WorldWideScience

Sample records for surface drift diffusion

  1. Drift-Diffusion Equation

    Directory of Open Access Journals (Sweden)

    K. Banoo

    1998-01-01

    equation in the discrete momentum space. This is shown to be similar to the conventional drift-diffusion equation except that it is a more rigorous solution to the Boltzmann equation because the current and carrier densities are resolved into M×1 vectors, where M is the number of modes in the discrete momentum space. The mobility and diffusion coefficient become M×M matrices which connect the M momentum space modes. This approach is demonstrated by simulating electron transport in bulk silicon.

  2. Role of drifts in diffusive shock acceleration

    International Nuclear Information System (INIS)

    Decker, R.B.

    1988-01-01

    The role played by shock-associated drifts during the diffusive acceleration of charged particles at collisionless MHD shocks is evaluated. In the rest frame of the shock, the total energy gained by a particle is shown to result from two coupled acceleration mechanisms, the usual first-order Fermi mechanism and the drift mechanism. When averaged over a distribution of particles, the ratio of the drift-associated energy gain to the total energy is found to be independent of the total energy at a given theta1 (the angle between the shock normal and the unperturbed upstream magnetic field) in agreement with theoretical predictions. No evidence is found for drift-associated deceleration, suggesting that drifts always augment acceleration. 35 references

  3. Spin drift and spin diffusion currents in semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Idrish Miah, M [Nanoscale Science and Technology Centre and School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia)], E-mail: m.miah@griffith.edu.au

    2008-09-15

    On the basis of a spin drift-diffusion model, we show how the spin current is composed and find that spin drift and spin diffusion contribute additively to the spin current, where the spin diffusion current decreases with electric field while the spin drift current increases, demonstrating that the extension of the spin diffusion length by a strong field does not result in a significant increase in spin current in semiconductors owing to the competing effect of the electric field on diffusion. We also find that there is a spin drift-diffusion crossover field for a process in which the drift and diffusion contribute equally to the spin current, which suggests a possible method of identifying whether the process for a given electric field is in the spin drift or spin diffusion regime. Spin drift-diffusion crossover fields for GaAs are calculated and are found to be quite small. We derive the relations between intrinsic spin diffusion length and the spin drift-diffusion crossover field of a semiconductor for different electron statistical regimes. The findings resulting from this investigation might be important for semiconductor spintronics.

  4. Spin drift and spin diffusion currents in semiconductors

    Directory of Open Access Journals (Sweden)

    M Idrish Miah

    2008-01-01

    Full Text Available On the basis of a spin drift-diffusion model, we show how the spin current is composed and find that spin drift and spin diffusion contribute additively to the spin current, where the spin diffusion current decreases with electric field while the spin drift current increases, demonstrating that the extension of the spin diffusion length by a strong field does not result in a significant increase in spin current in semiconductors owing to the competing effect of the electric field on diffusion. We also find that there is a spin drift-diffusion crossover field for a process in which the drift and diffusion contribute equally to the spin current, which suggests a possible method of identifying whether the process for a given electric field is in the spin drift or spin diffusion regime. Spin drift-diffusion crossover fields for GaAs are calculated and are found to be quite small. We derive the relations between intrinsic spin diffusion length and the spin drift-diffusion crossover field of a semiconductor for different electron statistical regimes. The findings resulting from this investigation might be important for semiconductor spintronics.

  5. Spin drift and spin diffusion currents in semiconductors

    International Nuclear Information System (INIS)

    Idrish Miah, M

    2008-01-01

    On the basis of a spin drift-diffusion model, we show how the spin current is composed and find that spin drift and spin diffusion contribute additively to the spin current, where the spin diffusion current decreases with electric field while the spin drift current increases, demonstrating that the extension of the spin diffusion length by a strong field does not result in a significant increase in spin current in semiconductors owing to the competing effect of the electric field on diffusion. We also find that there is a spin drift-diffusion crossover field for a process in which the drift and diffusion contribute equally to the spin current, which suggests a possible method of identifying whether the process for a given electric field is in the spin drift or spin diffusion regime. Spin drift-diffusion crossover fields for GaAs are calculated and are found to be quite small. We derive the relations between intrinsic spin diffusion length and the spin drift-diffusion crossover field of a semiconductor for different electron statistical regimes. The findings resulting from this investigation might be important for semiconductor spintronics.

  6. The importance of correcting for signal drift in diffusion MRI

    OpenAIRE

    Vos, Sjoerd B; Tax, Chantal M W; Luijten, Peter R; Ourselin, Sebastien; Leemans, Alexander; Froeling, Martijn

    2017-01-01

    PURPOSE: To investigate previously unreported effects of signal drift as a result of temporal scanner instability on diffusion MRI data analysis and to propose a method to correct this signal drift. METHODS: We investigated the signal magnitude of non-diffusion-weighted EPI volumes in a series of diffusion-weighted imaging experiments to determine whether signal magnitude changes over time. Different scan protocols and scanners from multiple vendors were used to verify this on phantom data, a...

  7. Cooling tower drift studies at the Paducah, Kentucky Gaseous Diffusion Plant. [Transport of drift-derived chromium in terrestrial ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, F.G.; Hanna, S.R.; Parr, P.D.

    1979-01-01

    The transfer and fate of chromium from cooling tower drift to terrestrial ecosystems were quantified at the Department of Energy's uranium enrichment facility at Paducah, Kentucky. Chromium concentrations in plant materials (fescue grass) decreased with increasing distance from the cooing tower, ranging from 251 +- 19 ppM at 15 meters to 0.52 +- 0.07 ppM at 1500 meters. The site of drift contamination, size characteristics, and elemental content of drift particles were determined using a scanning electron microscope with energy dispersive x-ray analysis capabilities. Results indicate that elemental content in drift water (mineral residue) may not be equivalent to the content in the recirculating cooling water of the tower. This hypothesis is contrary to basic assumptions in calculating drift emissions. A laboratory study simulating throughfall from 1 to 6 inches of rain suggested that there are more exchange sites associated with litter than live foliage. Leachate from each one inch throughfall simulant removed 3% of the drift mass from litter compared to 7 to 9% from live foliage. Results suggest that differences in retention are related to chemical properties of the drift rather than physical lodging of the particle residue. To determine the potential for movement of drift-derived chromium to surface streams, soil--water samplers (wells) were placed along a distance gradient to Little Bayou Creek. Samples from two depths following rainstorms revealed the absence of vertical or horizontal movement with maximum concentrations of 0.13 ppb at 50 meters from the tower. Preliminary model estimates of drift deposition are compared to depositionmeasurements. Isopleths of the predicted deposition are useful to identify areas of maximum drift transport in the environs of the gaseous diffusion plant.

  8. Drift and diffusion of electrons in gases: A compilation

    International Nuclear Information System (INIS)

    Peisert, A.; Sauli, F.

    1984-01-01

    This report is organized in two sections. The first contains an elementary introduction to the theory of electron transport in gases under the action of electric and magnetic fields, and gives indications on the use of two programs to compute drift and diffusion properties of electrons in gas mixtures. The second section contains an extensive collection of experimental and computed data on electron drift velocity and diffusion, as a function of electric field; an index allows one to find the data referring to any given gas mixture. (orig.)

  9. Cooling tower drift studies at the Paducah, Kentucky Gaseous Diffusion Plant

    International Nuclear Information System (INIS)

    Taylor, F.G.; Hanna, S.R.; Parr, P.D.

    1979-01-01

    The transfer and fate of chromium from cooling tower drift to terrestrial ecosystems were quantified at the Department of Energy's uranium enrichment facility at Paducah, Kentucky. Chromium concentrations in plant materials (fescue grass) decreased with increasing distance from the cooing tower, ranging from 251 +- 19 ppM at 15 meters to 0.52 +- 0.07 ppM at 1500 meters. The site of drift contamination, size characteristics, and elemental content of drift particles were determined using a scanning electron microscope with energy dispersive x-ray analysis capabilities. Results indicate that elemental content in drift water (mineral residue) may not be equivalent to the content in the recirculating cooling water of the tower. This hypothesis is contrary to basic assumptions in calculating drift emissions. A laboratory study simulating throughfall from 1 to 6 inches of rain suggested that there are more exchange sites associated with litter than live foliage. Leachate from each one inch throughfall simulant removed 3% of the drift mass from litter compared to 7 to 9% from live foliage. Results suggest that differences in retention are related to chemical properties of the drift rather than physical lodging of the particle residue. To determine the potential for movement of drift-derived chromium to surface streams, soil--water samplers (wells) were placed along a distance gradient to Little Bayou Creek. Samples from two depths following rainstorms revealed the absence of vertical or horizontal movement with maximum concentrations of 0.13 ppb at 50 meters from the tower. Preliminary model estimates of drift deposition are compared to depositionmeasurements. Isopleths of the predicted deposition are useful to identify areas of maximum drift transport in the environs of the gaseous diffusion plant

  10. Plasma drift towards a plane equipotential surface

    International Nuclear Information System (INIS)

    Carlqvist, P.

    1984-03-01

    Recently Alfven has qualitatively described how a collisionless plasma drifts in crossed electric and magnetic fields towards an infinite conducting plate of constant potential. In the present note we quantitatively study three models which are closely related to Alfven's model. It is found that when the plasma comes sufficiently close to a plane equipotential surface (conducting plate) it is deflected approximately along the surface. The deflection is not caused by pressure effects but rather by the electric and magnetic fields. Small fluxes of ions and electrons also cross the plane equipotential surface. These fluxes account for an electric current in the plasma which induces a magnetic field in the same direction as the total magnetic field assumed to be homogeneous. It is shown that if the Alfven number, M(sub)A, is much smaller than unity in the volume considered the magnetic field induced by plasma currents is small compared to the total magnetic field. However, if M(sub)A is of the order of unity or larger the total magnetic field is to a substantial degree generated by plasma currents. (Author)

  11. Incorporating photon recycling into the analytical drift-diffusion model of high efficiency solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Lumb, Matthew P. [The George Washington University, 2121 I Street NW, Washington, DC 20037 (United States); Naval Research Laboratory, Washington, DC 20375 (United States); Steiner, Myles A.; Geisz, John F. [National Renewable Energy Laboratory, Golden, Colorado 80401 (United States); Walters, Robert J. [Naval Research Laboratory, Washington, DC 20375 (United States)

    2014-11-21

    The analytical drift-diffusion formalism is able to accurately simulate a wide range of solar cell architectures and was recently extended to include those with back surface reflectors. However, as solar cells approach the limits of material quality, photon recycling effects become increasingly important in predicting the behavior of these cells. In particular, the minority carrier diffusion length is significantly affected by the photon recycling, with consequences for the solar cell performance. In this paper, we outline an approach to account for photon recycling in the analytical Hovel model and compare analytical model predictions to GaAs-based experimental devices operating close to the fundamental efficiency limit.

  12. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  13. Nonparametric estimates of drift and diffusion profiles via Fokker-Planck algebra.

    Science.gov (United States)

    Lund, Steven P; Hubbard, Joseph B; Halter, Michael

    2014-11-06

    Diffusion processes superimposed upon deterministic motion play a key role in understanding and controlling the transport of matter, energy, momentum, and even information in physics, chemistry, material science, biology, and communications technology. Given functions defining these random and deterministic components, the Fokker-Planck (FP) equation is often used to model these diffusive systems. Many methods exist for estimating the drift and diffusion profiles from one or more identifiable diffusive trajectories; however, when many identical entities diffuse simultaneously, it may not be possible to identify individual trajectories. Here we present a method capable of simultaneously providing nonparametric estimates for both drift and diffusion profiles from evolving density profiles, requiring only the validity of Langevin/FP dynamics. This algebraic FP manipulation provides a flexible and robust framework for estimating stationary drift and diffusion coefficient profiles, is not based on fluctuation theory or solved diffusion equations, and may facilitate predictions for many experimental systems. We illustrate this approach on experimental data obtained from a model lipid bilayer system exhibiting free diffusion and electric field induced drift. The wide range over which this approach provides accurate estimates for drift and diffusion profiles is demonstrated through simulation.

  14. Quantum-corrected drift-diffusion models for transport in semiconductor devices

    International Nuclear Information System (INIS)

    De Falco, Carlo; Gatti, Emilio; Lacaita, Andrea L.; Sacco, Riccardo

    2005-01-01

    In this paper, we propose a unified framework for Quantum-corrected drift-diffusion (QCDD) models in nanoscale semiconductor device simulation. QCDD models are presented as a suitable generalization of the classical drift-diffusion (DD) system, each particular model being identified by the constitutive relation for the quantum-correction to the electric potential. We examine two special, and relevant, examples of QCDD models; the first one is the modified DD model named Schroedinger-Poisson-drift-diffusion, and the second one is the quantum-drift-diffusion (QDD) model. For the decoupled solution of the two models, we introduce a functional iteration technique that extends the classical Gummel algorithm widely used in the iterative solution of the DD system. We discuss the finite element discretization of the various differential subsystems, with special emphasis on their stability properties, and illustrate the performance of the proposed algorithms and models on the numerical simulation of nanoscale devices in two spatial dimensions

  15. Estimating Outer Zone Radial Diffusion Coefficients from Drift Scale Fluctuations in Van Allen Particle Data

    Science.gov (United States)

    O'Brien, T. P., III; Claudepierre, S. G.

    2017-12-01

    During geomagnetic storms, the Earth's outer radiation belt experiences enhanced radial transport. This transport occurs via phase-dependent radial displacements of particles, either by impulsive events or drift resonant waves. Because transport is phase dependent, it produces drift phase bunching, which can be observed with in situ particle detectors. We provide bounds on the radial diffusion coefficients derived from this drift phase structure as seen by NASA's Van Allen Probes. We compare these bounds to published radial diffusion coefficient models, particularly those derived independently from electromagnetic field observations.

  16. Dimethylether: a low velocity, low diffusion drift chamber gas

    International Nuclear Information System (INIS)

    Villa, F.

    1983-01-01

    There are two main motivations to look for a low electron mobility gas: the first is that a low drift velocity relaxes the need to measure drift times with nanosecond (or even subnanosecond) precision; the second is that (in an ideal drift geometry), the capability of resolving two closely spaced tracks depends upon the ratio of electron mobility to ion mobility μ/sub e//μ/sub i/. Since μ/sub i/ is rather constant, the way to separate two tracks is to slow down the electrons. Many other properties are required besides low mobility and low drifting electron temperature: the gas should have a large (> 10 3 ) stable gain; it must be chemically stable and not oxic; it should not attack materials commonly used to fabricate drift chambers, etc. With these requirements in mind, we have tried a few promising (on paper) gases, either pure or in admixture with Argon. One of the gases examined, dimethylether [(CH 3 ) 2 )], has shown interesting characteristics

  17. Diffusion and drift of charges in semiconductor detectors

    International Nuclear Information System (INIS)

    Meidinger, N.

    1991-01-01

    For this analysis, a fully depleteable pn-CCD (a novel, energy and local resolution semiconductor using the drift chamber principle) has been tested for verification at different temperatures, photon energies, and drift times, including theoretical calculations. Experimental results are in good agreement with calculated data, and deviations (≤11%) have been understood to an extent that proposals can be made for improving the accuracy. Charge splitting has been found to be reduced in the case of reduced charge collecting areas, i.e. for example at lower temperatures, or with shorter drift times. This effect is also reduced in the case of larger charge collecting areas (pixels). With the given topology of the cell structure, the charge splitting can be much more strongly suppressed as compared to other X-ray CCD design types. (orig.) [de

  18. Diffusion and drift regimes of plasma ionization wave propagation in a microwave field

    International Nuclear Information System (INIS)

    Khodataev, K.V.; Gorelik, B.R.

