7. A stable high-order perturbation of surfaces method for numerical simulation of diffraction problems in triply layered media

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Youngjoon, E-mail: hongy@uic.edu; Nicholls, David P., E-mail: davidn@uic.edu

    2017-02-01

    The accurate numerical simulation of linear waves interacting with periodic layered media is a crucial capability in engineering applications. In this contribution we study the stable and high-order accurate numerical simulation of the interaction of linear, time-harmonic waves with a periodic, triply layered medium with irregular interfaces. In contrast with volumetric approaches, High-Order Perturbation of Surfaces (HOPS) algorithms are inexpensive interfacial methods which rapidly and recursively estimate scattering returns by perturbation of the interface shape. In comparison with Boundary Integral/Element Methods, the stable HOPS algorithm we describe here does not require specialized quadrature rules, periodization strategies, or the solution of dense non-symmetric positive definite linear systems. In addition, the algorithm is provably stable as opposed to other classical HOPS approaches. With numerical experiments we show the remarkable efficiency, fidelity, and accuracy one can achieve with an implementation of this algorithm.

  8. The Bitter Chemodiversity of Hops (Humulus lupulus L.).

    Science.gov (United States)

    Dresel, Michael; Vogt, Christian; Dunkel, Andreas; Hofmann, Thomas

    2016-10-03

    To map the chemodiversity of key bitter compounds in hops, a total of 75 different samples collected from the global hop market were analyzed for 117 key bitter tastants by means of a multiparametric HPLC-MS/MSMRM method. Among the compounds detected, 2'',3''-epoxyxanthohumol was detected for the first time in hops and iso¬xantho¬humol M was identified as a marker compound for varieties grown in Germany. Hop ageing experiments in the absence and presence of air oxygen, respectively, were conducted to address the stability of hop-derived compounds during long-term storage.

  9. Hopping Robot with Wheels

    Science.gov (United States)

    Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

    2003-01-01

    A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

  10. Steerable Hopping Six-Legged Robot

    Science.gov (United States)

    Younse, Paulo; Aghazarian, Hrand

    2010-01-01

    The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that

  11. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  12. Analysis of the Geometrical Evolution in On-the-Fly Surface-Hopping Nonadiabatic Dynamics with Machine Learning Dimensionality Reduction Approaches: Classical Multidimensional Scaling and Isometric Feature Mapping.

    Science.gov (United States)

    Li, Xusong; Xie, Yu; Hu, Deping; Lan, Zhenggang

    2017-10-10

    On-the-fly trajectory-based nonadiabatic dynamics simulation has become an important approach to study ultrafast photochemical and photophysical processes in recent years. Because a large number of trajectories are generated from the dynamics simulation of polyatomic molecular systems with many degrees of freedom, the analysis of simulation results often suffers from the large amount of high-dimensional data. It is very challenging but meaningful to find dominating active coordinates from very complicated molecular motions. Dimensionality reduction techniques provide ideal tools to realize this purpose. We apply two dimensionality reduction approaches (classical multidimensional scaling and isometric feature mapping) to analyze the results of the on-the-fly surface-hopping nonadiabatic dynamics simulation. Two representative model systems, CH 2 NH 2 + and the phytochromobilin chromophore model, are chosen to examine the performance of these dimensionality reduction approaches. The results show that these approaches are very promising, because they can extract the major molecular motion from complicated time-dependent molecular evolution without preknown knowledge.

  13. Protein structure prediction using basin-hopping

    Science.gov (United States)

    Prentiss, Michael C.; Wales, David J.; Wolynes, Peter G.

    2008-06-01

    Associative memory Hamiltonian structure prediction potentials are not overly rugged, thereby suggesting their landscapes are like those of actual proteins. In the present contribution we show how basin-hopping global optimization can identify low-lying minima for the corresponding mildly frustrated energy landscapes. For small systems the basin-hopping algorithm succeeds in locating both lower minima and conformations closer to the experimental structure than does molecular dynamics with simulated annealing. For large systems the efficiency of basin-hopping decreases for our initial implementation, where the steps consist of random perturbations to the Cartesian coordinates. We implemented umbrella sampling using basin-hopping to further confirm when the global minima are reached. We have also improved the energy surface by employing bioinformatic techniques for reducing the roughness or variance of the energy surface. Finally, the basin-hopping calculations have guided improvements in the excluded volume of the Hamiltonian, producing better structures. These results suggest a novel and transferable optimization scheme for future energy function development.

  14. Multi-state nonadiabatic deactivation mechanism of coumarin revealed by ab initio on-the-fly trajectory surface hopping dynamic simulation.

    Science.gov (United States)

    Gan, Yanzhen; Yue, Ling; Guo, Xugeng; Zhu, Chaoyuan; Cao, Zexing

    2017-05-17

    An on-the-fly trajectory surface hopping dynamic simulation has been performed for revealing the multi-state nonadiabatic deactivation mechanism of coumarin. The mechanism involves three adiabatic excited states, S 3 (ππ*L b ), S 2 (nπ*, ππ*L a ) and S 1 (ππ*L a , nπ*), and the ground state S 0 at the four state-averaged complete active space self-consistent field, SA4-CASSCF(12,10)/6-31G* level of theory. Upon photoexcitation to the third excited state S 3 (ππ*L b ) in the Franck-Condon region, 80% sampling trajectories decay to the dark S 2 (nπ*) state within an average of 5 fs via the conical intersection S 3 (ππ*L b )/S 2 (nπ*), while 20% decay to the S 2 (ππ*L a ) state within an average of 11 fs via the conical intersection S 3 (ππ*L b )/S 2 (ππ*L a ). Then, sampling trajectories via S 2 (nπ*)/S 1 (ππ*L a ) continue with ultrafast decay processes to give a final distribution of quantum yields as follows: 42% stay on the dark S 1 (nπ*) state, 43.3% go back to the ground S 0 state, 12% undergo a ring-opening reaction to the Z-form S 0 (Z) state, and 2.7% go to the E-form S 0 (E) state. The lifetimes of the excited states are estimated as follows: the S 3 state is about 12 fs on average, the S 2 state is about 80 fs, and the S 1 state has a fast component of about 160 fs and a slow component of 15 ps. The simulated ultrafast radiationless deactivation pathways of photoexcited coumarin immediately interpret the experimentally observed weak fluorescence emission.

  15. Unsupervised 3D ring template searching as an ideas generator for scaffold hopping: use of the LAMDA, RigFit, and field-based similarity search (FBSS) methods.

    Science.gov (United States)

    Bohl, Martin; Loeprecht, Björn; Wendt, Bernd; Heritage, Trevor; Richmond, Nicola J; Willett, Peter

    2006-01-01

    Crystal structures taken from the Cambridge Structural Database were used to build a ring scaffold database containing 19 050 3D structures, with each such scaffold then being used to generate a centroid connecting path (CCP) representation. The CCP is a novel object that connects ring centroids, ring linker atoms, and other important points on the connection path between ring centroids. Unsupervised searching in the scaffold and CCP data sets was carried out using the atom-based LAMDA and RigFit search methods and the field-based similarity search method. The performance of these methods was tested with three different ring scaffold queries. These searches demonstrated that unsupervised 3D scaffold searching methods can find not only the types of ring systems that might be retrieved in carefully defined pharmacophore searches (supervised approach) but also additional, structurally diverse ring systems that could form the starting point for lead discovery programs or other scaffold-hopping applications. Not only are the methods effective but some are sufficiently rapid to permit scaffold searching in large chemical databases on a routine basis.

  16. Surface decontamination compositions and methods

    Science.gov (United States)

    Wright,; Karen, E [Idaho Falls, ID; Cooper, David C [Idaho Falls, ID; Peterman, Dean R [Idaho Falls, ID; Demmer, Ricky L [Idaho Falls, ID; Tripp, Julia L [Pocatello, ID; Hull, Laurence C [Idaho Falls, ID

    2011-03-29

    Clay-based compositions capable of absorbing contaminants from surfaces or objects having surface faces may be applied to a surface and later removed, the removed clay-based compositions absorbing at least a portion of the contaminant from the surface or object to which it was applied.

  17. Electron hopping through proteins

    Czech Academy of Sciences Publication Activity Database

    Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.

    2012-01-01

    Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

  18. Climate, weather, and hops

    Science.gov (United States)

    As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

  19. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  20. Plasmodium falciparum Hop (PfHop Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

    Directory of Open Access Journals (Sweden)

    Tawanda Zininga

    Full Text Available Heat shock proteins (Hsps play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70 is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90 facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop. We previously characterised the Hop protein from Plasmodium falciparum (PfHop. We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we

  1. METHODS TO DEVELOP A TOROIDAL SURFACE

    Directory of Open Access Journals (Sweden)

    DANAILA Ligia

    2017-05-01

    Full Text Available The paper work presents two practical methods to draw the development of a surface unable to be developed applying classical methods of Descriptive Geometry, the toroidal surface, frequently met in technical practice. The described methods are approximate ones; the development is obtained with the help of points. The accuracy of the methods is given by the number of points used when drawing. As for any other approximate method, when practically manufactured the development may need to be adjusted on site.

  2. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  3. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  4. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

    Directory of Open Access Journals (Sweden)

    Haejoon Jung

    2018-01-01

    Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  5. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  6. Methods of decontaminating surfaces and related compositions

    Science.gov (United States)

    Demmer, Ricky L.; Crosby, Daniel; Norton, Christopher J.

    2016-11-22

    A composition of matter includes water, at least one acid, at least one surfactant, at least one fluoride salt, and ammonium nitrate. A method of decontaminating a surface includes exposing a surface to such a composition and removing the composition from the surface. Other compositions of matter include water, a fatty alcohol ether sulfate, nitrilotriacetic acid, at least one of hydrochloric acid and nitric acid, sodium fluoride, potassium fluoride, ammonium nitrate, and gelatin.

  7. Monte Carlo method for random surfaces

    International Nuclear Information System (INIS)

    Berg, B.

    1985-01-01

    Previously two of the authors proposed a Monte Carlo method for sampling statistical ensembles of random walks and surfaces with a Boltzmann probabilistic weight. In the present paper we work out the details for several models of random surfaces, defined on d-dimensional hypercubic lattices. (orig.)

  8. Hall effect in hopping regime

    Energy Technology Data Exchange (ETDEWEB)

    Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)

    2016-02-15

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  9. Surface physics theoretical models and experimental methods

    CERN Document Server

    Mamonova, Marina V; Prudnikova, I A

    2016-01-01

    The demands of production, such as thin films in microelectronics, rely on consideration of factors influencing the interaction of dissimilar materials that make contact with their surfaces. Bond formation between surface layers of dissimilar condensed solids-termed adhesion-depends on the nature of the contacting bodies. Thus, it is necessary to determine the characteristics of adhesion interaction of different materials from both applied and fundamental perspectives of surface phenomena. Given the difficulty in obtaining reliable experimental values of the adhesion strength of coatings, the theoretical approach to determining adhesion characteristics becomes more important. Surface Physics: Theoretical Models and Experimental Methods presents straightforward and efficient approaches and methods developed by the authors that enable the calculation of surface and adhesion characteristics for a wide range of materials: metals, alloys, semiconductors, and complex compounds. The authors compare results from the ...

  10. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  11. Characteristics of compounds in hops using cyclic voltammetry, UV-VIS, FTIR and GC-MS analysis.

    Science.gov (United States)

    Masek, Anna; Chrzescijanska, Ewa; Kosmalska, Anna; Zaborski, Marian

    2014-08-01

    The article presents the antioxidant properties of the extracts of hop EI and EII, by the electrochemical methods on a platinum electrode and comparative analysis of the composition of the extracts of hops using UV-VIS, FTIR and GC-MS methods. The hops extract EI, was obtained from the waste of the hops cone. The hops extract EII, was obtained from the hops cone itself. Hops contain a wide range of polyphenolic compounds with antioxidant properties divided in various chemical classes. Flavonoids and other polyphenolic compounds contained in hops show antioxidant capacity because of the presence of hydroxyl groups in various configurations and numbers within their molecules. The electrochemical properties and antioxidant capacity of hop samples were determined to select the most effective antioxidant. Based on the cyclic and pulse voltammograms, it was observed that hop extract EI contains polyphenols that are oxidised at a less positive potential than extract EII, i.e., it shows better antioxidant capacity. From the analysis of the UV-VIS and FTIR spectra and the GC-MS analysis, it was observed that extract EI contains less phenyl compounds than EII. In addition to flavonoids, EII contains hop acids and chlorophyll. The solutions of hop extracts show very good antioxidant capacities; therefore, they can effectively inhibit or slow negative oxidation reactions and scavenge free radicals and reactive oxygen species (ROS). Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  13. Generalised empirical method for predicting surface subsidence

    International Nuclear Information System (INIS)

    Zhang, M.; Bhattacharyya, A.K.

    1994-01-01

    Based on a simplified strata parameter, i.e. the ratio of total thickness of the strong rock beds in an overburden to the overall thickness of the overburden, a Generalised Empirical Method (GEM) is described for predicting the maximum subsidence and the shape of a complete transverse subsidence profile due to a single completely extracted longwall panel. In the method, a nomogram for predicting the maximum surface subsidence is first developed from the data collected from subsidence measurements worldwide. Then, a method is developed for predicting the shapes of complete transfer subsidence profiles for a horizontal seam and ground surface and is verified by case studies. 13 refs., 9 figs., 2 tabs

  14. Three-Dimensional Tracking of Interfacial Hopping Diffusion

    Science.gov (United States)

    Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

    2017-12-01

    Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

  15. Characterization of Volatile Components from Hüller Bitterer Hop Variety Using In-Tube Extraction GC-MS Analysis

    OpenAIRE

    Liana Claudia Salanță; Maria Tofană; Sonia Socaci; Carmen Pop; Anamaria Pop; Ana Cuceu

    2015-01-01

    The composition of hop oil contributes to the aroma of beer and the essential oil profile of hop samples contains valuable information for brewers. The aim of this study was to characterize the Hüller Bitterer hop variety, during the development of hop cones, by analysis the composition of volatile oil using in-tube extraction gas chromatography–mass spectrometry (ITEX-GC–MS). The obtained results show that the ITEX-GC/MS method is suitable for the determination of volatile compounds from hop...

  16. A Multicomponent UV Analysis of ["alpha"]- and ["beta"]-Acids in Hops

    Science.gov (United States)

    Egts, Haley; Durben, Dan J.; Dixson, John A.; Zehfus, Micheal H.

    2012-01-01

    A method is presented for the determination of ["alpha"]- and ["beta"]-acids (humulones and lupulones) in a hops sample using a multicomponent UV spectroscopic analysis of a methanolic hop extract. When compared with standard methods, this lab can be considered "greener" because it uses smaller volumes of safer solvents (methanol instead of…

  17. Surface Hopping Dynamics with Correlated Single-Reference Methods: 9H-Adenine as a Case Study

    Czech Academy of Sciences Publication Activity Database

    Plasser, F.; Crespo-Otero, R.; Pederzoli, Marek; Pittner, Jiří; Lischka, H.; Barbatti, M.

    2014-01-01

    Roč. 10, č. 4 (2014), s. 1395-1405 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/12/0559 Institutional support: RVO:61388955 Keywords : density-functional theory * resolved photoelectron spectroscopy * nonadiabatic molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.498, year: 2014

  18. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA...

  19. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  20. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  1. Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

    Science.gov (United States)

    Putnam, Michael

    2006-01-01

    This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

  2. Plasmonic nanostructures for surface enhanced spectroscopic methods.

    Science.gov (United States)

    Jahn, Martin; Patze, Sophie; Hidi, Izabella J; Knipper, Richard; Radu, Andreea I; Mühlig, Anna; Yüksel, Sezin; Peksa, Vlastimil; Weber, Karina; Mayerhöfer, Thomas; Cialla-May, Dana; Popp, Jürgen

    2016-02-07

    A comprehensive review of theoretical approaches to simulate plasmonic-active metallic nano-arrangements is given. Further, various fabrication methods based on bottom-up, self-organization and top-down techniques are introduced. Here, analytical approaches are discussed to investigate the optical properties of isotropic and non-magnetic spherical or spheroidal particles. Furthermore, numerical methods are introduced to research complex shaped structures. A huge variety of fabrication methods are reviewed, e.g. bottom-up preparation strategies for plasmonic nanostructures to generate metal colloids and core-shell particles as well as complex-shaped structures, self-organization as well as template-based methods and finally, top-down processes, e.g. electron beam lithography and its variants as well as nanoimprinting. The review article is aimed at beginners in the field of surface enhanced spectroscopy (SES) techniques and readers who have a general interest in theoretical modelling of plasmonic substrates for SES applications as well as in the fabrication of the desired structures based on methods of the current state of the art.

  3. Hopping system control with an approximated dynamics model and upper-body motion

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)

    2015-11-15

    A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

  4. SHOP: scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Linusson, Anna; Zamora, Ismael

    2007-01-01

    A new GRID-based method for scaffold hopping (SHOP) is presented. In a fully automatic manner, scaffolds were identified in a database based on three types of 3D-descriptors. SHOP's ability to recover scaffolds was assessed and validated by searching a database spiked with fragments of known...

  5. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    Science.gov (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  6. Cover Story: The Miseducation of Hip-Hop.

    Science.gov (United States)

    Evelyn, Jamilah

    2000-01-01

    Some higher education officials believe that hip-hop music is eating away at the morals, and ultimately the classroom experience, of today's college students. Discusses why the gap exists between student and faculty attitudes toward hip-hop, how hip-hop music represents blackness, how people perceive hip-hop youth, the positive side of hip-hop,…

  7. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  8. Method for surface treatment by electron beams

    International Nuclear Information System (INIS)

    Panzer, S.; Doehler, H.; Bartel, R.; Ardenne, T. von.

    1985-01-01

    The invention has been aimed at simplifying the technology and saving energy in modifying surfaces with the aid of electron beams. The described beam-object geometry allows to abandon additional heat treatments. It can be used for surface hardening

  9. Characterization of Volatile Components from Hüller Bitterer Hop Variety Using In-Tube Extraction GC-MS Analysis

    Directory of Open Access Journals (Sweden)

    Liana Claudia Salanță

    2015-05-01

    Full Text Available The composition of hop oil contributes to the aroma of beer and the essential oil profile of hop samples contains valuable information for brewers. The aim of this study was to characterize the Hüller Bitterer hop variety, during the development of hop cones, by analysis the composition of volatile oil using in-tube extraction gas chromatography–mass spectrometry (ITEX-GC–MS. The obtained results show that the ITEX-GC/MS method is suitable for the determination of volatile compounds from hop samples. A number of 60 compounds were separated and 50 of them were identified. The most important volatile compounds found in Hüller Bitterer hop variety belonging to the monoterpenes and sesquiterpenes classes are represented by: β-myrcene, β-caryophyllene and α-humulene. 

  10. The Pseudomonas syringae type III effector HopF2 suppresses Arabidopsis stomatal immunity.

    Directory of Open Access Journals (Sweden)

    Brenden Hurley

    Full Text Available Pseudomonas syringae subverts plant immune signalling through injection of type III secreted effectors (T3SE into host cells. The T3SE HopF2 can disable Arabidopsis immunity through Its ADP-ribosyltransferase activity. Proteomic analysis of HopF2 interacting proteins identified a protein complex containing ATPases required for regulating stomatal aperture, suggesting HopF2 may manipulate stomatal immunity. Here we report HopF2 can inhibit stomatal immunity independent of its ADP-ribosyltransferase activity. Transgenic expression of HopF2 in Arabidopsis inhibits stomatal closing in response to P. syringae and increases the virulence of surface inoculated P. syringae. Further, transgenic expression of HopF2 inhibits flg22 induced reactive oxygen species production. Intriguingly, ADP-ribosyltransferase activity is dispensable for inhibiting stomatal immunity and flg22 induced reactive oxygen species. Together, this implies HopF2 may be a bifunctional T3SE with ADP-ribosyltransferase activity required for inhibiting apoplastic immunity and an independent function required to inhibit stomatal immunity.

  11. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  12. Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus).

    Science.gov (United States)

    Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B

    2014-12-31

    Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

  13. Effect of ensiled hop (Humulus lupulus L.) residues on plasma acetate turnover rate in sheep.

    Science.gov (United States)

    Al-Mamun, Mohammad; Saito, Aya; Sano, Hiroaki

    2011-06-01

    An isotope dilution method using [1-(13)C]sodium acetate was applied to determine the effect of feeding ensiled hop (Humulus lupulus L.) residues on plasma acetate turnover rate in six adult crossbred sheep. The sheep were fed 63 g/kg body weight (BW)(0.75)/day of either mixed hay of orchardgrass (Dactylis glomerata L.) and reed canarygrass (Phalaris arundinacea L.) and round bale silage at 3:1 ratio (Hay-diet), or another where round bale silage was replaced by ensiled hop residues (Hop-diet) with a crossover design each of a 3-week period. The isotope dilution method was performed on day 21 of each dietary treatment. Dry matter digestibility was similar between diets, and nitrogen (N) digestibility was lower (P = 0.001) for Hop-diet than Hay-diet. However, N retention did not differ between diets. Plasma acetate concentration was lower (P = 0.04) for Hop-diet than Hay-diet, and the turnover rate of plasma acetate did not differ between diets. Plasma concentration of lactate and non-esterified fatty acids were similar between diets. Hop-diet was found almost comparable to Hay-diet on plasma acetate turnover rate in the present experimental conditions. Therefore, it could be concluded that hop residues partially could be used as an alternative to traditionally used round bale silage for rearing sheep. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

  14. The SAHR Setup-Controlling Hopping Speed and Height Using a Single Actuator

    Directory of Open Access Journals (Sweden)

    N. Cherouvim

    2008-01-01

    Full Text Available In this paper we present and experimentally validate a control method for regulating both the forward speed and the apex height of a one-legged hopping robot, using only a single actuator. The control method is based on a dynamic model of the hopping robot and makes use of the dynamic coupling of the vertical and forward motions of the robot. The control is applied first to a simulated model of the robot and shown to track a desired forward robot speed and a desired apex height. Then the SAHR (single actuator hopping robot hardware is introduced and is used as an experimental platform with which to evaluate the performance of the control method. The control method is applied to the physical setup and is shown to lead to a stable hopping gait with a desired forward speed and apex height, despite the unmodelled disturbances met on the laboratory floor.

  15. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  16. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  17. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  18. Hopping Conductivity Enhanced by Microwave Radiation

    International Nuclear Information System (INIS)

    Ovadyahu, Z

    2012-01-01

    Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

  19. Surface Imaging Skin Friction Instrument and Method

    Science.gov (United States)

    Brown, James L. (Inventor); Naughton, Jonathan W. (Inventor)

    1999-01-01

    A surface imaging skin friction instrument allowing 2D resolution of spatial image by a 2D Hilbert transform and 2D inverse thin-oil film solver, providing an innovation over prior art single point approaches. Incoherent, monochromatic light source can be used. The invention provides accurate, easy to use, economical measurement of larger regions of surface shear stress in a single test.

  20. A method of determining surface runoff by

    Science.gov (United States)

    Donald E. Whelan; Lemuel E. Miller; John B. Cavallero

    1952-01-01

    To determine the effects of watershed management on flood runoff, one must make a reliable estimate of how much the surface runoff can be reduced by a land-use program. Since surface runoff is the difference between precipitation and the amount of water that soaks into the soil, such an estimate must be based on the infiltration capacity of the soil.

  1. Jumping and Hopping in Elite and Amateur Orienteering Athletes and Correlations to Sprinting and Running

    DEFF Research Database (Denmark)

    Hébert-Losier, Kim; Jensen, Kurt; Holmberg, Hans-Christer

    2014-01-01

    PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlations...... with sprinting and/or running have been examined in orienteering athletes. METHODS: We investigated squat jump (SJ), countermovement jump (CMJ), standing long jump (SLJ), and hopping performed by 8 elite and 8 amateur male foot-orienteering athletes (29 ± 7 y, 183 ± 5 cm, 73 ± 7 kg) and possible correlations...

  2. System and method for free-boundary surface extraction

    KAUST Repository

    Algarni, Marei

    2017-10-26

    A method of extracting surfaces in three-dimensional data includes receiving as inputs three-dimensional data and a seed point p located on a surface to be extracted. The method further includes propagating a front outwardly from the seed point p and extracting a plurality of ridge curves based on the propagated front. A surface boundary is detected based on a comparison of distances between adjacent ridge curves and the desired surface is extracted based on the detected surface boundary.

  3. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  4. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry

    2013-09-01

    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  5. Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea.

    Science.gov (United States)

    Jeong, Kyoung Yong; Son, Mina; Choi, Soo Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein Soo; Lee, Jae Hyun; Park, Jung Won

    2016-03-01

    Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents.

  6. Surface analysis methods in materials science

    CERN Document Server

    Sexton, Brett; Smart, Roger

    1992-01-01

    The idea for this book stemmed from a remark by Philip Jennings of Murdoch University in a discussion session following a regular meeting of the Australian Surface Science group. He observed that a text on surface analysis and applica­ tions to materials suitable for final year undergraduate and postgraduate science students was not currently available. Furthermore, the members of the Australian Surface Science group had the research experience and range of coverage of sur­ face analytical techniques and applications to provide a text for this purpose. A of techniques and applications to be included was agreed at that meeting. The list intended readership of the book has been broadened since the early discussions, particularly to encompass industrial users, but there has been no significant alter­ ation in content. The editors, in consultation with the contributors, have agreed that the book should be prepared for four major groups of readers: - senior undergraduate students in chemistry, physics, metallur...

  7. Surface control alloy substrates and methods of manufacture therefor

    Energy Technology Data Exchange (ETDEWEB)

    Fritzemeier, Leslie G. (Mendon, MA); Li, Qi (Marlborough, MA); Rupich, Martin W. (Framingham, MA); Thompson, Elliott D. (Coventry, RI); Siegal, Edward J. (Malden, MA); Thieme, Cornelis Leo Hans (Westborough, MA); Annavarapu, Suresh (Brookline, MA); Arendt, Paul N. (Los Alamos, NM); Foltyn, Stephen R. (Los Alamos, NM)

    2004-05-04

    Methods and articles for controlling the surface of an alloy substrate for deposition of an epitaxial layer. The invention includes the use of an intermediate layer to stabilize the substrate surface against oxidation for subsequent deposition of an epitaxial layer.

  8. Hopping models for ion conduction in noncrystals

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2007-01-01

    semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

  9. Trainable Methods for Surface Natural Language Generation

    OpenAIRE

    Ratnaparkhi, Adwait

    2000-01-01

    We present three systems for surface natural language generation that are trainable from annotated corpora. The first two systems, called NLG1 and NLG2, require a corpus marked only with domain-specific semantic attributes, while the last system, called NLG3, requires a corpus marked with both semantic attributes and syntactic dependency information. All systems attempt to produce a grammatical natural language phrase from a domain-specific semantic representation. NLG1 serves a baseline syst...

  10. Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

    Directory of Open Access Journals (Sweden)

    Wang Xue-Wen

    2016-01-01

    Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

  11. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  12. Degradation of hop bitter acids by fungi

    International Nuclear Information System (INIS)

    Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

    2008-01-01

    Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

  13. Surface renewal method for estimating sensible heat flux | Mengistu ...

    African Journals Online (AJOL)

    For short canopies, latent energy flux may be estimated using a shortened surface energy balance from measurements of sensible and soil heat flux and the net irradiance at the surface. The surface renewal (SR) method for estimating sensible heat, latent energy, and other scalar fluxes has the advantage over other ...

  14. Method for treatment of a surface area of steel

    NARCIS (Netherlands)

    Bhowmik, S.; Aaldert, P.J.

    2009-01-01

    The invention relates to a method for treatment of a surface area of steel by polishing said surface area and performing a plasma treatment of said surface area wherein the plasma treatment is performed at at least atmospheric conditions and wherein the plasma treatment is carried out at a power of

  15. Applying isotope methods in flowing surface waters

    International Nuclear Information System (INIS)

    Mook, W.G.

    1976-01-01

    The most frequent application of natural or environmental isotopes to investigate surface water is as tracer. Especially the natural variations in the 18 O/ 16 O ratio in rainfall are traced in streams and rivers. The isotopes deuterium, 13 C and 14 C enable refined applications such as the investigation of geochemical processes in waters. 18 O analyses are fairly fast (20 samples per day can be carried out) and require little water (1 to 10 ml). Therefore, the natural variations in the 18 O/ 16 O ratio of water are treated. There is a certain connection between the 18 O/ 16 O and D/H ratios in rainfall waters. 18 O analyses are somewhat easier to perform so that this technique is generally preferred. Additional D analyses are of great use in detecting geochemical processes, e.g. evaporation. Although tritium is still an important agent in hydrological studies, the concentration variations in nature are now lower than for 18 O compared to the usual experimental error. Furthermore, they are not so important geochemically. Accurate tritium measurements require relatively much time (1 or 2 analyses per day), are expensive (50 DM to 150 DM) and require more material (10 to 500 ml water), depending on the desired accuracy. The stable and radioactive carbon isotopes are mainly used in special cases to study certain geochemical processes. (orig./HK) [de

  16. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  17. Chemical method for producing smooth surfaces on silicon wafers

    Science.gov (United States)

    Yu, Conrad

    2003-01-01

    An improved method for producing optically smooth surfaces in silicon wafers during wet chemical etching involves a pre-treatment rinse of the wafers before etching and a post-etching rinse. The pre-treatment with an organic solvent provides a well-wetted surface that ensures uniform mass transfer during etching, which results in optically smooth surfaces. The post-etching treatment with an acetic acid solution stops the etching instantly, preventing any uneven etching that leads to surface roughness. This method can be used to etch silicon surfaces to a depth of 200 .mu.m or more, while the finished surfaces have a surface roughness of only 15-50 .ANG. (RMS).

  18. ROUGHNESS ON WOOD SURFACES AND ROUGHNESS MEASUREMENT METHODS

    Directory of Open Access Journals (Sweden)

    İsmail Aydın

    2003-04-01

    Full Text Available Some visual characteristics of wood such as color, pattern and texture determine the quality of manufactured products. Surface properties of wood material are important both in production and marketing after production. Initial studies related to the roughness of wood surface were begun in early 1950’s. However, no general agreed standardization can not have been developed for wood surfaces. Surface roughness of wood is function of the production process, product type and the natural anatomical properties of wood. Contact and non-contact tracing methods are used to measure of wood surface roughness. Surface roughness also affects the gluability and wettability of wood surfaces. The success in finishing also depends on the surface roughness of wood.

  19. Formation of Reflecting Surfaces Based on Spline Methods

    Science.gov (United States)

    Zamyatin, A. V.; Zamyatina, E. A.

    2017-11-01

    The article deals with problem of reflecting barriers surfaces generation by spline methods. The cases of reflection when a geometric model is applied are considered. The surfaces of reflecting barriers are formed in such a way that they contain given points and the rays reflected at these points and hit at the defined points of specified surface. The reflecting barrier surface is formed by cubic splines. It enables a comparatively simple implementation of proposed algorithms in the form of software applications. The algorithms developed in the article can be applied in architecture and construction design for reflecting surface generation in optics and acoustics providing the geometrical model of reflex processes is used correctly.

  20. System and method for extracting a sample from a surface

    Science.gov (United States)

    Van Berkel, Gary; Covey, Thomas

    2015-06-23

    A system and method is disclosed for extracting a sample from a sample surface. A sample is provided and a sample surface receives the sample which is deposited on the sample surface. A hydrophobic material is applied to the sample surface, and one or more devices are configured to dispense a liquid on the sample, the liquid dissolving the sample to form a dissolved sample material, and the one or more devices are configured to extract the dissolved sample material from the sample surface.

  1. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  2. Evaluation of surface sampling method performance for Bacillus Spores on clean and dirty outdoor surfaces.

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Mollye C.; Einfeld, Wayne; Boucher, Raymond M.; Brown, Gary Stephen; Tezak, Matthew Stephen

    2011-06-01

    Recovery of Bacillus atrophaeous spores from grime-treated and clean surfaces was measured in a controlled chamber study to assess sampling method performance. Outdoor surfaces investigated by wipe and vacuum sampling methods included stainless steel, glass, marble and concrete. Bacillus atrophaeous spores were used as a surrogate for Bacillus anthracis spores in this study designed to assess whether grime-coated surfaces significantly affected surface sampling method performance when compared to clean surfaces. A series of chamber tests were carried out in which known amounts of spores were allowed to gravitationally settle onto both clean and dirty surfaces. Reference coupons were co-located with test coupons in all chamber experiments to provide a quantitative measure of initial surface concentrations of spores on all surfaces, thereby allowing sampling recovery calculations. Results from these tests, carried out under both low and high humidity conditions, show that spore recovery from grime-coated surfaces is the same as or better than spore recovery from clean surfaces. Statistically significant differences between method performance for grime-coated and clean surfaces were observed in only about half of the chamber tests conducted.

  3. Alternative methods to model frictional contact surfaces using NASTRAN

    Science.gov (United States)

    Hoang, Joseph

    1992-01-01

    Elongated (slotted) holes have been used extensively for the integration of equipment into Spacelab racks. In the past, this type of interface has been modeled assuming that there is not slippage between contact surfaces, or that there is no load transfer in the direction of the slot. Since the contact surfaces are bolted together, the contact friction provides a load path determined by the normal applied force (bolt preload) and the coefficient of friction. Three alternate methods that utilize spring elements, externally applied couples, and stress dependent elements are examined to model the contacted surfaces. Results of these methods are compared with results obtained from methods that use GAP elements and rigid elements.

  4. Surface-activated joining method for surveillance coupon reconstitution

    International Nuclear Information System (INIS)

    Kaihara, Shoichiro; Nakamura, Terumi

    1993-01-01

    As nuclear power plants approach the end of their license periods and license renewal is contemplated, there is an increasing need to expand the data base of mechanical properties obtainable from archival surveillance specimens. A new joining method for reconstituting broken Charpy specimens is being developed, the objective being to retain the original properties of the material in the process. The new method is called surface-activated joining (SAJ). It is designed to obtain a good junction without applying extra heating and deformation. In particular, the purpose of SAJ is to minimize the width of the heat-affected zone (HAZ) and to decrease the maximum temperature experienced by the specimen during reconsolidation of the two pieces. Generally, machined metal surfaces are contaminated with films of oxide, adsorbed gas, oil, or other vapors that impede bonding of surfaces during joining. However, if surface contamination is removed and the two surfaces are mated as closely as possible, joining can be achieved at low temperatures and modest stress levels. In order to apply the SAJ method, the following requirements must be met: (1) inert atmosphere to protect the surfaces from atmospheric gases and oxidation; (2) removal of the existing contamination layers to activate the surfaces; and (3) method for bringing the two surfaces into very intimate contact prior to joining

  5. Method for Surface Scanning in Medical Imaging and Related Apparatus

    DEFF Research Database (Denmark)

    2015-01-01

    A method and apparatus for surface scanning in medical imaging is provided. The surface scanning apparatus comprises an image source, a first optical fiber bundle comprising first optical fibers having proximal ends and distal ends, and a first optical coupler for coupling an image from the image...