    1997-01-01

    Investigation into diffusion and drift modes of a plasma ionization wave propagation in the microwave field are conducted within the framework of a one-dimensional model with regard to gas ionization by electron shock in an electrical field, adhesion, mobility and diffusion of electrons

  19. On diffusion processes with variable drift rates as models for decision making during learning

    International Nuclear Information System (INIS)

    Eckhoff, P; Holmes, P; Law, C; Connolly, P M; Gold, J I

    2008-01-01

    We investigate Ornstein-Uhlenbeck and diffusion processes with variable drift rates as models of evidence accumulation in a visual discrimination task. We derive power-law and exponential drift-rate models and characterize how parameters of these models affect the psychometric function describing performance accuracy as a function of stimulus strength and viewing time. We fit the models to psychophysical data from monkeys learning the task to identify parameters that best capture performance as it improves with training. The most informative parameter was the overall drift rate describing the signal-to-noise ratio of the sensory evidence used to form the decision, which increased steadily with training. In contrast, secondary parameters describing the time course of the drift during motion viewing did not exhibit steady trends. The results indicate that relatively simple versions of the diffusion model can fit behavior over the course of training, thereby giving a quantitative account of learning effects on the underlying decision process

  20. Cooling tower drift studies at the Paducah, Kentucky Gaseous Diffusion Plant

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, F. G.; Hanna, S. R.; Parr, P. D.

    1978-12-01

    The transfer and fate of chromium from cooling tower drift to terrestrial ecosystems were quantified with concentrations in plant materials (fescue grass) decreasing with increasing distance from the cooling tower. Results indicate that elemental content in drift water (mineral residue) may not be equivalent to the content in the recirculating cooling water of the tower. This hypothesis is contrary to basic assumptions in calculating drift emissions. Results suggest that differences in retention in litter and foliage are related to chemical properties of the drift rather than physical lodging of the particle residue. To determine the potential for movement of drift-derived chromium to surface streams, soil-water samplers (wells) were placed along a distance gradient to Little Bayou Creek. Preliminary model estimates of drift deposition are compared to deposition measurements.

  1. Chaotic diffusion across a magnetic island due to a single electrostatic drift wave

    International Nuclear Information System (INIS)

    Misguich, J.H.

    1990-05-01

    It is shown that the guiding center motion around a single chain of magnetic islands in a Tokamak can become chaotic in the presence of a single electrostatic drift wave. This process leads to radial diffusion across the islands without magnetic braiding. The chaotic diffusion appears to be selective in velocity space. Realistic values of the physical parameters are considered to deduce that this process can be effective in usual conditions: with the observed islands, and electrostatic field values corresponding to measured density fluctuations, this diffusion concerns ions with velocities higher than thermal, and almost all of the electron population. The consequences for radial diffusion are discussed

  2. Derivation and Numerical Approximation of the Quantum Drift Diffusion Model for Semiconductors

    International Nuclear Information System (INIS)

    Ohnmar Nwe

    2004-06-01

    This paper is concerned with the study of the quantum drift diffusion equation for semiconductors. Derivation of the mathematical model, which describes the electeon flow through a semiconductor device due to the application of a voltage, is considered and studied in numerical point of view by using some methods

  3. Numerical method for a 2D drift diffusion model arising in strained n ...

    Indian Academy of Sciences (India)

    Abstract. This paper reports the calculation of electron transport in metal oxide semiconductor field effects transistors (MOSFETs) with biaxially tensile strained silicon channel. The calculation is formulated based on two-dimensional drift diffusion model (DDM) including strain effects. The carrier mobility dependence on the ...

  4. Numerical method for a 2D drift diffusion model arising in strained n ...

    Indian Academy of Sciences (India)

    This paper reports the calculation of electron transport in metal oxide semiconductor field effects transistors (MOSFETs) with biaxially tensile strained silicon channel. The calculation is formulated based on two-dimensional drift diffusion model (DDM) including strain effects. The carrier mobility dependence on the lateral and ...

  5. The Influence of Feedback on Task-Switching Performance: A Drift Diffusion Modeling Account

    Directory of Open Access Journals (Sweden)

    Russell Cohen Hoffing

    2018-02-01

    Full Text Available Task-switching is an important cognitive skill that facilitates our ability to choose appropriate behavior in a varied and changing environment. Task-switching training studies have sought to improve this ability by practicing switching between multiple tasks. However, an efficacious training paradigm has been difficult to develop in part due to findings that small differences in task parameters influence switching behavior in a non-trivial manner. Here, for the first time we employ the Drift Diffusion Model (DDM to understand the influence of feedback on task-switching and investigate how drift diffusion parameters change over the course of task switch training. We trained 316 participants on a simple task where they alternated sorting stimuli by color or by shape. Feedback differed in six different ways between subjects groups, ranging from No Feedback (NFB to a variety of manipulations addressing trial-wise vs. Block Feedback (BFB, rewards vs. punishments, payment bonuses and different payouts depending upon the trial type (switch/non-switch. While overall performance was found to be affected by feedback, no effect of feedback was found on task-switching learning. Drift Diffusion Modeling revealed that the reductions in reaction time (RT switch cost over the course of training were driven by a continually decreasing decision boundary. Furthermore, feedback effects on RT switch cost were also driven by differences in decision boundary, but not in drift rate. These results reveal that participants systematically modified their task-switching performance without yielding an overall gain in performance.

  6. The Influence of Feedback on Task-Switching Performance: A Drift Diffusion Modeling Account.

    Science.gov (United States)

    Cohen Hoffing, Russell; Karvelis, Povilas; Rupprechter, Samuel; Seriès, Peggy; Seitz, Aaron R

    2018-01-01

    Task-switching is an important cognitive skill that facilitates our ability to choose appropriate behavior in a varied and changing environment. Task-switching training studies have sought to improve this ability by practicing switching between multiple tasks. However, an efficacious training paradigm has been difficult to develop in part due to findings that small differences in task parameters influence switching behavior in a non-trivial manner. Here, for the first time we employ the Drift Diffusion Model (DDM) to understand the influence of feedback on task-switching and investigate how drift diffusion parameters change over the course of task switch training. We trained 316 participants on a simple task where they alternated sorting stimuli by color or by shape. Feedback differed in six different ways between subjects groups, ranging from No Feedback (NFB) to a variety of manipulations addressing trial-wise vs. Block Feedback (BFB), rewards vs. punishments, payment bonuses and different payouts depending upon the trial type (switch/non-switch). While overall performance was found to be affected by feedback, no effect of feedback was found on task-switching learning. Drift Diffusion Modeling revealed that the reductions in reaction time (RT) switch cost over the course of training were driven by a continually decreasing decision boundary. Furthermore, feedback effects on RT switch cost were also driven by differences in decision boundary, but not in drift rate. These results reveal that participants systematically modified their task-switching performance without yielding an overall gain in performance.

  7. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  8. Drift tube measurements of mobilities and longitudinal diffusion coefficients of ions in gases

    International Nuclear Information System (INIS)

    Chelf, R.D.

    1982-01-01

    The zero-field mobilities of Br - and NH 4+ in O 2 were determined as a function of gas temperature in a high pressure drift tube mass spectrometer. The mobilities and longitudinal diffusion coefficients of the ion-gas combinations Br - in Ne and Kr, Li + in Xe, and Tl/ + in Kr and Xe were determined as a function of E/N, where E is the electric field strength and N is the gas number density in a low pressure drift tube mass spectrometer. The measured longitudinal diffusion coefficients were used for a test and comparison of the generalized Einstein relations of Viehland-Mason and Waldman-Mason theories. The measured mobilities of Br - in Kr and Tl/ + in Kr were used in an iterative-inversion scheme from which the ion-neutral interaction potentials were determined

  9. The first-passage time distribution for the diffusion model with variable drift

    DEFF Research Database (Denmark)

    Blurton, Steven Paul; Kesselmeier, Miriam; Gondan, Matthias

    2017-01-01

    across trials. This extra flexibility allows accounting for slow errors that often occur in response time experiments. So far, the predicted response time distributions were obtained by numerical evaluation as analytical solutions were not available. Here, we present an analytical expression...... for the cumulative first-passage time distribution in the diffusion model with normally distributed trial-to-trial variability in the drift. The solution is obtained with predefined precision, and its evaluation turns out to be extremely fast.......The Ratcliff diffusion model is now arguably the most widely applied model for response time data. Its major advantage is its description of both response times and the probabilities for correct as well as incorrect responses. The model assumes a Wiener process with drift between two constant...

  10. The Attentional Drift Diffusion Model of Simple Perceptual Decision-Making

    OpenAIRE

    Gabriela Tavares; Pietro Perona; Antonio Rangel; Antonio Rangel

    2017-01-01

    Perceptual decisions requiring the comparison of spatially distributed stimuli that are fixated sequentially might be influenced by fluctuations in visual attention. We used two psychophysical tasks with human subjects to investigate the extent to which visual attention influences simple perceptual choices, and to test the extent to which the attentional Drift Diffusion Model (aDDM) provides a good computational description of how attention affects the underlying decision processes. We find e...

  11. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  12. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  13. Measurements of electron drift and diffusion properties in a large cylindrical drift chamber (TPC) with parallel electric and magnetic fields

    International Nuclear Information System (INIS)

    Richstein, J.

    1986-01-01

    This work describes measurements on the drift of electrons in gases, using the TPC90, the prototype of the ALEPH Time Projection Chamber. Tracks which were created by UV-Laser ionization have been drifted over distances of up to 1.3 m in parallel electric and magnetic fields. Electron drift properties have been systematically measured as a function of these, in several gas mixtures. (orig./HSI)

  14. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  15. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  16. HDDM: Hierarchical Bayesian estimation of the Drift-Diffusion Model in Python.

    Science.gov (United States)

    Wiecki, Thomas V; Sofer, Imri; Frank, Michael J

    2013-01-01

    The diffusion model is a commonly used tool to infer latent psychological processes underlying decision-making, and to link them to neural mechanisms based on response times. Although efficient open source software has been made available to quantitatively fit the model to data, current estimation methods require an abundance of response time measurements to recover meaningful parameters, and only provide point estimates of each parameter. In contrast, hierarchical Bayesian parameter estimation methods are useful for enhancing statistical power, allowing for simultaneous estimation of individual subject parameters and the group distribution that they are drawn from, while also providing measures of uncertainty in these parameters in the posterior distribution. Here, we present a novel Python-based toolbox called HDDM (hierarchical drift diffusion model), which allows fast and flexible estimation of the the drift-diffusion model and the related linear ballistic accumulator model. HDDM requires fewer data per subject/condition than non-hierarchical methods, allows for full Bayesian data analysis, and can handle outliers in the data. Finally, HDDM supports the estimation of how trial-by-trial measurements (e.g., fMRI) influence decision-making parameters. This paper will first describe the theoretical background of the drift diffusion model and Bayesian inference. We then illustrate usage of the toolbox on a real-world data set from our lab. Finally, parameter recovery studies show that HDDM beats alternative fitting methods like the χ(2)-quantile method as well as maximum likelihood estimation. The software and documentation can be downloaded at: http://ski.clps.brown.edu/hddm_docs/

  17. HDDM: Hierarchical Bayesian estimation of the Drift-Diffusion Model in Python

    Directory of Open Access Journals (Sweden)

    Thomas V Wiecki

    2013-08-01

    Full Text Available The diffusion model is a commonly used tool to infer latent psychological processes underlying decision making, and to link them to neural mechanisms based on reaction times. Although efficient open source software has been made available to quantitatively fit the model to data, current estimation methods require an abundance of reaction time measurements to recover meaningful parameters, and only provide point estimates of each parameter. In contrast, hierarchical Bayesian parameter estimation methods are useful for enhancing statistical power, allowing for simultaneous estimation of individual subject parameters and the group distribution that they are drawn from, while also providing measures of uncertainty in these parameters in the posterior distribution. Here, we present a novel Python-based toolbox called HDDM (hierarchical drift diffusion model, which allows fast and flexible estimation of the the drift-diffusion model and the related linear ballistic accumulator model. HDDM requires fewer data per subject / condition than non-hierarchical method, allows for full Bayesian data analysis, and can handle outliers in the data. Finally, HDDM supports the estimation of how trial-by-trial measurements (e.g. fMRI influence decision making parameters. This paper will first describe the theoretical background of drift-diffusion model and Bayesian inference. We then illustrate usage of the toolbox on a real-world data set from our lab. Finally, parameter recovery studies show that HDDM beats alternative fitting methods like the chi-quantile method as well as maximum likelihood estimation. The software and documentation can be downloaded at: http://ski.clps.brown.edu/hddm_docs

  18. Electromigration-Induced Surface Drift and Slit Propagation in Polycrystalline Interconnects: Insights from Phase-Field Simulations

    Science.gov (United States)

    Mukherjee, Arnab; Ankit, Kumar; Selzer, Michael; Nestler, Britta

    2018-04-01

    We employ the phase-field method to assess electromigration (EM) damage in wide polycrystalline interconnects due to grain-boundary grooving. An interplay of surface and grain-boundary diffusion is shown to drastically influence the mode of progressive EM damage. Rapid atomic transport along the surface leads to shape-preserving surface drift reminiscent of Blech drift-velocity experiments. On the other hand, a comparatively faster grain-boundary transport localizes the damage, resulting in the proliferation of intergranular slits with a shape-preserving tip. At steady state, the two regimes exhibit exponents of 1 and 3 /2 , respectively, in Black's law. While surface drift obeys an inverse scaling with grain size, slits exhibit a direct relationship at small sizes, with the dependence becoming weaker at larger ones. Furthermore, we explain the influence of curvature- or EM-mediated healing fluxes running along the surface on groove replenishment. Insights derived from phase-field simulations of EM in bicrystals are extended to investigate the multiphysics of mixed-mode damage of a polycrystalline interconnect line that is characterized by a drift of small grain surfaces, slit propagation, and coarsening. The triple and quadruple junctions are identified as prominent sites of failure.

  19. Loss Aversion Reflects Information Accumulation, Not Bias: A Drift-Diffusion Model Study.

    Science.gov (United States)

    Clay, Summer N; Clithero, John A; Harris, Alison M; Reed, Catherine L

    2017-01-01

    Defined as increased sensitivity to losses, loss aversion is often conceptualized as a cognitive bias. However, findings that loss aversion has an attentional or emotional regulation component suggest that it may instead reflect differences in information processing. To distinguish these alternatives, we applied the drift-diffusion model (DDM) to choice and response time (RT) data in a card gambling task with unknown risk distributions. Loss aversion was measured separately for each participant. Dividing the participants into terciles based on loss aversion estimates, we found that the most loss-averse group showed a significantly lower drift rate than the other two groups, indicating overall slower uptake of information. In contrast, neither the starting bias nor the threshold separation (barrier) varied by group, suggesting that decision thresholds are not affected by loss aversion. These results shed new light on the cognitive mechanisms underlying loss aversion, consistent with an account based on information accumulation.

  20. Loss Aversion Reflects Information Accumulation, Not Bias: A Drift-Diffusion Model Study

    Directory of Open Access Journals (Sweden)

    Summer N. Clay

    2017-10-01

    Full Text Available Defined as increased sensitivity to losses, loss aversion is often conceptualized as a cognitive bias. However, findings that loss aversion has an attentional or emotional regulation component suggest that it may instead reflect differences in information processing. To distinguish these alternatives, we applied the drift-diffusion model (DDM to choice and response time (RT data in a card gambling task with unknown risk distributions. Loss aversion was measured separately for each participant. Dividing the participants into terciles based on loss aversion estimates, we found that the most loss-averse group showed a significantly lower drift rate than the other two groups, indicating overall slower uptake of information. In contrast, neither the starting bias nor the threshold separation (barrier varied by group, suggesting that decision thresholds are not affected by loss aversion. These results shed new light on the cognitive mechanisms underlying loss aversion, consistent with an account based on information accumulation.

  1. Origin of CH+ in diffuse molecular clouds. Warm H2 and ion-neutral drift

    Science.gov (United States)

    Valdivia, Valeska; Godard, Benjamin; Hennebelle, Patrick; Gerin, Maryvonne; Lesaffre, Pierre; Le Bourlot, Jacques

    2017-04-01

    Context. Molecular clouds are known to be magnetised and to display a turbulent and complex structure where warm and cold phases are interwoven. The turbulent motions within molecular clouds transport molecules, and the presence of magnetic fields induces a relative velocity between neutrals and ions known as the ion-neutral drift (vd). These effects all together can influence the chemical evolution of the clouds. Aims: This paper assesses the roles of two physical phenomena which have previously been invoked to boost the production of CH+ under realistic physical conditions: the presence of warm H2 and the increased formation rate due to the ion-neutral drift. Methods: We performed ideal magnetohydrodynamical (MHD) simulations that include the heating and cooling of the multiphase interstellar medium (ISM), and where we treat dynamically the formation of the H2 molecule. In a post-processing step we compute the abundances of species at chemical equilibrium using a solver that we developed. The solver uses the physical conditions of the gas as input parameters, and can also prescribe the H2 fraction if needed. We validate our approach by showing that the H2 molecule generally has a much longer chemical evolution timescale compared to the other species. Results: We show that CH+ is efficiently formed at the edge of clumps, in regions where the H2 fraction is low (0.3-30%) but nevertheless higher than its equilibrium value, and where the gas temperature is high (≳ 300 K). We show that warm and out of equilibrium H2 increases the integrated column densities of CH+ by one order of magnitude up to values still 3-10 times lower than those observed in the diffuse ISM. We balance the Lorentz force with the ion-neutral drag to estimate the ion-drift velocities from our ideal MHD simulations. We find that the ion-neutral drift velocity distribution peaks around 0.04 km s-1, and that high drift velocities are too rare to have a significant statistical impact on the

  2. Exploring the dynamics of balance data - movement variability in terms of drift and diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Gottschall, Julia [Institute of Physics, University of Oldenburg, D-26111 Oldenburg (Germany)], E-mail: julia.gottschall@uni-oldenburg.de; Peinke, Joachim [Institute of Physics, University of Oldenburg, D-26111 Oldenburg (Germany)], E-mail: peinke@uni-oldenburg.de; Lippens, Volker [Department of Human Movement, University of Hamburg, Moller Street 10, D-20148 Hamburg (Germany)], E-mail: vlippens@uni-hamburg.de; Nagel, Volker [Department of Human Movement, University of Hamburg, Moller Street 10, D-20148 Hamburg (Germany)

    2009-02-23

    We introduce a method to analyze postural control on a balance board by reconstructing the underlying dynamics in terms of a Langevin model. Drift and diffusion coefficients are directly estimated from the data and fitted by a suitable parametrization. The governing parameters are utilized to evaluate balance performance and the impact of supra-postural tasks on it. We show that the proposed method of analysis gives not only self-consistent results but also provides a plausible model for the reconstruction of balance dynamics.

  3. Exploring the dynamics of balance data - movement variability in terms of drift and diffusion

    International Nuclear Information System (INIS)

    Gottschall, Julia; Peinke, Joachim; Lippens, Volker; Nagel, Volker

    2009-01-01

    We introduce a method to analyze postural control on a balance board by reconstructing the underlying dynamics in terms of a Langevin model. Drift and diffusion coefficients are directly estimated from the data and fitted by a suitable parametrization. The governing parameters are utilized to evaluate balance performance and the impact of supra-postural tasks on it. We show that the proposed method of analysis gives not only self-consistent results but also provides a plausible model for the reconstruction of balance dynamics

  4. Leakage Current Degradation Due to Ion Drift and Diffusion in Tantalum and Niobium Oxide Capacitors

    Directory of Open Access Journals (Sweden)

    Kuparowitz Martin

    2017-06-01

    Full Text Available High temperature and high electric field applications in tantalum and niobium capacitors are limited by the mechanism of ion migration and field crystallization in a tantalum or niobium pentoxide insulating layer. The study of leakage current (DCL variation in time as a result of increasing temperature and electric field might provide information about the physical mechanism of degradation. The experiments were performed on tantalum and niobium oxide capacitors at temperatures of about 125°C and applied voltages ranging up to rated voltages of 35 V and 16 V for tantalum and niobium oxide capacitors, respectively. Homogeneous distribution of oxygen vacancies acting as positive ions within the pentoxide layer was assumed before the experiments. DCL vs. time characteristics at a fixed temperature have several phases. At the beginning of ageing the DCL increases exponentially with time. In this period ions in the insulating layer are being moved in the electric field by drift only. Due to that the concentration of ions near the cathode increases producing a positively charged region near the cathode. The electric field near the cathode increases and the potential barrier between the cathode and insulating layer decreases which results in increasing DCL. However, redistribution of positive ions in the insulator layer leads to creation of a ion concentration gradient which results in a gradual increase of the ion diffusion current in the direction opposite to the ion drift current component. The equilibrium between the two for a given temperature and electric field results in saturation of the leakage current value. DCL vs. time characteristics are described by the exponential stretched law. We found that during the initial part of ageing an exponent n = 1 applies. That corresponds to the ion drift motion only. After long-time application of the electric field at a high temperature the DCL vs. time characteristics are described by the exponential

  5. The drift diffusion model as the choice rule in reinforcement learning.

    Science.gov (United States)

    Pedersen, Mads Lund; Frank, Michael J; Biele, Guido

    2017-08-01

    Current reinforcement-learning models often assume simplified decision processes that do not fully reflect the dynamic complexities of choice processes. Conversely, sequential-sampling models of decision making account for both choice accuracy and response time, but assume that decisions are based on static decision values. To combine these two computational models of decision making and learning, we implemented reinforcement-learning models in which the drift diffusion model describes the choice process, thereby capturing both within- and across-trial dynamics. To exemplify the utility of this approach, we quantitatively fit data from a common reinforcement-learning paradigm using hierarchical Bayesian parameter estimation, and compared model variants to determine whether they could capture the effects of stimulant medication in adult patients with attention-deficit hyperactivity disorder (ADHD). The model with the best relative fit provided a good description of the learning process, choices, and response times. A parameter recovery experiment showed that the hierarchical Bayesian modeling approach enabled accurate estimation of the model parameters. The model approach described here, using simultaneous estimation of reinforcement-learning and drift diffusion model parameters, shows promise for revealing new insights into the cognitive and neural mechanisms of learning and decision making, as well as the alteration of such processes in clinical groups.

  6. Quantification of Stokes Drift as a Mechanism for Surface Oil Advection in the DWH Oil Spill

    Science.gov (United States)

    Clark, M.

    2013-12-01

    Stokes drift has previously been qualitatively shown to be a factor in ocean surface particle transport, but has never been comprehensively quantified. In addition, most operational ocean particle advection models used during the Deepwater Horizon oil spill do not explicitly account for Stokes drift, instead using a simple parameterization based on wind drift (or ignoring it completely). This research works to quantify Stokes drift via direct calculation, with a focus on shallow water, where Stokes drift is more likely to have a relatively large impact compared to other transport processes such as ocean currents. For this study, WaveWatch III modeled waves in the Gulf of Mexico are used, from which Stokes drift is calculated using the peak wave period and significant wave height outputs. Trajectories are also calculated to examine the role Stokes drift plays in bringing surface particles (and specifically surface oil slicks) onshore. The impact of Stokes drift is compared to transport by currents and traditional estimates of wind drift.

  7. A gradient structure for reaction–diffusion systems and for energy-drift-diffusion systems

    International Nuclear Information System (INIS)

    Mielke, Alexander

    2011-01-01

    In recent years the theory of the Wasserstein metric has opened up new treatments of diffusion equations as gradient systems, where the free energy or entropy take the role of the driving functional and where the space is equipped with the Wasserstein metric. We show on the formal level that this gradient structure can be generalized to reaction–diffusion systems with reversible mass-action kinetic. The metric is constructed using the dual dissipation potential, which is a quadratic functional of all chemical potentials including the mobilities as well as the reaction kinetics. The metric structure is obtained by Legendre transform from the dual dissipation potential. The same ideas extend to systems including electrostatic interactions or a correct energy balance via coupling to the heat equation. We show this by treating the semiconductor equations involving the electron and hole densities, the electrostatic potential, and the temperature. Thus, the models in Albinus et al (2002 Nonlinearity 15 367–83), which stimulated this work, have a gradient structure

  8. Effects of Alfvénic Drift on Diffusive Shock Acceleration at Weak Cluster Shocks

    Science.gov (United States)

    Kang, Hyesung; Ryu, Dongsu

    2018-03-01

    Non-detection of γ-ray emission from galaxy clusters has challenged diffusive shock acceleration (DSA) of cosmic-ray (CR) protons at weak collisionless shocks that are expected to form in the intracluster medium. As an effort to address this problem, we here explore possible roles of Alfvén waves self-excited via resonant streaming instability during the CR acceleration at parallel shocks. The mean drift of Alfvén waves may either increase or decrease the scattering center compression ratio, depending on the postshock cross-helicity, leading to either flatter or steeper CR spectra. We first examine such effects at planar shocks, based on the transport of Alfvén waves in the small amplitude limit. For the shock parameters relevant to cluster shocks, Alfvénic drift flattens the CR spectrum slightly, resulting in a small increase of the CR acceleration efficiency, η. We then consider two additional, physically motivated cases: (1) postshock waves are isotropized via MHD and plasma processes across the shock transition, and (2) postshock waves contain only forward waves propagating along with the flow due to a possible gradient of CR pressure behind the shock. In these cases, Alfvénic drift could reduce η by as much as a factor of five for weak cluster shocks. For the canonical parameters adopted here, we suggest η ∼ 10‑4–10‑2 for shocks with sonic Mach number M s ≈ 2–3. The possible reduction of η may help ease the tension between non-detection of γ-rays from galaxy clusters and DSA predictions.

  9. Exciton delocalization incorporated drift-diffusion model for bulk-heterojunction organic solar cells

    Science.gov (United States)

    Wang, Zi Shuai; Sha, Wei E. I.; Choy, Wallace C. H.

    2016-12-01

    Modeling the charge-generation process is highly important to understand device physics and optimize power conversion efficiency of bulk-heterojunction organic solar cells (OSCs). Free carriers are generated by both ultrafast exciton delocalization and slow exciton diffusion and dissociation at the heterojunction interface. In this work, we developed a systematic numerical simulation to describe the charge-generation process by a modified drift-diffusion model. The transport, recombination, and collection of free carriers are incorporated to fully capture the device response. The theoretical results match well with the state-of-the-art high-performance organic solar cells. It is demonstrated that the increase of exciton delocalization ratio reduces the energy loss in the exciton diffusion-dissociation process, and thus, significantly improves the device efficiency, especially for the short-circuit current. By changing the exciton delocalization ratio, OSC performances are comprehensively investigated under the conditions of short-circuit and open-circuit. Particularly, bulk recombination dependent fill factor saturation is unveiled and understood. As a fundamental electrical analysis of the delocalization mechanism, our work is important to understand and optimize the high-performance OSCs.

  10. Inhibition drives configural superiority of illusory Gestalt: Combined behavioral and drift-diffusion model evidence.

    Science.gov (United States)

    Nie, Qi-Yang; Maurer, Mara; Müller, Hermann J; Conci, Markus

    2016-05-01

    Illusory Kanizsa figures demonstrate that a perceptually completed whole is more than the sum of its composite parts. In the current study, we explored part/whole relationships in object completion using the configural superiority effect (CSE) with illusory figures (Pomerantz & Portillo, 2011). In particular, we investigated to which extent the CSE is modulated by closure in target and distractor configurations. Our results demonstrated a typical CSE, with detection of a configural whole being more efficient than the detection of a corresponding part-level target. Moreover, the CSE was more pronounced when grouped objects were presented in distractors rather than in the target. A follow-up experiment systematically manipulated closure in whole target or, respectively, distractor configurations. The results revealed the effect of closure to be again stronger in distractor, rather than in target configurations, suggesting that closure primarily affects the inhibition of distractors, and to a lesser extent the selection of the target. In addition, a drift-diffusion model analysis of our data revealed that efficient distractor inhibition expedites the rate of evidence accumulation, with closure in distractors particularly speeding the drift toward the decision boundary. In sum, our findings demonstrate that the CSE in Kanizsa figures derives primarily from the inhibition of closed distractor objects, rather than being driven by a conspicuous target configuration. Altogether, these results support a fundamental role of inhibition in driving configural superiority effects in visual search. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Effects of magnetic drift tangential to magnetic surfaces on neoclassical transport in non-axisymmetric plasmas

    International Nuclear Information System (INIS)

    Matsuoka, Seikichi; Satake, Shinsuke; Kanno, Ryutaro; Sugama, Hideo

    2015-01-01

    In evaluating neoclassical transport by radially local simulations, the magnetic drift tangential to a flux surface is usually ignored in order to keep the phase-space volume conservation. In this paper, effect of the tangential magnetic drift on the local neoclassical transport is investigated. To retain the effect of the tangential magnetic drift in the local treatment of neoclassical transport, a new local formulation for the drift kinetic simulation is developed. The compressibility of the phase-space volume caused by the tangential magnetic drift is regarded as a source term for the drift kinetic equation, which is solved by using a two-weight δf Monte Carlo method for non-Hamiltonian system [G. Hu and J. A. Krommes, Phys. Plasmas 1, 863 (1994)]. It is demonstrated that the effect of the drift is negligible for the neoclassical transport in tokamaks. In non-axisymmetric systems, however, the tangential magnetic drift substantially changes the dependence of the neoclassical transport on the radial electric field E r . The peaked behavior of the neoclassical radial fluxes around E r  =   0 observed in conventional local neoclassical transport simulations is removed by taking the tangential magnetic drift into account

  12. Effects of magnetic drift tangential to magnetic surfaces on neoclassical transport in non-axisymmetric plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Matsuoka, Seikichi, E-mail: matsuoka@rist.or.jp [Research Organization for Information Science and Technology, 6F Kimec-Center Build., 1-5-2 Minatojima-minamimachi, Chuo-ku, Kobe 650-0047 (Japan); Satake, Shinsuke; Kanno, Ryutaro [National Institute for Fusion Science, 322-6 Oroshi-cho, Toki 509-5292 (Japan); Department of Fusion Science, SOKENDAI (The Graduate University for Advanced Studies), 322-6 Oroshi-cho, Toki 509-5292 (Japan); Sugama, Hideo [National Institute for Fusion Science, 322-6 Oroshi-cho, Toki 509-5292 (Japan)

    2015-07-15

    In evaluating neoclassical transport by radially local simulations, the magnetic drift tangential to a flux surface is usually ignored in order to keep the phase-space volume conservation. In this paper, effect of the tangential magnetic drift on the local neoclassical transport is investigated. To retain the effect of the tangential magnetic drift in the local treatment of neoclassical transport, a new local formulation for the drift kinetic simulation is developed. The compressibility of the phase-space volume caused by the tangential magnetic drift is regarded as a source term for the drift kinetic equation, which is solved by using a two-weight δf Monte Carlo method for non-Hamiltonian system [G. Hu and J. A. Krommes, Phys. Plasmas 1, 863 (1994)]. It is demonstrated that the effect of the drift is negligible for the neoclassical transport in tokamaks. In non-axisymmetric systems, however, the tangential magnetic drift substantially changes the dependence of the neoclassical transport on the radial electric field E{sub r}. The peaked behavior of the neoclassical radial fluxes around E{sub r }={sub  }0 observed in conventional local neoclassical transport simulations is removed by taking the tangential magnetic drift into account.