  6. Agrochemical lead optimization by scaffold hopping.

    Science.gov (United States)

    Lamberth, Clemens

    2018-02-01

    Scaffold hopping, the exchange of a specific portion of a potential active ingredient with another substructure with the aim of finding isofunctional molecular structures with significantly different molecular backbones, often offers the chance in lead discovery or optimization to mitigate problems related to toxicity, intellectual property, and insufficient potency or stability. Scaffold hopping tools such as isosteric ring replacement including 1,3 nitrogen shift and cyclic imine-amide isosterism, but also ring opening and ring closure approaches, functional group isosterism, reversion of functional groups, chain shortening, chain lengthening, and scaffolds delivered by natural products, have become a permanent fixture of the innovation and optimization process in crop protection research. Their appropriate use will be explained through examples of success stories in the field of agrochemistry. Analogies to, but also differences from, the main categories of scaffold hopping in medicinal drug discovery are discussed. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  7. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenyang [Department of Bioengineering, University of California, Los Angeles, California 90095 (United States); Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J.; Sawant, Amit [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas 75390 (United States); Ruan, Dan, E-mail: druan@mednet.ucla.edu [Department of Bioengineering, University of California, Los Angeles, California 90095 and Department of Radiation Oncology, University of California, Los Angeles, California 90095 (United States)

    2015-11-15

    Purpose: To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). Methods: The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. Results: On phantom point clouds, their method

  8. Effect of Storage Duration and Atmosphere on the Content and Price of Hop Alpha Bitter Acids

    Directory of Open Access Journals (Sweden)

    Rybka A.

    2017-12-01

    Full Text Available The quality of hops is significantly affected by the content of alpha bitter acids. Maintaining it with minimum losses lies within the competence of both the hop grower and processor depending on how they follow the optimum harvest technology, storage conditions, and post-harvest hop processing. That indicator is considerably affected by the hop storage method, i.e. whether the warehouse is air-conditioned or not, as well as the storage duration. The alpha bitter acid content should not be reduced during storage. The objective of this paper is an analysis of the alpha bitter acid content in the Saaz hop variety in a technological sequence of operations starting with drying at the grower and finishing with six-month storing at the processor, with three storage variants: an air-conditioned warehouse, non-conditioned warehouse, and a variant in which the square bale is moved after 60 days from a non-conditioned warehouse into an air-conditioned warehouse. The analysis of samples to identify the alpha bitter acid content was carried out by means of the ASBC Hops-6 and the HPLC EBC 7.7 methods. Practically in all cases the alpha content declines, although if a square bale is placed in an air-conditioned warehouse this decline is the lowest depending on the storage duration. The economic analysis shows a significant profit referring to the price of alpha contained in 1 t of hops stored in an air-conditioned warehouse. At the date of 1/11/2015 this profit was 14 706 CZK, at the date of 4/1/2016 it was 7646 CZK, and at 1/3/2016 the profit was 6587 CZK.

  9. Interferometric method for measuring high velocities of diffuse surfaces

    International Nuclear Information System (INIS)

    Maron, Y.

    1978-01-01

    An interferometric method for measuring the displacement of diffuse surfaces moving with velocities of a few microsecond is presented. The method utilizes the interference between two light beams reflected from a constant area of the moving surface at two different angles. It enables the detection of high rate velocity variations. Light source of a fairly low temporal coherence and power around 100mW is needed. (author)

  10. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

    Science.gov (United States)

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

    2015-03-01

    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

  11. Epigenetic Stability of Cryopreserved and Cold-Stored Hops

    Science.gov (United States)

    Three hop accessions representative of commercially cultivated hops were selected for the analysis of epigenetic stability; females of different origins, including a cultivar developed in New Zealand (Calicross) from American cultivars, a landrace derived European cultivar (Tardif de Bourgogne), and...

  12. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system.

    Science.gov (United States)

    Liu, Wenyang; Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J; Sawant, Amit; Ruan, Dan

    2015-11-01

    To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. On phantom point clouds, their method achieved submillimeter

  13. Surface treatment and protection method for cadmium zinc telluride crystals

    Science.gov (United States)

    Wright, Gomez W.; James, Ralph B.; Burger, Arnold; Chinn, Douglas A.

    2003-01-01

    A method for treatment of the surface of a CdZnTe (CZT) crystal that provides a native dielectric coating to reduce surface leakage currents and thereby, improve the resolution of instruments incorporating detectors using CZT crystals. A two step process is disclosed, etching the surface of a CZT crystal with a solution of the conventional bromine/methanol etch treatment, and after attachment of electrical contacts, passivating the CZT crystal surface with a solution of 10 w/o NH.sub.4 F and 10 w/o H.sub.2 O.sub.2 in water.

  14. Surface Treatment And Protection Method For Cadium Zinc Telluride Crystals

    Science.gov (United States)

    Wright, Gomez W.; James, Ralph B.; Burger, Arnold; Chinn, Douglas A.

    2006-02-21

    A method for treatment of the surface of a CdZnTe (CZT) crystal that provides a native dielectric coating to reduce surface leakage currents and thereby, improve the resolution of instruments incorporating detectors using CZT crystals. A two step process is disclosed, etching the surface of a CZT crystal with a solution of the conventional bromine/methanol etch treatment, and after attachment of electrical contacts, passivating the CZT crystal surface with a solution of 10 w/o NH4F and 10 w/o H2O2 in water.

  15. Neural control of leg stiffness during hopping in boys and men.

    Science.gov (United States)

    Oliver, J L; Smith, P M

    2010-10-01

    The purpose of the study was to investigate whether boys and men utilise different control strategies whilst hopping. Eleven boys (11-12yr old) and ten men completed hopping at 1.5Hz, 3.0Hz and at their preferred frequency. A footswitch measured contact and flight times, from which leg stiffness was calculated. Simultaneously, surface electromyograms (EMGs) of selected lower limb muscles were recorded and quantified for each 30ms period during the first 120ms post-ground contact. At 1.5Hz there were no differences between the groups in relative stiffness or muscle activity. At 3.0Hz men had significantly shorter contact times (P=0.013), longer flight times (P=0.002), greater relative stiffness (P=0.01) and significantly greater soleus (P=0.012) and vastus lateralis (Pboys (P=0.007), with greater leg stiffness (PBoys and men demonstrated similar control strategies when hopping at a slow frequency, but when hopping frequency increased men were able to better increase feedforward and reflex muscle activity to hop with greater relative stiffness. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  16. Comparison study of intraoperative surface acquisition methods for surgical navigation.

    Science.gov (United States)

    Simpson, Amber L; Burgner, Jessica; Glisson, Courtenay L; Herrell, S Duke; Ma, Burton; Pheiffer, Thomas S; Webster, Robert J; Miga, Michael I

    2013-04-01

    Soft-tissue image-guided interventions often require the digitization of organ surfaces for providing correspondence from medical images to the physical patient in the operating room. In this paper, the effect of several inexpensive surface acquisition techniques on target registration error and surface registration error (SRE) for soft tissue is investigated. A systematic approach is provided to compare image-to-physical registrations using three different methods of organ spatial digitization: 1) a tracked laser-range scanner (LRS), 2) a tracked pointer, and 3) a tracked conoscopic holography sensor (called a conoprobe). For each digitization method, surfaces of phantoms and biological tissues were acquired and registered to CT image volume counterparts. A comparison among these alignments demonstrated that registration errors were statistically smaller with the conoprobe than the tracked pointer and LRS (pconoscopic holography) of digitizing surfaces for clinical usage. The tracked conoscopic holography device outperforms LRS acquisitions with respect to registration accuracy.

  17. Laser method of acoustical emission control from vibrating surfaces

    Science.gov (United States)

    Motyka, Zbigniew

    2013-01-01

    For limitation of the noise in environment, the necessity occurs of determining and location of sources of sounds emitted from surfaces of many machines and devices, assuring in effect the possibility of suitable constructional changes implementation, targeted at decreasing of their nuisance. In the paper, the results of tests and calculations are presented for plane surface sources emitting acoustic waves. The tests were realized with the use of scanning laser vibrometer which enabled remote registration and the spectral analysis of the surfaces vibrations. The known hybrid digital method developed for determination of sound wave emission from such surfaces divided into small finite elements was slightly modified by distinguishing the phase correlations between such vibrating elements. The final method being developed may find use in wide range of applications for different forms of vibrations of plane surfaces.

  18. A GPU-based mipmapping method for water surface visualization

    Science.gov (United States)

    Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan

    2018-03-01

    Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

  19. Study on a resource allocation scheme in multi-hop MIMO-OFDM systems over lognormal-rayleigh compound channels

    Directory of Open Access Journals (Sweden)

    LIU Jun

    2015-10-01

    Full Text Available For new generation wireless communication networks,this paper studies the optimization of the capacity and end-to-end throughput of the MIMO-OFDM based multi-hop relay systems.A water-filling power allocation method is proposed to improve the channel capacity and the throughput of the MIMO-OFDM system based multi-hop relay system in the Lognormal-Rayleigh shadowing compound channels.Simulations on the capacity and throughput show that the water-filling algorithm can improve the system throughput effectively in the MIMO-OFDM multi-hop relay system.

  20. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  1. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  2. Bounds on the hop domination number of a tree

    Indian Academy of Sciences (India)

    A hop dominating set of a graph is a set of vertices of if for every vertex of () \\ D, there exists u ∈ D such that (, ) = 2. The hop domination number of a graph , denoted by ℎ(), is the minimum cardinality of a hop dominating set of . We prove that for every tree of order with leaves and support ...

  3. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  4. Performance analysis of multi-hop wireless packet networks

    Directory of Open Access Journals (Sweden)

    Lim J.-T.

    1997-01-01

    Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

  5. Detecting mode hopping in single-longitudinal-mode fiber ring lasers based on an unbalanced fiber Michelson interferometer.

    Science.gov (United States)

    Ma, Mingxiang; Hu, Zhengliang; Xu, Pan; Wang, Wei; Hu, Yongming

    2012-10-20

    A method of detecting mode hopping for single-longitudinal-mode (SLM) fiber ring lasers has been proposed and experimentally demonstrated. The method that is based on an unbalanced Michelson interferometer (MI) utilizing phase generated carrier modulation instantly transforms mode-hopping dynamics into steep phase changes of the interferometer. Multiform mode hops in an SLM erbium-doped fiber ring laser with an 18.6 MHz mode spacing have been detected exactly in real-time domain and discussed in detail. Numerical results show that the MI-based method has a high testing sensitivity for identifying mode hopping, which will play a significant role in evaluating the output stability of SLM fiber lasers.

  6. Application of Ultrasonic Sensors in Road Surface Condition Distinction Methods

    Directory of Open Access Journals (Sweden)

    Shota Nakashima

    2016-10-01

    Full Text Available The number of accidents involving elderly individuals has been increasing with the increase of the aging population, posing increasingly serious challenges. Most accidents are caused by reduced judgment and physical abilities, which lead to severe consequences. Therefore, studies on support systems for elderly and visually impaired people to improve the safety and quality of daily life are attracting considerable attention. In this study, a road surface condition distinction method using reflection intensities obtained by an ultrasonic sensor was proposed. The proposed method was applied to movement support systems for elderly and visually impaired individuals to detect dangerous road surfaces and give an alarm. The method did not perform well in previous studies of puddle detection, because the alert provided by the method did not enable users to avoid puddles. This study extended the method proposed by previous studies with respect to puddle detection ability. The findings indicate the effectiveness of the proposed method by considering four road surface conditions. The proposed method could detect puddle conditions. The effectiveness of the proposed method was verified in all four conditions, since users could differentiate between road surface conditions and classify the conditions as either safe or dangerous.

  7. METHOD FOR FABRICATING NANOSCALE PATTERNS ON A SURFACE

    DEFF Research Database (Denmark)

    2000-01-01

    A novel method to fabricate nanoscale pits on Au(111) surfaces in contact with aqueous solution is claimed. The method uses in situ electrochemical scanning tunnelling microscopy with independent electrochemical substrate and tip potential control and very small bias voltages. This is significantly...

  8. The Rap on Hip-Hop

    Science.gov (United States)

    Piekarski, Bill

    2004-01-01

    From its humble origins some 30 years ago in New York's bombed-out, poverty-ravaged South Bronx, hip-hop has risen to become a dominant cultural force both here and abroad. Strictly defined, the term refers to the entire cultural constellation that accompanies rap music, which in 2001 surpassed country music as the most popular musical genre in…

  9. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  10. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  11. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  12. Quantifying Uncertainty in Near Surface Electromagnetic Imaging Using Bayesian Methods

    Science.gov (United States)

    Blatter, D. B.; Ray, A.; Key, K.

    2017-12-01

    Geoscientists commonly use electromagnetic methods to image the Earth's near surface. Field measurements of EM fields are made (often with the aid an artificial EM source) and then used to infer near surface electrical conductivity via a process known as inversion. In geophysics, the standard inversion tool kit is robust and can provide an estimate of the Earth's near surface conductivity that is both geologically reasonable and compatible with the measured field data. However, standard inverse methods struggle to provide a sense of the uncertainty in the estimate they provide. This is because the task of finding an Earth model that explains the data to within measurement error is non-unique - that is, there are many, many such models; but the standard methods provide only one "answer." An alternative method, known as Bayesian inversion, seeks to explore the full range of Earth model parameters that can adequately explain the measured data, rather than attempting to find a single, "ideal" model. Bayesian inverse methods can therefore provide a quantitative assessment of the uncertainty inherent in trying to infer near surface conductivity from noisy, measured field data. This study applies a Bayesian inverse method (called trans-dimensional Markov chain Monte Carlo) to transient airborne EM data previously collected over Taylor Valley - one of the McMurdo Dry Valleys in Antarctica. Our results confirm the reasonableness of previous estimates (made using standard methods) of near surface conductivity beneath Taylor Valley. In addition, we demonstrate quantitatively the uncertainty associated with those estimates. We demonstrate that Bayesian inverse methods can provide quantitative uncertainty to estimates of near surface conductivity.

  13. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  14. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  15. Inhibition of human cytochrome P450 enzymes by hops (Humulus lupulus) and hop prenylphenols.

    Science.gov (United States)

    Yuan, Yang; Qiu, Xi; Nikolić, Dejan; Chen, Shao-Nong; Huang, Ke; Li, Guannan; Pauli, Guido F; van Breemen, Richard B

    2014-03-12

    As hops (Humulus lupulus L.) are used in the brewing of beer and by menopausal women as estrogenic dietary supplements, the potential for hop extracts and hop constituents to cause drug-botanical interactions by inhibiting human cytochrome P450 enzymes was investigated. Inhibition of major human cytochrome P450 enzymes by a standardized hop extract and isolated hop prenylated phenols was evaluated using a fast and efficient assay based on ultrahigh pressure liquid chromatography-tandem mass spectrometry. The hop extract at 5 μg/mL inhibited CYP2C8 (93%), CYP2C9 (88%), CYP2C19 (70%), and CYP1A2 (27%) with IC50 values of 0.8, 0.9, 3.3, and 9.4 μg/mL, respectively, but time-dependent inactivation was observed only for CYP1A2. Isoxanthohumol from hops was the most potent inhibitor of CYP2C8 with an IC50 of 0.2 μM, whereas 8-prenylnaringenin was the most potent inhibitor of CYP1A2, CYP2C9 and CYP2C19 with IC50 values of 1.1 μM, 1.1 μM and 0.4 μM, respectively. Extracts of hops contain prenylated compounds such as the flavanones isoxanthohumol and 8-prenylnaringenin and the chalcone xanthohumol that can inhibit CYP450s, especially the CYP2C family, which may affect the efficacy and safety of some CYP2C substrate drugs when co-administered. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Optical description and design method with annularly stitched aspheric surface.

    Science.gov (United States)

    Cheng, De-Wen; Chen, Xue-Jiao; Xu, Chen; Hu, Yuan; Wang, Yong-Tian

    2015-12-01

    The relentless pressure for designs with new optical functions, small volume, and light weight has greatly increased the importance of aspheric surfaces. In this paper, we propose an annularly stitched aspheric surface (ASAS) description method to increase the freedom and flexibility of imaging system design. The rotationally symmetric ASAS consists of a circular central zone and one or more annular zones. Two neighboring zones are constrained to have the same derivatives on their joint curve, and this means the ASAS is C1 continuous. This finding is proved and verified by the mathematical deduction of the surface formulas. Two optimization strategies and two design methods with the C1 continuous constraints are also discussed. This surface can greatly facilitate the design and even achieve some previously impossible designs without increasing the fabrication difficulty. Two different systems with the proposed ASAS are optimized and the results are presented. The design results verified the practicability of the ASAS.

  17. Multiscale Finite Element Methods for Flows on Rough Surfaces

    KAUST Repository

    Efendiev, Yalchin

    2013-01-01

    In this paper, we present the Multiscale Finite Element Method (MsFEM) for problems on rough heterogeneous surfaces. We consider the diffusion equation on oscillatory surfaces. Our objective is to represent small-scale features of the solution via multiscale basis functions described on a coarse grid. This problem arises in many applications where processes occur on surfaces or thin layers. We present a unified multiscale finite element framework that entails the use of transformations that map the reference surface to the deformed surface. The main ingredients of MsFEM are (1) the construction of multiscale basis functions and (2) a global coupling of these basis functions. For the construction of multiscale basis functions, our approach uses the transformation of the reference surface to a deformed surface. On the deformed surface, multiscale basis functions are defined where reduced (1D) problems are solved along the edges of coarse-grid blocks to calculate nodalmultiscale basis functions. Furthermore, these basis functions are transformed back to the reference configuration. We discuss the use of appropriate transformation operators that improve the accuracy of the method. The method has an optimal convergence if the transformed surface is smooth and the image of the coarse partition in the reference configuration forms a quasiuniform partition. In this paper, we consider such transformations based on harmonic coordinates (following H. Owhadi and L. Zhang [Comm. Pure and Applied Math., LX(2007), pp. 675-723]) and discuss gridding issues in the reference configuration. Numerical results are presented where we compare the MsFEM when two types of deformations are used formultiscale basis construction. The first deformation employs local information and the second deformation employs a global information. Our numerical results showthat one can improve the accuracy of the simulations when a global information is used. © 2013 Global-Science Press.

  18. Experimental Method for Measuring Dust Load on Surfaces in Rooms

    DEFF Research Database (Denmark)

    Lengweiler, Philip; Nielsen, Peter V.; Moser, Alfred

    , there is a need for better understanding of the mechanism of dust deposition and resuspension. With the presented experimental setup, the dust load on surfaces in a channel can be measured as a function of the environmental and surface conditions and the type of particles under controlled laboratory conditions.......A new experimental setup to investigate the physical process of dust deposition and resuspension on and from surfaces is introduced. Dust deposition can reduce the airborne dust concentration considerably. As a basis for developing methods to eliminate dust-related problems in rooms...

  19. Noise robustness of interferometric surface topography evaluation methods. Correlogram correlation

    Science.gov (United States)

    Kiselev, Ilia; Kiselev, Egor I.; Drexel, Michael; Hauptmannl, Michael

    2017-12-01

    Different surface height estimation methods are differently affected by interferometric noise. From a theoretical analysis we obtain height variance estimators for the methods. The estimations allow us to rigorously compare the noise robustness of popular evaluation algorithms. The envelope methods have the highest variances and hence the lowest noise resistances. The noise robustness improves from the envelope to the phase methods, but a technique involving the correlation of correlograms is superior even to the latter. We dwell on some details of this correlogram correlation method and the range of its application.

  20. Multi-hop localization algorithm based on grid-scanning for wireless sensor networks.

    Science.gov (United States)

    Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian

    2011-01-01

    For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

  1. Cascading Multi-Hop Reservation and Transmission in Underwater Acoustic Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jae-Won Lee

    2014-10-01

    Full Text Available The long propagation delay in an underwater acoustic channel makes designing an underwater media access control (MAC protocol more challenging. In particular, handshaking-based MAC protocols widely used in terrestrial radio channels have been known to be inappropriate in underwater acoustic channels, because of the inordinately large latency involved in exchanging control packets. Furthermore, in the case of multi-hop relaying in a hop-by-hop handshaking manner, the end-to-end delay significantly increases. In this paper, we propose a new MAC protocol named cascading multi-hop reservation and transmission (CMRT. In CMRT, intermediate nodes between a source and a destination may start handshaking in advance for the next-hop relaying before handshaking for the previous node is completed. By this concurrent relaying, control packet exchange and data delivery cascade down to the destination. In addition, to improve channel utilization, CMRT adopts a packet-train method where multiple data packets are sent together by handshaking once. Thus, CMRT reduces the time taken for control packet exchange and accordingly increases the throughput. The performance of CMRT is evaluated and compared with that of two conventional MAC protocols (multiple-access collision avoidance for underwater (MACA-U and MACA-U with packet trains (MACA-UPT. The results show that CMRT outperforms other MAC protocols in terms of both throughput and end-to-end delay.

  2. 3D electric field calculation with surface charge method

    International Nuclear Information System (INIS)

    Yamada, S.

    1992-01-01

    This paper describes an outline and some examples of three dimensional electric field calculations with a computer code developed at NIRS. In the code, a surface charge method is adopted because of it's simplicity in the mesh establishing procedure. The charge density in a triangular mesh is assumed to distribute with a linear function of the position. The electric field distribution is calculated for a pair of drift tubes with the focusing fingers on the opposing surfaces. The field distribution in an acceleration gap is analyzed with a Fourier-Bessel series expansion method. The calculated results excellently reproduces the measured data with a magnetic model. (author)

  3. Electronic transport of molecular nanowires by considering of electron hopping energy between the second neighbors

    Directory of Open Access Journals (Sweden)

    H Rabani

    2015-07-01

    Full Text Available In this paper, we study the electronic conductance of molecular nanowires by considering the electron hopping between the first and second neighbors with the help Green’s function method at the tight-binding approach. We investigate three types of structures including linear uniform and periodic chains as well as poly(p-phenylene molecule which are embedded between two semi-infinite metallic leads. The results show that in the second neighbor approximation, the resonance, anti-resonance and Fano phenomena occur in the conductance spectra of these structures. Moreover, a new gap is observed at edge of the lead energy band wich its width depends on the value of the electron hopping energy between the second neighbors. In the systems including intrinsic gap, this hopping energy shifts the gap in the energy spectra.

  4. Identification and quantification of the oxidation products derived from α-acids and β-acids during storage of hops ( Humulus lupulus L.).

    Science.gov (United States)

    Taniguchi, Yoshimasa; Matsukura, Yasuko; Ozaki, Hiromi; Nishimura, Koichi; Shindo, Kazutoshi

    2013-03-27

    α-Acids and β-acids, two main components of hop resin, are known to be susceptible to oxygen and degraded during hop storage, although the oxidation products in stored hops have not been fully identified. In this study, we developed a high-performance liquid chromatography (HPLC) analysis method suitable for separation and quantification of the oxidation products. This HPLC analysis clearly proved, for the first time, that humulinones and hulupones are major products in oxidized hops. We are also the first to identify novel 4'-hydroxy-allohumulinones, suggested to be oxidative products of humulinones, by means of NMR spectroscopy and high-resolution mass spectrometry. Using the developed analytical method, changes in α- and β-acids and their oxidation products during hop storage were clearly revealed for the first time.

  5. Correction of surface aberration in strain scanning method with analyzer

    International Nuclear Information System (INIS)

    Shobu, Takahisa; Mizuki, Junichiro; Suzuki, Kenji; Akiniwa, Yoshiaki; Tanaka, Keisuke

    2006-01-01

    When a gauge volume sank below a specimen surface, the diffraction angle shifts. Thus, it is required to correct the surface aberration. For the annealed specimen of S45C, the shift in the diffraction angle was investigated using a strain scanning method with Ge (111) analyzer. This phenomenon was caused by the difference in the centroid between the geometric and the instrumental gauge volumes. This difference is explained by the following factors; 1) the change in the gauge volume by the divergence of the analyzer, 2) the X-ray penetration depth, 3) the gap of the centre line between the double receiving slits due to mis-setting the analyzer. As a result, the correcting method considered into these factors was proposed. For the shot-peened specimens of S45C, the diffraction angles were measured and corrected by our method. The distribution of the residual stress agreed with that obtained by the removal method. (author)

  6. Hip-Hop Fight Club: Radical Theory, Education, and Practice in and beyond the Classroom

    Directory of Open Access Journals (Sweden)

    Jared A. Ball

    2013-10-01

    Full Text Available Hip-hop remains a viable method for the teaching of radical theory, emancipatory journalism and Africana Media Theory.  Fight Club is an emergent model that builds from existing hip-hop traditions of freetyle battling where critical thought and intellectual challenges of hueristic norms are upended.  This article argues in favor of bringing the Fight Club model into the classroom which allows for heightened student engagement and the inclusion of radical theoretical approaches to the study of mass media, communication and journalism.

  7. Charge transport in organic semiconductors: assessment of the mean field theory in the hopping regime.

    Science.gov (United States)

    Wang, Linjun; Beljonne, David

    2013-08-14

    The performance of the mean field theory to account for charge transfer rate in molecular dimers and charge transport mobility in molecular stacks with small intermolecular electronic coupling and large local electron-phonon coupling (i.e., in the hopping regime) is carefully investigated against various other approaches. Using Marcus formula as a reference, it is found that mean field theory with system-bath interaction and surface hopping approaches yield fully consistent charge transfer rates in dimers. However, in contrast to the dimer case, incorporating system-bath interaction in the mean field approach results in a completely wrong temperature dependence of charge carrier mobility in larger aggregates. Although the mean field simulation starting from the relaxed geometry of a charged molecule and neglecting system-bath interaction can reproduce thermally activated transport, it is not able to characterize properly the role of additional nonlocal electron-phonon couplings. Our study reveals that the mean field theory must be used with caution when studying charge transport in the hopping regime of organic semiconductors, where the surface hopping approach is generally superior.

  8. Method and Apparatus for Creating a Topography at a Surface

    Science.gov (United States)

    Adams, David P.; Sinclair, Michael B.; Mayer, Thomas M.; Vasile, Michael J.; Sweatt, William C.

    2008-11-11

    Methods and apparatus whereby an optical interferometer is utilized to monitor and provide feedback control to an integrated energetic particle column, to create desired topographies, including the depth, shape and/or roughness of features, at a surface of a specimen. Energetic particle columns can direct energetic species including, ions, photons and/or neutral particles to a surface to create features having in-plane dimensions on the order of 1 micron, and a height or depth on the order of 1 nanometer. Energetic processes can include subtractive processes such as sputtering, ablation, focused ion beam milling and, additive processes, such as energetic beam induced chemical vapor deposition. The integration of interferometric methods with processing by energetic species offers the ability to create desired topographies at surfaces, including planar and curved shapes.

  9. Multi-phase-field method for surface tension induced elasticity

    Science.gov (United States)

    Schiedung, Raphael; Steinbach, Ingo; Varnik, Fathollah

    2018-01-01

    A method, based on the multi-phase-field framework, is proposed that adequately accounts for the effects of a coupling between surface free energy and elastic deformation in solids. The method is validated via a number of analytically solvable problems. In addition to stress states at mechanical equilibrium in complex geometries, the underlying multi-phase-field framework naturally allows us to account for the influence of surface energy induced stresses on phase transformation kinetics. This issue, which is of fundamental importance on the nanoscale, is demonstrated in the limit of fast diffusion for a solid sphere, which melts due to the well-known Gibbs-Thompson effect. This melting process is slowed down when coupled to surface energy induced elastic deformation.

  10. Temperature sensitive surfaces and methods of making same

    Science.gov (United States)

    Liang, Liang [Richland, WA; Rieke, Peter C [Pasco, WA; Alford, Kentin L [Pasco, WA

    2002-09-10

    Poly-n-isopropylacrylamide surface coatings demonstrate the useful property of being able to switch charateristics depending upon temperature. More specifically, these coatings switch from being hydrophilic at low temperature to hydrophobic at high temperature. Research has been conducted for many years to better characterize and control the properties of temperature sensitive coatings. The present invention provides novel temperature sensitive coatings on articles and novel methods of making temperature sensitive coatings that are disposed on the surfaces of various articles. These novel coatings contain the reaction products of n-isopropylacrylamide and are characterized by their properties such as advancing contact angles. Numerous other characteristics such as coating thickness, surface roughness, and hydrophilic-to-hydrophobic transition temperatures are also described. The present invention includes articles having temperature-sensitve coatings with improved properties as well as improved methods for forming temperature sensitive coatings.

  11. Localized surface plasmon resonance mercury detection system and methods

    Science.gov (United States)

    James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.

    2016-03-22

    A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.

  12. Method and apparatus for aligning laser reflective surfaces

    International Nuclear Information System (INIS)

    Caruolo, A.B.; Davis, J.W.; Walch, A.P.

    1975-01-01

    Methods and apparatus used in the alignment of high power laser systems to obtain optimum performance are disclosed. An external source of visible radiation provides an alignment beam which is reflected along the axis of a resonator. Reflecting surfaces of the resonator are aligned with respect to the axis located by the visible beam

  13. An alternative safer and cost effective surface sterilization method for ...

    African Journals Online (AJOL)

    Regardless of its serious health effect, mercury chloride is frequently utilized for surface sterilization to mitigate microbial contamination in sugarcane tissue culture. The current study aimed at finding an alternative safer and cost effective sterilization method to substitute mercury chloride. In the study, sugarcane shoot tip ...

  14. Response surface method to optimize the low cost medium for ...

    African Journals Online (AJOL)

    A protease producing Bacillus sp. GA CAS10 was isolated from ascidian Phallusia arabica, Tuticorin, Southeast coast of India. Response surface methodology was employed for the optimization of different nutritional and physical factors for the production of protease. Plackett-Burman method was applied to identify ...

  15. Surface sterilization method for reducing microbial contamination of ...

    African Journals Online (AJOL)

    An effective disinfection method for strawberry (Fragaria x ananassa Duch.) cv. Senga Sengana micropropagation using runner tips and nodal segments as explants was developed. The explants were surface sterilized with different sterilants for different durations. The present studies on the effect of different regimes of ...

  16. Assessment methods of injection moulded nano-patterned surfaces

    DEFF Research Database (Denmark)

    Menotti, S.; Bisacco, G.; Hansen, H. N.

    2014-01-01

    algorithm for feature recognition. To compare the methods, the mould insert and a number of replicated nano-patterned surfaces, injection moulded with an induction heating aid, were measured on nominally identical locations by means of an atomic force microscope mounted on a manual CMM....

  17. An alternative safer and cost effective surface sterilization method for ...

    African Journals Online (AJOL)

    user

    2013-10-30

    Oct 30, 2013 ... Regardless of its serious health effect, mercury chloride is frequently utilized for surface sterilization to mitigate microbial contamination in sugarcane tissue culture. The current study aimed at finding an alternative safer and cost effective sterilization method to substitute mercury chloride. In the study,.

  18. Comparison of surface sampling methods for virus recovery from fomites.

    Science.gov (United States)

    Julian, Timothy R; Tamayo, Francisco J; Leckie, James O; Boehm, Alexandria B

    2011-10-01

    The role of fomites in infectious disease transmission relative to other exposure routes is difficult to discern due, in part, to the lack of information on the level and distribution of virus contamination on surfaces. Comparisons of studies intending to fill this gap are difficult because multiple different sampling methods are employed and authors rarely report their method's lower limit of detection. In the present study, we compare a subset of sampling methods identified from a literature review to demonstrate that sampling method significantly influences study outcomes. We then compare a subset of methods identified from the review to determine the most efficient methods for recovering virus from surfaces in a laboratory trial using MS2 bacteriophage as a model virus. Recoveries of infective MS2 and MS2 RNA are determined using both a plaque assay and quantitative reverse transcription-PCR, respectively. We conclude that the method that most effectively recovers virus from nonporous fomites uses polyester-tipped swabs prewetted in either one-quarter-strength Ringer's solution or saline solution. This method recovers a median fraction for infective MS2 of 0.40 and for MS2 RNA of 0.07. Use of the proposed method for virus recovery in future fomite sampling studies would provide opportunities to compare findings across multiple studies.

  19. Surface zwitterionization: Effective method for preventing oral bacterial biofilm formation on hydroxyapatite surfaces

    Science.gov (United States)

    Lee, Myoungjin; Kim, Heejin; Seo, Jiae; Kang, Minji; Kang, Sunah; Jang, Joomyung; Lee, Yan; Seo, Ji-Hun

    2018-01-01

    In this study, we conducted surface zwitterionization of hydroxyapatite (HA) surfaces by immersing them in the zwitterionic polymer solutions to provide anti-bacterial properties to the HA surface. Three different monomers containing various zwitterionic groups, i.e., phosphorylcholine (PC), sulfobetaine (SB), and carboxybetaine (CB), were copolymerized with the methacrylic monomer containing a Ca2+-binding moiety, using the free radical polymerization method. As a control, functionalization of the copolymer containing the Ca2+-binding moiety was synthesized using a hydroxy group. The stable immobilization of the zwitterionic functional groups was confirmed by water contact angle analysis and X-ray photoelectron spectroscopy (XPS) measurement conducted after the sonication process. The zwitterionized HA surface showed significantly decreased protein adsorption, whereas the hydroxyl group-coated HA surface showed limited efficacy. The anti-bacterial adhesion property was confirmed by conducting Streptococcus mutans (S. mutans) adhesion tests for 6 h and 24 h. When furanone C-30, a representative anti-quorum sensing molecule for S. mutans, was used, only a small amount of bacteria adhered after 6 h and the population did not increase after 24 h. In contrast, zwitterionized HA surfaces showed almost no bacterial adhesion after 6 h and the effect was retained for 24 h, resulting in the lowest level of oral bacterial adhesion. These results confirm that surface zwitterionization is a promising method to effectively prevent oral bacterial adhesion on HA-based materials.

  20. A novel test method for quantifying surface tack of polypropylene compound surfaces

    Directory of Open Access Journals (Sweden)

    2011-11-01

    Full Text Available While adhesiveness is required for polymer surfaces in special applications, tacky surfaces are generally undesirable in many applications like automotive interior parts. The tackiness of polymer surface results from a combination of composition and additivation, and it can change significantly in natural or accelerated ageing. Since there is no established, uniform method to characterize surface tack, the major focus of the present work was on the development of an objective quantification method. A setup having a soft die tip attached to a standard tensile tester was developed aiming for correlation to the human sense of touch. Three different model thermoplastic polyolefin (TPO compound formulations based on a high-impact isotactic polypropylene (iPP composition with varying amounts and types of anti-scratch additives were used for these investigations. As the surface tack phenomenon is related to ageing and weathering, the material’s examination was also performed after various intervals of weathering. The developed method allows a fast assessment of the effect of polymer composition variations and different additive formulations on surface tack and gives identical rankings as the standardized haptic panel.

  1. Advances in calibration methods for micro- and nanoscale surfaces

    Science.gov (United States)

    Leach, R. K.; Giusca, C. L.; Coupland, J. M.

    2012-04-01

    Optical surface topography measuring instrument manufacturers often quote accuracies of the order of nanometres and claim that the instruments can reliably measure a range of surfaces with structures on the micro- to nanoscale. However, for many years there has been debate about the interpretation of the data from optical surface topography measuring instruments. Optical artefacts in the output data and a lack of a calibration infrastructure mean that it can be difficult to get optical instruments to agree with contact stylus instruments. In this paper, the current situation with areal surface topography measurements is discussed along with the ISO specification standards that are in draft form. An infrastructure is discussed whereby the ISO-defined metrological characteristics of optical instruments can be determined, but these characteristics do not allow the instrument to measure complex surfaces. Current research into methods for determining the transfer function of optical instruments is reviewed, which will allow the calibration of optical instruments to measure complex surfaces, at least in the case of weak scattering. The ability of some optical instruments to measure outside the spatial bandwidth limitation of the numerical aperture is presented and some general outlook for future work given.

  2. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  3. Optical triangulation method for height measurements on water surfaces

    Science.gov (United States)

    Maas, Hans-Gerd; Hentschel, Bernd; Schreiber, Frank

    2003-01-01

    Optical triangulation methods based on a laser light sheet and a camera are frequently used as a surface measurement technique in a wide range of applications. They allow for the fast accurate determination of height profiles, based on relatively simple hardware and software configurations. Moreover, they can be implemented very efficiently and are especially suited for measurements on moving objects such as products on an assembly line. The study presented in the paper describes the adaptation of laser light sheet optical triangulation techniques to the task of water level profile measurements in hydromechanics experimental facilities. The properties of water surfaces necessitate several modifications of optical triangulation techniques to make them applicable: The mirror-like reflection properties of water surfaces form a contradiction to the assumption of diffuse reflection, on which standard light sheet triangulation techniques are based; this problem can be circumvented by using a diffuse reflecting projection plane to capture the mirror-like reflection of the laser line from the water surface. Due to the angle of incidence law, however, water surface tilts caused by waves will usually cause a strong degradation of the quality of the results when using reflected light; this effect can largely be compensated by processing max-store images derived from short image sequences rather than single images. These extensions of optical triangulation turned out to be crucial for the applicability of the method on water surfaces. Besides the theoretical concept and a sensitivity analysis of the method, a system configuration is outlined, and the results of a number of practical experiments are shown and discussed.

  4. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  5. Small polaron hopping in magnetic semiconductors

    International Nuclear Information System (INIS)

    Emin, D.; Liu, N.L.H.

    1978-01-01

    In a number of magnetic insulators it has been hypothesized that the charge carriers form small polarons. The transfer of an electron between magnetic sites and how the magnetic nature of the material affects the rate which characterizes small-polaron hops between magnetic sites were studied. The basic transfer processes are addressed from a many-electron point in which the itinerant electron is treated as indistinguishable from those which contribute unpaired spins at the magnetic sites

  6. Pedagogical Ideas on Sonic, Mediated, and Virtual Musical Landscapes: Teaching Hip Hop in a University Classroom

    Science.gov (United States)

    Dhokai, Niyati

    2012-01-01

    Based on the experience of teaching the history of American hip hop music to a classroom of Canadian university students, the author considers the disjuncture between the cultural orientations of herself and her students. The author considers teaching methods to solve the place-based disjuncture that often occurs when teaching genres such as hip…

  7. SHOP: receptor-based scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Liljefors, Tommy; Sørensen, Morten D

    2009-01-01

    A new field-derived 3D method for receptor-based scaffold hopping, implemented in the software SHOP, is presented. Information from a protein-ligand complex is utilized to substitute a fragment of the ligand with another fragment from a database of synthetically accessible scaffolds. A GRID...

  8. Method for Reduction of Silver Biocide Plating on Metal Surfaces

    Science.gov (United States)

    Steele, John; Nalette, Timothy; Beringer, Durwood

    2013-01-01

    Silver ions in aqueous solutions (0.05 to 1 ppm) are used for microbial control in water systems. The silver ions remain in solution when stored in plastic containers, but the concentration rapidly decreases to non-biocidal levels when stored in metal containers. The silver deposits onto the surface and is reduced to non-biocidal silver metal when it contacts less noble metal surfaces, including stainless steel, titanium, and nickel-based alloys. Five methods of treatment of contact metal surfaces to deter silver deposition and reduction are proposed: (1) High-temperature oxidation of the metal surface; (2) High-concentration silver solution pre-treatment; (3) Silver plating; (4) Teflon coat by vapor deposition (titanium only); and (5) A combination of methods (1) and (2), which proved to be the best method for the nickel-based alloy application. The mechanism associated with surface treatments (1), (2), and (5) is thought to be the development of a less active oxide layer that deters ionic silver deposition. Mechanism (3) is an attempt to develop an equilibrium ionic silver concentration via dissolution of metallic silver. Mechanism (4) provides a non-reactive barrier to deter ionic silver plating. Development testing has shown that ionic silver in aqueous solution was maintained at essentially the same level of addition (0.4 ppm) for up to 15 months with method (5) (a combination of methods (1) and (2)), before the test was discontinued for nickel-based alloys. Method (1) resulted in the maintenance of a biocidal level (approximately 0.05 ppm) for up to 10 months before that test was discontinued for nickel-based alloys. Methods (1) and (2) used separately were able to maintain ionic silver in aqueous solution at essentially the same level of addition (0.4 ppm) for up to 10 months before the test was discontinued for stainless steel alloys. Method (3) was only utilized for titanium alloys, and was successful at maintaining ionic silver in aqueous solution at

  9. Methods to study microbial adhesion on abiotic surfaces

    Directory of Open Access Journals (Sweden)

    Ana Meireles

    2015-09-01

    Full Text Available Microbial biofilms are a matrix of cells and exopolymeric substances attached to a wet and solid surface and are commonly associated to several problems, such as biofouling and corrosion in industries and infectious diseases in urinary catheters and prosthesis. However, these cells may have several benefits in distinct applications, such as wastewater treatment processes, microbial fuel cells for energy production and biosensors. As microbial adhesion is a key step on biofilm formation, it is very important to understand and characterize microbial adhesion to a surface. This study presents an overview of predictive and experimental methods used for the study of bacterial adhesion. Evaluation of surface physicochemical properties have a limited capacity in describing the complex adhesion process. Regarding the experimental methods, there is no standard method or platform available for the study of microbial adhesion and a wide variety of methods, such as colony forming units counting and microscopy techniques, can be applied for quantification and characterization of the adhesion process.

  10. Simulating condensation on microstructured surfaces using Lattice Boltzmann Method

    Science.gov (United States)

    Alexeev, Alexander; Vasyliv, Yaroslav

    2017-11-01

    We simulate a single component fluid condensing on 2D structured surfaces with different wettability. To simulate the two phase fluid, we use the athermal Lattice Boltzmann Method (LBM) driven by a pseudopotential force. The pseudopotential force results in a non-ideal equation of state (EOS) which permits liquid-vapor phase change. To account for thermal effects, the athermal LBM is coupled to a finite volume discretization of the temperature evolution equation obtained using a thermal energy rate balance for the specific internal energy. We use the developed model to probe the effect of surface structure and surface wettability on the condensation rate in order to identify microstructure topographies promoting condensation. Financial support is acknowledged from Kimberly-Clark.

  11. Facile stamp patterning method for superhydrophilic/superhydrophobic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Lyu, Sungnam, E-mail: blueden@postech.ac.kr; Hwang, Woonbong, E-mail: whwang@postech.ac.kr [Department of Mechanical Engineering, POSTECH, Pohang 680-749 (Korea, Republic of)

    2015-11-16

    Patterning techniques are essential to many research fields such as chemistry, biology, medicine, and micro-electromechanical systems. In this letter, we report a simple, fast, and low-cost superhydrophobic patterning method using a superhydrophilic template. The technique is based on the contact stamping of the surface during hydrophobic dip coating. Surface characteristics were measured using scanning electron microscopy and energy-dispersive X-ray spectroscopic analysis. The results showed that the hydrophilic template, which was contacted with the stamp, was not affected by the hydrophobic solution. The resolution study was conducted using a stripe shaped stamp. The patterned line was linearly proportional to the width of the stamp line with a constant narrowing effect. A surface with regions of four different types of wetting was fabricated to demonstrate the patterning performance.

  12. Scattering of surface waves modelled by the integral equation method

    Science.gov (United States)

    Lu, Laiyu; Maupin, Valerie; Zeng, Rongsheng; Ding, Zhifeng

    2008-09-01

    The integral equation method is used to model the propagation of surface waves in 3-D structures. The wavefield is represented by the Fredholm integral equation, and the scattered surface waves are calculated by solving the integral equation numerically. The integration of the Green's function elements is given analytically by treating the singularity of the Hankel function at R = 0, based on the proper expression of the Green's function and the addition theorem of the Hankel function. No far-field and Born approximation is made. We investigate the scattering of surface waves propagating in layered reference models imbedding a heterogeneity with different density, as well as Lamé constant contrasts, both in frequency and time domains, for incident plane waves and point sources.

  13. Response-Surface Methods in R, Using rsm

    Directory of Open Access Journals (Sweden)

    Russell V. Lenth

    2009-10-01

    Full Text Available This article describes the recent package rsm, which was designed to provide R support for standard response-surface methods. Functions are provided to generate central-composite and Box-Behnken designs. For analysis of the resulting data, the package provides for estimating the response surface, testing its lack of fit, displaying an ensemble of contour plots of the fitted surface, and doing follow-up analyses such as steepest ascent, canonical analysis, and ridge analysis. It also implements a coded-data structure to aid in this essential aspect of the methodology. The functions are designed in hopes of providing an intuitive and effective user interface. Potential exists for expanding the package in a variety of ways.

  14. Exploration on Kerf-angle and Surface Roughness in Abrasive Waterjet Machining using Response Surface Method

    Science.gov (United States)

    Babu, Munuswamy Naresh; Muthukrishnan, Nambi

    2017-05-01

    Abrasive waterjet machining is a mechanical based unconventional cutting process which uses a mixture of abrasives and pressurized water as an intermediate to cut the material. The present paper focuses in analyzing the effect process parameters like feed rate, water pressure, standoff distance and abrasive flow rate on the surface roughness and kerf-angle of AISI 1018 mild steel experimentally. The experiments were performed under Taguchi's L27 orthogonal array. Moreover, the optimal parameter that significantly reduces the surface roughness and kerf-angle were calculated through response surface method. The most dominating process parameter that affects the responses was calculated by the Analysis of variance. In addition, machined surfaces are further subjected to scanning electron microscope (SEM) and atomic force microscope (AFM) for detailed study on the texture developed.

  15. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  16. Determination of the Geographical and Botanical Origin of Hops (Humulus lupulus L.) Using Stable Isotopes of C, N, and S.

    Science.gov (United States)

    Ocvirk, Miha; Ogrinc, Nives; Košir, Iztok Jože

    2018-02-28

    A need exists for a reliable method to determine the geographical and botanical origin of hops. For this study, three sets of samples were collected: the first set comprised 5 German samples; the second set comprised samples of hops from 10 of the world's major hop-growing regions; and the third comprised the 4 main Slovenian regions. The samples were analyzed using isotope ratio mass spectrometry (IRMS) to obtain δ 13 C, δ 15 N, and δ 34 S values. The δ 15 N (2.2 ‰ to 8.4 ‰) and δ 34 S (0.7 ‰ to 12.3 ‰) values were the most discriminating parameters for classifying hop according to geographical origin. ANOVA showed distinct groupings for 8 out of the 10 hop-growing regions. Although it was not possible to distinguish the geographical origin of hops based on δ 13 C (-28.9 ‰ to -24.7 ‰), in the case of botanical origin, δ 13 C values proved to be the most discriminative albeit with limited success.

  17. Theoretical studies of potential energy surfaces and computational methods

    Energy Technology Data Exchange (ETDEWEB)

    Shepard, R. [Argonne National Laboratory, IL (United States)

    1993-12-01

    This project involves the development, implementation, and application of theoretical methods for the calculation and characterization of potential energy surfaces involving molecular species that occur in hydrocarbon combustion. These potential energy surfaces require an accurate and balanced treatment of reactants, intermediates, and products. This difficult challenge is met with general multiconfiguration self-consistent-field (MCSCF) and multireference single- and double-excitation configuration interaction (MRSDCI) methods. In contrast to the more common single-reference electronic structure methods, this approach is capable of describing accurately molecular systems that are highly distorted away from their equilibrium geometries, including reactant, fragment, and transition-state geometries, and of describing regions of the potential surface that are associated with electronic wave functions of widely varying nature. The MCSCF reference wave functions are designed to be sufficiently flexible to describe qualitatively the changes in the electronic structure over the broad range of geometries of interest. The necessary mixing of ionic, covalent, and Rydberg contributions, along with the appropriate treatment of the different electron-spin components (e.g. closed shell, high-spin open-shell, low-spin open shell, radical, diradical, etc.) of the wave functions, are treated correctly at this level. Further treatment of electron correlation effects is included using large scale multireference CI wave functions, particularly including the single and double excitations relative to the MCSCF reference space. This leads to the most flexible and accurate large-scale MRSDCI wave functions that have been used to date in global PES studies.

  18. Comparison of optical methods for surface roughness characterization

    DEFF Research Database (Denmark)

    Feidenhans'l, Nikolaj Agentoft; Hansen, Poul Erik; Pilny, Lukas

    2015-01-01

    We report a study of the correlation between three optical methods for characterizing surface roughness: a laboratory scatterometer measuring the bi-directional reflection distribution function (BRDF instrument), a simple commercial scatterometer (rBRDF instrument), and a confocal optical profiler...... of the scattering angle distribution (Aq). The twenty-two investigated samples were manufactured with several methods in order to obtain a suitable diversity of roughness patterns.Our study shows a one-to-one correlation of both the Rq and the Rdq roughness values when obtained with the BRDF and the confocal...

  19. Resistance Values in Palestinian Hip-hop Music

    OpenAIRE

    Alindah, Lutfiyah

    2012-01-01

    This research aims to describe popular culture of Palestine Hip-Hop and the values of songs. This research has purposes 1) to describe popular culture in Palestine Hip-Hop, and 2) to find resistance value in hip-hop songs. This research used popular culture approach of Adorno that analyzes three songs of DAM group, they are Who is the Terrorist?, Ghareeb fi Biladi, and Olive Trees. This research shows that 1) Hip-Hop music is the source of resistance Palestine through music media, 2) three of...

  20. Terrain dependant hop count selection for transparent relay transmissions

    Directory of Open Access Journals (Sweden)

    Cibile K. Kanjirathumkal

    2013-12-01

    Full Text Available In this Letter, the selection of the best hop count for a particular topography, in the context of enhanced connectivity using multi-hop transparent relay communication is addressed. Based on the coefficient of variation and the terrain specific fading severity factor of the distribution, it is possible to estimate the optimal hop count that can provide the required performance at detector. Two distribution models, which can adequately characterise the terrain fading effects on empirical data are considered for performance comparison. The results are useful in selecting branches, with low variability and optimal hop count for connectivity, in multi-stream switched diversity combining systems.

  1. Simulating Muscle-Reflex Dynamics in a Simple Hopping Robot

    Science.gov (United States)

    Seyfarth, Andre; Kalveram, Karl Theodor; Geyer, Hartmut

    In legged systems, springy legs facilitate gaits with subsequent contact and flight phases. Here, we test whether electrical motors can generate leg behaviors suitable for stable hopping. We built a vertically operating sledge actuated by a motor-driven leg. The motor torque simulates either a linear leg spring or a muscle-reflex system. For stable hopping significant energy supply was required after midstance. This was achieved by enhancing leg stiffness or by continuously applying positive force feedback to the simulated muscle. The muscle properties combined with positive force feedback result in spring-like behavior which enables stable hopping with adjustable hopping height.

  2. Delta self-consistent field method to obtain potential energy surfaces of excited molecules on surfaces

    DEFF Research Database (Denmark)

    Gavnholt, Jeppe; Olsen, Thomas; Engelund, Mads

    2008-01-01

    is a density-functional method closely resembling standard density-functional theory (DFT), the only difference being that in Delta SCF one or more electrons are placed in higher lying Kohn-Sham orbitals instead of placing all electrons in the lowest possible orbitals as one does when calculating the ground......-photoemission spectroscopy measurements. This comparison shows that the modified Delta SCF method gives results in close agreement with experiment, significantly closer than the comparable methods. For N2 adsorbed on ruthenium (0001) we map out a two-dimensional part of the potential energy surfaces in the ground state...

  3. TWO METHODS FOR REMOTE ESTIMATION OF COMPLETE URBAN SURFACE TEMPERATURE

    Directory of Open Access Journals (Sweden)

    L. Jiang

    2017-09-01

    Full Text Available Complete urban surface temperature (TC is a key parameter for evaluating the energy exchange between the urban surface and atmosphere. At the present stage, the estimation of TC still needs detailed 3D structure information of the urban surface, however, it is often difficult to obtain the geometric structure and composition of the corresponding temperature of urban surface, so that there is still lack of concise and efficient method for estimating the TC by remote sensing. Based on the four typical urban surface scale models, combined with the Envi-met model, thermal radiant directionality forward modeling and kernel model, we analyzed a complete day and night cycle hourly component temperature and radiation temperature in each direction of two seasons of summer and winter, and calculated hemispherical integral temperature and TC. The conclusion is obtained by examining the relationship of directional radiation temperature, hemispherical integral temperature and TC: (1 There is an optimal angle of radiation temperature approaching the TC in a single observation direction when viewing zenith angle is 45–60°, the viewing azimuth near the vertical surface of the sun main plane, the average absolute difference is about 1.1 K in the daytime. (2 There are several (3–5 times directional temperatures of different view angle, under the situation of using the thermal radiation directionality kernel model can more accurately calculate the hemispherical integral temperature close to TC, the mean absolute error is about 1.0 K in the daytime. This study proposed simple and effective strategies for estimating TC by remote sensing, which are expected to improve the quantitative level of remote sensing of urban thermal environment.

  4. Two Methods for Remote Estimation of Complete Urban Surface Temperature

    Science.gov (United States)

    Jiang, L.; Zhan, W.; Zou, Z.

    2017-09-01

    Complete urban surface temperature (TC) is a key parameter for evaluating the energy exchange between the urban surface and atmosphere. At the present stage, the estimation of TC still needs detailed 3D structure information of the urban surface, however, it is often difficult to obtain the geometric structure and composition of the corresponding temperature of urban surface, so that there is still lack of concise and efficient method for estimating the TC by remote sensing. Based on the four typical urban surface scale models, combined with the Envi-met model, thermal radiant directionality forward modeling and kernel model, we analyzed a complete day and night cycle hourly component temperature and radiation temperature in each direction of two seasons of summer and winter, and calculated hemispherical integral temperature and TC. The conclusion is obtained by examining the relationship of directional radiation temperature, hemispherical integral temperature and TC: (1) There is an optimal angle of radiation temperature approaching the TC in a single observation direction when viewing zenith angle is 45-60°, the viewing azimuth near the vertical surface of the sun main plane, the average absolute difference is about 1.1 K in the daytime. (2) There are several (3-5 times) directional temperatures of different view angle, under the situation of using the thermal radiation directionality kernel model can more accurately calculate the hemispherical integral temperature close to TC, the mean absolute error is about 1.0 K in the daytime. This study proposed simple and effective strategies for estimating TC by remote sensing, which are expected to improve the quantitative level of remote sensing of urban thermal environment.

  5. Non thermal plasma surface cleaner and method of use

    KAUST Repository

    Neophytou, Marios

    2017-09-14

    Described herein are plasma generation devices and methods of use of the devices. The devices can be used for the cleaning of various surfaces and/or for inhibiting or preventing the accumulation of particulates, such as dust, or moisture on various surfaces. The devices can be used to remove dust and other particulate contaminants from solar panels and windows, or to avoid or minimize condensation on various surfaces. In an embodiment a plasma generation device is provided. The plasma generation device can comprise: a pair of electrodes (1,2) positioned in association with a surface of a dielectric substrate (3). The pair of electrodes (1,2) can comprise a first electrode (1) and a second electrode (2). The first electrode and second electrode can be of different sizes, one of the electrodes being smaller than the other of the electrodes. The first electrode and second electrode can be separated by a distance and electrically connected to a voltage source (4,5).

  6. Physical and chemical characterization methods of surfaces and interfaces; Methodes de caracterisation physico-chimique des surfaces et des interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Barthes-Labrousse, M.G. [Centre d`Etudes de Chimie Metallurgique, 94 - Vitry-sur-Seine (France)

    1997-12-31

    The main physical and chemical characterization techniques of surfaces and interfaces are presented. There are: Auger electron spectroscopy, photoelectron spectroscopies (XPS and UPS), secondary ions mass spectroscopy (SIMS), infrared and Raman spectroscopies, electron energy loss spectroscopy (EELS and HREELS) and atomic force microscopy (AFM). For each method is given the theoretical principle, the apparatus and the main uses of the techniques. (O.M.) 27 refs.

  7. Surface charge method for molecular surfaces with curved areal elements I. Spherical triangles

    Science.gov (United States)

    Yu, Yi-Kuo

    2018-03-01

    Parametrizing a curved surface with flat triangles in electrostatics problems creates a diverging electric field. One way to avoid this is to have curved areal elements. However, charge density integration over curved patches appears difficult. This paper, dealing with spherical triangles, is the first in a series aiming to solve this problem. Here, we lay the ground work for employing curved patches for applying the surface charge method to electrostatics. We show analytically how one may control the accuracy by expanding in powers of the the arc length (multiplied by the curvature). To accommodate not extremely small curved areal elements, we have provided enough details to include higher order corrections that are needed for better accuracy when slightly larger surface elements are used.

  8. New method to design stellarator coils without the winding surface

    Science.gov (United States)

    Zhu, Caoxiang; Hudson, Stuart R.; Song, Yuntao; Wan, Yuanxi

    2018-01-01

    Finding an easy-to-build coils set has been a critical issue for stellarator design for decades. Conventional approaches assume a toroidal ‘winding’ surface, but a poorly chosen winding surface can unnecessarily constrain the coil optimization algorithm, This article presents a new method to design coils for stellarators. Each discrete coil is represented as an arbitrary, closed, one-dimensional curve embedded in three-dimensional space. A target function to be minimized that includes both physical requirements and engineering constraints is constructed. The derivatives of the target function with respect to the parameters describing the coil geometries and currents are calculated analytically. A numerical code, named flexible optimized coils using space curves (FOCUS), has been developed. Applications to a simple stellarator configuration, W7-X and LHD vacuum fields are presented.

  9. A new method for patterning azopolymer thin film surfaces

    Science.gov (United States)

    Sorkhabi, Sh. Golghasemi; Barille, R.; Ahmadi-Kandjani, S.; Zielinska, S.; Ortyl, E.

    2017-04-01

    We present a simple bottom-up approach via an incoherent unpolarized illumination and the choice of a solvent-droplet-induced-dewetting method to photoinduce nano doughnuts on the surface of azopolymer thin films. We demonstrate that doughnut-shaped nanostructures can be formed and tailored with a wide range of typical sizes, thus providing a rich field of applications using surface photo-patterning. Furthermore, due to the presence of highly photoactive azobenzene derivative in the material, illumination of these nanostructures by a polarized laser light shows the possibility of a further growth and reshaping opening the way for fundamental studies of size-dependent scaling laws of optical properties and possible fabrication of nano-reactor or nano-trap patterns.

  10. Economic method for helical gear flank surface characterisation

    Science.gov (United States)

    Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.

    2018-03-01

    Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.

  11. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  12. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  13. Pharmacokinetics of prenylated hop phenols in women following oral administration of a standardized extract of hops.

    Science.gov (United States)

    van Breemen, Richard B; Yuan, Yang; Banuvar, Suzanne; Shulman, Lee P; Qiu, Xi; Alvarenga, René F Ramos; Chen, Shao-Nong; Dietz, Birgit M; Bolton, Judy L; Pauli, Guido F; Krause, Elizabeth; Viana, Marlos; Nikolic, Dejan

    2014-10-01

    Women seeking alternatives to hormone-replacement therapy for menopausal symptoms often try botanical dietary supplements containing extracts of hops (Humulus lupulus L.). Hops contain 8-prenylnaringenin (8-PN), a potent phytoestrogen, the related flavanones 6-prenylnaringenin and isoxanthohumol (IX), and the prenylated chalcone xanthohumol (XN). After chemically and biologically standardizing an extract of spent hops to these marker compounds, an escalating dose study was carried out in menopausal women to evaluate safety and pharmacokinetics. 8-PN, 6-prenylnaringenin, IX, and XN, sex hormones, and prothrombin time were determined in blood samples and/or 24 h urine samples. There was no effect on sex hormones or blood clotting. The maximum serum concentrations of the prenylated phenols were dose-dependent and were reached from 2 to 7 h, indicating slow absorption. The marker compounds formed glucuronides that were found in serum and urine. Secondary peaks at 5 h in the serum concentration-time curves indicated enterohepatic recirculation. The serum concentration-time curves indicated demethylation of IX to form 8-PN and cyclization of XN to IX. Slow absorption and enterohepatic recirculation contributed to half-lives exceeding 20 h. This human study indicated long half-lives of the estrogenic and proestrogenic prenylated phenols in hops but no acute toxicity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Extraction of bitter acids from hops and hop products using pressurized solvent extraction (PSE)

    Czech Academy of Sciences Publication Activity Database

    Čulík, J.; Jurková, M.; Horák, T.; Čejka, P.; Kellner, V.; Dvořák, J.; Karásek, Pavel; Roth, Michal

    2009-01-01

    Roč. 115, č. 3 (2009), s. 220-225 ISSN 0046-9750 R&D Projects: GA ČR GA203/08/1536; GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : hops * bitter acids * pressurized solvent extraction Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.000, year: 2009

  15. Deodorant effects of a supercritical hops extract: antibacterial activity against Corynebacterium xerosis and Staphylococcus epidermidis and efficacy testing of a hops/zinc ricinoleate stick in humans through the sensory evaluation of axillary deodorancy.

    Science.gov (United States)

    Dumas, Elizabeth R; Michaud, Amy E; Bergeron, Chantal; Lafrance, Jennifer L; Mortillo, Susan; Gafner, Stefan

    2009-09-01

    There is little scientific evidence to support the efficacy of natural deodorants and therefore, such products may be perceived as inefficacious. The evaluation of the in vitro antibacterial activity of a hop extract and the evaluation of the odor-reducing capacity of a hops/zinc ricinoleate-containing product by a sensory evaluation panel is employed to verify deodorant performance. The goal of this study was to evaluate the in vitro antibacterial activity of a hop extract against Corynebacterium xerosis and Staphylococcus epidermidis and to verify in vivo deodorant performance of a hops/zinc ricinoleate-containing product. The hops extract was evaluated on a culture of an armpit swab from six volunteers. Furthermore, the extract was submitted to a zone of inhibition test and an agar-dilution assay against two major odor-causing bacteria. The clinical evaluation of the finished product was carried out according to a standard method for substantiating deodorant efficacy using trained odor judges for the assessment of axillary malodor (ASTM method E 1207-87 Standard Practice for the Sensory Evaluation of Axillary Deodorancy). The supercritical hops extract showed good antibacterial activities in all three tests. Minimum inhibitory concentration values of 6.25 and 25 mug/mL against C. xerosis and S. aureus, respectively, were obtained in the agar-dilution assay. In the clinical underarm odor-reduction evaluation, the mean malodor score dropped from 6.28 (+/-0.70) to 1.80 (+/-0.71) after 8 h of application. There was still a noticeable effect at both 12 and 24 h after the application, with a score of 1.82 (+/-0.74) and 2.24 (+/-0.77), respectively. The hops extract has good in vitro antibacterial properties and, in combination with zinc ricinoleate in an appropriate base, delivers in vivo odor reduction. The clinical efficacy is likely due to a combination of the base ingredients and the antibacterial actives.

  16. An experimental method for making spectral emittance and surface temperature measurements of opaque surfaces

    International Nuclear Information System (INIS)

    Moore, Travis J.; Jones, Matthew R.; Tree, Dale R.; Daniel Maynes, R.; Baxter, Larry L.

    2011-01-01

    An experimental procedure has been developed to make spectral emittance and temperature measurements. The spectral emittance of an object is calculated using measurements of the spectral emissive power and of the surface temperature of the object obtained using a Fourier transform infrared (FTIR) spectrometer. A calibration procedure is described in detail which accounts for the temperature dependence of the detector. The methods used to extract the spectral emissive power and surface temperature from measured infrared spectra were validated using a blackbody radiator at known temperatures. The average error in the measured spectral emittance was 2.1% and the average difference between the temperature inferred from the recorded spectra and the temperature indicated on the blackbody radiator was 1.2%. The method was used to measure the spectral emittance of oxidized copper at various temperatures.

  17. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  18. Roman sophisticated surface modification methods to manufacture silver counterfeited coins

    Science.gov (United States)

    Ingo, G. M.; Riccucci, C.; Faraldi, F.; Pascucci, M.; Messina, E.; Fierro, G.; Di Carlo, G.

    2017-11-01

    By means of the combined use of X-ray photoelectron spectroscopy (XPS), optical microscopy (OM) and scanning electron microscopy (SEM) coupled with energy dispersive X-ray spectroscopy (EDS) the surface and subsurface chemical and metallurgical features of silver counterfeited Roman Republican coins are investigated to decipher some aspects of the manufacturing methods and to evaluate the technological ability of the Roman metallurgists to produce thin silver coatings. The results demonstrate that over 2000 ago important advances in the technology of thin layer deposition on metal substrates were attained by Romans. The ancient metallurgists produced counterfeited coins by combining sophisticated micro-plating methods and tailored surface chemical modification based on the mercury-silvering process. The results reveal that Romans were able systematically to chemically and metallurgically manipulate alloys at a micro scale to produce adherent precious metal layers with a uniform thickness up to few micrometers. The results converge to reveal that the production of forgeries was aimed firstly to save expensive metals as much as possible allowing profitable large-scale production at a lower cost. The driving forces could have been a lack of precious metals, an unexpected need to circulate coins for trade and/or a combinations of social, political and economic factors that requested a change in money supply. Finally, some information on corrosion products have been achieved useful to select materials and methods for the conservation of these important witnesses of technology and economy.

  19. Methods on estimation of the evaporation from water surface

    International Nuclear Information System (INIS)

    Trajanovska, Lidija; Tanushevska, Dushanka; Aleksovska, Nina

    2001-01-01

    The whole world water supply on the Earth is in close dependence on hydrological cycle connected with water circulation at Earth-Atmosphere route through evaporation, precipitation and water runoff. Evaporation exists worldwide where the atmosphere is unsatiated of water steam (when there is humidity in short supply) and it depends on climatic conditions in some regions. The purpose of this paper is to determine a method for estimation of evaporation of natural water surface in our areas, that means its determination as exact as possible. (Original)

  20. The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers

    International Nuclear Information System (INIS)

    Di Bing; Wang Ya-Dong; Zhang Ya-Lin; An Zhong

    2013-01-01

    The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons

  1. Evaluation of surface renewal and flux-variance methods above agricultural and forest surfaces

    Science.gov (United States)

    Fischer, M.; Katul, G. G.; Noormets, A.; Poznikova, G.; Domec, J. C.; Trnka, M.; King, J. S.

    2016-12-01

    Measurements of turbulent surface energy fluxes are of high interest in agriculture and forest research. During last decades, eddy covariance (EC), has been adopted as the most commonly used micrometeorological method for measuring fluxes of greenhouse gases, energy and other scalars at the surface-atmosphere interface. Despite its robustness and accuracy, the costs of EC hinder its deployment at some research experiments and in practice like e.g. for irrigation scheduling. Therefore, testing and development of other cost-effective methods is of high interest. In our study, we tested performance of surface renewal (SR) and flux variance method (FV) for estimates of sensible heat flux density. Surface renewal method is based on the concept of non-random transport of scalars via so-called coherent structures which if accurately identified can be used for the computing of associated flux. Flux variance method predicts the flux from the scalar variance following the surface-layer similarity theory. We tested SR and FV against EC in three types of ecosystem with very distinct aerodynamic properties. First site was represented by agricultural wheat field in the Czech Republic. The second site was a 20-m tall mixed deciduous wetland forest on the coast of North Carolina, USA. The third site was represented by pine-switchgrass intercropping agro-forestry system located in coastal plain of North Carolina, USA. Apart from solving the coherent structures in a SR framework from the structure functions (representing the most common approach), we applied ramp wavelet detection scheme to test the hypothesis that the duration and amplitudes of the coherent structures are normally distributed within the particular 30-minutes time intervals and so just the estimates of their averages is sufficient for the accurate flux determination. Further, we tested whether the orthonormal wavelet thresholding can be used for isolating of the coherent structure scales which are associated with

  2. Variable range hopping conduction and microstructure properties of semiconducting Co-doped TiO2

    International Nuclear Information System (INIS)

    Okutan, Mustafa; Bakan, Halil I.; Korkmaz, Kemal; Yakuphanoglu, Fahrettin

    2005-01-01

    The surface morphology, phases existing in the microstructure and conductivity behavior of Co-doped TiO2 have been investigated by atomic force microscopy (AFM), scanning electron microscopy (SEM), electrical conductivity measurements and X-ray diffraction technique. The semiconducting phase is found to obey Mott's variable range hopping mechanism of the conduction. The conduction mechanism of the ceramic shows a crossover from the, exp[-(T0/T)1/4] law to a simply activated law, exp(-ΔE/kT). This behavior is attributed to temperature-induced transition from 3D to thermally activated behavior. The hopping conduction parameters such as the characteristic temperature (T0), localization length (α), hopping distance (R), activation energy (ΔE) and density of states at Fermi level (N(EF) have been calculated. Surface morphology shows that the ceramic has a regular surface. The SEM study indicates that there are grains which have a certain type in the microstructure. Rutile phases with different plane in microstructure were found

  3. Comparison of dimensionality reduction methods for wood surface inspection

    Science.gov (United States)

    Niskanen, Matti; Silven, Olli

    2003-04-01

    Dimensionality reduction methods for visualization map the original high-dimensional data typically into two dimensions. Mapping preserves the important information of the data, and in order to be useful, fulfils the needs of a human observer. We have proposed a self-organizing map (SOM)- based approach for visual surface inspection. The method provides the advantages of unsupervised learning and an intuitive user interface that allows one to very easily set and tune the class boundaries based on observations made on visualization, for example, to adapt to changing conditions or material. There are, however, some problems with a SOM. It does not address the true distances between data, and it has a tendency to ignore rare samples in the training set at the expense of more accurate representation of common samples. In this paper, some alternative methods for a SOM are evaluated. These methods, PCA, MDS, LLE, ISOMAP, and GTM, are used to reduce dimensionality in order to visualize the data. Their principal differences are discussed and performances quantitatively evaluated in a few special classification cases, such as in wood inspection using centile features. For the test material experimented with, SOM and GTM outperform the others when classification performance is considered. For data mining kinds of applications, ISOMAP and LLE appear to be more promising methods.