  13. Modeling of ion acceleration through drift and diffusion at interplanetary shocks

    Science.gov (United States)

    Decker, R. B.; Vlahos, L.

    1986-01-01

    A test particle simulation designed to model ion acceleration through drift and diffusion at interplanetary shocks is described. The technique consists of integrating along exact particle orbits in a system where the angle between the shock normal and mean upstream magnetic field, the level of magnetic fluctuations, and the energy of injected particles can assume a range of values. The technique makes it possible to study time-dependent shock acceleration under conditions not amenable to analytical techniques. To illustrate the capability of the numerical model, proton acceleration was considered under conditions appropriate for interplanetary shocks at 1 AU, including large-amplitude transverse magnetic fluctuations derived from power spectra of both ambient and shock-associated MHD waves.

  14. Drift velocity, longitudinal and transverse diffusion in hydrocarbons derived from distributions of single electrons

    International Nuclear Information System (INIS)

    Schmidt, B.; Roncossek, M.

    1992-01-01

    A time of flight method is described which allows the simultaneous measurement of drift velocity w and the ratios of the longitudinal and transverse diffusion coefficients to mobility (D L /μ, D T /μ) of electrons in gases. The accuracy achieved in this omnipurpose experiment is comparable with that of specialised techniques and is estimated to be ±1% for w and ±5% for the d/μ measurements. Results for methane, ethane, ethene, propane, propene and cyclopropane for values of E/N (the electric field strength divided by the number density) ranging from 0.02 to 15 Td are presented and discussed (1 Td = 10 21 V m 2 ). 13 refs., 4 tabs., 7 figs

  15. Fast Drift and Diffusion in a Class of Isochronous Systems with the Windows Method

    Energy Technology Data Exchange (ETDEWEB)

    Fortunati, Alessandro, E-mail: alessandro.fortunati@bristol.ac.uk [University of Bristol, School of Mathematics (United Kingdom)

    2017-06-15

    The aim of the paper is to deal with some peculiar difficulties arising from the use of the geometrical tool known as windows method in the context of the well known problem of Arnold’s diffusion for isochronous nearly-integrable Hamiltonian systems. Despite the simple features of the class of systems at hand, it is possible to show how the absence of an anisochrony term leads to several substantial differences in the application of the method, requiring some additional devices, such as non-equally spaced transition chains and variable windows. As a consequence, we show the existence of a set of unstable orbits, whose drifting time matches, up to a constant, the one obtained via variational methods.

  16. The Attentional Drift Diffusion Model of Simple Perceptual Decision-Making

    Directory of Open Access Journals (Sweden)

    Gabriela Tavares

    2017-08-01

    Full Text Available Perceptual decisions requiring the comparison of spatially distributed stimuli that are fixated sequentially might be influenced by fluctuations in visual attention. We used two psychophysical tasks with human subjects to investigate the extent to which visual attention influences simple perceptual choices, and to test the extent to which the attentional Drift Diffusion Model (aDDM provides a good computational description of how attention affects the underlying decision processes. We find evidence for sizable attentional choice biases and that the aDDM provides a reasonable quantitative description of the relationship between fluctuations in visual attention, choices and reaction times. We also find that exogenous manipulations of attention induce choice biases consistent with the predictions of the model.

  17. The Attentional Drift Diffusion Model of Simple Perceptual Decision-Making.

    Science.gov (United States)

    Tavares, Gabriela; Perona, Pietro; Rangel, Antonio

    2017-01-01

    Perceptual decisions requiring the comparison of spatially distributed stimuli that are fixated sequentially might be influenced by fluctuations in visual attention. We used two psychophysical tasks with human subjects to investigate the extent to which visual attention influences simple perceptual choices, and to test the extent to which the attentional Drift Diffusion Model (aDDM) provides a good computational description of how attention affects the underlying decision processes. We find evidence for sizable attentional choice biases and that the aDDM provides a reasonable quantitative description of the relationship between fluctuations in visual attention, choices and reaction times. We also find that exogenous manipulations of attention induce choice biases consistent with the predictions of the model.

  18. Finite difference discretization of semiconductor drift-diffusion equations for nanowire solar cells

    Science.gov (United States)

    Deinega, Alexei; John, Sajeev

    2012-10-01

    We introduce a finite difference discretization of semiconductor drift-diffusion equations using cylindrical partial waves. It can be applied to describe the photo-generated current in radial pn-junction nanowire solar cells. We demonstrate that the cylindrically symmetric (l=0) partial wave accurately describes the electronic response of a square lattice of silicon nanowires at normal incidence. We investigate the accuracy of our discretization scheme by using different mesh resolution along the radial direction r and compare with 3D (x, y, z) discretization. We consider both straight nanowires and nanowires with radius modulation along the vertical axis. The charge carrier generation profile inside each nanowire is calculated using an independent finite-difference time-domain simulation.

  19. Novel determination of surface temperature of lithium hydride hydrolysis using DRIFT spectroscopy

    International Nuclear Information System (INIS)

    Awbery, Roy P.; Tsang, S.C.

    2008-01-01

    Diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy has been used to show how increasing temperature causes the hydroxyl band of LiOH to shift linearly and reversibly towards lower wavenumbers. The band shift with temperature was used to determine the surface temperature of LiH when exposed to water vapour at 158, 317, 793 and >1900 Pa (5%, 10%, 25% and >60% relative humidity), the exothermic hydrolysis reaction resulting in surface temperature increases of up to 50 deg. C. The rate of surface heating was found to increase slightly with increasing water vapour exposures up to 793 Pa, demonstrating that the LiH hydrolysis reaction rate was dependent upon the partial pressure of water vapour. The growth of surface LiOH appeared to significantly slow down further reaction until the water vapour exposure was increased beyond 1900 Pa, when formation of hydrated LiOH occurred. The effect of temperature on detectors was also investigated showing that baselines shifted towards higher intensities with increasing temperature when measured with a DTGS detector and towards lower intensities with an MCT detector, over the temperature range 25-450 deg. C

  20. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  1. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  2. The transport characteristics of passing fast ions produced by nonlocal overlapping of drift island surfaces and magnetic island surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Jinjia; Gong, Xueyu, E-mail: gongxueyu-usc@163.com; Xiang, Dong; Huang, Qianhong [School of Nuclear Science and Technology, University of South China, Hengyang 421001 (China); Yu, Jun [School of Mathematics and Physics, University of South China, Hengyang 421001 (China)

    2016-08-15

    The structure of the drift-island surface of passing fast ions (PFIs) is investigated in the presence of the resonant interaction with a magnetic island. Two overlapping regions of the drift-island surface and the magnetic island surface are found, one corresponding to local overlapping region and the other to non-local one. Here, the word “nonlocal” denotes that the resonances in the core plasma can have effects on the PFIs near the plasma boundary, while the “local” represents that the PFIs just near the resonant location are influenced. The nonlocal overlapping constructs a transport path along which the PFIs can become losses. There are three kinds of drift-island surfaces to join in forming the transport paths. A pitch angle region, which is called pitch angle gap, is found near the plasma boundary, where the drift-island surface cannot be formed and few PFIs are lost. The pitch-angle selective features of PFI losses are obtained by analyzing the three kinds of drift-island surfaces. The coupling between the crowd drift island surfaces and the collision can induce the prompt losses of PFIs and rapidly slowing down of PFI energy. The time of the prompt losses and the slowing down rate are calculated. Qualitatively, the theoretical results are in well agreement with the experimental observations in ASDEX Upgrade [M. García-Muñoz et al., Nucl. Fusion 47, L10 (2007)].

  3. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  4. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  5. The attentional drift-diffusion model extends to simple purchasing decisions.

    Science.gov (United States)

    Krajbich, Ian; Lu, Dingchao; Camerer, Colin; Rangel, Antonio

    2012-01-01

    How do we make simple purchasing decisions (e.g., whether or not to buy a product at a given price)? Previous work has shown that the attentional drift-diffusion model (aDDM) can provide accurate quantitative descriptions of the psychometric data for binary and trinary value-based choices, and of how the choice process is guided by visual attention. Here we extend the aDDM to the case of purchasing decisions, and test it using an eye-tracking experiment. We find that the model also provides a reasonably accurate quantitative description of the relationship between choice, reaction time, and visual fixations using parameters that are very similar to those that best fit the previous data. The only critical difference is that the choice biases induced by the fixations are about half as big in purchasing decisions as in binary choices. This suggests that a similar computational process is used to make binary choices, trinary choices, and simple purchasing decisions.

  6. The attentional drift-diffusion model extends to simple purchasing decisions

    Directory of Open Access Journals (Sweden)

    Ian eKrajbich

    2012-06-01

    Full Text Available How do we make simple purchasing decisions (e.g., whether or not to buy a product ata given price? Previous work has shown that the Attentional-Drift-Diffusion-Model (aDDMcan provide accurate descriptions of the psychometric data for binary and trinary value-based choices, and of how the choice process is guided by visual attention. However, the computational processes used to make purchasing decisions are unknown. Here we extend the aDDM to the case of purchasing decisions, and test it using an eye-tracking experiment. We find that the model provides a quantitatively accurate description of the relationship between choice, reaction time, and visual fixations using parameters that are very similar to those that best fit the previous data. The only critical difference is that the choice biases induced by the fixations are about half as big in purchasing decisions as in binary choices.This suggests that the brain uses similar computational processes in these varied decision situations.

  7. Effect of saddle-point anisotropy on point-defect drift-diffusion into straight dislocations

    International Nuclear Information System (INIS)

    Skinner, B.C.; Woo, C.H.

    1983-02-01

    Effects on point-defect drift-diffusion in the strain fields of edge or screw dislocations, due to the anisotropy of the point defect in its saddle-point configuration, are investigated. Expressions for sink strength and bias that include the saddle-point shape effect are derived, both in the absence and presence of an externally applied stress. These are found to depend on intrinsic parameters such as the relaxation volume and the saddle-point shape of the point defects, and extrinsic parameters such as temperature and the magnitude and direction of the externally applied stress with respect to the line direction and Burgers vector direction of the dislocation. The theory is applied to fcc copper and bcc iron. It is found that screw dislocations are biased sinks and that the stress-induced bias differential for the edge dislocations depends much more on the line direction than the Burgers vector direction. Comparison with the stress-induced bias differential due to the usual SIPA effect is made. It is found that the present effect causes a bias differential that is more than an order of magnitude larger

  8. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  9. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  10. The electron drift velocity and longitudinal diffusion coefficient of an electron swarm in hydrogen at elevated swarm energies

    International Nuclear Information System (INIS)

    Blevin, H.A.; Fletcher, J.; Hunter, S.R.

    1976-01-01

    A study of the photons produced at electron-molecule excitation collisions has been used to obtain information on the behaviour of an electron swarm moving through a neutral gas under the influence of a uniform electric field. Specifically, values have been obtained for the electron drift velocity and the longitudinal diffusion coefficients under equilibrium swarm conditions, i.e. remote from any electrode. (author)

  11. Intertwining personal and reward relevance: evidence from the drift-diffusion model.

    Science.gov (United States)

    Yankouskaya, A; Bührle, R; Lugt, E; Stolte, M; Sui, J

    2018-01-24

    In their seminal paper 'Is our self nothing but reward', Northoff and Hayes (Biol Psychiatry 69(11):1019-1025, Northoff, Hayes, Biological Psychiatry 69(11):1019-1025, 2011) proposed three models of the relationship between self and reward and opened a continuing debate about how these different fields can be linked. To date, none of the proposed models received strong empirical support. The present study tested common and distinct effects of personal relevance and reward values by de-componenting different stages of perceptual decision making using a drift-diffusion approach. We employed a recently developed associative matching paradigm where participants (N = 40) formed mental associations between five geometric shapes and five labels referring personal relevance in the personal task, or five shape-label pairings with different reward values in the reward task and then performed a matching task by indicating whether a displayed shape-label pairing was correct or incorrect. We found that common effects of personal relevance and monetary reward were manifested in the facilitation of behavioural performance for high personal relevance and high reward value as socially important signals. The differential effects between personal and monetary relevance reflected non-decisional time in a perceptual decision process, and task-specific prioritization of stimuli. Our findings support the parallel processing model (Northoff & Hayes, Biol Psychiatry 69(11):1019-1025, Northoff, Hayes, Biological Psychiatry 69(11):1019-1025, 2011) and suggest that self-specific processing occurs in parallel with high reward processing. Limitations and further directions are discussed.

  12. A drift-diffusion-reaction model for excitonic photovoltaic bilayers: Photovoltaic bilayers: Asymptotic analysis and a 2D hdg finite element scheme

    KAUST Repository

    Brinkman, Daniel; Fellner, Klemens J.; Markowich, Peter A.; Wolfram, Marie Therese

    2013-01-01

    We present and discuss a mathematical model for the operation of bilayer organic photovoltaic devices. Our model couples drift-diffusion-recombination equations for the charge carriers (specifically, electrons and holes) with a reaction

  13. Electromagnetic backscattering from one-dimensional drifting fractal sea surface II: Electromagnetic backscattering model

    International Nuclear Information System (INIS)

    Xie Tao; Zhao Shang-Zhuo; Fang He; Yu Wen-Jin; He Yi-Jun; Perrie, William

    2016-01-01

    Sea surface current has a significant influence on electromagnetic (EM) backscattering signals and may constitute a dominant synthetic aperture radar (SAR) imaging mechanism. An effective EM backscattering model for a one-dimensional drifting fractal sea surface is presented in this paper. This model is used to simulate EM backscattering signals from the drifting sea surface. Numerical results show that ocean currents have a significant influence on EM backscattering signals from the sea surface. The normalized radar cross section (NRCS) discrepancies between the model for a coupled wave-current fractal sea surface and the model for an uncoupled fractal sea surface increase with the increase of incidence angle, as well as with increasing ocean currents. Ocean currents that are parallel to the direction of the wave can weaken the EM backscattering signal intensity, while the EM backscattering signal is intensified by ocean currents propagating oppositely to the wave direction. The model presented in this paper can be used to study the SAR imaging mechanism for a drifting sea surface. (paper)

  14. How attention influences perceptual decision making: Single-trial EEG correlates of drift-diffusion model parameters

    Science.gov (United States)

    Nunez, Michael D.; Vandekerckhove, Joachim; Srinivasan, Ramesh

    2016-01-01

    Perceptual decision making can be accounted for by drift-diffusion models, a class of decision-making models that assume a stochastic accumulation of evidence on each trial. Fitting response time and accuracy to a drift-diffusion model produces evidence accumulation rate and non-decision time parameter estimates that reflect cognitive processes. Our goal is to elucidate the effect of attention on visual decision making. In this study, we show that measures of attention obtained from simultaneous EEG recordings can explain per-trial evidence accumulation rates and perceptual preprocessing times during a visual decision making task. Models assuming linear relationships between diffusion model parameters and EEG measures as external inputs were fit in a single step in a hierarchical Bayesian framework. The EEG measures were features of the evoked potential (EP) to the onset of a masking noise and the onset of a task-relevant signal stimulus. Single-trial evoked EEG responses, P200s to the onsets of visual noise and N200s to the onsets of visual signal, explain single-trial evidence accumulation and preprocessing times. Within-trial evidence accumulation variance was not found to be influenced by attention to the signal or noise. Single-trial measures of attention lead to better out-of-sample predictions of accuracy and correct reaction time distributions for individual subjects. PMID:28435173

  15. How attention influences perceptual decision making: Single-trial EEG correlates of drift-diffusion model parameters.