  4. Chicano Hip-Hop as Interethnic Contact Zone

    Science.gov (United States)

    McFarland, Pancho

    2008-01-01

    The critical study of rap music and hip-hop culture has the potential to expand Americans understanding of race and culture in the United States. Hip-hop culture as a multiracial, multiethnic phenomenon reveals the ways in which race relations over the past thirty years have become increasingly complex. The theories and concepts that they use to…

  5. Hip Hop Is Now: An Evolving Youth Culture

    Science.gov (United States)

    Taylor, Carl; Taylor, Virgil

    2007-01-01

    Emerging from Rap music, Hip Hop has become a lifestyle to many modern youth around the world. Embodying both creativity and controversy, Hip Hop mirrors the values, violence, and hypocrisy of modern culture. The authors dispel some of the simplistic views that surround this evolving youth movement embraced by millions of young people who are…

  6. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  7. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  8. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  9. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  10. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  11. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  12. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  13. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  14. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  15. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  16. Role of correlated hopping in mixed valence phenomena

    Indian Academy of Sciences (India)

    Abstract. Role of correlated hopping is studied using extended Falicov–Kimball model in a small cluster. A discontinuous insulator-to-metal transition is observed at a critical f-level energy. Transition is sharper for larger correlated hopping. In the specific heat curves a two-peak struc- ture consisting of a sharp peak followed ...

  17. Hop powdery mildew control through alteration of spring pruning practices

    Science.gov (United States)

    Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

  18. Factors of Intensification in the Hops Cluster of Chuvashia

    Science.gov (United States)

    Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.

    2016-01-01

    The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…

  19. A new surface resistance measurement method with ultrahigh sensitivity

    International Nuclear Information System (INIS)

    Liang, Changnian.

    1993-01-01

    A superconducting niobium triaxial cavity has been designed and fabricated to study residual surface resistance of planar superconducting materials. The edge of a 25.4 mm or larger diameter sample in the triaxial cavity is located outside the strong field region. Therefore, the edge effects and possible losses between the thin film and the substrate have been minimized, ensuring that induced RF losses are intrinsic to the test material. The fundamental resonant frequency of the cavity is the same as the working frequency of CEBAF cavities. The cavity has a compact size compared to its TE 011 counterpart, which makes it more sensitive to the sample's loss. For even higher sensitivity, a calorimetry method has been used to measure the RF losses on the superconducting sample. At 2 K, a 2 μK temperature change can be resolved by using carbon resistor sensors. The temperature distribution caused by RF heating is measured by 16 carbon composition resistor sensors. A 0.05 μW heating power can be detected as such a resolution, which translates to a surface resistance of 0.02 nΩ at a surface magnetic field of 52 Oe. This is the most sensitive device for surface resistance measurements to date. In addition, losses due to the indium seal, coupling probes, field emission sites other than the sample, and all of the high field resonator surface, are excluded in the measurement. Surface resistance of both niobium and high-Tc superconducting thin films has been measured. A low R s of 35.2 μΩ was measured for a 25.4 mm diameter YBa 2 Cu 3 O 7 thin film at 1.5 GHz and at 2 K. The measurement result is the first result for a large area epitaxially grown thin film sample at such a low RF frequency. The abrupt disappearance of multipacting between two parallel plates has been observed and monitored with the 16 temperature mapping sensors. Field emission or some field dependent anomalous RF losses on the niobium plate have also been observed

  20. Multi-hop conjugation based bacteria nanonetworks.

    Science.gov (United States)

    Balasubramaniam, Sasitharan; Lio', Pietro

    2013-03-01

    Molecular communication is a new paradigm for nanomachines to exchange information, by utilizing biological mechanism and/or components to transfer information (e.g., molecular diffusion, neuronal networks, molecular motors). One possible approach for molecular communication is through the use of bacteria, which can act as carriers for DNA-based information, i.e., plasmids. This paper analyzes multi-hop molecular nanonetworks that utilize bacteria as a carrier. The proposed approach combines different properties of bacteria to enable multi-hop transmission, such as conjugation and chemotaxis-based motility. Various analyses have been performed, including the correlation between the success rate of plasmid delivery to the destination node, and the role of conjugation in enabling this; as well as analyses on the impact of large topology shapes (e.g., Grid, Random, and Scale-free) on the success rate of plasmid delivery for multiple source-destination nanonetworks. A further solution proposed in this paper is the application of antibiotics to act as filters on illegitimate messages that could be delivered by the bacteria. Our evaluation, which has been conducted through a series of simulations, has shown that numerous bacteria properties fit to properties required for communication networking (e.g., packet filtering, routing, addressing).

  1. Vortex variable range hopping in a conventional superconducting film

    Science.gov (United States)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  2. Evaluation of Surface Treatment Methods on the Bond Strength of Zirconia Ceramics Systems, Resin Cements and Tooth Surface

    Directory of Open Access Journals (Sweden)

    Akkuş Emek

    2015-07-01

    Full Text Available Objectives: To compare the effects of airborne-particle abrasion (APA and tribochemical silica coating (TSC surface treatment methods on the shear bond strength of zirconia ceramics systems, resin cements and tooth surface

  3. A plateau-valley separation method for multifunctional surfaces characterization

    DEFF Research Database (Denmark)

    Godi, Alessandro; Kühle, A.; De Chiffre, Leonardo

    2012-01-01

    Turned multifunctional surfaces are a new typology of textured surfaces presenting a flat plateau region and deterministically distributed lubricant reservoirs. Existing standards are not suitable for the characterization of such surfaces, providing at times values without physical meaning. A new...

  4. Improved visualization of intracranial vessels by gradient moment nulling in hybrid of opposite-contrast magnetic resonance angiography (HOP MRA)

    International Nuclear Information System (INIS)

    Azuma, Toshiya; Kodama, Takao; Yano, Takanori; Suzuki, Masayuki; Kimura, Tokunori; Tamaribuchi, Youko

    2010-01-01

    Hybrid of opposite-contrast (HOP) magnetic resonance angiography (MRA) is a new method that combines the advantages of 3-dimensional (3D) time-of-flight (TOF) MRA and black-blood (BB) MRA without prolonging acquisition time. In phantom and clinical studies, we focused on image differences when we applied gradient moment nulling (GMN) to 2 or 3 axes in the first echo. We made an original phantom with a semicircular tube of 3- and 5-mm internal diameter, with flow rate in the tube of 0, 20, 60, 80, or 120 cm/s. In original images of the phantom obtained with TOF MRA and flow-sensitive BB MRA and in filter frequency-weighted subtraction (FWS) processed images acquired with HOP MRA, we measured the contrast-to-noise ratio (CNR) of both the inside and outside of the tubes. In FWS processed images with GMN applied to 2 axes, the CNR was high at various flow rates in both straight and bending portions of the tubes in comparison with TOF images. In a clinical study in 15 patients, we evaluated vessel visualization in images obtained using conventional TOF MRA with magnetization transfer contrast (MTC) and HOP MRA. In clinical studies, visualization scores of HOP MRA were equivalent to those of conventional TOF MRA in the bilateral internal carotid arteries (ICA) and inferior in the basilar arteries. However, visualization of the peripheral portion of the middle cerebral artery (MCA) improved significantly in HOP MRA with GMN applied to 2 and 3 axes. Visualization of the main trunk of the ICA and MCA was superior in HOP MRA with GMN applied to 2 axes. HOP MRA with 2-axis GMN may be useful for excellent visualization of both major arteries and peripheral vessels in the head. (author)

  5. DETERMINATION OF CLINICALLY RELEVANT DIFFERENCES IN FRONTAL PLANE HOP TESTS IN WOMEN'S COLLEGIATE BASKETBALL AND SOCCER PLAYERS

    Science.gov (United States)

    Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung

    2017-01-01

    Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally

  6. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  7. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  8. Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

    Science.gov (United States)

    Liu, Zechang; Wang, Liping; Liu, Yumei

    2018-01-18

    Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  9. Diffusion in quasi-one-dimensional channels: A small system n, p, T, transition state theory for hopping times

    Science.gov (United States)

    Ahmadi, Sheida; Bowles, Richard K.

    2017-04-01

    Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.

  10. Nuclear magnetic resonance and high-performance liquid chromatography techniques for the characterization of bioactive compounds from Humulus lupulus L. (hop).

    Science.gov (United States)

    Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica

    2018-01-19

    Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.

  11. Biological methods used to assess surface water quality

    Directory of Open Access Journals (Sweden)

    Szczerbiñska Natalia

    2015-12-01

    Full Text Available In accordance with the guidelines of the Water Framework Directive 2000/60 (WFD, both ecological and chemical statuses determine the assessment of surface waters. The profile of ecological status is based on the analysis of various biological components, and physicochemical and hydromorphological indicators complement this assessment. The aim of this article is to present the biological methods used in the assessment of water status with a special focus on bioassay, as well as to provide a review of methods of monitoring water status. Biological test methods include both biomonitoring and bioanalytics. Water biomonitoring is used to assess and forecast the status of water. These studies aim to collect data on water pollution and forecast its impact. Biomonitoring uses organisms which are characterized by particular vulnerability to contaminants. Bioindicator organisms are algae, fungi, bacteria, larval invertebrates, cyanobacteria, macroinvertebrates, and fish. Bioanalytics is based on the receptors of contaminants that can be biologically active substances. In bioanalytics, biosensors such as viruses, bacteria, antibodies, enzymes, and biotests are used to assess degrees of pollution.

  12. Integral methods for shallow free-surface flows with separation

    DEFF Research Database (Denmark)

    Watanabe, S.; Putkaradze, V.; Bohr, Tomas

    2003-01-01

    eddy and separated flow. Assuming a variable radial velocity profile as in Karman-Pohlhausen's method, we obtain a system of two ordinary differential equations for stationary states that can smoothly go through the jump. Solutions of the system are in good agreement with experiments. For the flow down...... an inclined plane we take a similar approach and derive a simple model in which the velocity profile is not restricted to a parabolic or self-similar form. Two types of solutions with large surface distortions are found: solitary, kink-like propagating fronts, obtained when the flow rate is suddenly changed......, and stationary jumps, obtained, for instance, behind a sluice gate. We then include time dependence in the model to study the stability of these waves. This allows us to distinguish between sub- and supercritical flows by calculating dispersion relations for wavelengths of the order of the width of the layer....

  13. Method for producing high surface area chromia materials for catalysis

    Science.gov (United States)

    Gash, Alexander E [Brentwood, CA; Satcher, Joe [Patterson, CA; Tillotson, Thomas [Tracy, CA; Hrubesh, Lawrence [Pleasanton, CA; Simpson, Randall [Livermore, CA

    2007-05-01

    Nanostructured chromium(III)-oxide-based materials using sol-gel processing and a synthetic route for producing such materials are disclosed herein. Monolithic aerogels and xerogels having surface areas between 150 m.sup.2/g and 520 m.sup.2/g have been produced. The synthetic method employs the use of stable and inexpensive hydrated-chromium(III) inorganic salts and common solvents such as water, ethanol, methanol, 1-propanol, t-butanol, 2-ethoxy ethanol, and ethylene glycol, DMSO, and dimethyl formamide. The synthesis involves the dissolution of the metal salt in a solvent followed by an addition of a proton scavenger, such as an epoxide, which induces gel formation in a timely manner. Both critical point (supercritical extraction) and atmospheric (low temperature evaporation) drying may be employed to produce monolithic aerogels and xerogels, respectively.

  14. Modified surface testing method for large convex aspheric surfaces based on diffraction optics.

    Science.gov (United States)

    Zhang, Haidong; Wang, Xiaokun; Xue, Donglin; Zhang, Xuejun

    2017-12-01

    Large convex aspheric optical elements have been widely applied in advanced optical systems, which have presented a challenging metrology problem. Conventional testing methods cannot satisfy the demand gradually with the change of definition of "large." A modified method is proposed in this paper, which utilizes a relatively small computer-generated hologram and an illumination lens with certain feasibility to measure the large convex aspherics. Two example systems are designed to demonstrate the applicability, and also, the sensitivity of this configuration is analyzed, which proves the accuracy of the configuration can be better than 6 nm with careful alignment and calibration of the illumination lens in advance. Design examples and analysis show that this configuration is applicable to measure the large convex aspheric surfaces.

  15. Power-Hop: A Pervasive Observation for Real Complex Networks.

    Science.gov (United States)

    Papalexakis, Evangelos; Hooi, Bryan; Pelechrinis, Konstantinos; Faloutsos, Christos

    2016-01-01

    Complex networks have been shown to exhibit universal properties, with one of the most consistent patterns being the scale-free degree distribution, but are there regularities obeyed by the r-hop neighborhood in real networks? We answer this question by identifying another power-law pattern that describes the relationship between the fractions of node pairs C(r) within r hops and the hop count r. This scale-free distribution is pervasive and describes a large variety of networks, ranging from social and urban to technological and biological networks. In particular, inspired by the definition of the fractal correlation dimension D2 on a point-set, we consider the hop-count r to be the underlying distance metric between two vertices of the network, and we examine the scaling of C(r) with r. We find that this relationship follows a power-law in real networks within the range 2 ≤ r ≤ d, where d is the effective diameter of the network, that is, the 90-th percentile distance. We term this relationship as power-hop and the corresponding power-law exponent as power-hop exponent h. We provide theoretical justification for this pattern under successful existing network models, while we analyze a large set of real and synthetic network datasets and we show the pervasiveness of the power-hop.

  16. Particle hopping vs. fluid-dynamical models for traffic flow

    Energy Technology Data Exchange (ETDEWEB)

    Nagel, K.

    1995-12-31

    Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

  17. Job-hopping and New Firm Survival

    DEFF Research Database (Denmark)

    Failla, Virgilio

    The paper builds on Lazear´s (2005) jack-of-all-trades theory according to which individuals who invest in a balanced set of skills become entrepreneurs, while workers who specialize in a particular skill prefer to choose wage employment. Although a number of studies provide empirical support...... for this theory, little is known about the characteristics of this so called `balanced´ skills set. Do entrepreneurial outcomes of individuals presenting a highly varied work experiences differ from entrepreneurs with a less varied career' In particular, how do the characteristics of the entrepreneurs´ job......-hopping experience prior to the founding affect the growth of the new venture' It is well established that the industry and managerial pre-entry experience of the founder is beneficial. Experienced entrepreneurs are better at identifying opportunities (Shane, 2000), learning (Dencker, Gruber and Shah 2008), and have...

  18. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  19. Landing mechanics during side hopping and crossover hopping maneuvers in noninjured women and women with anterior cruciate ligament reconstruction.

    Science.gov (United States)

    Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L

    2011-01-01

    To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. A case-control study. A 3-dimensional motion analysis laboratory. Twenty-eight young women (range, 21-35 years) (15 control subjects and 13 subjects with ACL reconstruction). All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Noninjured women and women with ACL reconstruction exhibited similar hip- and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years

  20. Rapid surface enhanced Raman scattering detection method for chloramphenicol residues

    Science.gov (United States)

    Ji, Wei; Yao, Weirong

    2015-06-01

    Chloramphenicol (CAP) is a widely used amide alcohol antibiotics, which has been banned from using in food producing animals in many countries. In this study, surface enhanced Raman scattering (SERS) coupled with gold colloidal nanoparticles was used for the rapid analysis of CAP. Density functional theory (DFT) calculations were conducted with Gaussian 03 at the B3LYP level using the 3-21G(d) and 6-31G(d) basis sets to analyze the assignment of vibrations. Affirmatively, the theoretical Raman spectrum of CAP was in complete agreement with the experimental spectrum. They both exhibited three strong peaks characteristic of CAP at 1104 cm-1, 1344 cm-1, 1596 cm-1, which were used for rapid qualitative analysis of CAP residues in food samples. The use of SERS as a method for the measurements of CAP was explored by comparing use of different solvents, gold colloidal nanoparticles concentration and absorption time. The method of the detection limit was determined as 0.1 μg/mL using optimum conditions. The Raman peak at 1344 cm-1 was used as the index for quantitative analysis of CAP in food samples, with a linear correlation of R2 = 0.9802. Quantitative analysis of CAP residues in foods revealed that the SERS technique with gold colloidal nanoparticles was sensitive and of a good stability and linear correlation, and suited for rapid analysis of CAP residue in a variety of food samples.

  1. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  2. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  3. Holstein polarons and triplet bipolarons with NNN hopping

    Science.gov (United States)

    Chakraborty, Monodeep; Taraphder, A.; Berciu, Mona

    2017-05-01

    We study the ground state of 1D Holstein single polaron with next nearest neighbour electron hopping (NNN), employing a variational approximation based on exact diagonalization. Our investigation reveals that, depending upon the sign and magnitude of the NNN hopping integral with respect to nearest neighbour hopping, the polaron band minima may occur at non-zero kGS. We compare the present scenario with the SSH polarons, where a similar feature is also observed, albeit, due to very different mechanism. Our initial investigation of triplet bipolarons, in presence of an attractive extended Hubbard interactions, further substantiates the differences between the present model and the SSH model.

  4. Method for Qualification of Coatings Applied to Wet Surfaces

    Science.gov (United States)

    2009-12-16

    The field application of a pipeline repair or rehabilitation coating usually cannot wait until ambient conditions become optimal. In a humid environment, water can condense on the pipe surface because the pipe surface is usually cooler than the ambie...

  5. Genetic and epigenetic stability of cryopreserved and cold-stored hops (Humulus lupulus L.).

    Science.gov (United States)

    Peredo, Elena L; Arroyo-García, Rosa; Reed, Barbara M; Revilla, M Angeles

    2008-12-01

    Conventional cold storage and cryopreservation methods for hops (Humulus lupulus L.) are available but, to our knowledge, the genetic and epigenetic stability of the recovered plants have not been tested. This study analyzed 51 accessions of hop using the molecular techniques, Random Amplified DNA Polymorphism (RAPD) and Amplified Fragment Length Polymorphism (AFLP), revealing no genetic variation among greenhouse-grown controls and cold stored or cryopreserved plants. Epigenetic stability was evaluated using Methylation Sensitive Amplified Polymorphism (MSAP). Over 36% of the loci were polymorphic when the cold and cryo-treated plants were compared to greenhouse plants. The main changes were demethylation events and they were common to the cryopreserved and cold stored plants indicating the possible effect of the in vitro establishment process, an essential step in both protocols. Protocol-specific methylation patterns were also detected indicating that both methods produced epigenetic changes in plants following cold storage and cryopreservation.

  6. Response Surface Methods For Spatially-Resolved Optical Measurement Techniques

    Science.gov (United States)

    Danehy, P. M.; Dorrington, A. A.; Cutler, A. D.; DeLoach, R.

    2003-01-01

    Response surface methods (or methodology), RSM, have been applied to improve data quality for two vastly different spatially-resolved optical measurement techniques. In the first application, modern design of experiments (MDOE) methods, including RSM, are employed to map the temperature field in a direct-connect supersonic combustion test facility at NASA Langley Research Center. The laser-based measurement technique known as coherent anti-Stokes Raman spectroscopy (CARS) is used to measure temperature at various locations in the combustor. RSM is then used to develop temperature maps of the flow. Even though the temperature fluctuations at a single point in the flowfield have a standard deviation on the order of 300 K, RSM provides analytic fits to the data having 95% confidence interval half width uncertainties in the fit as low as +/- 30 K. Methods of optimizing future CARS experiments are explored. The second application of RSM is to quantify the shape of a 5-meter diameter, ultra-lightweight, inflatable space antenna at NASA Langley Research Center. Photogrammetry is used to simultaneously measure the shape of the antenna at approximately 500 discrete spatial locations. RSM allows an analytic model to be developed that describes the shape of the majority of the antenna with an uncertainty of 0.4 mm, with 95% confidence. This model would allow a quantitative comparison between the actual shape of the antenna and the original design shape. Accurately determining this shape also allows confident interpolation between the measured points. Such a model could, for example, be used for ray tracing of radio-frequency waves up to 95 GHz. to predict the performance of the antenna.

  7. ROUGHNESS ON WOOD SURFACES AND ROUGHNESS MEASUREMENT METHODS

    OpenAIRE

    İsmail Aydın; Gürsel Çolakoğlu

    2003-01-01

    Some visual characteristics of wood such as color, pattern and texture determine the quality of manufactured products. Surface properties of wood material are important both in production and marketing after production. Initial studies related to the roughness of wood surface were begun in early 1950’s. However, no general agreed standardization can not have been developed for wood surfaces. Surface roughness of wood is function of the production process, product type and the natural anatomic...

  8. A New Method Based on TOPSIS and Response Surface Method for MCDM Problems with Interval Numbers

    Directory of Open Access Journals (Sweden)

    Peng Wang

    2015-01-01

    Full Text Available As the preference of design maker (DM is always ambiguous, we have to face many multiple criteria decision-making (MCDM problems with interval numbers in our daily life. Though there have been some methods applied to solve this sort of problem, it is always complex to comprehend and sometimes difficult to implement. The calculation processes are always ineffective when a new alternative is added or removed. In view of the weakness like this, this paper presents a new method based on TOPSIS and response surface method (RSM for MCDM problems with interval numbers, RSM-TOPSIS-IN for short. The key point of this approach is the application of deviation degree matrix, which ensures that the DM can get a simple response surface (RS model to rank the alternatives. In order to demonstrate the feasibility and effectiveness of the proposed method, three illustrative MCMD problems with interval numbers are analysed, including (a selection of investment program, (b selection of a right partner, and (c assessment of road transport technologies. The contrast of ranking results shows that the RSM-TOPSIS-IN method is in good agreement with those derived by earlier researchers, indicating it is suitable to solve MCDM problems with interval numbers.

  9. Preparative isolation and purification of xanthohumol from hops (Humulus lupulus L.) by high-speed counter-current chromatography.

    Science.gov (United States)

    Chen, Qi-He; Fu, Ming-Liang; Chen, Miao-Miao; Liu, Jing; Liu, Xiao-Jie; He, Guo-Qing; Pu, Shou-Cheng

    2012-05-01

    Xanthohumol (XN) and related prenylflavonoids are the main bioactive components of hops (Humulus lupulus L.). The current work is to investigate the use of high-speed counter-current chromatography (HSCCC) in search for high isolation of xanthohumol from hops. A solvent system consisted of n-hexane-ethyl acetate-methanol-water at a volume ratio of 5:5:4:3 was employed. The results demonstrated that the constructed method could be well applied for the isolation of xanthohumol from hops extract. After HSCCC isolation procedure, the purity of xanthohumol was over 95% assayed by HPLC and the yield of extraction was 93.60%. The chemical structure identification of xanthohumol was carried out by UV, (1)H NMR and (13)C NMR. The present results demonstrated that xanthohumol could be efficiently obtained using a single HSCCC step from H. lupulus L. extract. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. A facile method for simulating randomly rough membrane surface associated with interface behaviors

    Science.gov (United States)

    Qu, Xiaolu; Cai, Xiang; Zhang, Meijia; Lin, Hongjun; Leihong, Zhao; Liao, Bao-Qiang

    2018-01-01

    Modeling rough surfaces has emerged as a distinct discipline of considerable research interest in interface behaviors including membrane fouling. In this paper, a facile method was proposed to simulate rough membrane surface morphology. Natural membrane surface was found to be randomly rough, and its height distribution obeys Gaussian distribution. A new method which combines spectrum method, Gaussian distribution and Fourier transform technique was deduced. Simulation of the rough membrane surface showed high similarity in terms of statistical roughness and height distribution between the simulated surface and the real membrane surface, indicating feasibility of the new method. It was found that, correlation length (l) and the number of superposed ridges (N) are key parameters affecting the simulated membrane surface morphology. This new method has evident advantages over conventional modeling methods The proposed method for randomly rough membrane surface modeling could be potentially used to quantify the interfacial interactions between two rough surfaces, giving implications for membrane fouling mitigation.

  11. Multi-hop amplify-and-forward relaying cooperation in the presence of I/Q imbalance

    KAUST Repository

    Qi, Jian

    2013-06-01

    In this paper, multi-hop cooperative networks implementing channel state information (CSI)-assisted amplify-and-forward (AF) relaying in the presence of in-phase and quadrature-phase (I/Q) imbalance are investigated. We propose a compensation algorithm for the I/Q imbalance. The performance of the multi-hop CSI-assisted AF cooperative networks with and without compensation for I/Q imbalance in Nakagami-m fading environment is evaluated in terms of average symbol error probability. Numerical results are provided and show that the proposed compensation method can effectively mitigate the impact of I/Q imbalance. © 2013 IEEE.

  12. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  13. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    Science.gov (United States)

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan

    2014-07-22

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  14. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    POSPÍŠIL, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  15. Treating primary insomnia - the efficacy of valerian and hops.

    Science.gov (United States)

    Salter, Shanah; Brownie, Sonya

    2010-06-01

    To evaluate the efficacy of valerian and hops in the treatment of primary insomnia. The AMED and MEDLINE databases were searched for primary sources of literature published between 1950 and 2009, using keywords: herbal medicine, medicinal plants, herbal, Valeriana officinalis, valerian, Humulus lupulus, hops, sleep, insomnia. Studies were included if they evaluated the efficacy of valerian or hops in improving primary insomnia in adults: sixteen studies met the inclusion criteria. Twelve of these found that the use of valerian, on its own, or in combination with hops, is associated with improvements in some sleep parameters (eg. sleep latency and quality of sleep). However, these results need to be interpreted cautiously as there were significant differences in design between the studies. Further randomised, double blind, placebo controlled trials are needed before such herbal treatments can be confidently recommended for the treatment of primary insomnia.

  16. Hopping in a supercooled binary Lennard-Jones liquid

    DEFF Research Database (Denmark)

    Schrøder, Thomas; Dyre, Jeppe

    1998-01-01

    A binary Lennard–Jones liquid has been investigated by molecular dynamics at equilibrium supercooled conditions. At the lowest temperature investigated, hopping is present in the system as indicated by a secondary peak in 4r2Gs(r,t), where Gs(r,t) is the van Hove self correlation function......", as often argued, and that the system has a single-peaked distribution of hopping-distances centered around the characteristic intermolecular distance....

  17. Generalizing the Hop: Object-Level Programming for Legged Motion

    Science.gov (United States)

    1990-08-01

    1989. 4. J. Hodgins, J. Koechling, and M. H. Raibert, "Running experiments with a planar biped ," in The 3rd International Symposium on Robotics ...controlling a hopping robot . The approach focuses on the interaction between the hopper and its surroundings at points of con- tact. It is only through...locomotion of legged robots . Walking, running, and hopping are distinguished from most conventional robot tasks in several respects. A stationary robot

  18. Structure-aware Bayesian compressive sensing for frequency-hopping spectrum estimation

    Science.gov (United States)

    Liu, Shengheng; Zhang, Yimin D.; Shan, Tao; Qin, Si; Amin, Moeness G.

    2016-05-01

    Frequency-hopping (FH) is one of the commonly used spread spectrum techniques that finds wide applications in communications and radar systems due to its capability of low probability of intercept, reduced interference, and desirable ambiguity property. In this paper, we consider the blind estimation of the instantaneous FH spectrum without the knowledge of hopping patterns. The FH signals are analyzed in the joint time-frequency domain, where FH signals manifest themselves as sparse entries, thus inviting compressive sensing and sparse reconstruction techniques for FH spectrum estimation. In particular, the signals' piecewise-constant frequency characteristics are exploited in the reconstruction of sparse quadratic time-frequency representations. The Bayesian compressive sensing methods are applied to provide high-resolution frequency estimation. The FH spectrum characteristics are used in the design of signal-dependent kernel within the framework of structure-aware sparse reconstruction.

  19. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  20. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  1. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  2. The Impact of Globalization Process of Hip-Hop Music in Semarang as a Reflection of American Pop Culture (a Case Study of Semarang Hip-Hop Community)

    OpenAIRE

    Alfian, Muhammad Rio

    2013-01-01

    Skripsi ini, berfokus pada analisis mengenai proses glokalisasi musik hip hop sebagai refleksi budaya pop Amerika di Indonesia. Studi kasus dari skripsi ini adalah komunitas musik hip hop di kota Semarang bernama “024 Streets”. Tujuan dari penelitian ini adalah untuk menunjukkan proses glokalisasi musik hip hop sebagai subkultur anak muda di Semarang. Penulis menggunakan metode kualitatif dari Chaterine Dawson untuk mengumpulkan data mengenai komunitas musik hip-hop (024 Streets) dan metode p...

  3. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  4. What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

    Science.gov (United States)

    Love, Bettina L.

    2015-01-01

    Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

  5. Guiding the Influence of Hip-Hop Music on Middle-School Students' Feelings, Thinking, and Behaving

    Science.gov (United States)

    Brown, Veda

    2006-01-01

    Although the nature of the relationship of music on students' emotional development remains an issue for continued research, my overall purpose is to provide adults with research-based methods to help children become better consumers of hip-hop music. First, I identify research-based recommendations to prepare adults as facilitators of children's…

  6. The sedative effects of hops (Humulus lupulus), a component of beer, on the activity/rest rhythm.

    Science.gov (United States)

    Franco, L; Sánchez, C; Bravo, R; Rodriguez, A; Barriga, C; Juánez, Javier Cubero

    2012-06-01

    The hop (Humulus lupulus), a component of beer, is a sedative plant whose pharmacological activity is due principally to its bitter resins, especially to the α-acid component 2-methyl-3-buten-2-ol. The mechanism of action of the resin of hop consists of increasing the activity of the neurotransmitter γ-aminobutyric (GABA), inhibiting the central nervous system (CNS). To analyze in an experimental model of diurnal animal the sedative effect of hop, a component of beer, on the activity/rest rhythm. Experiments were performed with common quail (Coturnix coturnix) similar to humans in the sleep-wake rhythm, isolated in 25 × 25 × 25 cm methacrylate cages, with food and water ad libitum, in a room with artificial ventilation (22 ± 1 °C) and a lighting cycle of 12L/12D (n = 5). The doses administered, close to the content of non-alcoholic beer, were 1, 2 and 11 mg extract of hop as one capsule per day, at 18:00 h for one week. A control group received capsules only with a methylcellulose excipient and a basal group received no treatment. The chronobiological analysis of the animals' activity captured and logged by the software DAS24 was performed using the Ritme computer program (cosinor methods). With the dose of 2 mg, there was a statistically significant (p hop extract effectively decreased nocturnal activity in the circadian activity rhythm. On the basis of this investigation, administration of non-alcoholic beer would be recommended due to its hop content and consequent sedative action, which would be an aid to nocturnal sleep.

  7. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  8. Analytical methods for the characterization of surface finishing in bricks

    International Nuclear Information System (INIS)

    Nardini, I.; Zendri, E.; Biscontin, G.; Brunetin, A.

    2006-01-01

    The recent restoration works of Santo Stefano Church Facade (XV century) in Venice have shown traces variously saved of different kind of surface finishes. These finishes were found on the brick's surface both in the masonry and in the decorative elements. Different brick's surface and decorative tile samples were investigated using several techniques: optical microscopy, scanning electron-microscopy, thermal analysis, infrared spectroscopy and reflectance Fourier transform infrared microspectroscopy. The evaluation of the reached results was used to understand the decorative techniques and to recognize the material employed

  9. Carbon nanotube oscillator surface profiling device and method of use

    Science.gov (United States)

    Popescu, Adrian [Tampa, FL; Woods, Lilia M [Tampa, FL; Bondarev, Igor V [Fuquay Varina, NC

    2011-11-15

    The proposed device is based on a carbon nanotube oscillator consisting of a finite length outer stationary nanotube and a finite length inner oscillating nanotube. Its main function is to measure changes in the characteristics of the motion of the carbon nanotube oscillating near a sample surface, and profile the roughness of this surface. The device operates in a non-contact mode, thus it can be virtually non-wear and non-fatigued system. It is an alternative to the existing atomic force microscope (AFM) tips used to scan surfaces to determine their roughness.

  10. Contribution of surface analysis spectroscopic methods to the lubrication field

    International Nuclear Information System (INIS)

    Blanc, C.

    1979-01-01

    The analytical surface technics such as ESCA, AES and SIMS are tested to be applied to a particular lubrication field. One deals with a 100 C 6 steel surface innumered in tricresylphosphate at 110 0 C for 15 days. The nature of the first layers is studied after relevant solvant cleaning. An iron oxide layer is produced on the bearing surface, namely αFe 2 -O 3 . ESCA, AES and SIMS studies show an overlayer of iron phosphate. The exact nature of iron phosphate is not clearly established but the formation of a ferrous phosphate coating can be assumed from ESCA analysis [fr

  11. Method and coating composition for protecting and decontaminating surfaces

    Science.gov (United States)

    Overhold, D C; Peterson, M D

    1959-03-10

    A protective coating useful in the decontamination of surfaces exposed to radioactive substances is described. This coating is placed on the surface before use and is soluble in water, allowing its easy removal in the event decontamination becomes necessary. Suitable coating compositions may be prepared by mixing a water soluble carbohydrate such as sucrose or dextrin, together with a hygroscopic agent such as calcium chloride or zinc chloride.

  12. Multi-Hop Teleportation of an Unknown Qubit State Based on W States

    Science.gov (United States)

    Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen

    2018-04-01

    Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.

  13. Influence of various surface-conditioning methods on the bond strength of metal brackets to ceramic surfaces

    NARCIS (Netherlands)

    Schmage, P; Nergiz, [No Value; Herrmann, W; Ozcan, M; Nergiz, Ibrahim; �zcan, Mutlu

    With the increase in adult orthodontic treatment comes the need to find a reliable method for bonding orthodontic brackets onto metal or ceramic crowns and fixed partial dentures. In this study, shear bond strength and surface roughness tests were used to examine the effect of 4 different surface

  14. Feasibility of using a seismic surface wave method to study seasonal and weather effects on shallow surface soils

    Science.gov (United States)

    The objective of this paper is to study the feasibility of using a seismic surface wave method to investigate seasonal and weather effects on shallow surface soils. In the study, temporal variations of subsurface soil properties were measured and monitored by using a combination of a new seismic su...

  15. Non-invasive genotyping of Helicobacter pylori cagA, vacA, and hopQ from asymptomatic children.

    Science.gov (United States)

    Sicinschi, Liviu A; Correa, Pelayo; Bravo, Luis E; Peek, Richard M; Wilson, Keith T; Loh, John T; Yepez, Maria C; Gold, Benjamin D; Thompson, Dexter T; Cover, Timothy L; Schneider, Barbara G

    2012-04-01

    Helicobacter pylori infection is usually acquired in childhood, but little is known about its natural history in asymptomatic children, primarily due to the paucity of non-invasive diagnostic methods. H. pylori strains harboring cagA and specific alleles of hopQ and vacA are associated with increased risk for gastric cancer. Many studies of H. pylori virulence markers in children have the bias that symptomatic subjects are selected for endoscopy, and these children may harbor the most virulent strains. Our aim is to genotype cagA, hopQ, and vacA alleles in stool DNA samples of healthy Colombian children residing in an area with high incidence of gastric cancer, to avoid selection bias resulting from endoscopy. H. pylori status of 86 asymptomatic children was assessed by (13) C-urea breath test (UBT) and PCR. H. pylori 16S rRNA, cagA, hopQ, and vacA genes were amplified from stool DNA samples and sequenced. UBT was positive in 69 (80.2%) of 86 children; in stool DNA analysis, 78.3% were positive by 16S rRNA PCR. cagA, vacA, and hopQ were detected in 66.1%, 84.6%, and 72.3% of stool DNA samples from 16S rRNA-positive children. Of the children's DNA samples, which revealed vacA and hopQ alleles, 91.7% showed vacA s1 and 73.7% showed type I hopQ. Type I hopQ alleles were associated with cagA positivity and vacA s1 genotypes (p pylori were successfully genotyped in a high percentage of the asymptomatic infected children, revealing a high prevalence of genotypes associated with virulence. Type I hopQ alleles were associated with the presence of cagA and the vacA s1 genotype. © 2012 Blackwell Publishing Ltd.