    Science.gov (United States)

    Nunez, Michael D; Vandekerckhove, Joachim; Srinivasan, Ramesh

    2017-02-01

    Perceptual decision making can be accounted for by drift-diffusion models, a class of decision-making models that assume a stochastic accumulation of evidence on each trial. Fitting response time and accuracy to a drift-diffusion model produces evidence accumulation rate and non-decision time parameter estimates that reflect cognitive processes. Our goal is to elucidate the effect of attention on visual decision making. In this study, we show that measures of attention obtained from simultaneous EEG recordings can explain per-trial evidence accumulation rates and perceptual preprocessing times during a visual decision making task. Models assuming linear relationships between diffusion model parameters and EEG measures as external inputs were fit in a single step in a hierarchical Bayesian framework. The EEG measures were features of the evoked potential (EP) to the onset of a masking noise and the onset of a task-relevant signal stimulus. Single-trial evoked EEG responses, P200s to the onsets of visual noise and N200s to the onsets of visual signal, explain single-trial evidence accumulation and preprocessing times. Within-trial evidence accumulation variance was not found to be influenced by attention to the signal or noise. Single-trial measures of attention lead to better out-of-sample predictions of accuracy and correct reaction time distributions for individual subjects.

  16. Exact representation of the asymptotic drift speed and diffusion matrix for a class of velocity-jump processes

    Science.gov (United States)

    Mascia, Corrado

    2016-01-01

    This paper examines a class of linear hyperbolic systems which generalizes the Goldstein-Kac model to an arbitrary finite number of speeds vi with transition rates μij. Under the basic assumptions that the transition matrix is symmetric and irreducible, and the differences vi -vj generate all the space, the system exhibits a large-time behavior described by a parabolic advection-diffusion equation. The main contribution is to determine explicit formulas for the asymptotic drift speed and diffusion matrix in term of the kinetic parameters vi and μij, establishing a complete connection between microscopic and macroscopic coefficients. It is shown that the drift speed is the arithmetic mean of the velocities vi. The diffusion matrix has a more complicate representation, based on the graph with vertices the velocities vi and arcs weighted by the transition rates μij. The approach is based on an exhaustive analysis of the dispersion relation and on the application of a variant of the Kirchoff's matrix tree Theorem from graph theory.

  17. Analysis and Calibration of in situ scanning tunnelling microscopy Images with atomic Resolution Influenced by Surface Drift Phenomena

    DEFF Research Database (Denmark)

    Andersen, Jens Enevold Thaulov; Møller, Per

    1994-01-01

    The influence of surface drift velocities on in situ scanning tunnelling microscopy (STM) experiments with atomic resolution is analysed experimentally and mathematically. Constant drift velocities much smaller than the speed of scanning can in many in situ STM experiments with atomic resolution ...... as well as the vectors of the non-distorted surface lattice can be determined. The calibration of distances can thus be carried out also when the image is influenced by drift. Results with gold surfaces and graphite surfaces are analysed and discussed....

  18. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  19. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  20. Effects of binge drinking and hangover on response selection sub-processes-a study using EEG and drift diffusion modeling.

    Science.gov (United States)

    Stock, Ann-Kathrin; Hoffmann, Sven; Beste, Christian

    2017-09-01

    Effects of binge drinking on cognitive control and response selection are increasingly recognized in research on alcohol (ethanol) effects. Yet, little is known about how those processes are modulated by hangover effects. Given that acute intoxication and hangover seem to be characterized by partly divergent effects and mechanisms, further research on this topic is needed. In the current study, we hence investigated this with a special focus on potentially differential effects of alcohol intoxication and subsequent hangover on sub-processes involved in the decision to select a response. We do so combining drift diffusion modeling of behavioral data with neurophysiological (EEG) data. Opposed to common sense, the results do not show an impairment of all assessed measures. Instead, they show specific effects of high dose alcohol intoxication and hangover on selective drift diffusion model and EEG parameters (as compared to a sober state). While the acute intoxication induced by binge-drinking decreased the drift rate, it was increased by the subsequent hangover, indicating more efficient information accumulation during hangover. Further, the non-decisional processes of information encoding decreased with intoxication, but not during hangover. These effects were reflected in modulations of the N2, P1 and N1 event-related potentials, which reflect conflict monitoring, perceptual gating and attentional selection processes, respectively. As regards the functional neuroanatomical architecture, the anterior cingulate cortex (ACC) as well as occipital networks seem to be modulated. Even though alcohol is known to have broad neurobiological effects, its effects on cognitive processes are rather specific. © 2016 Society for the Study of Addiction.

  1. Terahertz instability of surface optical-phonon polaritons that interact with surface plasmon polaritons in the presence of electron drift

    International Nuclear Information System (INIS)

    Sydoruk, O.; Solymar, L.; Shamonina, E.; Kalinin, V.

    2010-01-01

    Traveling-wave interaction between optical phonons and electrons drifting in diatomic semiconductors has potential for amplification and generation of terahertz radiation. Existing models of this interaction were developed for infinite materials. As a more practically relevant configuration, we studied theoretically a finite semiconductor slab surrounded by a dielectric. This paper analyzes the optical-phonon instability in the slab including the Lorentz force and compares it to the instability in an infinite material. As the analysis shows, the slab instability occurs because of the interaction of surface optical-phonon polaritons with surface plasmon polaritons in the presence of electron drift. The properties of the instability depend on the slab thickness when the thickness is comparable to the wavelength. For large slab thicknesses, however, the dispersion relation of the slab is similar to that of an infinite material, although the coupling is weaker. The results could be used for the design of practical terahertz traveling-wave oscillators and amplifiers.

  2. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  3. Stokes drift

    Science.gov (United States)

    van den Bremer, T. S.; Breivik, Ø.

    2017-12-01

    During its periodic motion, a particle floating at the free surface of a water wave experiences a net drift velocity in the direction of wave propagation, known as the Stokes drift (Stokes 1847 Trans. Camb. Philos. Soc. 8, 441-455). More generally, the Stokes drift velocity is the difference between the average Lagrangian flow velocity of a fluid parcel and the average Eulerian flow velocity of the fluid. This paper reviews progress in fundamental and applied research on the induced mean flow associated with surface gravity waves since the first description of the Stokes drift, now 170 years ago. After briefly reviewing the fundamental physical processes, most of which have been established for decades, the review addresses progress in laboratory and field observations of the Stokes drift. Despite more than a century of experimental studies, laboratory studies of the mean circulation set up by waves in a laboratory flume remain somewhat contentious. In the field, rapid advances are expected due to increasingly small and cheap sensors and transmitters, making widespread use of small surface-following drifters possible. We also discuss remote sensing of the Stokes drift from high-frequency radar. Finally, the paper discusses the three main areas of application of the Stokes drift: in the coastal zone, in Eulerian models of the upper ocean layer and in the modelling of tracer transport, such as oil and plastic pollution. Future climate models will probably involve full coupling of ocean and atmosphere systems, in which the wave model provides consistent forcing on the ocean surface boundary layer. Together with the advent of new space-borne instruments that can measure surface Stokes drift, such models hold the promise of quantifying the impact of wave effects on the global atmosphere-ocean system and hopefully contribute to improved climate projections. This article is part of the theme issue 'Nonlinear water waves'.

  4. Dissociable mechanisms of speed-accuracy tradeoff during visual perceptual learning are revealed by a hierarchical drift diffusion model

    Directory of Open Access Journals (Sweden)

    Jiaxiang eZhang

    2014-04-01

    Full Text Available Two phenomena are commonly observed in decision-making. First, there is a speed-accuracy tradeoff such that decisions are slower and more accurate when instructions emphasize accuracy over speed, and vice versa. Second, decision performance improves with practice, as a task is learnt. The speed-accuracy tradeoff and learning effects have been explained under a well-established evidence-accumulation framework for decision-making, which suggests that evidence supporting each choice is accumulated over time, and a decision is committed to when the accumulated evidence reaches a decision boundary. This framework suggests that changing the decision boundary creates the tradeoff between decision speed and accuracy, while increasing the rate of accumulation leads to more accurate and faster decisions after learning. However, recent studies challenged the view that speed-accuracy tradeoff and learning are associated with changes in distinct, single decision parameters. Further, the influence of speed-accuracy instructions over the course of learning remains largely unknown. Here, we used a hierarchical drift-diffusion model to examine the speed-accuracy tradeoff during learning of a coherent motion discrimination task across multiple training sessions, and a transfer test session. The influence of speed-accuracy instructions was robust over training and generalized across untrained stimulus features. Emphasizing decision accuracy rather than speed was associated with increased boundary separation, drift rate and non-decision time at the beginning of training. However, after training, an emphasis on decision accuracy was only associated with increased boundary separation. In addition, faster and more accurate decisions after learning were due to a gradual decrease in boundary separation and an increase in drift rate. The results suggest that speed-accuracy instructions and learning differentially shape decision-making processes at different time scales.

  5. Compact modeling of nanoscale triple-gate junctionless transistors covering drift-diffusion to quasi-ballistic carrier transport

    Science.gov (United States)

    Oproglidis, T. A.; Karatsori, T. A.; Barraud, S.; Ghibaudo, G.; Dimitriadis, C. A.

    2018-04-01

    In this work, we extend our analytical compact model for nanoscale junctionless triple-gate (JL TG) MOSFETs, capturing carrier transport from drift-diffusion to quasi-ballistic regime. This is based on a simple formulation of the low-field mobility extracted from experimental data using the Y-function method, taking into account the ballistic carrier motion and an increased carrier scattering in process-induced defects near the source/drain regions. The case of a Schottky junction in non-ideal ohmic contact at the drain side was also taken into account by modifying the threshold voltage and ideality factor of the JL transistor. The model is validated with experimental data for n-channel JL TG MOSFETs with channel length varying from 95 down to 25 nm. It can be easily implemented as a compact model for use in Spice circuit simulators.

  6. Exact Markov chain and approximate diffusion solution for haploid genetic drift with one-way mutation.

    Science.gov (United States)

    Hössjer, Ola; Tyvand, Peder A; Miloh, Touvia

    2016-02-01

    The classical Kimura solution of the diffusion equation is investigated for a haploid random mating (Wright-Fisher) model, with one-way mutations and initial-value specified by the founder population. The validity of the transient diffusion solution is checked by exact Markov chain computations, using a Jordan decomposition of the transition matrix. The conclusion is that the one-way diffusion model mostly works well, although the rate of convergence depends on the initial allele frequency and the mutation rate. The diffusion approximation is poor for mutation rates so low that the non-fixation boundary is regular. When this happens we perturb the diffusion solution around the non-fixation boundary and obtain a more accurate approximation that takes quasi-fixation of the mutant allele into account. The main application is to quantify how fast a specific genetic variant of the infinite alleles model is lost. We also discuss extensions of the quasi-fixation approach to other models with small mutation rates. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  8. Drift chamber detectors

    International Nuclear Information System (INIS)

    Duran, I.; Martinez Laso, L.

    1989-01-01

    A review of High Energy Physics detectors based on drift chambers is presented. The ionization, drift diffusion, multiplication and detection principles are described. Most common drift media are analysied, and a classification of the detectors according to its geometry is done. Finally the standard read-out methods are displayed and the limits of the spatial resolution are discussed. (Author)

  9. Drift Chambers detectors

    International Nuclear Information System (INIS)

    Duran, I.; Martinez laso, L.

    1989-01-01

    We present here a review of High Energy Physics detectors based on drift chambers. The ionization, drift diffusion, multiplication and detection principles are described. Most common drift media are analysed, and a classification of the detectors according to its geometry is done. Finally the standard read-out methods are displayed and the limits of the spatial resolution are discussed. (Author) 115 refs

  10. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  11. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  12. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  13. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  14. Nonlinear drift-diffusion model of gating in K and nACh ion channels

    Energy Technology Data Exchange (ETDEWEB)

    Vaccaro, S.R. [Department of Physics, University of Adelaide, Adelaide, South Australia 5005 (Australia)], E-mail: svaccaro@physics.adelaide.edu.au

    2007-09-03

    The configuration of a sensor regulates the transition between the closed and open states of both voltage and ligand gated channels. The closed state dwell-time distribution f{sub c}(t) derived from a Fokker-Planck equation with a nonlinear diffusion coefficient is in good agreement with experimental data and can account for the power law approximation to f{sub c}(t) for a delayed rectifier K channel and a nicotinic acetylcholine (nACh) ion channel. The solution of a master equation which approximates the Fokker-Planck equation provides a better description of the small time behaviour of the dwell-time distribution and can account for the empirical rate-amplitude correlation for these ion channels.

  15. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  16. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  17. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  18. Feasibility of diffuse reflectance infrared Fourier spectroscopy (DRIFTS) to quantify iron-cyanide (Fe-CN) complexes in soil

    Science.gov (United States)

    Sut-Lohmann, Magdalena; Raab, Thomas

    2017-04-01

    Contaminated sites create a significant risk to human health, by poisoning drinking water, soil, air and as a consequence food. Continuous release of persistent iron-cyanide (Fe-CN) complexes from various industrial sources poses a high hazard to the environment and indicates the necessity to analyze considerable amount of samples. At the present time quantitative determination of Fe-CN concentration in soil usually requires a time consuming two step process: digestion of the sample (e.g., micro distillation system) and its analytical detection performed, e.g., by automated spectrophotometrical flow injection analysis (FIA). In order to determine the feasibility of diffuse reflectance infrared Fourier spectroscopy (DRIFTS) to quantify the Fe-CN complexes in soil matrix, 42 soil samples were collected (8 to 12.520 mg kg-1CN) indicating single symmetrical CN band in the range 2092 - 2084 cm-1. Partial least squares (PLS) calibration-validation model revealed IR response to CNtot exceeding 1268 mg kg-1 (limit of detection, LOD). Subsequently, leave-one-out cross-validation (LOO-CV) was performed on soil samples containing low CNtot (900 mg kg-1 resulted in LOD equal to 3494 mg kg-1. Our results indicate that spectroscopic data in combination with PLS statistics can efficiently be used to predict Fe-CN concentrations in soil. We conclude that the protocol applied in this study can strongly reduce the time and costs essential for the spatial and vertical screening of the site affected by complexed Fe-CN.