  16. Group IV nanocrystals with ion-exchangeable surface ligands and methods of making the same

    Energy Technology Data Exchange (ETDEWEB)

    Wheeler, Lance M.; Nichols, Asa W.; Chernomordik, Boris D.; Anderson, Nicholas C.; Beard, Matthew C.; Neale, Nathan R.

    2018-01-09

    Methods are described that include reacting a starting nanocrystal that includes a starting nanocrystal core and a covalently bound surface species to create an ion-exchangeable (IE) nanocrystal that includes a surface charge and a first ion-exchangeable (IE) surface ligand ionically bound to the surface charge, where the starting nanocrystal core includes a group IV element.

  17. A novel surface cleaning method for chemical removal of fouling lead layer from chromium surfaces

    Science.gov (United States)

    Gholivand, Kh.; Khosravi, M.; Hosseini, S. G.; Fathollahi, M.

    2010-10-01

    Most products especially metallic surfaces require cleaning treatment to remove surface contaminations that remain after processing or usage. Lead fouling is a general problem which arises from lead fouling on the chromium surfaces of bores and other interior parts of systems which have interaction with metallic lead in high temperatures and pressures. In this study, a novel chemical solution was introduced as a cleaner reagent for removing metallic lead pollution, as a fouling metal, from chromium surfaces. The cleaner aqueous solution contains hydrogen peroxide (H 2O 2) as oxidizing agent of lead layer on the chromium surface and acetic acid (CH 3COOH) as chelating agent of lead ions. The effect of some experimental parameters such as acetic acid concentration, hydrogen peroxide concentration and temperature of the cleaner solution during the operation on the efficiency of lead cleaning procedure was investigated. The results of scanning electron microscopy (SEM) showed that using this procedure, the lead pollution layer could be completely removed from real chromium surfaces without corrosion of the original surface. Finally, the optimum conditions for the complete and fast removing of lead pollution layer from chromium surfaces were proposed. The experimental results showed that at the optimum condition (acetic acid concentration 28% (V/V), hydrogen peroxide 8% (V/V) and temperature 35 °C), only 15-min time is needed for complete removal of 3 g fouling lead from a chromium surface.

  18. In Search of the Golden Age Hip-Hop Sound (1986–1996

    Directory of Open Access Journals (Sweden)

    Ben Duinker

    2017-09-01

    Full Text Available The notion of a musical repertoire's "sound" is frequently evoked in journalism and scholarship, but what parameters comprise such a sound? This question is addressed through a statistically-driven corpus analysis of hip-hop music released during the genre's Golden Age era. The first part of the paper presents a methodology for developing, transcribing, and analyzing a corpus of 100 hip-hop tracks released during the Golden Age. Eight categories of aurally salient musical and production parameters are analyzed: tempo, orchestration and texture, harmony, form, vocal and lyric profiles, global and local production effects, vocal doubling and backing, and loudness and compression. The second part of the paper organizes the analysis data into three trend categories: trends of change (parameters that change over time, trends of prevalence (parameters that remain generally constant across the corpus, and trends of similarity (parameters that are similar from song to song. These trends form a generalized model of the Golden Age hip-hop sound which considers both global (the whole corpus and local (unique songs within the corpus contexts. By operationalizing "sound" as the sum of musical and production parameters, aspects of popular music that are resistant to traditional music-analytical methods can be considered.

  19. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

    Directory of Open Access Journals (Sweden)

    Zhongcheng Wei

    2017-01-01

    Full Text Available As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs. However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs.

  20. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs.

    Science.gov (United States)

    Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

    2017-01-14

    As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs.

  1. HapHop-Physio: a computer game to support cognitive therapies in children.

    Science.gov (United States)

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

    2017-01-01

    Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch ® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

  2. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  3. Reducing Motional Decoherence in Ion Traps with Surface Science Methods

    Science.gov (United States)

    Haeffner, Hartmut

    2014-03-01

    Many trapped ions experiments ask for low motional heating rates while trapping the ions close to trapping electrodes. However, in practice small ion-electrode distances lead to unexpected high heating rates. While the mechanisms for the heating is still unclear, it is now evident that surface contamination of the metallic electrodes is at least partially responsible for the elevated heating rates. I will discuss heating rate measurements in a microfabricated surface trap complemented with basic surface science studies. We monitor the elemental surface composition of the Cu-Al alloy trap with an Auger spectrometer. After bake-out, we find a strong Carbon and Oxygen contamination and heating rates of 200 quanta/s at 1 MHz trap frequency. After removing most of the Carbon and Oxygen with Ar-Ion sputtering, the heating rates drop to 4 quanta/s. Interestingly, we still measure the decreased heating rate even after the surface oxidized from the background gas throughout a 40-day waiting time in UHV.

  4. Biomimetic superhydrophobic polyolefin surfaces fabricated with a facile scraping, bonding and peeling method

    NARCIS (Netherlands)

    Feng, Huanhuan; Zheng, Tingting; Wang, Huiliang

    2016-01-01

    Inspired by the superhydrophobicity of juicy peach surface, on which microscale hairs are standing vertically to the surface plane, an extremely simple, inexpensive physical method is developed for fabrication of superhydrophobic polyolefin surfaces over large areas. This method includes three

  5. Method of removing hazardous material deposited on concrete surface

    International Nuclear Information System (INIS)

    Komatsu, Fumiaki; Baba, Kyoji.

    1991-01-01

    A salt compound containing a carbonate group such as sodium carbonate or potassium carbonate is dissolved in water and the aqueous solution is sprayed on the surface of concretes, kept for a predetermined period and dried to deposit the carbonate on the surface of the concretes. Then, aqueous solution of an organic acid such as oxalic acid or citric acid is sprayed and reacted with the carbonate to form bubbles of gaseous carbon dioxide. With such procedures, hazardous material containing radioactive materials intruded to the unevenness or fine holes on the surface of the concrete, or heavy metals such as hexavalent chromium or lead are deposited to the bubbles of gaseous carbon dioxide to be raised up therewith. By removing the bubbles, hazardous materials such as radioactive materials or heavy metals intruded to the concretes can be removed without generating powdery dusts, without requiring a large-scaled device and without changing the characteristic of the concretes. (T.M.)

  6. Methods of remote surface chemical analysis for asteroid missions

    International Nuclear Information System (INIS)

    Sagdeev, R.Z.; Managadze, G.G.; Shutyaev, I.Yu.; Timofeev, P.P.; Szegoe, K.

    1984-06-01

    Different remote sensing methods are discussed which can be applied to investigate the chemical composition of minor bodies of the Solar System. The secondary-ion method, remote laser mass-analysis and electron beam induced X-ray emission analysis are treated in detail. Relative advantages of these techniques are analyzed. The physical limitation of the methods: effects of solar magnetic field and solar wind on the secondary-ion and laser methods and the effect of electrostatic potential of the space apparatus on the ion and electron beam methods are described. First laboratory results of remote laser method are given. (D.Gy.)

  7. A surface refractive index scanning system and method

    DEFF Research Database (Denmark)

    2015-01-01

    The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction, and a s......The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction...

  8. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna

    2014-01-01

    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...

  9. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  10. Response surface method applied to optimization of estradiol ...

    Indian Academy of Sciences (India)

    An optimization process based on response surface methodology was carried out in order to develop a statistical model which describes the relationship between active independent variables and estradiol flux. This model can be used to find out a combination of factor levels during response optimization. Possible options ...

  11. Membrane mimetic surface functionalization of nanoparticles: Methods and applications

    Science.gov (United States)

    Weingart, Jacob; Vabbilisetty, Pratima; Sun, Xue-Long

    2013-01-01

    Nanoparticles (NPs), due to their size-dependent physical and chemical properties, have shown remarkable potential for a wide range of applications over the past decades. Particularly, the biological compatibilities and functions of NPs have been extensively studied for expanding their potential in areas of biomedical application such as bioimaging, biosensing, and drug delivery. In doing so, surface functionalization of NPs by introducing synthetic ligands and/or natural biomolecules has become a critical component in regards to the overall performance of the NP system for its intended use. Among known examples of surface functionalization, the construction of an artificial cell membrane structure, based on phospholipids, has proven effective in enhancing biocompatibility and has become a viable alternative to more traditional modifications, such as direct polymer conjugation. Furthermore, certain bioactive molecules can be immobilized onto the surface of phospholipid platforms to generate displays more reminiscent of cellular surface components. Thus, NPs with membrane-mimetic displays have found use in a range of bioimaging, biosensing, and drug delivery applications. This review herein describes recent advances in the preparations and characterization of integrated functional NPs covered by artificial cell membrane structures and their use in various biomedical applications. PMID:23688632

  12. Child-Mediated Stroke Communication: Findings from Hip Hop Stroke

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

    2011-01-01

    Background and Purpose Low thrombolysis rates for acute ischemic stroke is linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether “Child-Mediated Stroke Communication” (CMSC) could improve stroke literacy parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke (HHS). Methods Parents of children aged 9 to 12 years from two public schools in Harlem, NYC, were recruited to participate in stroke literacy questionnaires before and after their child’s participation in HHS, a novel CMSC intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week following the intervention. Results Fifth and Sixth grade students (n =182) were enrolled into HHS. 102 parents were approached in person to participate; 75 opted to participate and 71 completed both pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program: before the program, 3 parents of 75 (3.9%) were able to identify the five cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911), compared to 21 of 71 parents (29.6%) post-intervention (pstroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that schoolchildren aged 9-12 may be effective conduits of critical stroke knowledge to their Parents. PMID:22033995

  13. SDN-based path hopping communication against eavesdropping attack

    Science.gov (United States)

    Zhang, Chuanhao; Bu, Youjun; Zhao, Zheng

    2016-10-01

    Network eavesdropping is one of the most popular means used by cyber attackers, which has been a severe threat to network communication security. Adversaries could capture and analyze network communication data from network nodes or links, monitor network status and steal sensitive data such as username and password etc. Traditional network usually uses static network configuration, and existing defense methods, including firewall, IDS, IPS etc., cannot prevent eavesdropping, which has no distinguishing characteristic. Network eavesdropping become silent during most of the time of the attacking process, which is why it is difficult to discover and to defend. But A successful eavesdropping attack also has its' precondition, which is the target path should be relatively stable and has enough time of duration. So, In order to resolve this problem, it has to work on the network architecture. In this paper, a path hopping communication(PHC) mechanism based on Software Define Network (SDN) was proposed to solve this problem. In PHC, Ends in communication packets as well as the routing paths were changed dynamically. Therefore, the traffic would be distributed to multiple flows and transmitted along different paths. so that Network eavesdropping attack could be prevented effectively. It was concluded that PHC was able to increase the overhead of Network eavesdropping, as well as the difficulty of communication data recovery.

  14. Ion implantation method for preparing polymers having oxygen erosion resistant surfaces

    Science.gov (United States)

    Lee, Eal H.; Mansur, Louis K.; Heatherly, Jr., Lee

    1995-01-01

    Hard surfaced polymers and the method for making them are generally described. Polymers are subjected to simultaneous multiple ion beam bombardment, that results in a hardening of the surface, improved wear resistance, and improved oxygen erosion resistance.

  15. A surface defects inspection method based on multidirectional gray-level fluctuation

    Directory of Open Access Journals (Sweden)

    Yunpeng Ma

    2017-05-01

    Full Text Available Machine vision inspection technology provides an efficient tool for surface defects inspection. However, because of the multiformity of surface defects, the existing machine vision methods for surface defects inspection are limited by application scenarios. In order to improve the versatility of algorithms, and to process various kinds of images more accurately, we propose a new adaptive method for surface defect detection, named neighborhood gray-level difference method using the multidirectional gray-level fluctuation. This method changes thresholds and step values by extracting gray-level-fluctuating condition of images, and then it uses the neighborhood gray-level difference to segment defects from background. Experimental results demonstrate the effectiveness of the proposed method for inspecting different surface defects. Compared with other methods, the proposed method can be applied to inspect various surface defects, and it can provide more accurate defect segmentation results.

  16. A comparative study of different methods for calculating electronic transition rates

    Science.gov (United States)

    Kananenka, Alexei A.; Sun, Xiang; Schubert, Alexander; Dunietz, Barry D.; Geva, Eitan

    2018-03-01

    We present a comprehensive comparison of the following mixed quantum-classical methods for calculating electronic transition rates: (1) nonequilibrium Fermi's golden rule, (2) mixed quantum-classical Liouville method, (3) mean-field (Ehrenfest) mixed quantum-classical method, and (4) fewest switches surface-hopping method (in diabatic and adiabatic representations). The comparison is performed on the Garg-Onuchic-Ambegaokar benchmark charge-transfer model, over a broad range of temperatures and electronic coupling strengths, with different nonequilibrium initial states, in the normal and inverted regimes. Under weak to moderate electronic coupling, the nonequilibrium Fermi's golden rule rates are found to be in good agreement with the rates obtained via the mixed quantum-classical Liouville method that coincides with the fully quantum-mechanically exact results for the model system under study. Our results suggest that the nonequilibrium Fermi's golden rule can serve as an inexpensive yet accurate alternative to Ehrenfest and the fewest switches surface-hopping methods.

  17. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  18. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  19. Particle trapping and hopping in an optofluidic fishnet

    Science.gov (United States)

    Shi, Y. Z.; Xiong, S.; Zhang, Y.; Chin, L. K.; Wu, J. H.; Chen, T. N.; Liu, A. Q.

    2017-08-01

    Particle jumping between optical potentials has attracted much attention owing to its extensive involvement in many physical and biological experiments. In some circumstances, particle jumping indicates escaping from the optical trap, which is an issue people are trying to avoid. Nevertheless, particle jumping can facilitate the individual trap in each laser spot in the optical lattice and enable sorting and delivery of nanoparticles. Particle hopping has not been seen in fluid because Fluidic drag force dramatically reduce the dwell time of particle or break the potential well. Here, we observe particle hopping in the microchannel by three reasons, e.g., particle collision or aggregation, light disturbing by pretrapped particle and fake trapping position. We show that commonly ignored particle influence to the light could create a new isolated trapping position, where particle hops to the adjacent potential well. The hopping happens in an optofluidic fishnet which is comprised of discrete hotspots enabling 2D patterning of particles in the flow stream for the first time. We also achieve a 2D patterning of cryptosporidium in the microchannel. Our observed particle hopping in the flow stream completes the family of particle kinetics in potential wells and inspires new interests in the particle disturbed optical trapping. The 2D patterning of particles benefits the parallel study of biological samples in the flow stream and have potential on cell sorting and drug delivery.

  20. First-principles Green's-function method for surface calculations: A pseudopotential localized basis set approach

    Science.gov (United States)

    Smidstrup, Søren; Stradi, Daniele; Wellendorff, Jess; Khomyakov, Petr A.; Vej-Hansen, Ulrik G.; Lee, Maeng-Eun; Ghosh, Tushar; Jónsson, Elvar; Jónsson, Hannes; Stokbro, Kurt

    2017-11-01

    We present an efficient implementation of a surface Green's-function method for atomistic modeling of surfaces within the framework of density functional theory using a pseudopotential localized basis set approach. In this method, the system is described as a truly semi-infinite solid with a surface region coupled to an electron reservoir, thereby overcoming several fundamental drawbacks of the traditional slab approach. The versatility of the method is demonstrated with several applications to surface physics and chemistry problems that are inherently difficult to address properly with the slab method, including metal work function calculations, band alignment in thin-film semiconductor heterostructures, surface states in metals and topological insulators, and surfaces in external electrical fields. Results obtained with the surface Green's-function method are compared to experimental measurements and slab calculations to demonstrate the accuracy of the approach.

  1. The orthogonal gradients method: A radial basis functions method for solving partial differential equations on arbitrary surfaces

    KAUST Repository

    Piret, Cécile

    2012-05-01

    Much work has been done on reconstructing arbitrary surfaces using the radial basis function (RBF) method, but one can hardly find any work done on the use of RBFs to solve partial differential equations (PDEs) on arbitrary surfaces. In this paper, we investigate methods to solve PDEs on arbitrary stationary surfaces embedded in . R3 using the RBF method. We present three RBF-based methods that easily discretize surface differential operators. We take advantage of the meshfree character of RBFs, which give us a high accuracy and the flexibility to represent the most complex geometries in any dimension. Two out of the three methods, which we call the orthogonal gradients (OGr) methods are the result of our work and are hereby presented for the first time. © 2012 Elsevier Inc.

  2. Ion Beam Methods for the Surface Characterization of Polymers.

    Science.gov (United States)

    1982-02-01

    These surface spectroscopies are useful in many areas of polymer technology including synthesis, extrusion and forming, and long time durability and...Pure and Applied Chemistry Meeting on Polymer Degradation held at Durham University, Durham, England, in July 1981. The author thanks Dr. W. J. Feast...25 7 SIMS Data in Mass Range 160-330 from Teflon Using Charge Neutralization (Ref. 19) 26 8 (a) ISS/SIMS Data for Polypropylene Using 3He+ at 2500 eV

  3. Methods of Attaching or Grafting Carbon Nanotubes to Silicon Surfaces and Composite Structures Derived Therefrom

    Science.gov (United States)

    Tour, James M. (Inventor); Chen, Bo (Inventor); Flatt, Austen K. (Inventor); Stewart, Michael P. (Inventor); Dyke, Christopher A. (Inventor); Maya, Francisco (Inventor)

    2012-01-01

    The present invention is directed toward methods of attaching or grafting carbon nanotubes (CNTs) to silicon surfaces. In some embodiments, such attaching or grafting occurs via functional groups on either or both of the CNTs and silicon surface. In some embodiments, the methods of the present invention include: (1) reacting a silicon surface with a functionalizing agent (such as oligo(phenylene ethynylene)) to form a functionalized silicon surface; (2) dispersing a quantity of CNTs in a solvent to form dispersed CNTs; and (3) reacting the functionalized silicon surface with the dispersed CNTs. The present invention is also directed to the novel compositions produced by such methods.

  4. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)

    The theory and practice of electrical and gravity methods of geophysics for groundwater exploration was reviewed with illustrations and data examples. With the goal of reducing cases of borehole/water-well failure attributed to the lack of the knowledge of the methods of geophysics for groundwater exploration and ...

  5. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)

    USER

    method of groundwater exploration was discussed with field data from Wokbedilo community in Ethopia. ... Electromagnetic and electrical methods have shown superior suitability for groundwater exploration because rock properties that are crucial to hydrogeology ..... Where M and R are the mass and radius of the earth.

  6. Photoswitchable method for the ordered attachment of proteins to surfaces

    Science.gov (United States)

    Camarero, Julio A.; De Yoreo, James J.; Kwon, Youngeun

    2010-04-20

    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  7. Ernst Equation and Riemann Surfaces: Analytical and Numerical Methods

    Energy Technology Data Exchange (ETDEWEB)

    Ernst, Frederick J [FJE Enterprises, 511 County Route 59, Potsdam, NY 13676 (United States)

    2007-06-18

    source can be represented by discontinuities in the metric tensor components. The first two chapters of this book are devoted to some basic ideas: in the introductory chapter 1 the authors discuss the concept of integrability, comparing the integrability of the vacuum Ernst equation with the integrability of nonlinear equations of Korteweg-de Vries (KdV) type, while in chapter 2 they describe various circumstances in which the vacuum Ernst equation has been determined to be relevant, not only in connection with gravitation but also, for example, in the construction of solutions of the self-dual Yang-Mills equations. It is also in this chapter that one of several equivalent linear systems for the Ernst equation is described. The next two chapters are devoted to Dmitry Korotkin's concept of algebro-geometric solutions of a linear system: in chapter 3 the structure of such solutions of the vacuum Ernst equation, which involve Riemann theta functions of hyperelliptic algebraic curves of any genus, is contrasted with the periodic structure of such solutions of the KdV equation. How such solutions can be obtained, for example, by solving a matrix Riemann-Hilbert problem and how the metric tensor of the associated spacetime can be evaluated is described in detail. In chapter 4 the asymptotic behaviour and the similarity structure of the general algebro-geometric solutions of the Ernst equation are described, and the relationship of such solutions to the perhaps more familiar multi-soliton solutions is discussed. The next three chapters are based upon the authors' own published research: in chapter 5 it is shown that a problem involving counter-rotating infinitely thin disks of matter can be solved in terms of genus two Riemann theta functions, while in chapter 6 the authors describe numerical methods that facilitate the construction of such solutions, and in chapter 7 three-dimensional graphs are displayed that depict all metrical fields of the associated spacetime

  8. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  9. Comparison of Rheological Properties of Hopped Wort and Malt Wort

    Directory of Open Access Journals (Sweden)

    Petr Trávníček

    2015-01-01

    Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

  10. Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance.

    Science.gov (United States)

    Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V

    2012-05-04

    In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

  11. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage

    Directory of Open Access Journals (Sweden)

    Ziola Barry

    2009-09-01

    Full Text Available Abstract Background Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol. Use of antimicrobial compounds (e.g., hop-compounds, Penicillin by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Results Lactic acid bacteria susceptibility test broth medium (LSM used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Conclusion Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  12. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage.

    Science.gov (United States)

    Haakensen, Monique; Vickers, David M; Ziola, Barry

    2009-09-07

    Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol). Use of antimicrobial compounds (e.g., hop-compounds, Penicillin) by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Lactic acid bacteria susceptibility test broth medium (LSM) used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  13. Integral methods for shallow free-surface flows with separation

    DEFF Research Database (Denmark)

    Watanabe, S.; Putkaradze, V.; Bohr, Tomas

    2003-01-01

    an inclined plane we take a similar approach and derive a simple model in which the velocity profile is not restricted to a parabolic or self-similar form. Two types of solutions with large surface distortions are found: solitary, kink-like propagating fronts, obtained when the flow rate is suddenly changed......, and stationary jumps, obtained, for instance, behind a sluice gate. We then include time dependence in the model to study the stability of these waves. This allows us to distinguish between sub- and supercritical flows by calculating dispersion relations for wavelengths of the order of the width of the layer....

  14. A new method for background rejection with surface sensitive bolometers

    International Nuclear Information System (INIS)

    Nones, C.; Foggetta, L.; Giuliani, A.; Pedretti, M.; Salvioni, C.; Sangiorgio, S.

    2006-01-01

    We report the performance of three prototype TeO 2 macrobolometers, able to identify events due to energy deposited at the detector surface. This capability is obtained by thermally coupling thin active layers to the main absorber of the bolometer, and is proved by irradiating the detectors with alpha particles. This technique can be very useful in view of background study and reduction for the CUORE experiment, a next generation Double Beta Decay search based on TeO 2 macrobolometers and to be installed in the Laboratori Nazionali del Gran Sasso

  15. Quantitative trait loci in hop (Humulus lupulus L.) reveal complex genetic architecture underlying variation in sex, yield and cone chemistry.

    Science.gov (United States)

    McAdam, Erin L; Freeman, Jules S; Whittock, Simon P; Buck, Emily J; Jakse, Jernej; Cerenak, Andreja; Javornik, Branka; Kilian, Andrzej; Wang, Cai-Hong; Andersen, Dave; Vaillancourt, René E; Carling, Jason; Beatson, Ron; Graham, Lawrence; Graham, Donna; Darby, Peter; Koutoulis, Anthony

    2013-05-30

    Hop (Humulus lupulus L.) is cultivated for its cones, the secondary metabolites of which contribute bitterness, flavour and aroma to beer. Molecular breeding methods, such as marker assisted selection (MAS), have great potential for improving the efficiency of hop breeding. The success of MAS is reliant on the identification of reliable marker-trait associations. This study used quantitative trait loci (QTL) analysis to identify marker-trait associations for hop, focusing on traits related to expediting plant sex identification, increasing yield capacity and improving bittering, flavour and aroma chemistry. QTL analysis was performed on two new linkage maps incorporating transferable Diversity Arrays Technology (DArT) markers. Sixty-three QTL were identified, influencing 36 of the 50 traits examined. A putative sex-linked marker was validated in a different pedigree, confirming the potential of this marker as a screening tool in hop breeding programs. An ontogenetically stable QTL was identified for the yield trait dry cone weight; and a QTL was identified for essential oil content, which verified the genetic basis for variation in secondary metabolite accumulation in hop cones. A total of 60 QTL were identified for 33 secondary metabolite traits. Of these, 51 were pleiotropic/linked, affecting a substantial number of secondary metabolites; nine were specific to individual secondary metabolites. Pleiotropy and linkage, found for the first time to influence multiple hop secondary metabolites, have important implications for molecular selection methods. The selection of particular secondary metabolite profiles using pleiotropic/linked QTL will be challenging because of the difficulty of selecting for specific traits without adversely changing others. QTL specific to individual secondary metabolites, however, offer unequalled value to selection programs. In addition to their potential for selection, the QTL identified in this study advance our understanding of the

  16. Using of the surface activation method for enhancement of machine realibility

    International Nuclear Information System (INIS)

    Postnikov, V.I.; Garbar, I.N.

    1979-01-01

    A surface activation method is described for controlling the wear of units and details, allowing one to measure the wear at continuous operation of the mechanism by any program. The main advantages of the surface activation method for the wear tests are shown. By means of that method it was possible to develop a simultaneous controlling conjugate detail wear, and a method of different-activity brands, as well as the method for repeated activation of details. Development of theory for the engineering and technology of engine wear control by the surface activation method allowed one to improve the efficiency and reduce the time of research in the field of friction and wear

  17. Advanced Bayesian Methods for Lunar Surface Navigation, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — The key innovation of this project is the application of advanced Bayesian methods to integrate real-time dense stereo vision and high-speed optical flow with an...

  18. Advanced Bayesian Methods for Lunar Surface Navigation, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The key innovation of this project will be the application of advanced Bayesian methods to integrate real-time dense stereo vision and high-speed optical flow with...

  19. Variable range hopping conduction and microstructure properties of semiconducting Co-doped TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Okutan, Mustafa [Department of Physics, Gebze Institute of Technology, 41400 Gebze (Turkey)]. E-mail: mokutan@gyte.edu.tr; Bakan, Halil I. [TUBITAK-MAM, Materials and Chemical Research Institute, 41470 Gebze (Turkey); Korkmaz, Kemal [Department of Material Science and Engineering, Gebze Institute of Technology, 41400 Gebze (Turkey); Yakuphanoglu, Fahrettin [Department of Physics, Faculty of Arts and Science, Firat University, 23169 Elazig (Turkey)

    2005-01-31

    The surface morphology, phases existing in the microstructure and conductivity behavior of Co-doped TiO2 have been investigated by atomic force microscopy (AFM), scanning electron microscopy (SEM), electrical conductivity measurements and X-ray diffraction technique. The semiconducting phase is found to obey Mott's variable range hopping mechanism of the conduction. The conduction mechanism of the ceramic shows a crossover from the, exp[-(T0/T)1/4] law to a simply activated law, exp(-{delta}E/kT). This behavior is attributed to temperature-induced transition from 3D to thermally activated behavior. The hopping conduction parameters such as the characteristic temperature (T0), localization length ({alpha}), hopping distance (R), activation energy ({delta}E) and density of states at Fermi level (N(EF) have been calculated. Surface morphology shows that the ceramic has a regular surface. The SEM study indicates that there are grains which have a certain type in the microstructure. Rutile phases with different plane in microstructure were found.

  20. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  1. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Directory of Open Access Journals (Sweden)

    María Pilar Castañeda-Ojeda

    2017-05-01

    Full Text Available The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts.

  2. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  3. Evaluation of chemical surface treatment methods for mitigation of PWSCC

    International Nuclear Information System (INIS)

    Dame, C.; Marks, C.; Olender, A.; Farias, J.

    2015-01-01

    As part of its mission to propose innovative and safe technologies to mitigate Primary Water Stress Corrosion Cracking (PWSCC) in Pressurized Water Reactors (PWR), EPRI recently initiated a program to evaluate potential new chemical surface treatments that might delay the occurrence of PWSCC such that no failure of components would be observed during their lifetime. Among the initial screening of more than thirty technologies, seven were selected for a more detailed review. The selected technologies were: nickel and nickel alloy plating, organic inhibitors, chromium-based inhibitors, silicon carbide, titanium-based inhibitors, rare earth metal (REM)-based inhibitors and encapsulation. The conclusions of the review of these technologies were that two of them were worth pursuing, titanium-based and REM-based inhibitors, and that evaluating the radiological consequences of injecting these products in the primary system, as well as assessing their efficacy to mitigate PWSCC, should be prioritized as the next required steps in qualification for implementation. (authors)

  4. Application of response surface methodology method in designing corrosion inhibitor

    Science.gov (United States)

    Asmara, Y. P.; Athirah; Siregar, J. P.; Kurniawan, T.; Bachtiar, D.

    2017-10-01

    In oil and gas pipelines and offshore structure, inhibitors have been considered to be the first choice to reduce corrosion rate. There are many corrosion inhibitor compositions available in the market. To produce the best corrosion inhibitor requires many experimental data which is not efficient. These experiments used response surface methodology (RSM) to select corrosion inhibitor compositions. The experiments investigated effects of corrosion inhibition on corrosion rate of low carbon steel in 3% NaCl solution with different concentrations of selected main inhibitor compositions which are ethyl acetate (EA), ethylene glycol (EG) and sodium benzoate (SB). Corrosion rate were calculated using linear polarization resistance (LPR). All of the experiments were set in natural conditions at pH 7. MINITAB® version 15 was used for data analysis. It is shown that a quadratic model is a representative model can predict best corrosion inhibitor composition comprehensibly.

  5. Mixture and method for simulating soiling and weathering of surfaces

    Science.gov (United States)

    Sleiman, Mohamad; Kirchstetter, Thomas; Destaillats, Hugo; Levinson, Ronnen; Berdahl, Paul; Akbari, Hashem

    2018-01-02

    This disclosure provides systems, methods, and apparatus related to simulated soiling and weathering of materials. In one aspect, a soiling mixture may include an aqueous suspension of various amounts of salt, soot, dust, and humic acid. In another aspect, a method may include weathering a sample of material in a first exposure of the sample to ultraviolet light, water vapor, and elevated temperatures, depositing a soiling mixture on the sample, and weathering the sample in a second exposure of the sample to ultraviolet light, water vapor, and elevated temperatures.

  6. A simple method to assess bacterial attachment to surfaces

    Digital Repository Service at National Institute of Oceanography (India)

    Sonak; Bhosle

    of ineubation. There was a highly significant positive linear relationship between crystal violet stained attached cells and the viable cell count of cells attached to aluminium panels (r = 0.9997; p less than 0.001: n = 6). The method is relatively simple...

  7. The calculation of surface free energy based on embedded atom method for solid nickel

    International Nuclear Information System (INIS)

    Luo Wenhua; Hu Wangyu; Su Kalin; Liu Fusheng

    2013-01-01

    Highlights: ► A new solution for accurate prediction of surface free energy based on embedded atom method was proposed. ► The temperature dependent anisotropic surface energy of solid nickel was obtained. ► In isotropic environment, the approach does not change most predictions of bulk material properties. - Abstract: Accurate prediction of surface free energy of crystalline metals is a challenging task. The theory calculations based on embedded atom method potentials often underestimate surface free energy of metals. With an analytical charge density correction to the argument of the embedding energy of embedded atom method, an approach to improve the prediction for surface free energy is presented. This approach is applied to calculate the temperature dependent anisotropic surface energy of bulk nickel and surface energies of nickel nanoparticles, and the obtained results are in good agreement with available experimental data.

  8. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  9. Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

    NARCIS (Netherlands)

    van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène

    2015-01-01

    Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

  10. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  11. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  12. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  13. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  14. The Influence of European and American Wild Germplasm in Hop Cultivars

    Science.gov (United States)

    Microsatellite variation at the nuclear and chloroplast genomes was evaluated for wild European and wild American hops, in order to assess the genetic diversity and origin of cultivated hops. Seven nuclear loci and 32 chloroplast loci were used in the analysis of 182 hop accessions including wild Eu...

  15. Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

    National Research Council Canada - National Science Library

    Roberts, Christopher

    2003-01-01

    .... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

  16. First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China

    Science.gov (United States)

    Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...

  17. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    Science.gov (United States)

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  18. The modal surface interpolation method for damage localization

    Science.gov (United States)

    Pina Limongelli, Maria

    2017-05-01

    The Interpolation Method (IM) has been previously proposed and successfully applied for damage localization in plate like structures. The method is based on the detection of localized reductions of smoothness in the Operational Deformed Shapes (ODSs) of the structure. The IM can be applied to any type of structure provided the ODSs are estimated accurately in the original and in the damaged configurations. If the latter circumstance fails to occur, for example when the structure is subjected to an unknown input(s) or if the structural responses are strongly corrupted by noise, both false and missing alarms occur when the IM is applied to localize a concentrated damage. In order to overcome these drawbacks a modification of the method is herein investigated. An ODS is the deformed shape of a structure subjected to a harmonic excitation: at resonances the ODS are dominated by the relevant mode shapes. The effect of noise at resonance is usually lower with respect to other frequency values hence the relevant ODS are estimated with higher reliability. Several methods have been proposed to reliably estimate modal shapes in case of unknown input. These two circumstances can be exploited to improve the reliability of the IM. In order to reduce or eliminate the drawbacks related to the estimation of the ODSs in case of noisy signals, in this paper is investigated a modified version of the method based on a damage feature calculated considering the interpolation error relevant only to the modal shapes and not to all the operational shapes in the significant frequency range. Herein will be reported the comparison between the results of the IM in its actual version (with the interpolation error calculated summing up the contributions of all the operational shapes) and in the new proposed version (with the estimation of the interpolation error limited to the modal shapes).

  19. A quantitative method to estimate high gloss polished tool steel surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Rebeggiani, S; Rosen, B-G [Halmstad University, The Functional Surfaces Research Group, Box 823, SE-301 18 HALMSTAD (Sweden); Sandberg, A, E-mail: sabina.rebeggiani@hh.se [Uddeholms AB, SE-683 85 Hagfors (Sweden)

    2011-08-19

    Visual estimations are today the most common way to assess the surface quality of moulds and dies; a method that are both subjective and, with today's high demands on surfaces, hardly usable to distinguish between the finest surface qualities. Instead a method based on non-contact 3D-surface texture analysis is suggested. Several types of tool steel samples, manually as well as machine polished, were analysed to study different types of surface defects such as pitting, orange peel and outwardly features. The classification of the defect structures serves as a catalogue where known defects are described. Suggestions of different levels of 'high surface quality' defined in numerical values adapted to high gloss polished tool steel surfaces are presented. The final goal is to develop a new manual that can work as a 'standard' for estimations of tool steel surfaces for steel producers, mould makers, polishers etc.