  19. Quantitative evaluation of multiple adulterants in roasted coffee by Diffuse Reflectance Infrared Fourier Transform Spectroscopy (DRIFTS) and chemometrics.

    Science.gov (United States)

    Reis, Nádia; Franca, Adriana S; Oliveira, Leandro S

    2013-10-15

    The current study presents an application of Diffuse Reflectance Infrared Fourier Transform Spectroscopy for detection and quantification of fraudulent addition of commonly employed adulterants (spent coffee grounds, coffee husks, roasted corn and roasted barley) to roasted and ground coffee. Roasted coffee samples were intentionally blended with the adulterants (pure and mixed), with total adulteration levels ranging from 1% to 66% w/w. Partial Least Squares Regression (PLS) was used to relate the processed spectra to the mass fraction of adulterants and the model obtained provided reliable predictions of adulterations at levels as low as 1% w/w. A robust methodology was implemented that included the detection of outliers. High correlation coefficients (0.99 for calibration; 0.98 for validation) coupled with low degrees of error (1.23% for calibration; 2.67% for validation) confirmed that DRIFTS can be a valuable analytical tool for detection and quantification of adulteration in ground, roasted coffee. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  1. Drift wave turbulence studies on closed and open flux surfaces: effect limiter/divertor plates location

    International Nuclear Information System (INIS)

    Ribeiro, T.; Scott, B.

    2007-01-01

    The field line connection of a tokamak sheared magnetic field has an important impact on turbulence, by ensuring a finite parallel dynamical response for every degree of freedom available in the system. This constitutes the main property which distinguishes closed from open flux surfaces in such a device. In the latter case, the poloidal periodicity of the magnetic field is replaced by a Debye sheath arising where the field lines strike the limiter/divertor plates. This is enough to break the field line connection constraint and allow the existence of convective cell modes, leading to a change in the character of the turbulence from drift wave- (closed flux surfaces) to interchange-type (open flux surfaces), and hence increasing the turbulent transport observed. Here we study the effect of changing the poloidal position of the limiter/divertor plates, using the three-dimensional electromagnetic gyrofluid turbulence code GEM, which has time dependently self consistent field aligned flux tube coordinates. For the closed flux surfaces, the globally consistent periodic boundary conditions are invoked, and for open flux surfaces a standard Debye sheath is used at the striking points. In particular, the use of two limiter positions simultaneously, top and bottom, is in order, such to allow a separation between the inboard and outboard sides of the tokamak. This highlights the differences between those two regions of the tokamak, where the curvature is either favourable (former) or unfavourable (latter), and further makes room for future experimental qualitative comparisons, for instance, on double null configurations of the tokamak ASDEX Upgrade. (author)

  2. Measuring currents, ice drift, and waves from space: the Sea surface KInematics Multiscale monitoring (SKIM) concept

    Science.gov (United States)

    Ardhuin, Fabrice; Aksenov, Yevgueny; Benetazzo, Alvise; Bertino, Laurent; Brandt, Peter; Caubet, Eric; Chapron, Bertrand; Collard, Fabrice; Cravatte, Sophie; Delouis, Jean-Marc; Dias, Frederic; Dibarboure, Gérald; Gaultier, Lucile; Johannessen, Johnny; Korosov, Anton; Manucharyan, Georgy; Menemenlis, Dimitris; Menendez, Melisa; Monnier, Goulven; Mouche, Alexis; Nouguier, Frédéric; Nurser, George; Rampal, Pierre; Reniers, Ad; Rodriguez, Ernesto; Stopa, Justin; Tison, Céline; Ubelmann, Clément; van Sebille, Erik; Xie, Jiping

    2018-05-01

    We propose a satellite mission that uses a near-nadir Ka-band Doppler radar to measure surface currents, ice drift and ocean waves at spatial scales of 40 km and more, with snapshots at least every day for latitudes 75 to 82°, and every few days for other latitudes. The use of incidence angles of 6 and 12° allows for measurement of the directional wave spectrum, which yields accurate corrections of the wave-induced bias in the current measurements. The instrument's design, an algorithm for current vector retrieval and the expected mission performance are presented here. The instrument proposed can reveal features of tropical ocean and marginal ice zone (MIZ) dynamics that are inaccessible to other measurement systems, and providing global monitoring of the ocean mesoscale that surpasses the capability of today's nadir altimeters. Measuring ocean wave properties has many applications, including examining wave-current interactions, air-sea fluxes, the transport and convergence of marine plastic debris and assessment of marine and coastal hazards.

  3. Holocene Millennial-scale Surface and Bottom Water Variability, Feni Drift, NE Atlantic Ocean: Foraminiferal Assemblages

    Science.gov (United States)

    Lassen, S. J.; Richter, T. O.; de Stigter, H. C.; van Weering, T. C. E.; de Haas, H.

    A high-resolution sediment core from Feni Drift (ENAM9606, 56N 14W, 2543 m wa- ter depth) was investigated for planktonic and benthic foraminiferal assemblages dur- ing the last 12,000 years. During the Preboreal, peak abundances of T.quinqueloba indicate the passage of the Arctic front over the core site. Holocene planktonic foraminiferal assemblages indicate a gradual warming trend of surface water masses punctuated by a major cooling (8,200ky event s.l.), and possibly a slight cooling dur- ing the last 3,000 years. The interval from 10 to 5kyrs shows higher and fluctuating abundances of T.quinqueloba and G.bulloides, which suggest proximity of the subarc- tic front and enhanced spring blooms compared to the upper Holocene. Abundance peaks of N.pachyderma(s) and/or T.quinqueloba indicate a series of millennial-scale cooling events during the entire Holocene, which can be correlated to similar episodes previously described from other locations in the North Atlantic and Norwegian- Greenland Sea. Benthic foraminiferal assemblages indicate a gradual transition from seasonal, spring-bloom related food supply in the Lower Holocene (dominance of the phytodetritus species E.exigua) to possibly lower, but more sustained food supply in the Upper Holocene (dominance of C.obtusa and C.laevigata).

  4. Measuring currents, ice drift, and waves from space: the Sea surface KInematics Multiscale monitoring (SKIM concept

    Directory of Open Access Journals (Sweden)

    F. Ardhuin

    2018-05-01

    Full Text Available We propose a satellite mission that uses a near-nadir Ka-band Doppler radar to measure surface currents, ice drift and ocean waves at spatial scales of 40 km and more, with snapshots at least every day for latitudes 75 to 82°, and every few days for other latitudes. The use of incidence angles of 6 and 12° allows for measurement of the directional wave spectrum, which yields accurate corrections of the wave-induced bias in the current measurements. The instrument's design, an algorithm for current vector retrieval and the expected mission performance are presented here. The instrument proposed can reveal features of tropical ocean and marginal ice zone (MIZ dynamics that are inaccessible to other measurement systems, and providing global monitoring of the ocean mesoscale that surpasses the capability of today's nadir altimeters. Measuring ocean wave properties has many applications, including examining wave–current interactions, air–sea fluxes, the transport and convergence of marine plastic debris and assessment of marine and coastal hazards.

  5. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  6. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  7. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  8. Facile synthesis of surface N-doped Bi_2O_2CO_3: Origin of visible light photocatalytic activity and in situ DRIFTS studies

    International Nuclear Information System (INIS)

    Zhou, Ying; Zhao, Ziyan; Wang, Fang; Cao, Kun; Doronkin, Dmitry E.; Dong, Fan; Grunwaldt, Jan-Dierk

    2016-01-01

    Graphical abstract: Surfactant (CTAB) can induce nitrogen interstitially doping in the Bi_2O_2CO_3 surface, leading to the formation of localized states from N−O bond, which probably account for the origin of the visible light activity. Moreover, the photocatalytic NO oxidation processes over Bi_2O_2CO_3 were successfully monitored for the first time by in situ DRIFTS. - Highlights: • Interstitially doping N in the Bi_2O_2CO_3 surface was achieved at room temperature. • N-doped Bi_2O_2CO_3 exhibited significantly enhanced visible light photocatalytic activity compared to the pristine Bi_2O_2CO_3. • The formation of localized states from N−O bond could account for the visible light activity of Bi_2O_2CO_3. • The photocatalytic NO oxidation process was monitored by in situ DRIFTS. - Abstract: Bi_2O_2CO_3 nanosheets with exposed {001} facets were prepared by a facile room temperature chemical method. Due to the high oxygen atom density in {001} facets of Bi_2O_2CO_3, the addition of cetyltrimethylammonium bromide (CTAB) does not only influence the growth of crystalline Bi_2O_2CO_3, but also modifies the surface properties of Bi_2O_2CO_3 through the interaction between CTAB and Bi_2O_2CO_3. Nitrogen from CTAB as dopant interstitially incorporates in the Bi_2O_2CO_3 surface evidenced by both experimental and theoretical investigations. Hence, the formation of localized states from N−O bond improves the visible light absorption and charge separation efficiency, which leads to an enhancement of visible light photocatalytic activity toward to the degradation of Rhodamine B (RhB) and oxidation of NO. In addition, the photocatalytic NO oxidation over Bi_2O_2CO_3 nanosheets was successfully monitored for the first time using in situ diffuse reflectance infrared Fourier-transform spectroscopy (DRIFTS). Both bidentate and monodentate nitrates were identified on the surface of catalysts during the photocatalytic reaction process. The application of this strategy to

  9. Hierarchical Statistical 3D ' Atomistic' Simulation of Decanano MOSFETs: Drift-Diffusion, Hydrodynamic and Quantum Mechanical Approaches

    Science.gov (United States)

    Asenov, Asen; Brown, A. R.; Slavcheva, G.; Davies, J. H.

    2000-01-01

    When MOSFETs are scaled to deep submicron dimensions the discreteness and randomness of the dopant charges in the channel region introduces significant fluctuations in the device characteristics. This effect, predicted 20 year ago, has been confirmed experimentally and in simulation studies. The impact of the fluctuations on the functionality, yield, and reliability of the corresponding systems shifts the paradigm of the numerical device simulation. It becomes insufficient to simulate only one device representing one macroscopical design in a continuous charge approximation. An ensemble of macroscopically identical but microscopically different devices has to be characterized by simulation of statistically significant samples. The aims of the numerical simulations shift from predicting the characteristics of a single device with continuous doping towards estimating the mean values and the standard deviations of basic design parameters such as threshold voltage, subthreshold slope, transconductance, drive current, etc. for the whole ensemble of 'atomistically' different devices in the system. It has to be pointed out that even the mean values obtained from 'atomistic' simulations are not identical to the values obtained from continuous doping simulations. In this paper we present a hierarchical approach to the 'atomistic' simulation of aggressively scaled decanano MOSFETs. A full scale 3D drift-diffusion'atomostic' simulation approach is first described and used for verification of the more economical, but also more restricted, options. To reduce the processor time and memory requirements at high drain voltage we have developed a self-consistent option based on a thin slab solution of the current continuity equation only in the channel region. This is coupled to the Poisson's equation solution in the whole simulation domain in the Gummel iteration cycles. The accuracy of this approach is investigated in comparison with the full self-consistent solution. At low drain

  10. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  11. The Drift Diffusion Model can account for the accuracy and reaction time of value-based choices under high and low time pressure

    Directory of Open Access Journals (Sweden)

    Milica Milosavljevic

    2010-10-01

    Full Text Available An important open problem is how values are compared to make simple choices. A natural hypothesis is that the brain carries out the computations associated with the value comparisons in a manner consistent with the Drift Diffusion Model (DDM, since this model has been able to account for a large amount of data in other domains. We investigated the ability of four different versions of the DDM to explain the data in a real binary food choice task under conditions of high and low time pressure. We found that a seven-parameter version of the DDM can account for the choice and reaction time data with high-accuracy, in both the high and low time pressure conditions. The changes associated with the introduction of time pressure could be traced to changes in two key model parameters: the barrier height and the noise in the slope of the drift process.

  12. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  13. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  14. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  15. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  16. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  17. Prediction of galactic cosmic ray intensity variation for a few (up to 10-12 years ahead on the basis of convection-diffusion and drift model

    Directory of Open Access Journals (Sweden)

    L. I. Dorman

    2005-11-01

    Full Text Available We determine the dimension of the Heliosphere (modulation region, radial diffusion coefficient and other parameters of convection-diffusion and drift mechanisms of cosmic ray (CR long-term variation, depending on particle energy, the level of solar activity (SA and general solar magnetic field. This important information we obtain on the basis of CR and SA data in the past, taking into account the theory of convection-diffusion and drift global modulation of galactic CR in the Heliosphere. By using these results and the predictions which are regularly published elsewhere of expected SA variation in the near future and prediction of next future SA cycle, we may make a prediction of the expected in the near future long-term cosmic ray intensity variation. We show that by this method we may make a prediction of the expected in the near future (up to 10-12 years, and may be more, in dependence for what period can be made definite prediction of SA galactic cosmic ray intensity variation in the interplanetary space on different distances from the Sun, in the Earth's magnetosphere, and in the atmosphere at different altitudes and latitudes.

  18. A drift-diffusion-reaction model for excitonic photovoltaic bilayers: Photovoltaic bilayers: Asymptotic analysis and a 2D hdg finite element scheme

    KAUST Repository

    Brinkman, Daniel

    2013-05-01

    We present and discuss a mathematical model for the operation of bilayer organic photovoltaic devices. Our model couples drift-diffusion-recombination equations for the charge carriers (specifically, electrons and holes) with a reaction-diffusion equation for the excitons/polaron pairs and Poisson\\'s equation for the self-consistent electrostatic potential. The material difference (i.e. the HOMO/LUMO gap) of the two organic substrates forming the bilayer device is included as a work-function potential. Firstly, we perform an asymptotic analysis of the scaled one-dimensional stationary state system: (i) with focus on the dynamics on the interface and (ii) with the goal of simplifying the bulk dynamics away from the interface. Secondly, we present a two-dimensional hybrid discontinuous Galerkin finite element numerical scheme which is very well suited to resolve: (i) the material changes, (ii) the resulting strong variation over the interface, and (iii) the necessary upwinding in the discretization of drift-diffusion equations. Finally, we compare the numerical results with the approximating asymptotics. © 2013 World Scientific Publishing Company.

  19. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  20. II. Inhibited Diffusion Driven Surface Transmutations

    Science.gov (United States)

    Chubb, Talbot A.

    2006-02-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

  1. II. Inhibited diffusion driven surface transmutations

    International Nuclear Information System (INIS)

    Cubb, Talbot A.