  20. Comparison of two methods of surface profile extraction from multiple ultrasonic range measurements

    NARCIS (Netherlands)

    Barshan, B; Baskent, D

    Two novel methods for surface profile extraction based on multiple ultrasonic range measurements are described and compared. One of the methods employs morphological processing techniques, whereas the other employs a spatial voting scheme followed by simple thresholding. Morphological processing

  1. 4 HOMEBOYS : Hip hop -musiikin korukulttuuri ja kulttuurihistoria & suomalainen hip hop -genre korumuotoilun kohderyhmänä

    OpenAIRE

    Joki, Eini

    2010-01-01

    Käsittelen opinnäytetyössäni hip hopin korukulttuuria sekä globaalisti että Suomen mittakaavassa. Tutkimuksellisempi puoli käsittelee suomalaisen hip hopin historiaa, arvopohjaa ja korunkäyttöä. Halusin luoda korun suomalaiselle hip hop -skenelle ja -käyttäjälle. Kirjallisen osion ja kuva-aineiston kautta käsittelin hip hopin kulttuurihistoriaa, korukulttuuria ja bling bling -ilmiötä. Tarkastelin myös hieman suomalaisen hip hop -skenen korunkulttuuria ja korumarkkinoita. Lopuksi tein ...

  2. Method of defence of solder surface from oxidization

    Directory of Open Access Journals (Sweden)

    Kurmashev Sh. D.

    2010-02-01

    Full Text Available Compositions are developed for defence of fusion solder from oxidization on the basis of mixture of glycerin, urea and powders of refractory oxides, carbides (Al2O3, TiO2, SIC, graphite. The offered compositions can be used for defence of fusion of solder from oxidization in the process of soludering and tinning of explorers, and also electric conclusions of elements of radio electronic apparatus by the method of immersion in stationary baths.

  3. Soft-landing ion deposition of isolated radioactive probe atoms on surfaces: A novel method

    NARCIS (Netherlands)

    Laurens, C.R; Rosu, M.F; Pleiter, F; Niesen, L

    1997-01-01

    We present a method to deposit a wide range of radioactive probe atoms on surfaces, without introducing lattice damage or contaminating the surface with other elements or isotopes. In this method, the probe atoms are mass separated using an isotope separator, decelerated to 5 eV, and directly

  4. Air powder abrasive treatment as an implant surface cleaning method: a literature review

    NARCIS (Netherlands)

    Tastepe, C.S.; van Waas, R.; Liu, Y.; Wismeijer, D.

    2012-01-01

    OBJECTIVE: To evaluate the air powder abrasive treatment as an implant surface cleaning method for peri-implantitis based on the existing literature. MATERIALS AND METHODS: A PubMed search was conducted to find articles that reported on air powder abrasive treatment as an implant surface cleaning

  5. Determination of optimum "multi-channel surface wave method" field parameters.

    Science.gov (United States)

    2012-12-01

    Multi-channel surface wave methods (especially the multi-channel analyses of surface wave method; MASW) are routinely used to : determine the shear-wave velocity of the subsurface to depths of 100 feet for site classification purposes. Users are awar...

  6. Developments of a bonding technique for optical materials by a surface activation method

    International Nuclear Information System (INIS)

    Sugiyama, Akira; Oda, Tomohiro; Abe, Tomoyuki; Kusunoki, Isao

    2005-01-01

    We started developing the laser crystal bounding by the surface activation method which can splice crystals together without using hydrogen bonding. For the surface activation, neutral argon beams were used for irradiation of specimens. In the bonding trials with sapphire crystals, we recognized possibility of the bonding method for optical elements. (author)

  7. Method of electrode printing on one or more surfaces of a dielectric substrate

    KAUST Repository

    Neophytou, Marios

    2017-09-14

    Described herein is a method for printing electrodes surfaces of a dielectric substrate. Provided herein is a new method of depositing electrically conductive electrodes of any shape on flexible and/or rigid dielectric substrates/surfaces and devices so produced. In various embodiments, the devices can generate ionic wind, for example to remove dust or other debris or contaminants or to remove ice or humidity from a surface.

  8. A Level Set Discontinuous Galerkin Method for Free Surface Flows - and Water-Wave Modeling

    DEFF Research Database (Denmark)

    Grooss, Jesper

    2005-01-01

    We present a discontinuous Galerkin method on a fully unstructured grid for the modeling of unsteady incompressible fluid flows with free surfaces. The surface is modeled by a level set technique. We describe the discontinuous Galerkin method in general, and its application to the flow equations...... equations in time are discussed. We investigate theory of di erential algebraic equations, and connect the theory to current methods for solving the unsteady fluid flow equations. We explore the use of a semi-implicit spectral deferred correction method having potential to achieve high temporal order....... The deferred correction method is applied on the fluid flow equations and show good results in periodic domains. We describe the design of a level set method for the free surface modeling. The level set utilize the high order accurate discontinuous Galerkin method fully and represent smooth surfaces very...

  9. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  10. Crossing the Lexicon: Anglicisms in the German Hip Hop Community

    Science.gov (United States)

    Garley, Matthew E.

    2012-01-01

    The influence of English on German has been an ongoing subject of intense popular and academic interest in the German sphere. In order to better understand this language contact situation, this research project investigates anglicisms--instances of English language material in a German language context--in the German hip hop community, where the…

  11. Hopping in a supercooled binary Lennard-Jones liquid

    DEFF Research Database (Denmark)

    Schrøder, Thomas; Dyre, Jeppe

    1998-01-01

    A binary Lennard–Jones liquid has been investigated by molecular dynamics at equilibrium supercooled conditions. At the lowest temperature investigated, hopping is present in the system as indicated by a secondary peak in 4r2Gs(r,t), where Gs(r,t) is the van Hove self correlation function...

  12. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  13. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  14. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  15. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    to inhibit the motor cortex and this resulted in a suppression of the early EMG burst. These results suggest that sensory feedback and descending drive from the motor cortex are integrated to drive the motor neuron pool during the early EMG burst in hopping. Thus, simple reflexes work in concert with higher...

  16. Potential African Substitutes for Hops in Tropical Beer Brewing ...

    African Journals Online (AJOL)

    ... the vegetables were stored at ambient temperature than when they were stored at refrigeration or freezing temperatures. Losses in bitterness were more for water extracts than for organic solvent extracts. Key Words: Hops, Resins, Essential Oils, Bitterness level. Journal of Food Technology in Africa Vol.9(1) 2004: 13-16 ...

  17. High Order Differential Frequency Hopping: Design and Analysis

    Directory of Open Access Journals (Sweden)

    Yong Li

    2015-01-01

    Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

  18. Costs and returns of producing hops in established tree plantations

    Science.gov (United States)

    Kim Ha; Shadi Atallah; Tamara Benjamin; Lori Hoagland; Lenny Farlee; Keith. Woeste

    2017-01-01

    This article is the first of two publications that analyzes economic opportunities in forest farming for Indiana forest plantation owners. This study explores growing hops along the fence lines of newly established forest stands, while the second study investigates producing American ginseng in older (20- to 30-year-old) forests. The economic analysis presented in this...

  19. Hopping locomotion at different gravity: metabolism and mechanics in humans.

    Science.gov (United States)

    Pavei, Gaspare; Minetti, Alberto E

    2016-05-15

    Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.

  20. Hip-Hop and Bongo Flavour Music in Contemporary Tanzania ...

    African Journals Online (AJOL)

    ... used as instruments to innovate and produce change, this article argues that Bongo Flavour and hip-hop are not only music genres, but also cultural expressions necessary for the understanding of a substantial part of contemporary Tanzanian youths. The focus here is on young male artists living in urban environments.

  1. Chicano Hip-Hop as Interethnic Contact Zone

    Science.gov (United States)

    McFarland, Pancho

    2008-01-01

    Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

  2. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  3. A Hop-Count Analysis Scheme for Avoiding Wormhole Attacks in MANET.

    Science.gov (United States)

    Jen, Shang-Ming; Laih, Chi-Sung; Kuo, Wen-Chung

    2009-01-01

    MANET, due to the nature of wireless transmission, has more security issues compared to wired environments. A specific type of attack, the Wormhole attack does not require exploiting any nodes in the network and can interfere with the route establishment process. Instead of detecting wormholes from the role of administrators as in previous methods, we implement a new protocol, MHA, using a hop-count analysis from the viewpoint of users without any special environment assumptions. We also discuss previous works which require the role of administrator and their reliance on impractical assumptions, thus showing the advantages of MHA.

  4. A Hop-Count Analysis Scheme for Avoiding Wormhole Attacks in MANET

    Directory of Open Access Journals (Sweden)

    Chi-Sung Laih

    2009-06-01

    Full Text Available MANET, due to the nature of wireless transmission, has more security issues compared to wired environments. A specific type of attack, the Wormhole attack does not require exploiting any nodes in the network and can interfere with the route establishment process. Instead of detecting wormholes from the role of administrators as in previous methods, we implement a new protocol, MHA, using a hop-count analysis from the viewpoint of users without any special environment assumptions. We also discuss previous works which require the role of administrator and their reliance on impractical assumptions, thus showing the advantages of MHA.

  5. Using parallel computing methods to improve log surface defect detection methods

    Science.gov (United States)

    R. Edward Thomas; Liya. Thomas

    2013-01-01

    Determining the size and location of surface defects is crucial to evaluating the potential yield and value of hardwood logs. Recently a surface defect detection algorithm was developed using the Java language. This algorithm was developed around an earlier laser scanning system that had poor resolution along the length of the log (15 scan lines per foot). A newer...

  6. Importance of the carbon surface chemistry: methods of characterization; Importance de la chimie de surface des materiaux carbones

    Energy Technology Data Exchange (ETDEWEB)

    Burg, Ph. [Universite Paul Verlaine, Lab. de Chimie et Applications, UFR Sciences, 57 - Metz (France); Vix-Guterl, C. [Centre National de la Recherche Scientifique, Institut de Chimie des Surfaces et Interfaces (ICSI) UPR CNRS 9069, 68 - Mulhouse (France)

    2006-03-15

    The diversity of the carbonaceous materials in terms of chemical composition and porous texture explains their large field of applications. The performances of such materials are often influenced by their surface chemistry that is not easy to investigate. Thus a large range of complementary analytical methods is necessary. (authors)

  7. A robust real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenyang [Department of Bioengineering, University of California, Los Angeles, Los Angeles, California 90095 (United States); Cheung, Yam [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas 75390 (United States); Sawant, Amit [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas, 75390 and Department of Radiation Oncology, University of Maryland, College Park, Maryland 20742 (United States); Ruan, Dan, E-mail: druan@mednet.ucla.edu [Department of Bioengineering, University of California, Los Angeles, Los Angeles, California 90095 and Department of Radiation Oncology, University of California, Los Angeles, Los Angeles, California 90095 (United States)

    2016-05-15

    Purpose: To develop a robust and real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system. Methods: The authors have developed a robust and fast surface reconstruction method on point clouds acquired by the photogrammetry system, without explicitly solving the partial differential equation required by a typical variational approach. Taking advantage of the overcomplete nature of the acquired point clouds, their method solves and propagates a sparse linear relationship from the point cloud manifold to the surface manifold, assuming both manifolds share similar local geometry. With relatively consistent point cloud acquisitions, the authors propose a sparse regression (SR) model to directly approximate the target point cloud as a sparse linear combination from the training set, assuming that the point correspondences built by the iterative closest point (ICP) is reasonably accurate and have residual errors following a Gaussian distribution. To accommodate changing noise levels and/or presence of inconsistent occlusions during the acquisition, the authors further propose a modified sparse regression (MSR) model to model the potentially large and sparse error built by ICP with a Laplacian prior. The authors evaluated the proposed method on both clinical point clouds acquired under consistent acquisition conditions and on point clouds with inconsistent occlusions. The authors quantitatively evaluated the reconstruction performance with respect to root-mean-squared-error, by comparing its reconstruction results against that from the variational method. Results: On clinical point clouds, both the SR and MSR models have achieved sub-millimeter reconstruction accuracy and reduced the reconstruction time by two orders of magnitude to a subsecond reconstruction time. On point clouds with inconsistent occlusions, the MSR model has demonstrated its advantage in achieving consistent and robust performance despite the introduced

  8. Phytochemical and morphological characterization of hop (Humulus lupulus L.) cones over five developmental stages using high performance liquid chromatography coupled to time-of-flight mass spectrometry, ultrahigh performance liquid chromatography photodiode array detection, and light microscopy techniques.

    Science.gov (United States)

    Kavalier, Adam R; Litt, Amy; Ma, Chunhui; Pitra, Nicholi J; Coles, Mark C; Kennelly, Edward J; Matthews, Paul D

    2011-05-11

    Hop (Humulus lupulus L.) inflorescences, commonly known as "hop cones", are prized for their terpenophenolic contents, used in beer production and, more recently, in biomedical applications. In this study we investigated morphological and phytochemical characteristics of hop cones over five developmental stages, using liquid chromatography coupled to time-of-flight mass spectrometry (LC-TOF-MS), and ultrahigh performance liquid chromatography photodiode array detection (UHPLC-PDA) methods to quantitate 21 polyphenolics and seven terpenophenolics. Additionally, we used light microscopy to correlate phytochemical quantities with changes in the morphology of the cones. Significant increases in terpenophenolics, concomitant with glandular trichome development and associated gross morphological changes, were mapped over development to fluctuations in contents of polyphenolic constituents and their metabolic precursor compounds. The methods reported here can be used for targeted metabolic profiling of flavonoids, phenolic acids, and terpenophenolics in hops, and are applicable to quantitation in other crops.

  9. Measurement of the specific surface area of loose copper deposit by electrochemical methods

    Directory of Open Access Journals (Sweden)

    E. A. Dolmatova

    2016-07-01

    Full Text Available In the work the surface area of the electrode with dispersed copper deposit obtained within 30 seconds was evaluated by techniques of chronopotentiometry (CPM and impedance spectroscopy. In method CPM the electrode surface available for measurement depends on the value of the polarizing current. At high currents during the transition time there is a change of surface relief that can not determine the full surface of loose deposit. The electrochemical impedance method is devoid of this shortcoming since the measurements are carried out in indifferent electrolyte in the absence of current. The area measured by the impedance is tens of times higher than the value obtained by chronopotentiometry. It is found that from a solution containing sulfuric acid the deposits form with a high specific surface area. Based on these data it was concluded that the method of impedance spectroscopy can be used to measure in situ the surface area of the dispersed copper deposits.

  10. HapHop-Physio: a computer game to support cognitive therapies in children

    Directory of Open Access Journals (Sweden)

    Rico-Olarte C

    2017-07-01

    Full Text Available Carolina Rico-Olarte,1 Diego M López,1 Santiago Narváez,1 Charic D Farinango,1 Peter S Pharow2 1Faculty of Electronics and Telecommunications Engineering, Universidad del Cauca, Telematics Engineering Research Group, Popayán, Colombia; 2Fraunhofer Institute of Digital Media and Technology IDMT, Ilmenau, Germany Background: Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective: The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods: Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results: The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion: The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. Keywords: computer game, exer-games, cognitive therapies, rehabilitation

  11. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  12. Advantage Clean & Porous TM new technological methods of surface treatment of dental implants

    Directory of Open Access Journals (Sweden)

    Лев Ильич Винников

    2015-02-01

    Full Text Available The purpose of this study was a comparative analysis of the surfaces of dental implants treated with technological methods SLA and RBM to identify their positive and negative characteristics. Based on these results to develop a new process Clean & Porous surface treatment of dental implants to obtain highly, rough and porous surface, which is characteristic for the technology SLA, and absolutely clean surface characteristic of technology RBM, without their disadvantages (unwarranted complete removal of abrasive particles SLA case and the absence of a clear structure of the surface topography in the case of RBM.The structure and purity of the implant surface Straumann, Alfa-Bio, DIO, Finish Line. studied in micrographs obtained by an electron microscope (SEM at the University of Technion (increase 500,2000,3000. To study the chemical properties of the samples, the method of X-ray energy dispersive spectroscopy (EDS, based on an analysis of its X-ray emission energy spectrum.Comparative analysis of the implant surfaces treated with the methods and RBM SLA showed that despite the reliability of these methods, each of them has certain disadvantages (contamination cases alumina particle surface with sufficient structural SLA and craters on the surface organized RBM. Developed by Finish Line Materials and Processes Ltd new technology of surface treatment of dental implants Clean & PorousTM, combining the best characteristics of the methods of SLA and RBM, possible to obtain a well-structured and absolutely clean surface.The proposed new original method Clean & PorousTM treatment of dental implants meet the criteria (roughness, porosity and surface finish of the implant, which provide an ideal osseointegration. Since osseointegration is a key issue in modern implantology it enables to obtain reliable primary fixation of the implant in the bone. From a clinical point of view it reduces the healing of the implant, as well as creating conditions

  13. Efficacy of single dose antihistamine vs. single dose valerian-hops in subjective sleep measures among war refugees: a comparison trial

    Directory of Open Access Journals (Sweden)

    Omar Salem Gammoh

    Full Text Available Abstract Background Many sedatives and anxiolytics are used in single dose or chronically to aid sleep. Clinically important sedatives include valerian-hops and antihistamines as they are used over the counter and are highly accessible and safe agents. Objectives To evaluate and compare a single dose of chlorpheniramine versus valerian-hops combination in modulating subjective sleep measures in insomniac war refugees. Methods Insomnia among refugees was screened using the Insomnia Severity Index (ISI. Insomniac subjects were randomized to received a single dose valerian-hops (320/80 mg (n = 65, or chlorpheneramine (4 mg (n = 50 or placebo (n = 76 two hours prior sleeping. Participants were instructed to complete Leeds Sleep Evaluation Questionnaire (LSEQ, visual analogue scales of anxiety and sedation. Also sleep latency, total hours slept and self-rated improvement were obtained. Results Almost 75% of screened refugees had insomnia. Chlorpheneramine reduced sleep latency and anxiety significantly, however it resulted in poor sleep quality. Valerian-hops group showed marked anxiolysis one hour after dosing, a sleep quality similar to placebo and better than chlorpheneramine, and better alertness compared to placebo. Participants satisfaction was higher with chlorpheneramine and there was no difference in the total hours slept. Discussion Valerian-hops combination may provide better sleep quality than antihistamines.

  14. Method of driving liquid flow at or near the free surface using magnetic microparticles

    Science.gov (United States)

    Snezhko, Oleksiy [Woodridge, IL; Aronson, Igor [Darien, IL; Kwok, Wai-Kwong [Evanston, IL; Belkin, Maxim V [Woodridge, IL

    2011-10-11

    The present invention provides a method of driving liquid flow at or near a free surface using self-assembled structures composed of magnetic particles subjected to an external AC magnetic field. A plurality of magnetic particles are supported at or near a free surface of liquid by surface tension or buoyancy force. An AC magnetic field traverses the free surface and dipole-dipole interaction between particles produces in self-assembled snake structures which oscillate at the frequency of the traverse AC magnetic field. The snake structures independently move across the free surface and may merge with other snake structures or break up and coalesce into additional snake structures experiencing independent movement across the liquid surface. During this process, the snake structures produce asymmetric flow vortices across substantially the entirety of the free surface, effectuating liquid flow across the free surface.

  15. A robust real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system.

    Science.gov (United States)

    Liu, Wenyang; Cheung, Yam; Sawant, Amit; Ruan, Dan

    2016-05-01

    To develop a robust and real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system. The authors have developed a robust and fast surface reconstruction method on point clouds acquired by the photogrammetry system, without explicitly solving the partial differential equation required by a typical variational approach. Taking advantage of the overcomplete nature of the acquired point clouds, their method solves and propagates a sparse linear relationship from the point cloud manifold to the surface manifold, assuming both manifolds share similar local geometry. With relatively consistent point cloud acquisitions, the authors propose a sparse regression (SR) model to directly approximate the target point cloud as a sparse linear combination from the training set, assuming that the point correspondences built by the iterative closest point (ICP) is reasonably accurate and have residual errors following a Gaussian distribution. To accommodate changing noise levels and/or presence of inconsistent occlusions during the acquisition, the authors further propose a modified sparse regression (MSR) model to model the potentially large and sparse error built by ICP with a Laplacian prior. The authors evaluated the proposed method on both clinical point clouds acquired under consistent acquisition conditions and on point clouds with inconsistent occlusions. The authors quantitatively evaluated the reconstruction performance with respect to root-mean-squared-error, by comparing its reconstruction results against that from the variational method. On clinical point clouds, both the SR and MSR models have achieved sub-millimeter reconstruction accuracy and reduced the reconstruction time by two orders of magnitude to a subsecond reconstruction time. On point clouds with inconsistent occlusions, the MSR model has demonstrated its advantage in achieving consistent and robust performance despite the introduced occlusions. The authors have

  16. Micro Surface Defect Detection Method for Silicon Steel Strip Based on Saliency Convex Active Contour Model

    Directory of Open Access Journals (Sweden)

    Kechen Song

    2013-01-01

    Full Text Available Accurate detection of surface defect is an indispensable section in steel surface inspection system. In order to detect the micro surface defect of silicon steel strip, a new detection method based on saliency convex active contour model is proposed. In the proposed method, visual saliency extraction is employed to suppress the clutter background for the purpose of highlighting the potential objects. The extracted saliency map is then exploited as a feature, which is fused into a convex energy minimization function of local-based active contour. Meanwhile, a numerical minimization algorithm is introduced to separate the micro surface defects from cluttered background. Experimental results demonstrate that the proposed method presents good performance for detecting micro surface defects including spot-defect and steel-pit-defect. Even in the cluttered background, the proposed method detects almost all of the microdefects without any false objects.

  17. An experimental method to determine the electrostatic field enhancement factor of a practical conductor surface

    DEFF Research Database (Denmark)

    McAllister, Iain Wilson; Crichton, George C

    1989-01-01

    A method of determining the field enhancement factor of a practical conductor is presented. The method is developed from a modified theory of discharge onset in a gaseous medium. This modification incorporates the influence of conductor surface roughness. Onset data from an experimental study...... that utilized electrodes of varying surface roughness are examined, and the results obtained using the proposed method are discussed with reference to both the underlying theory and the practical aspects of the experimental measurements...

  18. Immunomodulation by the Pseudomonas syringae HopZ type III effector family in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jennifer D Lewis

    Full Text Available Pseudomonas syringae employs a type III secretion system to inject 20-30 different type III effector (T3SE proteins into plant host cells. A major role of T3SEs is to suppress plant immune responses and promote bacterial infection. The YopJ/HopZ acetyltransferases are a superfamily of T3SEs found in both plant and animal pathogenic bacteria. In P. syringae, this superfamily includes the evolutionarily diverse HopZ1, HopZ2 and HopZ3 alleles. To investigate the roles of the HopZ family in immunomodulation, we generated dexamethasone-inducible T3SE transgenic lines of Arabidopsis for HopZ family members and characterized them for immune suppression phenotypes. We show that all of the HopZ family members can actively suppress various facets of Arabidopsis immunity in a catalytic residue-dependent manner. HopZ family members can differentially suppress the activation of mitogen-activated protein (MAP kinase cascades or the production of reactive oxygen species, whereas all members can promote the growth of non-virulent P. syringae. Localization studies show that four of the HopZ family members containing predicted myristoylation sites are localized to the vicinity of the plasma membrane while HopZ3 which lacks the myristoylation site is at least partially nuclear localized, suggesting diversification of immunosuppressive mechanisms. Overall, we demonstrate that despite significant evolutionary diversification, all HopZ family members can suppress immunity in Arabidopsis.

  19. Comparison of 3 methods on fabricating micro- /nano- structured surface on 3D mold cavity

    DEFF Research Database (Denmark)

    Zhang, Yang; Hansen, Hans Nørgaard; Bissacco, Giuliano

    2015-01-01

    limited to flat or simple shaped geometries. In this paper, 3 approaches for fabricating micro and nano- structured surfaces on a mold cavity for injection moulding are investigated and compared. The first approach is to use pre-fabricated plate with micro-structured surface as an insert for the mold......The methods to manufacture micro- or nano- structures on surfaces have been an area of intense investigation. Demands are shown for technologies for surface structuring on real 3D parts in many fields. However, most technologies for the fabrication of micro-structured functional surfaces are still...

  20. Numerical simulation of sloshing with large deforming free surface by MPS-LES method

    Science.gov (United States)

    Pan, Xu-jie; Zhang, Huai-xin; Sun, Xue-yao

    2012-12-01

    Moving particle semi-implicit (MPS) method is a fully Lagrangian particle method which can easily solve problems with violent free surface. Although it has demonstrated its advantage in ocean engineering applications, it still has some defects to be improved. In this paper, MPS method is extended to the large eddy simulation (LES) by coupling with a sub-particle-scale (SPS) turbulence model. The SPS turbulence model turns into the Reynolds stress terms in the filtered momentum equation, and the Smagorinsky model is introduced to describe the Reynolds stress terms. Although MPS method has the advantage in the simulation of the free surface flow, a lot of non-free surface particles are treated as free surface particles in the original MPS model. In this paper, we use a new free surface tracing method and the key point is "neighbor particle". In this new method, the zone around each particle is divided into eight parts, and the particle will be treated as a free surface particle as long as there are no "neighbor particles" in any two parts of the zone. As the number density parameter judging method has a high efficiency for the free surface particles tracing, we combine it with the neighbor detected method. First, we select out the particles which may be mistreated with high probabilities by using the number density parameter judging method. And then we deal with these particles with the neighbor detected method. By doing this, the new mixed free surface tracing method can reduce the mistreatment problem efficiently. The serious pressure fluctuation is an obvious defect in MPS method, and therefore an area-time average technique is used in this paper to remove the pressure fluctuation with a quite good result. With these improvements, the modified MPS-LES method is applied to simulate liquid sloshing problems with large deforming free surface. Results show that the modified MPS-LES method can simulate the large deforming free surface easily. It can not only capture

  1. A DFT based method for calculating the surface energies of asymmetric MoP facets

    Science.gov (United States)

    Tian, Xinxin; Wang, Tao; Fan, Lifang; Wang, Yuekui; Lu, Haigang; Mu, Yuewen

    2018-01-01

    MoP is a promising catalyst in heterogeneous catalysis. Understanding its surface stability and morphology is the first and essential step in exploring its catalytic properties. However, traditional surface energy calculation method does not work for the asymmetric termination of MoP. In this work, we reported a useful DFT based method to get the surface energies of asymmetric MoP facets. Under ideal condition, the (101) surface with mixed Mo/P termination is most stable, followed by the (100) surface, while the (001) surface is least stable. Wulff construction reveals the exposure of six surfaces on the MoP nanoparticle, where the (101) has the largest contribution. Atomistic thermodynamics results reveal the changes in surface stability orders with experimental conditions, and the (001)-P termination becomes more and more stable with increasing P chemical potential, which indicates its exposure is possible at defined conditions. Our results agree well with the previous experimental XRD and TEM data. We believe the reported method for surface energy calculation could be extended to other similar systems with asymmetric surface terminations.

  2. Predicting muscle forces during the propulsion phase of single leg triple hop test.

    Science.gov (United States)

    Alvim, Felipe Costa; Lucareli, Paulo Roberto Garcia; Menegaldo, Luciano Luporini

    2018-01-01

    Functional biomechanical tests allow the assessment of musculoskeletal system impairments in a simple way. Muscle force synergies associated with movement can provide additional information for diagnosis. However, such forces cannot be directly measured noninvasively. This study aims to estimate muscle activations and forces exerted during the preparation phase of the single leg triple hop test. Two different approaches were tested: static optimization (SO) and computed muscle control (CMC). As an indirect validation, model-estimated muscle activations were compared with surface electromyography (EMG) of selected hip and thigh muscles. Ten physically healthy active women performed a series of jumps, and ground reaction forces, kinematics and EMG data were recorded. An existing OpenSim model with 92 musculotendon actuators was used to estimate muscle forces. Reflective markers data were processed using the OpenSim Inverse Kinematics tool. Residual Reduction Algorithm (RRA) was applied recursively before running the SO and CMC. For both, the same adjusted kinematics were used as inputs. Both approaches presented similar residuals amplitudes. SO showed a closer agreement between the estimated activations and the EMGs of some muscles. Due to inherent EMG methodological limitations, the superiority of SO in relation to CMC can be only hypothesized. It should be confirmed by conducting further studies comparing joint contact forces. The workflow presented in this study can be used to estimate muscle forces during the preparation phase of the single leg triple hop test and allows investigating muscle activation and coordination. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Role of transverse hopping in a two-coupled-chains model

    International Nuclear Information System (INIS)

    Fabrizio, M.

    1993-01-01

    We study the effect of a transverse hopping t perpendicular in two chains of both spinless and spinning repulsively interacting fermions, by means of renormalization group and bosonization techniques. We show that, independent of the presence of spin, t perpendicular strongly modifies the asymptotic long-wavelength behavior of the two chains, opening gaps in the excitation spectra. The origin of the instability of the gapless Luttinger-liquid behavior is identified in the flavor (==chain index) anisotropy induced by t perpendicular . In the case of spinning fermions, it leads to dominant pair fluctuations, in spite of the repulsive interaction. The role of spin is further analyzed in a model of two coupled chains showing, in the absence of t perpendicular , spin-charge separation without anomalous exponents. We solve this model exactly by the bosonization technique, and we find that the interesting analytical properties induced by spin-charge separation persist in the presence of transverse hopping, although t perpendicular does modify the shape of the Fermi surface. The asymptotic expression of the single-particle Green function is also obtained

  4. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  5. A new capacitive/resistive probe method for studying magnetic surfaces

    International Nuclear Information System (INIS)

    Kitajima, Sumio; Takayama, Masakazu; Zama, Tatsuya; Takaya, Kazuhiro; Takeuchi, Nobunao; Watanabe, Hiroshige

    1991-01-01

    A new capacitive/resistive probe method for mapping the magnetic surfaces from resistance or capacitance between a magnetic surface and a vacuum vessel was developed and tested. Those resistances and capacitances can be regarded as components of a simple electrical bridge circuit. This method exploits electrical transient response of the bridge circuit for a square pulse. From equiresistance or equicapacitance points, the magnetic surface structure can be deduced. Measurements on the Tohoku University Heliac, which is a small-size standard heliac, show good agreement with numerical calculations. This method is particularly useful for pulse-operated machines. (author)

  6. Temperature Dependence of Arn + Cluster Backscattering from Polymer Surfaces: a New Method to Determine the Surface Glass Transition Temperature

    Science.gov (United States)

    Poleunis, Claude; Cristaudo, Vanina; Delcorte, Arnaud

    2018-01-01

    In this work, time-of-flight secondary ion mass spectrometry (ToF-SIMS) was used to study the intensity variations of the backscattered Arn + clusters as a function of temperature for several amorphous polymer surfaces (polyolefins, polystyrene, and polymethyl methacrylate). For all these investigated polymers, our results show a transition of the ratio Ar2 +/(Ar2 + + Ar3 +) when the temperature is scanned from -120 °C to +125 °C (the exact limits depend on the studied polymer). This transition generally spans over a few tens of degrees and the temperature of the inflection point of each curve is always lower than the bulk glass transition temperature (Tg) reported for the considered polymer. Due to the surface sensitivity of the cluster backscattering process (several nanometers), the presented analysis could provide a new method to specifically evaluate a surface transition temperature of polymers, with the same lateral resolution as the gas cluster beam. [Figure not available: see fulltext.

  7. Temperature Dependence of Arn+ Cluster Backscattering from Polymer Surfaces: a New Method to Determine the Surface Glass Transition Temperature.

    Science.gov (United States)

    Poleunis, Claude; Cristaudo, Vanina; Delcorte, Arnaud

    2018-01-01

    In this work, time-of-flight secondary ion mass spectrometry (ToF-SIMS) was used to study the intensity variations of the backscattered Ar n + clusters as a function of temperature for several amorphous polymer surfaces (polyolefins, polystyrene, and polymethyl methacrylate). For all these investigated polymers, our results show a transition of the ratio Ar 2 + /(Ar 2 + + Ar 3 + ) when the temperature is scanned from -120 °C to +125 °C (the exact limits depend on the studied polymer). This transition generally spans over a few tens of degrees and the temperature of the inflection point of each curve is always lower than the bulk glass transition temperature (T g ) reported for the considered polymer. Due to the surface sensitivity of the cluster backscattering process (several nanometers), the presented analysis could provide a new method to specifically evaluate a surface transition temperature of polymers, with the same lateral resolution as the gas cluster beam. Graphical abstract ᅟ.

  8. Biomimetic superhydrophobic polyolefin surfaces fabricated with a facile scraping, bonding and peeling method

    Directory of Open Access Journals (Sweden)

    Feng Huanhuan

    2016-01-01

    Full Text Available Inspired by the superhydrophobicity of juicy peach surface, on which microscale hairs are standing vertically to the surface plane, an extremely simple, inexpensive physical method is developed for fabrication of superhydrophobic polyolefin surfaces over large areas. This method includes three steps: abrasive paper scraping, adhesive tape bonding and 90° peeling. Scraping increases the roughness and enhence water contact angles (CAs on polyolefin surfaces. It increases more when the scraped surface are bonded with adhesive types and then then 90° peeled. The CA variation depends on the types of polyolefin and abrasive paper. Superhydrophobic lowdensity polyethylene (LDPE, high-density polyethylene (HDPE and polypropylene (PP surfaces (CA>150° are obtained and they all exhibit very low adhesive force and high resistance to strong acids and bases.

  9. A Two-stage Improvement Method for Robot Based 3D Surface Scanning

    Science.gov (United States)

    He, F. B.; Liang, Y. D.; Wang, R. F.; Lin, Y. S.

    2018-03-01

    As known that the surface of unknown object was difficult to measure or recognize precisely, hence the 3D laser scanning technology was introduced and used properly in surface reconstruction. Usually, the surface scanning speed was slower and the scanning quality would be better, while the speed was faster and the quality would be worse. In this case, the paper presented a new two-stage scanning method in order to pursuit the quality of surface scanning in a faster speed. The first stage was rough scanning to get general point cloud data of object’s surface, and then the second stage was specific scanning to repair missing regions which were determined by chord length discrete method. Meanwhile, a system containing a robotic manipulator and a handy scanner was also developed to implement the two-stage scanning method, and relevant paths were planned according to minimum enclosing ball and regional coverage theories.

  10. A New Approach to Bézier Surface Visualization by a Ray Tracing Method

    OpenAIRE

    Glazs, A; Sisojevs, A

    2008-01-01

    Problem of free – form surfaces visualization is actual in various areas of a science and engineering. One of mathematical models used for this purpose is the mathematical description of a Bézier surface. Classical methods of computer graphics based on polygonal models use only polygonal interpolation of a Bézier surface. Such approach inevitably leads to occurrence of an error and as a consequence – to discrepancy of an image.

  11. Comparison of two split-window methods for retrieving land surface ...

    Indian Academy of Sciences (India)

    Land surface temperature (LST) is a key parameter in environment and earth science study, especially for monitoring drought. The objective of this work is a comparison of two split-window methods: Mao method and Sobrino method, for retrieving LST using MODIS (Moderate-resolution Imaging Spectroradiometer) data in ...

  12. A method for calculating the time-dependent surface temperature of a cylinder containing radioactive waste

    International Nuclear Information System (INIS)

    Fynbo, P.B.

    1981-02-01

    A method is described by which the surface temperature of a steel cylinder containing radioactive waste can be calculated. The method assumes a time-dependent continuous line source in cylindrical symmetry and it applies Laplace transformation. The resultant laplace transform is approximated and then inverted (by convolution). The method is computationally fast and future generalisations to similar problems are suggested. (author)

  13. Ion-step method for surface potential sensing of silicon nanowires

    NARCIS (Netherlands)

    Chen, S.; van Nieuwkasteele, Jan William; van den Berg, Albert; Eijkel, Jan C.T.