    2006-01-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  2. II. Inhibited diffusion driven surface transmutations

    Energy Technology Data Exchange (ETDEWEB)

    Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

    2006-07-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  3. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  4. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  5. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  6. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  7. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  8. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  9. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  10. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  11. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  12. Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

    Science.gov (United States)

    Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

    2018-04-01

    The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

  13. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  14. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  15. Dike/Drift Interactions

    Energy Technology Data Exchange (ETDEWEB)

    E. Gaffiney

    2004-11-23

    This report presents and documents the model components and analyses that represent potential processes associated with propagation of a magma-filled crack (dike) migrating upward toward the surface, intersection of the dike with repository drifts, flow of magma in the drifts, and post-magma emplacement effects on repository performance. The processes that describe upward migration of a dike and magma flow down the drift are referred to as the dike intrusion submodel. The post-magma emplacement processes are referred to as the post-intrusion submodel. Collectively, these submodels are referred to as a conceptual model for dike/drift interaction. The model components and analyses of the dike/drift interaction conceptual model provide the technical basis for assessing the potential impacts of an igneous intrusion on repository performance, including those features, events, and processes (FEPs) related to dike/drift interaction (Section 6.1).

  16. Dike/Drift Interactions

    International Nuclear Information System (INIS)

    Gaffiney, E.

    2004-01-01

    This report presents and documents the model components and analyses that represent potential processes associated with propagation of a magma-filled crack (dike) migrating upward toward the surface, intersection of the dike with repository drifts, flow of magma in the drifts, and post-magma emplacement effects on repository performance. The processes that describe upward migration of a dike and magma flow down the drift are referred to as the dike intrusion submodel. The post-magma emplacement processes are referred to as the post-intrusion submodel. Collectively, these submodels are referred to as a conceptual model for dike/drift interaction. The model components and analyses of the dike/drift interaction conceptual model provide the technical basis for assessing the potential impacts of an igneous intrusion on repository performance, including those features, events, and processes (FEPs) related to dike/drift interaction (Section 6.1)

  17. Diffuse reflectance infrared fourier transform spectroscopic (DRIFTS) investigation of E.coli, Staphylococcus aureus and Candida albicans

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza, L.; PrabhaDevi; Kamat, T.; Naik, C.G.

    -quadrant streak pattern. Sample preparation and DRIFT spectroscopic analysis A single colony of culture cells in replicates of 5, were carefully removed from the fourth quadrant using a platinum loop. The cells were transferred into sterile glass vials... and dried in an incubator at 45°C for 30 min. Special care was taken to free samples completely from moisture by vacuum treatment using a Jouan lyophilizer (RC10-22, Heto DRYWINNER, France). Microbial cells weighing 0.9-1.3 mg dry weight was thoroughly...

  18. An electrodeless drift chamber

    International Nuclear Information System (INIS)

    Allison, J.; Barlow, R.J.; Bowdery, C.K.; Duerdoth, I.; Rowe, P.G.

    1982-01-01

    We describe a chamber in which the drift field is controlled by the deposition of electrostatic charge on an insulating surface. The chamber operates with good efficiency and precision for observed drift distances of up to 45 cm, promises to be extremely robust and adaptable and offers a very cheap way of making particle detectors. (orig.)

  19. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  20. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  1. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  2. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  3. Laboratory Course on Drift Chambers

    International Nuclear Information System (INIS)

    Garcia-Ferreira, Ix-B.; Garcia-Herrera, J.; Villasenor, L.

    2006-01-01

    Drift chambers play an important role in particle physics experiments as tracking detectors. We started this laboratory course with a brief review of the theoretical background and then moved on to the the experimental setup which consisted of a single-sided, single-cell drift chamber. We also used a plastic scintillator paddle, standard P-10 gas mixture (90% Ar, 10% CH4) and a collimated 90Sr source. During the laboratory session the students performend measurements of the following quantities: a) drift velocities and their variations as function of the drift field; b) gas gains and c) diffusion of electrons as they drifted in the gas

  4. Capabilities and limitations of handheld Diffuse Reflectance Infrared Fourier Transform Spectroscopy (DRIFTS) for the analysis of colourants and binders in 20th-century reverse paintings on glass

    Science.gov (United States)

    Steger, Simon; Stege, Heike; Bretz, Simone; Hahn, Oliver

    2018-04-01

    A non-invasive method has been carried out to show the capabilities and limitations of Diffuse Reflectance Infrared Fourier Transform Spectroscopy (DRIFTS) for identifying of colourants and binders in modern reverse glass paintings. For this purpose, the reverse glass paintings "Zwei Frauen am Tisch" (1920-22), "Bäume" (1946) (both by Heinrich Campendonk), "Lofoten" (1933) (Edith Campendonk-van Leckwyck) and "Ohne Titel" (1954) (Marianne Uhlenhuth), were measured. In contrast to other techniques (e.g. panel and mural painting), the paint layers are applied in reverse succession. In multi-layered paint systems, the front paint layer may no longer be accessible. The work points out the different spectral appearance of a given substance (gypsum, basic lead white) in reverse glass paintings. However, inverted bands, band overlapping and derivative-shaped spectral features can be interpreted by comparing the spectra from the paintings with spectra from pure powders and pigment/linseed oil mock-ups. Moreover, the work focuses on this method's capabilities in identifying synthetic organic pigments (SOP). Reference spectra of three common SOP (PG7, PY1, PR83) were obtained from powders and historical colour charts. We identified PR83 and PY1 in two reverse glass paintings, using the measured reference spectra. The recorded DRIFTS spectra of pure linseed oil, gum Arabic, mastic, polyvinyl acetate resin and bees wax can be used to classify the binding media of the measured paintings.

  5. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  6. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  7. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  8. Dike/Drift Interactions

    Energy Technology Data Exchange (ETDEWEB)

    E.S. Gaffney

    2003-10-08

    This report documents the model of events associated with a potential intrusion of magma from a volcanic dike into a drift or drifts in the Yucca Mountain Nuclear Waste Repository. The following topics are included in this report: (1) A discussion of dike propagation, which provides the basis for describing the path that a representative dike, or swarm of dikes, would follow during an event. (2) A discussion of magma flow, which evaluates the interaction at the junction of the propagating dike with the drift and the movement of magmatic products into and down drifts and, potentially, through a drift to the surface by way of access drift or a secondary dike opened up along the drift. (3) A discussion of gas flow and conductive cooling of a magma-filled drift, describing how an adjacent drift that has not been intersected by a dike could be affected by post-intrusion phenomena. Note that a gas flow analysis is also addressed in ''Igneous Intrusion Impacts on Waste Form and Waste Packages'' (BSC 2003 [DIRS 161810]), and those results are consistent with the results presented in this report.

  9. Dike/Drift Interactions

    International Nuclear Information System (INIS)

    E.S. Gaffney

    2003-01-01

    This report documents the model of events associated with a potential intrusion of magma from a volcanic dike into a drift or drifts in the Yucca Mountain Nuclear Waste Repository. The following topics are included in this report: (1) A discussion of dike propagation, which provides the basis for describing the path that a representative dike, or swarm of dikes, would follow during an event. (2) A discussion of magma flow, which evaluates the interaction at the junction of the propagating dike with the drift and the movement of magmatic products into and down drifts and, potentially, through a drift to the surface by way of access drift or a secondary dike opened up along the drift. (3) A discussion of gas flow and conductive cooling of a magma-filled drift, describing how an adjacent drift that has not been intersected by a dike could be affected by post-intrusion phenomena. Note that a gas flow analysis is also addressed in ''Igneous Intrusion Impacts on Waste Form and Waste Packages'' (BSC 2003 [DIRS 161810]), and those results are consistent with the results presented in this report

  10. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  11. The drift-diffusion interpretation of the electron current within the organic semiconductor characterized by the bulk single energy trap level

    Science.gov (United States)

    Cvikl, B.

    2010-01-01

    The closed solution for the internal electric field and the total charge density derived in the drift-diffusion approximation for the model of a single layer organic semiconductor structure characterized by the bulk shallow single trap-charge energy level is presented. The solutions for two examples of electric field boundary conditions are tested on room temperature current density-voltage data of the electron conducting aluminum/tris(8-hydroxyquinoline aluminum/calcium structure [W. Brütting et al., Synth. Met. 122, 99 (2001)] for which jexp∝Va3.4, within the interval of bias 0.4 V≤Va≤7. In each case investigated the apparent electron mobility determined at given bias is distributed within a given, finite interval of values. The bias dependence of the logarithm of their lower limit, i.e., their minimum values, is found to be in each case, to a good approximation, proportional to the square root of the applied electric field. On account of the bias dependence as incorporated in the minimum value of the apparent electron mobility the spatial distribution of the organic bulk electric field as well as the total charge density turn out to be bias independent. The first case investigated is based on the boundary condition of zero electric field at the electron injection interface. It is shown that for minimum valued apparent mobilities, the strong but finite accumulation of electrons close to the anode is obtained, which characterize the inverted space charge limited current (SCLC) effect. The second example refers to the internal electric field allowing for self-adjustment of its boundary values. The total electron charge density is than found typically to be of U shape, which may, depending on the parameters, peak at both or at either Alq3 boundary. It is this example in which the proper SCLC effect is consequently predicted. In each of the above two cases, the calculations predict the minimum values of the electron apparent mobility, which substantially

  12. Arsenic mobility in groundwater/surface water systems in carbonate-rich Pleistocene glacial drift aquifers (Michigan)

    International Nuclear Information System (INIS)

    Szramek, Kathryn; Walter, Lynn M.; McCall, Patti

    2004-01-01

    Within the Lower Peninsula of Michigan, groundwaters from the Marshall Formation (Mississippian) contain As derived from As-rich pyrites, often exceeding the World Heath Organization drinking water limit of 10 μg/L. Many Michigan watersheds, established on top of Pleistocene glacial drift derived from erosion of the underlying Marshall Formation, also have waters with elevated As. The Huron River watershed in southeastern Lower Michigan is a well characterized hydrogeochemical system of glacial drift deposits, proximate to the Marshall Fm. subcrop, which hosts carbonate-rich groundwaters, streams, and wetlands (fens), and well-developed soil profiles. Aqueous and solid phase geochemistry was determined for soils, soil waters, surface waters (streams and fens) and groundwaters from glacial drift aquifers to better understand the hydrogeologic and chemical controls on As mobility. Soil profiles established on the glacial drift exhibit enrichment in both Fe and As in the oxyhydroxide-rich zone of accumulation. The amounts of Fe and As present as oxyhydroxides are comparable to those reported from bulk Marshall Fm. core samples by previous workers. However, the As host in core samples is largely unaltered pyrite and arsenopyrite. This suggests that the transformation of Fe sulfides to Fe oxyhydroxides largely retains As and Fe at the oxidative weathering site. Groundwaters have the highest As values of all the waters sampled, and many were at or above the World Health limit. Most groundwaters are anaerobic, within the zones of Fe 3+ and As(V) reduction. Although reduction of Fe(III) oxyhydroxides is the probable source of As, there is no correlation between As and Fe concentrations. The As/Fe mole ratios in drift groundwaters are about an order of magnitude greater than those in soil profiles, suggesting that As is more mobile than Fe. This is consistent with the dominance of As(III) in these groundwaters and with the partitioning of Fe 2+ into carbonate cements. Soil

  13. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  14. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  15. Edge Plasma Simulations in NSTX and CTF: Synergy of Lithium Coating, Non-Diffusive Anomalous Transport and Drifts. Final Technical Report

    International Nuclear Information System (INIS)

    Pigarov, Alexander

    2012-01-01

    This is the final report for the Research Grant DE-FG02-08ER54989 'Edge Plasma Simulations in NSTX and CTF: Synergy of Lithium Coating, Non-Diffusive Anomalous Transport and Drifts'. The UCSD group including: A.Yu. Pigarov (PI), S.I. Krasheninnikov and R.D. Smirnov, was working on modeling of the impact of lithium coatings on edge plasma parameters in NSTX with the multi-species multi-fluid code UEDGE. The work was conducted in the following main areas: (i) improvements of UEDGE model for plasma-lithium interactions, (ii) understanding the physics of low-recycling divertor regime in NSTX caused by lithium pumping, (iii) study of synergistic effects with lithium coatings and non-diffusive ballooning-like cross-field transport, (iv) simulation of experimental multi-diagnostic data on edge plasma with lithium pumping in NSTX via self-consistent modeling of D-Li-C plasma with UEDGE, and (v) working-gas balance analysis. The accomplishments in these areas are given in the corresponding subsections in Section 2. Publications and presentations made under the Grant are listed in Section 3.

  16. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  17. Drifting through Basic Subprocesses of Reading: A Hierarchical Diffusion Model Analysis of Age Effects on Visual Word Recognition.

    Science.gov (United States)

    Froehlich, Eva; Liebig, Johanna; Ziegler, Johannes C; Braun, Mario; Lindenberger, Ulman; Heekeren, Hauke R; Jacobs, Arthur M

    2016-01-01

    Reading is one of the most popular leisure activities and it is routinely performed by most individuals even in old age. Successful reading enables older people to master and actively participate in everyday life and maintain functional independence. Yet, reading comprises a multitude of subprocesses and it is undoubtedly one of the most complex accomplishments of the human brain. Not surprisingly, findings of age-related effects on word recognition and reading have been partly contradictory and are often confined to only one of four central reading subprocesses, i.e., sublexical, orthographic, phonological and lexico-semantic processing. The aim of the present study was therefore to systematically investigate the impact of age on each of these subprocesses. A total of 1,807 participants (young, N = 384; old, N = 1,423) performed four decision tasks specifically designed to tap one of the subprocesses. To account for the behavioral heterogeneity in older adults, this subsample was split into high and low performing readers. Data were analyzed using a hierarchical diffusion modeling approach, which provides more information than standard response time/accuracy analyses. Taking into account incorrect and correct response times, their distributions and accuracy data, hierarchical diffusion modeling allowed us to differentiate between age-related changes in decision threshold, non-decision time and the speed of information uptake. We observed longer non-decision times for older adults and a more conservative decision threshold. More importantly, high-performing older readers outperformed younger adults at the speed of information uptake in orthographic and lexico-semantic processing, whereas a general age-disadvantage was observed at the sublexical and phonological levels. Low-performing older readers were slowest in information uptake in all four subprocesses. Discussing these results in terms of computational models of word recognition, we propose age

  18. Drifting through basic subprocesses of reading: A hierarchical diffusion model analysis of age effects on visual word recognition

    Directory of Open Access Journals (Sweden)

    Eva Froehlich

    2016-11-01

    Full Text Available Reading is one of the most popular leisure activities and it is routinely performed by most individuals even in old age. Successful reading enables older people to master and actively participate in everyday life and maintain functional independence. Yet, reading comprises a multitude of subprocesses and it is undoubtedly one of the most complex accomplishments of the human brain. Not surprisingly, findings of age-related effects on word recognition and reading have been partly contradictory and are often confined to only one of four central reading subprocesses, i.e., sublexical, orthographic, phonological and lexico-semantic processing. The aim of the present study was therefore to systematically investigate the impact of age on each of these subprocesses. A total of 1,807 participants (young, N = 384; old, N = 1,423 performed four decision tasks specifically designed to tap one of the subprocesses. To account for the behavioral heterogeneity in older adults, this subsample was split into high and low performing readers. Data were analyzed using a hierarchical diffusion modelling approach which provides more information than standard response times/accuracy analyses. Taking into account incorrect and correct response times, their distributions and accuracy data, hierarchical diffusion modelling allowed us to differentiate between age-related changes in decision threshold, non-decision time and the speed of information uptake. We observed longer non-decision times for older adults and a more conservative decision threshold. More importantly, high-performing older readers outperformed younger adults at the speed of information uptake in orthographic and lexico-semantic processing whereas a general age-disadvantage was observed at the sublexical and phonological levels. Low-performing older readers were slowest in information uptake in all four subprocesses. Discussing these results in terms of computational models of word recognition, we propose

  19. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  20. Impact of model resolution on simulated wind, drifting snow and surface mass balance in Terre Adélie, East Antarctica

    NARCIS (Netherlands)

    Lenaerts, J.T.M.|info:eu-repo/dai/nl/314850163; van den Broeke, M.R.|info:eu-repo/dai/nl/073765643; Scarchilli, C.; Agosta, C.