    2016-01-01

    This paper presents a novel stimulus-response method for surface potential sensing of silicon nanowire (Si NW) field-effect transistors. When an "ion-step" from low to high ionic strength is given as a stimulus to the gate oxide surface, an increase of double layer capacitance is therefore expected.

  14. A new practical method to reconstruct cerebral surface anatomical images for computer-assisted neurosurgery

    Energy Technology Data Exchange (ETDEWEB)

    Nakajima, Shin; Kato, Amami; Yoshimine, Toshiki; Taneda, Mamoru; Hayakawa, Toru (Osaka Univ. (Japan). Faculty of Medicine)

    1994-03-01

    Authors have developed a new, practical method to reconstruct cerebral surface anatomical images for better surgical orientation and surgical planning. Using a personal computer and a commercially available image handling software, an area encompassing the surface gyri and sulci is selected from the most superficial slice of T1-weighted MR images, after which this selected area, on adjusting the alignment, is overlayed onto the next superficial slice. By repeating this procedure for 4 to 7 times, the brain surface image obtained clearly displays the gyri and sulci. A vascular image of the cerebral surface can also be obtained by this same method by using T2-weighted images or MR angiograms. Then, by combining both the brain surface and vascular images, an anatomically reconstructed image of the cerebral surface is achieved. The outlines of the lesion or ventricles can also be added, if necessary, and the entire procedure takes an hour or less. The authors believe that this method is superior to conventional surface anatomy scanning for discriminating anatomical structures close to a lesion. This surface anatomical imaging method has been used for the surgical planning and its use helped to minimize surgical damage to the eloquent areas. (author).

  15. Whole-surface round object imaging method using line-scan hyperspectral imaging system

    Science.gov (United States)

    To achieve comprehensive online quality and safety inspection of fruits, whole-surface sample presentation and imaging regimes must be considered. Specifically, a round object sample presentation method is under development to achieve effective whole-surface sample evaluation based on the use of a s...

  16. On the Surface Free Energy of PVC/EVA Polymer Blends: Comparison of Different Calculation Methods.

    Science.gov (United States)

    Michalski; Hardy; Saramago

    1998-12-01

    The surface free energy of polymeric films of polyvinylchloride (PVC) + poly(ethylene-co-vinylacetate) (EVA) blends was calculated using the van Oss treatment (Lifshitz and electron donor-electron acceptor components of surface free energy) and the Owens-Wendt treatment (dispersive and nondispersive components of surface free energy). Surface free energy results were found to be greatly dependent on the calculation method and on the number of standard liquids used for contact angle measurements. The nondispersive/donor-acceptor surface free energy component and the total surface free energy of polymeric films were always higher when the van Oss treatment was used compared to the Owens-Wendt treatment. Conversely, both methods led to similar apolar/Lifshitz components. All the calculation methods were in good agreement for the surface free energy of PVC; however, a discrepancy between the methods arose as EVA content in the blends increased. It seems that there is not yet a definite solution for the calculation of solid surface free energy. Further developments of existing models are needed in order to gain consistency when calculating this important physicochemical quantity. Copyright 1998 Academic Press.

  17. Method for the indication of failures on the surface of magnetizable workpieces

    International Nuclear Information System (INIS)

    1976-01-01

    Using the magnetic powder method as a quality test of ferromagnetic work pieces, solid iron powder, pigment and lac are put on the surface and the powder agglomeration sprayed with a solvent. This way the varnish softens and adheres the powder to the surface. A non-explosive solvent is used and with help of additives the contrast increases. (TK) [de

  18. Methods for surface treating metals, ceramics, and plastics before adhesive bonding

    International Nuclear Information System (INIS)

    Althouse, L.P.

    1976-01-01

    Methods for pretreating the surfaces of metals, ceramics, and plastics before they are coated with adhesive and used in assembly are described. The treatments recommended have been used successfully in the laboratory at LLL. Many are used in the assembly of nuclear devices. However, an unusual alloy or complex configuration may require trials before a specific surface treatment is chosen

  19. Surface plasmon resonance is an analytically sensitive method for antigen profiling of extracellular vesicles

    NARCIS (Netherlands)

    Gool, Elmar L.; Stojanovic, Ivan; Schasfoort, Richardus B.M.; Sturk, Auguste; Van Leeuwen, Ton G.; Nieuwland, Rienk; Terstappen, Leon W.M.M.; Coumans, Frank A.W.

    2017-01-01

    BACKGROUND: Identification, enumeration, and characterization of extracellular vesicles (EVs) are hampered by the small size of EVs, a low refractive index, and low numbers of antigens on their surface. METHODS: We investigated the potential of a 48- multiplex surface plasmon resonance imaging

  20. Surface exposure dating of non-terrestrial bodies using optically stimulated luminescence: A new method

    DEFF Research Database (Denmark)

    Sohbati, Reza; Jain, Mayank; Murray, Andrew

    2012-01-01

    We propose a new method for in situ surface exposure dating of non-terrestrial geomorphological features using optically stimulated luminescence (OSL); our approach is based on the progressive emptying of trapped charge with exposure to light at depth into a mineral surface. A complete model...

  1. Adhesion of resin composites to biomaterials in dentistry : an evaluation of surface conditioning methods

    NARCIS (Netherlands)

    Özcan, Mutlu

    2003-01-01

    Since previous investigations revealed that most clinical failures in adhesively luted ceramic restorations initiate from the cementation or internal surfaces, the study presented in Chapter II evaluated the effect of three different surface conditioning methods on the bond strength of a Bis-GMA

  2. Electronic interconnects and devices with topological surface states and methods for fabricating same

    Energy Technology Data Exchange (ETDEWEB)

    Yazdani, Ali; Ong, N. Phuan; Cava, Robert J.

    2016-05-03

    An interconnect is disclosed with enhanced immunity of electrical conductivity to defects. The interconnect includes a material with charge carriers having topological surface states. Also disclosed is a method for fabricating such interconnects. Also disclosed is an integrated circuit including such interconnects. Also disclosed is a gated electronic device including a material with charge carriers having topological surface states.

  3. Electronic interconnects and devices with topological surface states and methods for fabricating same

    Energy Technology Data Exchange (ETDEWEB)

    Yazdani, Ali; Ong, N. Phuan; Cava, Robert J.

    2017-04-04

    An interconnect is disclosed with enhanced immunity of electrical conductivity to defects. The interconnect includes a material with charge carriers having topological surface states. Also disclosed is a method for fabricating such interconnects. Also disclosed is an integrated circuit including such interconnects. Also disclosed is a gated electronic device including a material with charge carriers having topological surface states.

  4. Planar integrated optical methods for examining thin films and their surface adlayers.

    Science.gov (United States)

    Plowman, T E; Saavedra, S S; Reichert, W M

    1998-03-01

    Thin film integrated optical waveguides (IOWs) have gained acceptance as a method for characterizing ultrathin dielectrical films and adlayers bound to the film surface. Here, we present the expressions that govern IOW methods as well as describe the common experimental configurations used in attenuated total reflection, fluorescence and Raman applications. The applications of these techniques to the study of adsorbed or surface-bound proteins to polymer and glass waveguides are reviewed.

  5. Condition Assessment for Wastewater Pipes: Method for Assessing Cracking and Surface Damage of Concrete Pipes

    OpenAIRE

    Hauge, Petter

    2013-01-01

    The objective of the Master Thesis has been to provide an improved method for condition assessment, which will give a better correlation between Condition class and actual Condition of concrete pipes with cracking and/or surface damages. Additionally improvement of the characterization of cracking (SR) and surface (KO) damages was a sub goal.Based on the findings described in my Thesis and my Specialization Project (Hauge 2012), I recommend that the Norwegian condition assessment method based...

  6. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  7. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  8. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  9. Superconducting correlations in Hubbard chains with correlated hopping

    Science.gov (United States)

    Arrachea, L.; Aligia, A. A.; Gagliano, E.; Hallberg, K.; Balseiro, C.

    1994-12-01

    We consider an extended one-dimensional Hubbard model in which the magnitude of the hopping between two sites for particles with given spin depends on the occupation of the states with opposite spin at both sites. Diagonalizing exactly finite-size chains, and using known results of conformal field theory we delimit the regions of parameters for which two particles bind and the pair superconducting correlation functions are the dominant ones at large distances. For Coulomb repulsion U smaller than a critical density-dependent value Uc and any density, there are ranges of the ratios of the hopping parameters for which the superconducting fluctuations dominate. At half filling, for parameters within this range, a transition from a regime with dominant superconducting correlations to an insulating state takes place as a function of U. We also study the model for parameters near a recently found exactly solvable limit in which the number of doubly occupied sites is conserved.

  10. Changes in the hop-derived volatile profile upon lab scale boiling.

    Science.gov (United States)

    Praet, Tatiana; Van Opstaele, Filip; Steenackers, Bart; De Brabanter, Joseph; De Vos, Dirk; Aerts, Guido; De Cooman, Luc

    2015-09-01

    Hop terpenes might be oxidized during kettle boiling into more water soluble compounds that could contribute to 'hoppy' aroma of kettle hopped lager beers. Our current research proves that the boiling process induces significant changes in the hop oil volatile profile. The discrimination between volatile profiles of unboiled and boiled hop essential oil was evaluated via principal component and cluster analysis (PCA and CA). HS-SPME-GC-MS analysis revealed quantitative changes (e.g. increases in the levels of oxygenated α-humulene and β-caryophyllene derivatives) as well as qualitative changes (i.e. detection of compounds, not found in unboiled hop essential oil) in the hop oil volatile profile upon boiling. Many of these compounds were previously found in lager beer and may therefore contribute to beer flavor. Interestingly, the analytical difference between unboiled and boiled hop essential oil proved to be more pronounced as the initial hop essential oil concentration used for boiling was increased. In addition, lager beers spiked with boiled hop oil were described as 'hoppy/spicy' during sensory evaluations. Therefore, the newly formed products and hop oil constituents that are characterized by an increased recovery after boiling, are candidate compounds for 'hoppy' aroma in real brewing practice. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. The measurement of surface roughness to determine the suitability of different methods for stone cleaning

    International Nuclear Information System (INIS)

    Vazquez-Calvo, Carmen; Alvarez de Buergo, Monica; Fort, Rafael; Varas-Muriel, Maria Jose

    2012-01-01

    The roughness of stone surface was measured, before and after bead blasting-based cleaning methods, to select the most efficient one to be used in masonry and stonework of specific areas of the Cathedral of Segovia (Spain). These types of cleaning methods can, besides the removal of soiling and surface deposits, leave a rougher surface, which would mean higher and more rapid water retention and deposit accumulation due to a specific surface increase, therefore accelerating stone decay. Or, in contrast, the cleaning method can be so aggressive that it can smooth the surface by reducing its roughness, a fact that usually corresponds to excessive material removal—soot and deposits–-but also part of the stone substrate. Roughness results were complemented with scanning electron microscopy observations and analyses and colour measurements. Finally, it was possible to select the best cleaning method among the six that were analysed, for different areas and different stone materials. Therefore, this study confirms the measurement of surface roughness as a reliable test to determine the suitability of stone cleaning methods; it is a non-destructive technique, portable and friendly to use, which can help us to rapidly assess—together with other techniques—the efficacy and aggressiveness of the stone cleaning method. (paper)

  12. A hybrid 3D SEM reconstruction method optimized for complex geologic material surfaces.

    Science.gov (United States)

    Yan, Shang; Adegbule, Aderonke; Kibbey, Tohren C G

    2017-08-01

    Reconstruction methods are widely used to extract three-dimensional information from scanning electron microscope (SEM) images. This paper presents a new hybrid reconstruction method that combines stereoscopic reconstruction with shape-from-shading calculations to generate highly-detailed elevation maps from SEM image pairs. The method makes use of an imaged glass sphere to determine the quantitative relationship between observed intensity and angles between the beam and surface normal, and the detector and surface normal. Two specific equations are derived to make use of image intensity information in creating the final elevation map. The equations are used together, one making use of intensities in the two images, the other making use of intensities within a single image. The method is specifically designed for SEM images captured with a single secondary electron detector, and is optimized to capture maximum detail from complex natural surfaces. The method is illustrated with a complex structured abrasive material, and a rough natural sand grain. Results show that the method is capable of capturing details such as angular surface features, varying surface roughness, and surface striations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Transmit Power Allocation for Physical Layer Security in Cooperative Multi-Hop Full-Duplex Relay Networks

    Directory of Open Access Journals (Sweden)

    Jong-Ho Lee

    2016-10-01

    Full Text Available In this paper, we consider a transmit power allocation problem for secure transmission in multi-hop decode-and-forward (DF full-duplex relay (FDR networks, where multiple FDRs are located at each hop and perform cooperative beamforming to null out the signal at multiple eavesdroppers. For a perfect self-interference cancellation (PSIC case, where the self-interference signal at each FDR is completely canceled, we derive an optimal power allocation (OPA strategy using the Karush-Kuhn-Tucker (KKT conditions to maximize the achievable secrecy rate under an overall transmit power constraint. In the case where residual self-interferences exist owing to imperfect self-interference cancellation (ISIC, we also propose a transmit power allocation scheme using the geometric programming (GP method. Numerical results are presented to verify the secrecy rate performance of the proposed power allocation schemes.

  14. Transmit Power Allocation for Physical Layer Security in Cooperative Multi-Hop Full-Duplex Relay Networks.

    Science.gov (United States)

    Lee, Jong-Ho; Sohn, Illsoo; Kim, Yong-Hwa

    2016-10-17

    In this paper, we consider a transmit power allocation problem for secure transmission in multi-hop decode-and-forward (DF) full-duplex relay (FDR) networks, where multiple FDRs are located at each hop and perform cooperative beamforming to null out the signal at multiple eavesdroppers. For a perfect self-interference cancellation (PSIC) case, where the self-interference signal at each FDR is completely canceled, we derive an optimal power allocation (OPA) strategy using the Karush-Kuhn-Tucker (KKT) conditions to maximize the achievable secrecy rate under an overall transmit power constraint. In the case where residual self-interferences exist owing to imperfect self-interference cancellation (ISIC), we also propose a transmit power allocation scheme using the geometric programming (GP) method. Numerical results are presented to verify the secrecy rate performance of the proposed power allocation schemes.

  15. HPLC Analysis of alpha and beta Acids in Hops

    Energy Technology Data Exchange (ETDEWEB)

    Danenhower, Travis [Kutztown University; Force, Leyna [Kutztown University; Petersen, Kenneth [Kutztown University; Betts, Thomas [Kutztown University; Baker, Gary A [ORNL

    2008-01-01

    Early in brewing history, a variety of herbs and spices (such as coriander, rosemary, yarrow, and bog myrtle) were used to flavor beer (1). It is evident, from the Bavarian Purity Law of 1516, that a major shift in beer flavoring occurred around the middle of the second millennium. This law declared that only three ingredients could be used to brew beer: barley, water, and hops (1), thus eliminating other spices from German beer. (The importance of yeast had not yet been uncovered.)

  16. Force feedback effects on single molecule hopping and pulling experiments

    Science.gov (United States)

    Rico-Pasto, M.; Pastor, I.; Ritort, F.

    2018-03-01

    Single-molecule experiments with optical tweezers have become an important tool to study the properties and mechanisms of biological systems, such as cells and nucleic acids. In particular, force unzipping experiments have been used to extract the thermodynamics and kinetics of folding and unfolding reactions. In hopping experiments, a molecule executes transitions between the unfolded and folded states at a preset value of the force [constant force mode (CFM) under force feedback] or trap position [passive mode (PM) without feedback] and the force-dependent kinetic rates extracted from the lifetime of each state (CFM) and the rupture force distributions (PM) using the Bell-Evans model. However, hopping experiments in the CFM are known to overestimate molecular distances and folding free energies for fast transitions compared to the response time of the feedback. In contrast, kinetic rate measurements from pulling experiments have been mostly done in the PM while the CFM is seldom implemented in pulling protocols. Here, we carry out hopping and pulling experiments in a short DNA hairpin in the PM and CFM at three different temperatures (6 °C, 25 °C, and 45 °C) exhibiting largely varying kinetic rates. As expected, we find that equilibrium hopping experiments in the CFM and PM perform well at 6 °C (where kinetics are slow), whereas the CFM overestimates molecular parameters at 45 °C (where kinetics are fast). In contrast, nonequilibrium pulling experiments perform well in both modes at all temperatures. This demonstrates that the same kind of feedback algorithm in the CFM leads to more reliable determination of the folding reaction parameters in irreversible pulling experiments.

  17. Hip Hop Dance Experience Linked to Sociocognitive Ability

    OpenAIRE

    Bonny, Justin W.; Lindberg, Jenna C.; Pacampara, Marc C.

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skill...

  18. Two-legged hopping in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Matthew F. Moran

    2013-03-01

    Full Text Available Sensory processing deficits are common within autism spectrum disorders (ASD. Deficits have a heterogeneous dispersion across the spectrum and multimodal processing tasks are thought to magnify integration difficulties. Two-legged hopping in place in sync with an auditory cue (2.3, 3.0 Hz was studied in a group of six individuals with expressive language impaired ASD (ELI-ASD and an age-matched control group. Vertical ground reaction force data were collected and discrete Fourier transforms were utilized to determine dominant hopping cadence. Effective leg stiffness was computed through a mass-spring model representation. The ELI-ASD group were unsuccessful in matching their hopping cadence (2.21±0.30 hops•sec-1, 2.35±0.41 hops•sec-1 to either auditory cue with greater deviations at the 3.0 Hz cue. In contrast, the control group was able to match hopping cadence (2.35±0.06 hops•sec-1, 3.02±0.10 hops•sec-1 to either cue via an adjustment of effective leg stiffness. The ELI-ASD group demonstrated a varied response with an interquartile range (IQR in excess of 0.5 hops•sec-1 as compared to the control group with an IQR < 0.03 hops•sec-1. Several sensorimotor mechanisms could explain the inability of participants with ELI-ASD to modulate motor output to match an external auditory cue. These results suggest that a multimodal gross motor task can (1 discriminate performance among a group of individuals with severe autism, and (2 could be a useful quantitative tool for evaluating motor performance in individuals with ASD individuals.

  19. Rend og hop - Vi si´r stop

    DEFF Research Database (Denmark)

    Lund, Ole

    Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere dominere...

  20. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  1. Implementation of Low Power Multi-hop Wireless Sensor Network

    Directory of Open Access Journals (Sweden)

    Zhou Jianhong

    2016-01-01

    Full Text Available In this paper, the multi-hop wireless sensor network is created, which is realized by Micaz and Mib520 Board using TinyOS and Cygwin. The mote transmission mode is engaged and off-the-shelf protocols and algorithm, RSSI and PDR, are applied in this wireless network and the performance is improved. Several experiments are proposed to set standard RSSI threshold value to allow the user to send packet with efficient power level.

  2. The Soft-Confined Method for Creating Molecular Models of Amorphous Polymer Surfaces

    KAUST Repository

    Liu, Hongyi

    2012-02-09

    The goal of this work was to use molecular dynamics (MD) simulations to build amorphous surface layers of polypropylene (PP) and cellulose and to inspect their physical and interfacial properties. A new method to produce molecular models for these surfaces was developed, which involved the use of a "soft" confining layer comprised of a xenon crystal. This method compacts the polymers into a density distribution and a degree of molecular surface roughness that corresponds well to experimental values. In addition, calculated properties such as density, cohesive energy density, coefficient of thermal expansion, and the surface energy agree with experimental values and thus validate the use of soft confining layers. The method can be applied to polymers with a linear backbone such as PP as well as those whose backbones contain rings, such as cellulose. The developed PP and cellulose surfaces were characterized by their interactions with water. It was found that a water nanodroplet spreads on the amorphous cellulose surfaces, but there was no significant change in the dimension of the droplet on the PP surface; the resulting MD water contact angles on PP and amorphous cellulose surfaces were determined to be 106 and 33°, respectively. © 2012 American Chemical Society.

  3. Surface exposure dating of non-terrestrial bodies using optically stimulated luminescence: A new method

    DEFF Research Database (Denmark)

    Sohbati, Reza; Jain, Mayank; Murray, Andrew

    2012-01-01

    We propose a new method for in situ surface exposure dating of non-terrestrial geomorphological features using optically stimulated luminescence (OSL); our approach is based on the progressive emptying of trapped charge with exposure to light at depth into a mineral surface. A complete model...... will be applicable over the last 100 ka. The method is ideally suited to in situ measurement using existing technology developed for space applications, and so offers for the first time the realistic possibility of direct determination of exposure ages of young non-terrestrial surfaces. © 2012 Elsevier Inc. All...... rights reserved....

  4. Systems and Methods of Laser Texturing of Material Surfaces and Their Applications

    Science.gov (United States)

    Gupta, Mool C. (Inventor); Nayak, Barada K. (Inventor)

    2014-01-01

    The surface of a material is textured and by exposing the surface to pulses from an ultrafast laser. The laser treatment causes pillars to form on the treated surface. These pillars provide for greater light absorption. Texturing and crystallization can be carried out as a single step process. The crystallization of the material provides for higher electric conductivity and changes in optical and electronic properties of the material. The method may be performed in vacuum or a gaseous environment. The gaseous environment may aid in texturing and/or modifying physical and chemical properties of the surfaces. This method may be used on various material surfaces, such as semiconductors, metals and their alloys, ceramics, polymers, glasses, composites, as well as crystalline, nanocrystalline, polycrystalline, microcrystalline, and amorphous phases.

  5. Fabricating superhydrophobic polymer surfaces with excellent abrasion resistance by a simple lamination templating method.

    Science.gov (United States)

    Xu, Qian Feng; Mondal, Bikash; Lyons, Alan M

    2011-09-01

    Fabricating robust superhydrophobic surfaces for commercial applications is challenging as the fine-scale surface features, necessary to achieve superhydrophobicity, are susceptible to mechanical damage. Herein, we report a simple and inexpensive lamination templating method to create superhydrophobic polymer surfaces with excellent abrasion resistance and water pressure stability. To fabricate the surfaces, polyethylene films were laminated against woven wire mesh templates. After cooling, the mesh was peeled from the polymer creating a 3D array of ordered polymer microposts on the polymer surface. The resulting texture is monolithic with the polymer film and requires no chemical modification to exhibit superhydrophobicity. By controlling lamination parameters and mesh dimensions, polyethylene surfaces were fabricated that exhibit static contact angles of 160° and slip angles of 5°. Chemical and mechanical stability was evaluated using an array of manual tests as well as a standard reciprocating abraser test. Surfaces remained superhydrophobic after more than 5500 abrasion cycles at a pressure of 32.0 kPa. In addition, the surface remains dry after immersing into water for 5 h at 55 kPa. This method is environmental friendly, as it employs no solvents or harsh chemicals and may provide an economically viable path to manufacture large areas of mechanically robust superhydrophobic surfaces from inexpensive polymers and reusable templates.

  6. Improved atmospheric effects elimination method for pBRDF models of painted surfaces.

    Science.gov (United States)

    Zhang, Ying; Zhang, Yi; Zhao, Huijie; Wang, Zeying

    2017-07-10

    A method for eliminating atmospheric effects in polarimetric imaging remote sensing detection was developed by combining the shadowing method and radiative transfer (RT) model. First, a polarized bidirectional reflectance distribution function (pBRDF) model of painted surfaces was constructed. Using the resulting polarimetric radiance composition, the atmospheric effects elimination method was developed and compared to Shell's method. Experiments were performed using a liquid-crystal-variable-retarder-based imaging polarimeter to obtain the surface pBRDFs. The proposed method showed better performance under different weather conditions than Shell's method. Furthermore, the error was below 4.8% in the proposed method (6.8% in Shell's method), indicating improved quantitative accuracy of the target physical parameters in remote sensing.

  7. Effective Hamiltonians for Rapidly Driven Many-Body Lattice Systems: Induced Exchange Interactions and Density-Dependent Hoppings

    Science.gov (United States)

    Itin, A. P.; Katsnelson, M. I.

    2015-08-01

    We consider 1D lattices described by Hubbard or Bose-Hubbard models, in the presence of periodic high-frequency perturbations, such as uniform ac force or modulation of hopping coefficients. Effective Hamiltonians for interacting particles are derived using an averaging method resembling classical canonical perturbation theory. As is known, a high-frequency force may renormalize hopping coefficients, causing interesting phenomena such as coherent destruction of tunneling and creation of artificial gauge fields. We find explicitly additional corrections to the effective Hamiltonians due to interactions, corresponding to nontrivial processes such as single-particle density-dependent tunneling, correlated pair hoppings, nearest neighbor interactions, etc. Some of these processes arise also in multiband lattice models, and are capable of giving rise to a rich variety of quantum phases. The apparent contradiction with other methods, e.g., Floquet-Magnus expansion, is explained. The results may be useful for designing effective Hamiltonian models in experiments with ultracold atoms, as well as in the field of ultrafast nonequilibrium magnetism. An example of manipulating exchange interaction in a Mott-Hubbard insulator is considered, where our corrections play an essential role.

  8. Tethering complexes in the endocytic pathway: CORVET and HOPS.

    Science.gov (United States)

    Solinger, Jachen A; Spang, Anne

    2013-06-01

    Endocytosis describes the processes by which proteins, peptides and solutes, and also pathogens, enter the cell. Endocytosed material progresses to endosomes. Genetic studies in yeast, worms, flies and mammals have identified a set of universally conserved proteins that are essential for early-to-late endosome transition and lysosome biogenesis, and for endolysosomal trafficking pathways, including autophagy. The two Vps-C complexes CORVET (class C core vacuole/endosome tethering) and HOPS (homotypic fusion and vacuole protein sorting) perform diverse biochemical functions in endocytosis: they tether membranes, interact with Rab GTPases, activate and proof-read SNARE assembly to drive membrane fusion, and possibly attach endosomes to the cytoskeleton. In addition, several of the CORVET and HOPS subunits have diversified in metazoans, and probably form additional specialized complexes to accomodate the higher complexity of trafficking pathways in these cells. Recent studies offer new insights into the complex relationships between CORVET and HOPS complexes and other factors of the endolysosomal pathway. Interactions with V-ATPase, the ESCRT machinery, phosphoinositides, the cytoskeleton and the Rab switch suggest an intricate cooperative network for endosome maturation. Accumulating evidence supports the view that endosomal tethering complexes implement a regulatory logic that governs endomembrane identity and dynamics. © 2013 The Authors Journal compilation © 2013 FEBS.

  9. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  10. Different methods to alter surface morphology of high aspect ratio structures

    Energy Technology Data Exchange (ETDEWEB)

    Leber, M., E-mail: moritz.leber@utah.edu [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Shandhi, M.M.H. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Hogan, A. [Blackrock Microsystems, Salt Lake City, UT (United States); Solzbacher, F. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Bhandari, R.; Negi, S. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT (United States); Blackrock Microsystems, Salt Lake City, UT (United States)

    2016-03-01

    Graphical abstract: Surface engineering of high aspect ratio silicon structures. - Highlights: • Multiple roughening techniques for high aspect ratio devices were investigated. • Modification of surface morphology of high aspect ratio silicon devices (1:15). • Decrease of 76% in impedance proves significant increase in surface area. - Abstract: In various applications such as neural prostheses or solar cells, there is a need to alter the surface morphology of high aspect ratio structures so that the real surface area is greater than geometrical area. The change in surface morphology enhances the devices functionality. One of the applications of altering the surface morphology is of neural implants such as the Utah electrode array (UEA) that communicate with single neurons by charge injection induced stimulation or by recording electrical neural signals. For high selectivity between single cells of the nervous system, the electrode surface area is required to be as small as possible, while the impedance is required to be as low as possible for good signal to noise ratios (SNR) during neural recording. For stimulation, high charge injection and charge transfer capacities of the electrodes are required, which increase with the electrode surface. Traditionally, researchers have worked with either increasing the roughness of the existing metallization (platinum grey, black) or other materials such as Iridium Oxide and PEDOT. All of these previously investigated methods lead to more complicated metal deposition processes that are difficult to control and often have a critical impact on the mechanical properties of the metal films. Therefore, a modification of the surface underneath the electrode's coating will increase its surface area while maintaining the standard and well controlled metal deposition process. In this work, the surfaces of the silicon micro-needles were engineered by creating a defined microstructure on the electrodes surface using several

  11. Laser pulse transient method for measuring the normal spectral emissivity of samples with arbitrary surface quality

    Science.gov (United States)

    Jeromen, A.; Grabec, I.; Govekar, E.

    2008-09-01

    A laser pulse transient method for measuring normal spectral emissivity is described. In this method, a laser pulse ( λ=1064 nm) irradiates the top surface of a flat specimen. A two-dimensional temperature response of the bottom surface is measured with a calibrated thermographic camera. By solving an axisymmetric boundary value heat conduction problem, the normal spectral emissivity at 1064 nm is determined by using an iterative nonlinear least-squares estimation procedure. The method can be applied to arbitrary sample surface quality. The method is tested on a nickel specimen and used to determine the normal spectral emissivity of AISI 304 stainless steel. The expanded combined uncertainty of the method has been estimated to be 18%.

  12. Facile method to fabricate raspberry-like particulate films for superhydrophobic surfaces.

    Science.gov (United States)

    Tsai, Hui-Jung; Lee, Yuh-Lang

    2007-12-04

    A facile method using layer-by-layer assembly of silica particles is proposed to prepare raspberry-like particulate films for the fabrication of superhydrophobic surfaces. Silica particles 0.5 microm in diameter were used to prepare a surface with a microscale roughness. Nanosized silica particles were then assembled on the particulate film to construct a finer structure on top of the coarse one. After surface modification with dodecyltrichlorosilane, the advancing and receding contact angles of water on the dual-sized structured surface were 169 and 165 degrees , respectively. The scale ratio of the micro/nano surface structure and the regularity of the particulate films on the superhydrophobic surface performance are discussed.

  13. Development and application of QM/MM methods to study the solvation effects and surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Dibya, Pooja Arora [Iowa State Univ., Ames, IA (United States)

    2010-01-01

    Quantum mechanical (QM) calculations have the advantage of attaining high-level accuracy, however QM calculations become computationally inefficient as the size of the system grows. Solving complex molecular problems on large systems and ensembles by using quantum mechanics still poses a challenge in terms of the computational cost. Methods that are based on classical mechanics are an inexpensive alternative, but they lack accuracy. A good trade off between accuracy and efficiency is achieved by combining QM methods with molecular mechanics (MM) methods to use the robustness of the QM methods in terms of accuracy and the MM methods to minimize the computational cost. Two types of QM combined with MM (QM/MM) methods are the main focus of the present dissertation: the application and development of QM/MM methods for solvation studies and reactions on the Si(100) surface. The solvation studies were performed using a discreet solvation model that is largely based on first principles called the effective fragment potential method (EFP). The main idea of combining the EFP method with quantum mechanics is to accurately treat the solute-solvent and solvent-solvent interactions, such as electrostatic, polarization, dispersion and charge transfer, that are important in correctly calculating solvent effects on systems of interest. A second QM/MM method called SIMOMM (surface integrated molecular orbital molecular mechanics) is a hybrid QM/MM embedded cluster model that mimics the real surface.3 This method was employed to calculate the potential energy surfaces for reactions of atomic O on the Si(100) surface. The hybrid QM/MM method is a computationally inexpensive approach for studying reactions on larger surfaces in a reasonably accurate and efficient manner. This thesis is comprised of four chapters: Chapter 1 describes the general overview and motivation of the dissertation and gives a broad background of the computational methods that have been employed in this work

  14. Reliability-based design optimization via high order response surface method

    International Nuclear Information System (INIS)

    Li, Hong Shuang

    2013-01-01

    To reduce the computational effort of reliability-based design optimization (RBDO), the response surface method (RSM) has been widely used to evaluate reliability constraints. We propose an efficient methodology for solving RBDO problems based on an improved high order response surface method (HORSM) that takes advantage of an efficient sampling method, Hermite polynomials and uncertainty contribution concept to construct a high order response surface function with cross terms for reliability analysis. The sampling method generates supporting points from Gauss-Hermite quadrature points, which can be used to approximate response surface function without cross terms, to identify the highest order of each random variable and to determine the significant variables connected with point estimate method. The cross terms between two significant random variables are added to the response surface function to improve the approximation accuracy. Integrating the nested strategy, the improved HORSM is explored in solving RBDO problems. Additionally, a sampling based reliability sensitivity analysis method is employed to reduce the computational effort further when design variables are distributional parameters of input random variables. The proposed methodology is applied on two test problems to validate its accuracy and efficiency. The proposed methodology is more efficient than first order reliability method based RBDO and Monte Carlo simulation based RBDO, and enables the use of RBDO as a practical design tool.

  15. A high-reflective surface measurement method based on conoscopic holography technology

    Science.gov (United States)

    Cheng, Xu; Li, ZhongWei; Shi, YuSheng; Zhao, HengShuang; Zhan, Guomin

    2014-11-01

    Measuring high-reflective surfaces using optical method is always a big challenging problem. This paper presents a high-reflective surface measurement method based on conoscopic holography technology using a 4D motion platform equipped with a conoscopic holography optical probe. There are two key problems needed to solve before the automate scan of the complex shape surface: the coordinate calibration and the path planning. To improve the calibration efficiency and accuracy, the coordinate calibration is divided into two parts: the rough calibration and the accurate registration. The path planning consists of two aspects including: the path points generation and the path points verification. In addition, by scanning the objects having high-reflective surfaces, such as the metal blades, coins and other work-pieces, the efficiency of the measurement method has been verified.

  16. Metastability in plyometric training on unstable surfaces: a pilot study

    Science.gov (United States)

    2014-01-01

    Background In the past, plyometric training (PT) has been predominantly performed on stable surfaces. The purpose of this pilot study was to examine effects of a 7-week lower body PT on stable vs. unstable surfaces. This type of exercise condition may be denoted as metastable equilibrium. Methods Thirty-three physically active male sport science students (age: 24.1 ± 3.8 years) were randomly assigned to a PT group (n = 13) exercising on stable (STAB) and a PT group (n = 20) on unstable surfaces (INST). Both groups trained countermovement jumps, drop jumps, and practiced a hurdle jump course. In addition, high bar squats were performed. Physical fitness tests on stable surfaces (hexagonal obstacle test, countermovement jump, hurdle drop jump, left-right hop, dynamic and static balance tests, and leg extension strength) were used to examine the training effects. Results Significant main effects of time (ANOVA) were found for the countermovement jump, hurdle drop jump, hexagonal test, dynamic balance, and leg extension strength. A significant interaction of time and training mode was detected for the countermovement jump in favor of the INST group. No significant improvements were evident for either group in the left-right hop and in the static balance test. Conclusions These results show that lower body PT on unstable surfaces is a safe and efficient way to improve physical performance on stable surfaces. PMID:25089202

  17. Hip-Hop to Health Jr. Randomized Effectiveness Trial

    Science.gov (United States)

    Kong, Angela; Buscemi, Joanna; Stolley, Melinda R.; Schiffer, Linda A.; Kim, Yoonsang; Braunschweig, Carol L.; Gomez-Perez, Sandra L.; Blumstein, Lara B.; Van Horn, Linda; Dyer, Alan R.; Fitzgibbon, Marian L.

    2015-01-01

    Introduction The preschool years provide a unique window of opportunity to intervene on obesity-related lifestyle risk factors during the formative years of a child’s life. The purpose of this study was to assess the impact of a preschool-based obesity prevention effectiveness trial at 1-year follow-up. Design RCT. Settings/participants Primarily African American children (aged 3–5 years, N=618) attending Head Start preschool programs administered by Chicago Public Schools. Methods Eighteen preschools were randomly assigned in 2007–2008 to receive either: (1) a 14-week teacher-delivered intervention focused on healthy lifestyle behaviors; or (2) a 14-week teacher-delivered general health curriculum (control group). Main outcome measures The primary outcome, BMI, was measured at baseline, post-intervention, and 1-year follow-up. Diet and screen time behaviors were also assessed at these time points. Multilevel mixed effects models were used to test for between-group differences. Data were analyzed in 2014. Results Significant between-group differences were observed in diet, but not in BMI z-score or screen time at 1-year follow-up. Diet differences favored the intervention arm over controls in overall diet quality (p=0.02) and in subcomponents of diet quality, as measured by the Healthy Eating Index-2005, and in fruit intake (servings/day, excludes juice) (p=0.02). Diet quality worsened more among controls than the intervention group at 1-year follow-up. Conclusions The adaptation of Hip-Hop to Health Jr. produced modest benefits in diet quality, but did not significantly impact weight gain trajectory. Not unlike other effectiveness trials, this real-world version delivered by Head Start teachers produced fewer benefits than the more rigorous efficacy trial. It is important to understand and build upon the lessons learned from these types of trials so that we can design, implement, and disseminate successful evidence-based programs more widely and effectively

  18. Isolation of bitter acids from hops (Humulus lupulus L.) using countercurrent chromatography.

    Science.gov (United States)

    Dahlberg, Clinton J; Harris, Guy; Urban, Jan; Tripp, Matthew L; Bland, Jeffrey S; Carroll, Brian J

    2012-05-01

    Commercially available hops (Humulus lupulus L.) bitter acid extracts contain a mixture of three major congeners (co-, n-, and ad-) in addition to cis/trans diastereomers for each congener. Individual isomerized α-acids were obtained by the consecutive application of two separate countercurrent chromatography methods. First, individual isomerized α-acid congeners as a mixture of cis/trans diastereomers were obtained using a solvent system consisting of hexane and aqueous buffer. The second purification, capable of separating cis/trans diastereomers, was accomplished using a quaternary solvent system; an alternative procedure using β-cyclodextrin followed by countercurrent chromatography was also investigated. The NaBH(4) reduction of the purified isomerized α-acid compounds followed by countercurrent chromatography purification resulted in individual ρ iso α-acids (>95%). Similarly, catalytic hydrogenation of the purified isomerized α-acid compounds followed by countercurrent chromatography purification produced individual tetrahydro isomerized α-acids (>95%). Reported herein is a widely applicable approach that focuses on three critical variables--solvent system composition, pH, and buffer-to-sample ratio--that enable the efficient purification of individual bitter acids (≥95%) from commercially available hops extracts. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Superconductivity with s and p symmetries in an extended Hubbard model with correlated hopping

    Science.gov (United States)

    Aligia, A. A.; Gagliano, E.; Arrachea, L.; Hallberg, K.

    1998-10-01

    We consider a generalized Hubbard model with on-site and nearest-neighbour repulsions U and V respectively, and nearest-neighbour hopping for spin up (down) which depends on the total occupation n_b of spin down (up) electrons on both sites involved. The hopping parameters are t_{AA}, t_{AB} and t_{BB} for n_b=0,1,2 respectively. We briefly summarize results which support that the model exhibits s-wave superconductivity for certain parameters and extend them by studying the Berry phases. Using a generalized Hartree-Fock(HF) BCS decoupling of the two and three-body terms, we obtain that at half filling, for t_{AB}method supports the previous results, there are quantitative differences.

  20. Superconductivity with s and p symmetries in an extended Hubbard model with correlated hopping

    Energy Technology Data Exchange (ETDEWEB)

    Aligia, A.A.; Gagliano, E.; Hallberg, K. [Comision Nacional de Energia Atomica (CNEA), San Carlos de Bariloche (Argentina). Centro Atomico Bariloche (CAB); Arrachea, L. [Max-Planck-Institut fuer Physik komplexer Systeme, Noethnitzer Strasse 38, 01187 Dresden (Germany)

    1998-10-01

    We consider a generalized Hubbard model with on-site and nearest-neighbour repulsions U and V respectively, and nearest-neighbour hopping for spin up (down) which depends on the total occupation n{sub b} of spin down (up) electrons on both sites involved. The hopping parameters are t{sub AA}, t{sub AB} and t{sub BB} for n{sub b}=0,1,2 respectively. We briefly summarize results which support that the model exhibits s-wave superconductivity for certain parameters and extend them by studying the Berry phases. Using a generalized Hartree-Fock(HF) BCS decoupling of the two and three-body terms, we obtain that at half filling, for t{sub AB}method supports the previous results, there are quantitative differences. (orig.) 68 refs.

  1. Development of autoradiographic method for measuring sorption of radionuclides on natural fracture surfaces

    International Nuclear Information System (INIS)

    Muuronen, S.

    1983-11-01

    On the basis of positive results about sorption of radionuclides in rock thin sections an autoradiographic method applicable for measurement sorption of radionuclides on rough rock surfaces was developed. There is no method available because 1) a plane film cannot be used because due to the roughness of rock surfaces 2) rock samples used in this investigation cannot be studied with microscopes and 3) autoradiogram cannot be studied fixed on the surface of a rock sample because the colours of the minerals in the sample will interfere with the interpretation. This report discusses experimental work done to find an useful proedure. In the development of the method main emphasis was put on investigation of the following steps: 1) preparation of the sample for equilibration and spiking; 2) properties of the covering paint for the rock surface and 3) testing of autoradiographic methods using different nuclear emulsions. As the result of these experiments promising autoradiograms with gel emulsion for sawed rock surfaces and with stripping film for rough rock surfaces were obtained. The mineralogic disribution of sorbed activity is easily seen in autoradiograms. Much work must still be done to get reliable quantitative information from autoradiograms. For developing of the autoradiographic method sawed plane rock samples of quartz feldspar intergrowth, pegmatite and limestone were used. In addition core samples of tonalite and mica gneiss from Olkiluoto were utilized. The distribution coefficients (Ksub(a)) obtained for cesium were 560 x 10 -4 and 620 x 10 -4 m 3 /m 2 for tonalite and mica gneiss, respectively. The results are little higher but of the same order of magnitude as obtained by the autoradiographic method using rock thin sections and by the batch method using crused samples. The natural fracture surface sorption study is a logical step in determining the scaling factor from laboratory to field studies. Field data will be needed to determine whether laboratory

  2. Pre-absorbed immunoproteomics: a novel method for the detection of Streptococcus suis surface proteins.

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    Full Text Available Streptococcus suis serotype 2 (SS2 is a zoonotic pathogen that can cause infections in pigs and humans. Bacterial surface proteins are often investigated as potential vaccine candidates and biomarkers of virulence. In this study, a novel method for identifying bacterial surface proteins is presented, which combines immunoproteomic and immunoserologic techniques. Critical to the success of this new method is an improved procedure for generating two-dimensional electrophoresis gel profiles of S. suis proteins. The S. suis surface proteins identified in this study include muramidase-released protein precursor (MRP and an ABC transporter protein, while MRP is thought to be one of the main virulence factors in SS2 located on the bacterial surface. Herein, we demonstrate that the ABC transporter protein can bind to HEp-2 cells, which strongly suggests that this protein is located on the bacterial cell surface and may be involved in pathogenesis. An immunofluorescence assay confirmed that the ABC transporter is localized to the bacterial outer surface. This new method may prove to be a useful tool for identifying surface proteins, and aid in the development of new vaccine subunits and disease diagnostics.

  3. «Hip hop culture»: a review of its potential as an educational tool

    Directory of Open Access Journals (Sweden)

    Alberto RODRÍGUEZ ÁLVAREZ

    2014-12-01

    Full Text Available  This paper reviews the meaning of «hip hop culture» as a contemporary musical phenomenon, and how rap is a feature of the social and educational activities aimed at youth. The purpose of it is to show the evolution of hip hop, its agents, its practices, and its relationship with the world of the music industry and cultural action.It provides useful information on the contents of the Spanish rap lyrics that have been analyzed to check the messages transmitted, the ideas and references to the precepts legitimized in «hip hop culture». This is an approach to the idea that hip hop is a means of expression of social concerns and values that identify the hip hop culture. So, this study aims to provide a better knowledge of some educational experiences that have used hip hop as a tool to promote change in neighbourhoods, social groups or youth groups.

  4. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh

    2013-10-01

    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  5. Self-cleaning Foliar Surfaces Characterization using RIMAPS Technique and Variogram Method

    International Nuclear Information System (INIS)

    Rosi, Pablo E.

    2002-01-01

    Along the last ten years many important studies about characterization of self-cleaning foliar surfaces have been done and focused new interest on this kind of surfaces.These studies were possible due to the development of a novel preparation technique for this biological material that let us observe the delicate structures of a foliar surface under scanning electron microscope (S.E.M.).This technique consists of replacing the natural water of the specimen by glycerol. Digital S.E.M. images from both self-cleaning and non-self-cleaning foliar surfaces were obtained and analyzed using RIMAPS technique and Variograms method. Our results revealed the existence of a common and exclusive geometrical pattern that is found in species which present self-cleaning foliar surfaces.This pattern combines at least nine different directions.The results from the Variograms method showed that the stomata play a key role in the determination of foliar surface roughness. In addition, spectra from RIMAPS technique constitute a fingerprint of a foliar surface so they can be used to find evolutionary relationships among species.Further studies will provide more detailed information to fully elucidate the self-cleaning pattern, so it might be possible to reproduce it on an artificial surface and make it self-cleaning

  6. A new method for solid surface topographical studies using nematic liquid crystals

    Science.gov (United States)

    Baber, N.; Strugalski, Z.

    1984-03-01

    A new simple method has been developed to investigate the topography of a wide range of solid surfaces using nematic liquid crystals. Polarizing microscopy is employed. The usefulness of the method for detecting weak mechanical effects has been demonstrated. An application in criminology is foreseen.

  7. Variant of a volume-of-fluid method for surface tension-dominant two ...

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... The capabilities of the volume-of-fluid method for the calculation of surface tension-dominant two-phase flows are explained. The accurate calculation of the interface remains a problem for the volume-of-fluid method if the density ratios of the fluids in different phases are high. The simulations of bubble ...

  8. Seismo-acoustic location method for small-magnitude surface explosions

    Science.gov (United States)

    Che, I.-Y.; Shin, J. S.; Kang, I. B.

    2009-02-01

    The aims of this study were to develop an improved method using infrasound observations at multiple seismo-acoustic arrays for locating small-magnitude surface explosions at regional distances and to apply the method to ground-truth blasting events for validation. The location method is based on a nonlinear grid search using the travel times and back azimuths of infrasonic signals generated from the surface explosions and on seismic parameters that are independently determined by routine seismic monitoring systems. Specifically, the method utilizes wind-corrected infrasonic azimuths in grid searching to constrain the grids according to nearness to feasibly real observations. Ground-truth events were recorded by a seismo-acoustic station temporarily operated inside an open-pit mine and then used to investigate the improvement by the location method. The method improved the locating of ground-truth events by approximately 50% compared to the seismic location results. Surface explosions generating both seismic and infrasonic signals could be located independently by the seismic location, infrasonic-azimuth intersection, and seismo-acoustic location method, respectively. This method can be applied to automatic seismic/infrasonic monitoring systems as an additional location tool for explosion-induced seismic events, allowing for simultaneous monitoring for surface explosions and reduced risk of false location results.

  9. Effect of surface conditioning methods on the bond strength of luting cement to ceramics

    NARCIS (Netherlands)

    Ozcan, M; Vallittu, PK; Özcan, Mutlu; Vallittu, Pekka K.

    2003-01-01

    Objectives. This study evaluated the effect of three different surface conditioning methods on the bond strength of a Bis-GMA based luting cement to six commercial dental ceramics. Methods. Six disc shaped ceramic specimens (glass ceramics, glass infiltrated alumina, glass infiltrated zirconium

  10. Variational space–time (dis)continuous Galerkin method for nonlinear free surface water waves

    NARCIS (Netherlands)

    Gagarina, Elena; Ambati, V.R.; van der Vegt, Jacobus J.W.; Bokhove, Onno

    2014-01-01

    A new variational finite element method is developed for nonlinear free surface gravity water waves using the potential flow approximation. This method also handles waves generated by a wave maker. Its formulation stems from Miles’ variational principle for water waves together with a finite element

  11. Variational space-time (dis)continuous Galerkin method for nonlinear free surface waves

    NARCIS (Netherlands)

    Gagarina, Elena; van der Vegt, Jacobus J.W.; Ambati, V.R.; Bokhove, Onno

    A new variational finite element method is developed for nonlinear free surface gravity water waves. This method also handles waves generated by a wave maker. Its formulation stems from Miles' variational principle for water waves together with a space-time finite element discretization that is

  12. Study of the possibilities of using nuclear methods for characterizing the surface region of glasses

    International Nuclear Information System (INIS)

    Hsiung, P.

    1983-01-01

    Following a review of the different methods used for the analysis of surfaces, we give a detailed description of charged particle elastic backscattering and the experimental devices. We then apply this method to the study of the lixiviation of borosilicate glasses in aqueous media and to the characterization of two heavy elements, cerium and thorium and their possible interaction in simple borosilicates [fr

  13. [Modern methods for studying the surface of titanium implants (literature review)].

    Science.gov (United States)

    Suba, Csongor; Velich, Norbert; Vörös, János; Turi, Csaba; Szabó, György

    2004-02-01

    Studies of the coatings found on the surface of titanium implants employed in oral surgery are indispensable for understanding the interactions between the organism and the implant. This paper surveys the theory and practical applicability of the methods most frequently applied to study the surface structure and composition of the material. Detailed accounts are given of various structure investigation methods: scanning electron microscopy, stereo scanning electron microscopy, X-ray diffraction, atomic force microscopy and interference microscopy; and of various composition investigation methods: secondary ion mass spectroscopy, X-ray photoelectron spectroscopy, Auger electron spectroscopy; and also of the corrosion procedures for the study of electrochemical behaviour.

  14. Green's function surface-integral method for nonlocal response of plasmonic nanowires in arbitrary dielectric environments

    DEFF Research Database (Denmark)

    Yan, Wei; Mortensen, N. Asger; Wubs, Martijn

    2013-01-01

    We develop a nonlocal-response generalization to the Green's function surface-integral method (GSIM), also known as the boundary-element method. This numerically efficient method can accurately describe the linear hydrodynamic nonlocal response of arbitrarily shaped plasmonic nanowires in arbitrary...... and the longitudinal wave number become smaller, or when the effective background permittivity or the mode inhomogeneity increase. The inhomogeneity can be expressed in terms of an effective angular momentum of the surface-plasmon mode. We compare local and nonlocal response of freestanding nanowires, and of nanowires...

  15. An adaptive finite element method for simulating surface tension with the gradient theory of fluid interfaces

    KAUST Repository

    Kou, Jisheng

    2014-01-01

    The gradient theory for the surface tension of simple fluids and mixtures is rigorously analyzed based on mathematical theory. The finite element approximation of surface tension is developed and analyzed, and moreover, an adaptive finite element method based on a physical-based estimator is proposed and it can be coupled efficiently with Newton\\'s method as well. The numerical tests are carried out both to verify the proposed theory and to demonstrate the efficiency of the proposed method. © 2013 Elsevier B.V. All rights reserved.

  16. Facile method to stain the bacterial cell surface for super-resolution fluorescence microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Gunsolus, Ian L.; Hu, Dehong; Mihai, Cosmin; Lohse, Samuel E.; Lee, Chang-Soo; Torelli, Marco; Hamers, Robert J.; Murphy, Catherine; Orr, Galya; Haynes, Christy L.

    2014-01-01

    A method to fluorescently stain the surfaces of both Gram-negative and Gram-positive bacterial cells compatible with super-resolution fluorescence microscopy is presented. This method utilizes a commercially-available fluorescent probe to label primary amines at the surface of the cell. We demonstrate efficient staining of two bacterial strains, the Gram-negative Shewanella oneidensis MR-1 and the Gram-positive Bacillus subtilis 168. Using structured illumination microscopy and stochastic optical reconstruction microscopy, which require high quantum yield or specialized dyes, we show that this staining method may be used to resolve the bacterial cell surface with sub-diffraction-limited resolution. We further use this method to identify localization patterns of nanomaterials, specifically cadmium selenide quantum dots, following interaction with bacterial cells.

  17. Stability analysis of a partitioned iterative method for steady free surface flow

    Science.gov (United States)

    Demeester, Toon; Degroote, Joris; Vierendeels, Jan

    2018-02-01

    This note considers the steady free surface (FS) flow problem as encountered in the paper by van Brummelen et al. [1]. In that paper, steady flow of water in a two-dimensional slice of an infinitely wide open channel with a particular bottom wall is calculated as the first step in the development of a 3D surface fitting method for steady flow around ships. In these water-air flows, the influence of air is usually negligible due to the large difference in density. Contrary to surface capturing methods which are typically multiphase techniques (such as the volume-of-fluid method), fitting methods usually consider only the water phase. The latter approach requires appropriate FS boundary conditions. The dynamic boundary condition (DBC) used here assumes that the pressure is constant (atmospheric) at the FS and the shear stresses are zero. The kinematic boundary condition (KBC) states that the FS is impermeable.

  18. Bone surface enhancement in ultrasound images using a new Doppler-based acquisition/processing method

    Science.gov (United States)

    Yang, Xu; Tang, Songyuan; Tasciotti, Ennio; Righetti, Raffaella

    2018-01-01

    Ultrasound (US) imaging has long been considered as a potential aid in orthopedic surgeries. US technologies are safe, portable and do not use radiations. This would make them a desirable tool for real-time assessment of fractures and to monitor fracture healing. However, image quality of US imaging methods in bone applications is limited by speckle, attenuation, shadow, multiple reflections and other imaging artifacts. While bone surfaces typically appear in US images as somewhat ‘brighter’ than soft tissue, they are often not easily distinguishable from the surrounding tissue. Therefore, US imaging methods aimed at segmenting bone surfaces need enhancement in image contrast prior to segmentation to improve the quality of the detected bone surface. In this paper, we present a novel acquisition/processing technique for bone surface enhancement in US images. Inspired by elastography and Doppler imaging methods, this technique takes advantage of the difference between the mechanical and acoustic properties of bones and those of soft tissues to make the bone surface more easily distinguishable in US images. The objective of this technique is to facilitate US-based bone segmentation methods and improve the accuracy of their outcomes. The newly proposed technique is tested both in in vitro and in vivo experiments. The results of these preliminary experiments suggest that the use of the proposed technique has the potential to significantly enhance the detectability of bone surfaces in noisy ultrasound images.

  19. Savage Vernacular: Performing Race, Memory, and Hip Hop in Filipino America

    OpenAIRE

    Villegas, Mark

    2015-01-01

    By observing and analyzing live performances, music, visual art, interviews, television shows, and online discourse, this dissertation traces the ways in which Filipino American hip hop performance remembers the racialized histories of the Filipino body. Through both quotidian and spectacular performances in hip hop, Filipino Americans have been contributing to crucial forms of knowledge that help unpack the terms of Filipino and American culture. Hip hop culture, I argue, operates as a produ...

  20. A method for finding the ridge between saddle points applied to rare event rate estimates

    DEFF Research Database (Denmark)

    Maronsson, Jon Bergmann; Jónsson, Hannes; Vegge, Tejs

    2012-01-01

    A method is presented for finding the ridge between first order saddle points on a multidimensional surface. For atomic scale systems, such saddle points on the energy surface correspond to atomic rearrangement mechanisms. Information about the ridge can be used to test the validity of the harmonic...... to the path. The method is applied to Al adatom diffusion on the Al(100) surface to find the ridge between 2-, 3- and 4-atom concerted displacements and hop mechanisms. A correction to the harmonic approximation of transition state theory was estimated by direct evaluation of the configuration integral along...

  1. A Multi-Hop Energy Neutral Clustering Algorithm for Maximizing Network Information Gathering in Energy Harvesting Wireless Sensor Networks.

    Science.gov (United States)

    Yang, Liu; Lu, Yinzhi; Zhong, Yuanchang; Wu, Xuegang; Yang, Simon X

    2015-12-26

    Energy resource limitation is a severe problem in traditional wireless sensor networks (WSNs) because it restricts the lifetime of network. Recently, the emergence of energy harvesting techniques has brought with them the expectation to overcome this problem. In particular, it is possible for a sensor node with energy harvesting abilities to work perpetually in an Energy Neutral state. In this paper, a Multi-hop Energy Neutral Clustering (MENC) algorithm is proposed to construct the optimal multi-hop clustering architecture in energy harvesting WSNs, with the goal of achieving perpetual network operation. All cluster heads (CHs) in the network act as routers to transmit data to base station (BS) cooperatively by a multi-hop communication method. In addition, by analyzing the energy consumption of intra- and inter-cluster data transmission, we give the energy neutrality constraints. Under these constraints, every sensor node can work in an energy neutral state, which in turn provides perpetual network operation. Furthermore, the minimum network data transmission cycle is mathematically derived using convex optimization techniques while the network information gathering is maximal. Simulation results show that our protocol can achieve perpetual network operation, so that the consistent data delivery is guaranteed. In addition, substantial improvements on the performance of network throughput are also achieved as compared to the famous traditional clustering protocol LEACH and recent energy harvesting aware clustering protocols.

  2. An Improved Local Gradient Method for Sea Surface Wind Direction Retrieval from SAR Imagery

    Directory of Open Access Journals (Sweden)

    Lizhang Zhou

    2017-06-01

    Full Text Available Sea surface wind affects the fluxes of energy, mass and momentum between the atmosphere and ocean, and therefore regional and global weather and climate. With various satellite microwave sensors, sea surface wind can be measured with large spatial coverage in almost all-weather conditions, day or night. Like any other remote sensing measurements, sea surface wind measurement is also indirect. Therefore, it is important to develop appropriate wind speed and direction retrieval models for different types of microwave instruments. In this paper, a new sea surface wind direction retrieval method from synthetic aperture radar (SAR imagery is developed. In the method, local gradients are computed in frequency domain by combining the operation of smoothing and computing local gradients in one step to simplify the process and avoid the difference approximation. This improved local gradients (ILG method is compared with the traditional two-dimensional fast Fourier transform (2D FFT method and local gradients (LG method, using interpolating wind directions from the European Centre for Medium-Range Weather Forecast (ECMWF reanalysis data and the Cross-Calibrated Multi-Platform (CCMP wind vector product. The sensitivities to the salt-and-pepper noise, the additive noise and the multiplicative noise are analyzed. The ILG method shows a better performance of retrieval wind directions than the other two methods.

  3. Evaluating polymer degradation with complex mixtures using a simplified surface area method.

    Science.gov (United States)

    Steele, Kandace M; Pelham, Todd; Phalen, Robert N

    2017-09-01

    Chemical-resistant gloves, designed to protect workers from chemical hazards, are made from a variety of polymer materials such as plastic, rubber, and synthetic rubber. One material does not provide protection against all chemicals, thus proper polymer selection is critical. Standardized testing, such as chemical degradation tests, are used to aid in the selection process. The current methods of degradation ratings based on changes in weight or tensile properties can be expensive and data often do not exist for complex chemical mixtures. There are hundreds of thousands of chemical products on the market that do not have chemical resistance data for polymer selection. The method described in this study provides an inexpensive alternative to gravimetric analysis. This method uses surface area change to evaluate degradation of a polymer material. Degradation tests for 5 polymer types against 50 complex mixtures were conducted using both gravimetric and surface area methods. The percent change data were compared between the two methods. The resulting regression line was y = 0.48x + 0.019, in units of percent, and the Pearson correlation coefficient was r = 0.9537 (p ≤ 0.05), which indicated a strong correlation between percent weight change and percent surface area change. On average, the percent change for surface area was about half that of the weight change. Using this information, an equivalent rating system was developed for determining the chemical degradation of polymer gloves using surface area.

  4. Standard Test Method for Measuring Heat Flux Using Surface-Mounted One-Dimensional Flat Gages

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This test method describes the measurement of the net heat flux normal to a surface using flat gages mounted onto the surface. Conduction heat flux is not the focus of this standard. Conduction applications related to insulation materials are covered by Test Method C 518 and Practices C 1041 and C 1046. The sensors covered by this test method all use a measurement of the temperature difference between two parallel planes normal to the surface to determine the heat that is exchanged to or from the surface in keeping with Fourier’s Law. The gages operate by the same principles for heat transfer in either direction. 1.2 This test method is quite broad in its field of application, size and construction. Different sensor types are described in detail in later sections as examples of the general method for measuring heat flux from the temperature gradient normal to a surface (1). Applications include both radiation and convection heat transfer. The gages have broad application from aerospace to biomedical en...

  5. Method using laser irradiation for the production of atomically clean crystalline silicon and germanium surfaces

    Science.gov (United States)

    Ownby, Gary W.; White, Clark W.; Zehner, David M.

    1981-01-01

    This invention relates to a new method for removing surface impurities from crystalline silicon or germanium articles, such as off-the-shelf p- or n-type wafers to be doped for use as junction devices. The principal contaminants on such wafers are oxygen and carbon. The new method comprises laser-irradiating the contaminated surface in a non-reactive atmosphere, using one or more of Q-switched laser pulses whose parameters are selected to effect melting of the surface without substantial vaporization thereof. In a typical application, a plurality of pulses is used to convert a surface region of an off-the-shelf silicon wafer to an automatically clean region. This can be accomplished in a system at a pressure below 10.sup.-8 Torr, using Q-switched ruby-laser pulses having an energy density in the range of from about 60 to 190 MW/cm.sup.2.

  6. The impact of accelerometer mounting methods on the level of vibrations recorded at ground surface

    Directory of Open Access Journals (Sweden)

    Krzysztof Czech

    2014-08-01

    Full Text Available The paper presents the results of field research based on the measurements of accelerations recorded at ground surface. The source of the vibration characterized by high repetition rate of pulse parameters was light falling weight deflectometer ZFG-01. Measurements of vibrations have been carried out using top quality high-precision measuring system produced by Brüel&Kiær. Accelerometers were mounted on a sandy soil surface at the measuring points located radially at 5-m and 10-m distances from the source of vibration. The paper analyses the impact that the method of mounting accelerometers on the ground has on the level of the recorded values of accelerations of vibrations. It has been shown that the method of attaching the sensor to the surface of the ground is crucial for the credibility of the performed measurements.[b]Keywords[/b]: geotechnics, surface vibrations, ground, vibration measurement

  7. Construction of super - hydrophobic copper alloy surface by one - step mixed solution immersion method

    Science.gov (United States)

    Gu, Qiang; Chen, Ying; Chen, Dong; Zhang, Zeting

    2018-01-01

    This paper presents a method for preparing a super hydrophobic surface with a fast, simple, low-cost, one-step reaction by immersing copper alloy in an ethanol solution containing silver nitrate and myristic acid. The effects of reaction time, reaction temperature, reactant concentration and reaction time on the wettability of the material were studied. The surface wettability, appearance, chemical composition, durability and chemical stability of the prepared samples was measured by water contact angle (CA), scanning electron microscopy (SEM), energy dispersive spectrometer (EDS), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FTIR). The results show that when the reaction time is only 10min, the surface WCA of the prepared material can reach 154.9. This study provides an effective method for the rapid preparation of stable super hydrophobic surfaces.

  8. Super-hydrophobic surfaces from a simple coating method: a bionic nanoengineering approach

    International Nuclear Information System (INIS)

    Liu Yuyang; Chen Xianqiong; Xin, J H

    2006-01-01

    Inspired by the self-cleaning behaviour of lotus leaves in nature, we developed a simple coating method that can facilitate the bionic creation of super-hydrophobic surfaces on various substrates, thus providing a feasible way of fabricating super-hydrophobic surfaces for civil and industrial applications. Micro-nanoscale binary structured composite particles of silica/fluoropolymer were prepared using an emulsion-mediated sol-gel process, and then these composite particles were applied to various substrates to mimic the surface microstructures of lotus leaves. Super-hydrophobic surfaces with a water contact angle larger than 150 deg. are obtained, and these super-hydrophobic surfaces are expected to have potential applications for rusting-resistant, anti-fog and self-cleaning treatments

  9. Fuzzy surfaces in GIS and geographical analysis theory, analytical methods, algorithms and applications

    CERN Document Server

    Lodwick, Weldon

    2007-01-01

    Surfaces are a central to geographical analysis. Their generation and manipulation are a key component of geographical information systems (GISs). However, geographical surface data is often not precise. When surfaces are used to model geographical entities, the data inherently contains uncertainty in terms of both position and attribute. Fuzzy Surface in GIS and Geographical Analysis sets out a process to identify the uncertainty in geographic entities. It describes how to successfully obtain, model, analyze, and display data, as well as interpret results within the context of GIS. Focusing on uncertainty that arises from transitional boundaries, the book limits its study to three types of uncertainties: intervals, fuzzy sets, and possibility distributions. The book explains that uncertainty in geographical data typically stems from these three and it is only natural to incorporate them into the analysis and display of surface data. The book defines the mathematics associated with each method for analysis,...

  10. Analysis of WEDM Process Parameters on Surface Roughness and Kerf using Taguchi Method

    Directory of Open Access Journals (Sweden)

    Asfana Banu

    2017-12-01

    Full Text Available In obtaining the best quality of engineering parts, the quality of machined surface plays an essential role. The fatigue strength, wear resistance, and corrosion of workpiece are some of the aspects of the qualities that can be improved. This paper investigates the effect of wire electrical discharge machining (WEDM process parameters on surface roughness and kerf on stainless steel using distilled water as dielectric fluid and brass wire as tool electrode. The selected process parameters are voltage open, wire speed, wire tension, voltage gap, and off time. Empirical models using Taguchi method were developed for the estimation of surface roughness and kerf. The analysis revealed that off time has major influence on surface roughness and kerf. The optimum machining parameters for minimum surface roughness and kerf were found to be 10 V open voltage, 2.84 µs off time, 12 m/min wire speed, 6.3 N wire tension, and 54.91 V voltage gap.

  11. Animal galloping and human hopping: an energetics and biomechanics laboratory exercise.

    Science.gov (United States)

    Lindstedt, Stan L; Mineo, Patrick M; Schaeffer, Paul J

    2013-12-01

    This laboratory exercise demonstrates fundamental principles of mammalian locomotion. It provides opportunities to interrogate aspects of locomotion from biomechanics to energetics to body size scaling. It has the added benefit of having results with robust signal to noise so that students will have success even if not "meticulous" in attention to detail. First, using respirometry, students measure the energetic cost of hopping at a "preferred" hop frequency. This is followed by hopping at an imposed frequency half of the preferred. By measuring the O2 uptake and work done with each hop, students calculate mechanical efficiency. Lessons learned from this laboratory include 1) that the metabolic cost per hop at half of the preferred frequency is nearly double the cost at the preferred frequency; 2) that when a person is forced to hop at half of their preferred frequency, the mechanical efficiency is nearly that predicted for muscle but is much higher at the preferred frequency; 3) that the preferred hop frequency is strongly body size dependent; and 4) that the hop frequency of a human is nearly identical to the galloping frequency predicted for a quadruped of our size. Together, these exercises demonstrate that humans store and recover elastic recoil potential energy when hopping but that energetic savings are highly frequency dependent. This stride frequency is dependent on body size such that frequency is likely chosen to maximize this function. Finally, by requiring students to make quantitative solutions using appropriate units and dimensions of the physical variables, these exercises sharpen analytic and quantitative skills.

  12. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    International Nuclear Information System (INIS)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-01-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

  13. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    Science.gov (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2017-07-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  14. Decoherence and mode hopping in a magnetic tunnel junction based spin torque oscillator.

    Science.gov (United States)

    Muduli, P K; Heinonen, O G; Akerman, Johan

    2012-05-18

    We discuss the coherence of magnetic oscillations in a magnetic tunnel junction based spin torque oscillator as a function of the external field angle. Time-frequency analysis shows mode hopping between distinct oscillator modes, which arises from linear and nonlinear couplings in the Landau-Lifshitz-Gilbert equation, analogous to mode hopping observed in semiconductor ring lasers. These couplings and, therefore, mode hopping are minimized near the current threshold for the antiparallel alignment of free-layer with reference layer magnetization. Away from the antiparallel alignment, mode hopping limits oscillator coherence.

  15. Hip-hop as a resource for understanding the urban context

    Science.gov (United States)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  16. The politics of the cipher: hip-hop, antiphony, and multiculturalism

    OpenAIRE

    Ganesh, B.

    2017-01-01

    This project explores the incipient forms of multiculture present in the musical publics assembled by hip-hop music and culture based on ethnography of a university student group, S4HH (Students for Hip-hop). I position the cipher (a circle of people rapping together) as the diagram of the ethics and politics of hip-hop listening. The primary aesthetic feature of the cipher is antiphony or call-and-response musicality. However, affect in hip-hop musical publics goes beyond aesthetics; it cata...

  17. Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

    Science.gov (United States)

    Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

    2015-08-01

    Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

  18. Coupling characteristics of dielectric-loaded surface plasmon polariton waveguides: a simple method of analysis.

    Science.gov (United States)

    Srivastava, Triranjita; Kumar, Arun

    2009-11-01

    A simple method to obtain the coupling characteristics of a directional coupler consisting of two dielectric-loaded surface plasmon polariton waveguides is reported. The method is found to give accurate results in comparison with the widely used effective index method. Theoretical results are also found to match excellently with recently reported measurements on coupling lengths in such waveguides [Opt. Lett.34, 310 (2009)OPLEDP0146-959210.1364/OL.34.000310].

  19. Measurement of the body surface temperature by the method of laser photothermal radiometry

    International Nuclear Information System (INIS)

    Skvortsov, L A; Kirillov, V M

    2003-01-01

    The specific features of contactless measurements of the body surface temperature by the method of repetitively pulsed laser photothermal radiometry are considered and the requirements to the parameters of the laser and measurement scheme are formulated. The sensitivity of the method is estimated. The advantages of laser photothermal radiometry over the conventional passive radiometric method are discussed. (laser applications and other topics in quantum electronics)

  20. A Numerical Method for Predicting Rayleigh Surface Wave Velocity in Anisotropic Crystals (Postprint)

    Science.gov (United States)

    2017-09-05

    crystal symmetries and directions of propagation, and the advantages and disadvantages are dis- cussed. An alternative method of finding the RSW velocity...efficient in calculating RSW velocity curves in all cases. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license ...http://creativecommons.org/ licenses /by-nc-nd/4.0/). 1. Introduction Surface acoustic waves (SAW) such as Rayleigh surface waves (RSW) are important in