    2012-01-01

    This paper presents the impact of model resolution on the simulated wind speed, drifting snow climate and surface mass balance (SMB) of Terre Ad´elie and its surroundings, East Antarctica. We compare regional climate model simulations at 27 and 5.5 km resolution for the year 2009. The wind speed

  1. Drift Chambers detectors; Detectores de deriva

    Energy Technology Data Exchange (ETDEWEB)

    Duran, I; Martinez laso, L

    1989-07-01

    We present here a review of High Energy Physics detectors based on drift chambers. The ionization, drift diffusion, multiplication and detection principles are described. Most common drift media are analysed, and a classification of the detectors according to its geometry is done. Finally the standard read-out methods are displayed and the limits of the spatial resolution are discussed. (Author) 115 refs.

  2. A GENERALIZED TWO-COMPONENT MODEL OF SOLAR WIND TURBULENCE AND AB INITIO DIFFUSION MEAN-FREE PATHS AND DRIFT LENGTHSCALES OF COSMIC RAYS

    Energy Technology Data Exchange (ETDEWEB)

    Wiengarten, T.; Fichtner, H.; Kleimann, J.; Scherer, K. [Institut für Theoretische Physik IV, Ruhr-Universität Bochum (Germany); Oughton, S. [Department of Mathematics, University of Waikato, Hamilton 3240 (New Zealand); Engelbrecht, N. E. [Center for Space Research, North-West University, Potchefstroom 2520 (South Africa)

    2016-12-10

    We extend a two-component model for the evolution of fluctuations in the solar wind plasma so that it is fully three-dimensional (3D) and also coupled self-consistently to the large-scale magnetohydrodynamic equations describing the background solar wind. The two classes of fluctuations considered are a high-frequency parallel-propagating wave-like piece and a low-frequency quasi-two-dimensional component. For both components, the nonlinear dynamics is dominanted by quasi-perpendicular spectral cascades of energy. Driving of the fluctuations by, for example, velocity shear and pickup ions is included. Numerical solutions to the new model are obtained using the Cronos framework, and validated against previous simpler models. Comparing results from the new model with spacecraft measurements, we find improved agreement relative to earlier models that employ prescribed background solar wind fields. Finally, the new results for the wave-like and quasi-two-dimensional fluctuations are used to calculate ab initio diffusion mean-free paths and drift lengthscales for the transport of cosmic rays in the turbulent solar wind.

  3. A GENERALIZED TWO-COMPONENT MODEL OF SOLAR WIND TURBULENCE AND AB INITIO DIFFUSION MEAN-FREE PATHS AND DRIFT LENGTHSCALES OF COSMIC RAYS

    International Nuclear Information System (INIS)

    Wiengarten, T.; Fichtner, H.; Kleimann, J.; Scherer, K.; Oughton, S.; Engelbrecht, N. E.

    2016-01-01

    We extend a two-component model for the evolution of fluctuations in the solar wind plasma so that it is fully three-dimensional (3D) and also coupled self-consistently to the large-scale magnetohydrodynamic equations describing the background solar wind. The two classes of fluctuations considered are a high-frequency parallel-propagating wave-like piece and a low-frequency quasi-two-dimensional component. For both components, the nonlinear dynamics is dominanted by quasi-perpendicular spectral cascades of energy. Driving of the fluctuations by, for example, velocity shear and pickup ions is included. Numerical solutions to the new model are obtained using the Cronos framework, and validated against previous simpler models. Comparing results from the new model with spacecraft measurements, we find improved agreement relative to earlier models that employ prescribed background solar wind fields. Finally, the new results for the wave-like and quasi-two-dimensional fluctuations are used to calculate ab initio diffusion mean-free paths and drift lengthscales for the transport of cosmic rays in the turbulent solar wind.

  4. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  5. Estimation of annual heat flux balance at the sea surface from sst (NOAA-satellite and ships drift data off southeast Brazil

    Directory of Open Access Journals (Sweden)

    Yoshimine Ikeda

    1985-01-01

    Full Text Available The objective of this work is to study the possibility of estimating the heat flux balance at the sea surface from GOSSTCOMP (Global Ocean Sea Surface Temperature Computation developed by NOAA/NESS, USA, and sea surface current data based from ships drift information obtained from Pilot Charts, published by the Diretoria de Hidrografia e Navegação (DHN, Brazilian Navy. The annual mean value of the heat flux balance at the sea surface off southeast Brazil for 1977, is estimated from data on the balance between the heat transported by the currents and that transported by eddy diffusion for each volume defined as 2º x 2º (Lat. x Long. square with a constant depth equivalent to an oceanic mixed layer, 100 m thick. Results show several oceanic areas where there are net flows of heat from atmosphere towards the sea surface. In front of Rio de Janeiro the heat flow was downward and up to 70 ly day-1 and is probably related to the upwellirug phenomenon normally occurring in that area. Another coastal area between Lat. 25ºS to 28ºS indicated an downward flow up to 50 ly day-1; and for an area south of Lat. 27ºS, Long. 040ºW - 048ºW an downward flow up to 200 ly day-1, where the transfer was probably due to the cold water of a nortward flux from the Falkland (Malvinas Current. Results also show several oceanic areas where net flows of heat (of about -100 ly day-1 were toward the atmosphere. In the oceanic areas Lat. 19ºS - 23ºS and Lat. 24ºS - 30ºS, the flows were probably due to the warm water of a southward flux of the Brazil Current. The resulting fluxes from the warm waters of the Brazil Current when compared with those from warm waters of the Gulf Stream and Kuroshio, indicate that the Gulf Stream carries about 3.3 times and the Kuroshio 1.7 times more heat than the Brazil Current. These values agree with those of data available on the heat fluxes of the above mentioned Currents calculated by different methods (Budyko, 1974.

  6. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  7. On the physics of electron transfer (drift) in the substance: about the reason of “abnormal” fast transfer of electrons in the plasma of tokamak and at known Bohm’s diffusion

    Science.gov (United States)

    Boriev, I. A.

    2018-03-01

    An analysis of the problem of so-called “abnormal” fast transfer of electrons in tokamak plasma, which turned out much faster than the result of accepted calculation, is given. Such transfer of hot electrons leads to unexpectedly fast destruction of the inner tokamak wall with ejection of its matter in plasma volume, what violates a condition of plasma confinement for controlled thermonuclear fusion. It is shown, taking into account real physics of electron drift in the gas (plasma) and using the conservation law for momentum of electron transfer (drift), that the drift velocity of elastically scattered electrons should be significantly greater than that of accepted calculation. The reason is that the relaxation time of the momentum of electron transfer, to which the electron drift velocity is proportional, is significantly greater (from 16 up to 4 times) than the electron free path time. Therefore, generally accepted replacement of the relaxation time, which is unknown a priori, by the electron free path time, leads to significant (16 times for thermal electrons) underestimation of electron drift velocity (mobility). This result means, that transfer of elastically (and isotropically) scattered electrons in the gas phase should be so fast, and corresponds to multiplying coefficient (16), introduced by D. Bohm to explain the observed by him “abnormal” fast diffusion of electrons.

  8. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  9. Reducing Pesticide Drift

    Science.gov (United States)

    Provides information about pesticide spray drift, including problems associated with drift, managing risks from drift and the voluntary Drift Reduction Technology program that seeks to reduce spray drift through improved spray equipment design.

  10. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  11. Drift chamber

    International Nuclear Information System (INIS)

    Inagaki, Yosuke

    1977-01-01

    Drift chamber is becoming an important detector in high energy physics as a precision and fast position detector because of its high spatial resolution and count-rate. The basic principle is that it utilizes the drift at constant speed of electrons ionized along the tracks of charged particles towards the anode wire in the nearly uniform electric field. The method of measuring drift time includes the analog and digital ones. This report describes about the construction of and the application of electric field to the drift chamber, mathematical analysis on the electric field and equipotential curve, derivation of spatial resolution and the factor for its determination, and selection of gas to be used. The performance test of the chamber was carried out using a small test chamber, the collimated β source of Sr-90, and 500 MeV/C electron beam from the 1.3 GeV electron synchrotron in the Institute of Nuclear Study, University of Tokyo. Most chambers to date adopted one dimensional read-out, but it is very advantageous if the two dimensional read-out is feasible with one chamber when the resolution in that direction is low. The typical methods of delay line and charge division for two dimensional read-out are described. The development of digital read-out system is underway, which can process the signal of a large scale drift chamber at high speed. (Wakatsuki, Y.)

  12. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  13. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  14. CTF Void Drift Validation Study

    Energy Technology Data Exchange (ETDEWEB)

    Salko, Robert K. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Gosdin, Chris [Pennsylvania State Univ., University Park, PA (United States); Avramova, Maria N. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Gergar, Marcus [Pennsylvania State Univ., University Park, PA (United States)

    2015-10-26

    This milestone report is a summary of work performed in support of expansion of the validation and verification (V&V) matrix for the thermal-hydraulic subchannel code, CTF. The focus of this study is on validating the void drift modeling capabilities of CTF and verifying the supporting models that impact the void drift phenomenon. CTF uses a simple turbulent-diffusion approximation to model lateral cross-flow due to turbulent mixing and void drift. The void drift component of the model is based on the Lahey and Moody model. The models are a function of two-phase mass, momentum, and energy distribution in the system; therefore, it is necessary to correctly model the ow distribution in rod bundle geometry as a first step to correctly calculating the void distribution due to void drift.

  15. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  16. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  17. Drift-Scale Radionuclide Transport

    International Nuclear Information System (INIS)

    Houseworth, J.

    2004-01-01

    The purpose of this model report is to document the drift scale radionuclide transport model, taking into account the effects of emplacement drifts on flow and transport in the vicinity of the drift, which are not captured in the mountain-scale unsaturated zone (UZ) flow and transport models ''UZ Flow Models and Submodels'' (BSC 2004 [DIRS 169861]), ''Radionuclide Transport Models Under Ambient Conditions'' (BSC 2004 [DIRS 164500]), and ''Particle Tracking Model and Abstraction of Transport Process'' (BSC 2004 [DIRS 170041]). The drift scale radionuclide transport model is intended to be used as an alternative model for comparison with the engineered barrier system (EBS) radionuclide transport model ''EBS Radionuclide Transport Abstraction'' (BSC 2004 [DIRS 169868]). For that purpose, two alternative models have been developed for drift-scale radionuclide transport. One of the alternative models is a dual continuum flow and transport model called the drift shadow model. The effects of variations in the flow field and fracture-matrix interaction in the vicinity of a waste emplacement drift are investigated through sensitivity studies using the drift shadow model (Houseworth et al. 2003 [DIRS 164394]). In this model, the flow is significantly perturbed (reduced) beneath the waste emplacement drifts. However, comparisons of transport in this perturbed flow field with transport in an unperturbed flow field show similar results if the transport is initiated in the rock matrix. This has led to a second alternative model, called the fracture-matrix partitioning model, that focuses on the partitioning of radionuclide transport between the fractures and matrix upon exiting the waste emplacement drift. The fracture-matrix partitioning model computes the partitioning, between fractures and matrix, of diffusive radionuclide transport from the invert (for drifts without seepage) into the rock water. The invert is the structure constructed in a drift to provide the floor of the

  18. Projected Changes on the Global Surface Wave Drift Climate towards the END of the Twenty-First Century

    Science.gov (United States)

    Carrasco, Ana; Semedo, Alvaro; Behrens, Arno; Weisse, Ralf; Breivik, Øyvind; Saetra, Øyvind; Håkon Christensen, Kai

    2016-04-01

    The global wave-induced current (the Stokes Drift - SD) is an important feature of the ocean surface, with mean values close to 10 cm/s along the extra-tropical storm tracks in both hemispheres. Besides the horizontal displacement of large volumes of water the SD also plays an important role in the ocean mix-layer turbulence structure, particularly in stormy or high wind speed areas. The role of the wave-induced currents in the ocean mix-layer and in the sea surface temperature (SST) is currently a hot topic of air-sea interaction research, from forecast to climate ranges. The SD is mostly driven by wind sea waves and highly sensitive to changes in the overlaying wind speed and direction. The impact of climate change in the global wave-induced current climate will be presented. The wave model WAM has been forced by the global climate model (GCM) ECHAM5 wind speed (at 10 m height) and ice, for present-day and potential future climate conditions towards the end of the end of the twenty-first century, represented by the Intergovernmental Panel for Climate Change (IPCC) CMIP3 (Coupled Model Inter-comparison Project phase 3) A1B greenhouse gas emission scenario (usually referred to as a ''medium-high emissions'' scenario). Several wave parameters were stored as output in the WAM model simulations, including the wave spectra. The 6 hourly and 0.5°×0.5°, temporal and space resolution, wave spectra were used to compute the SD global climate of two 32-yr periods, representative of the end of the twentieth (1959-1990) and twenty-first (1969-2100) centuries. Comparisons of the present climate run with the ECMWF (European Centre for Medium-Range Weather Forecasts) ERA-40 reanalysis are used to assess the capability of the WAM-ECHAM5 runs to produce realistic SD results. This study is part of the WRCP-JCOMM COWCLIP (Coordinated Ocean Wave Climate Project) effort.

  19. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  20. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  1. A new multi-domain method based on an analytical control surface for linear and second-order mean drift wave loads on floating bodies

    Science.gov (United States)

    Liang, Hui; Chen, Xiaobo

    2017-10-01

    A novel multi-domain method based on an analytical control surface is proposed by combining the use of free-surface Green function and Rankine source function. A cylindrical control surface is introduced to subdivide the fluid domain into external and internal domains. Unlike the traditional domain decomposition strategy or multi-block method, the control surface here is not panelized, on which the velocity potential and normal velocity components are analytically expressed as a series of base functions composed of Laguerre function in vertical coordinate and Fourier series in the circumference. Free-surface Green function is applied in the external domain, and the boundary integral equation is constructed on the control surface in the sense of Galerkin collocation via integrating test functions orthogonal to base functions over the control surface. The external solution gives rise to the so-called Dirichlet-to-Neumann [DN2] and Neumann-to-Dirichlet [ND2] relations on the control surface. Irregular frequencies, which are only dependent on the radius of the control surface, are present in the external solution, and they are removed by extending the boundary integral equation to the interior free surface (circular disc) on which the null normal derivative of potential is imposed, and the dipole distribution is expressed as Fourier-Bessel expansion on the disc. In the internal domain, where the Rankine source function is adopted, new boundary integral equations are formulated. The point collocation is imposed over the body surface and free surface, while the collocation of the Galerkin type is applied on the control surface. The present method is valid in the computation of both linear and second-order mean drift wave loads. Furthermore, the second-order mean drift force based on the middle-field formulation can be calculated analytically by using the coefficients of the Fourier-Laguerre expansion.

  2. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  3. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  4. Upper ocean currents and sea surface temperatures (SST) from Satellite-tracked drifting buoys (drifters) as part of the Global Drifter Program for Hawaii region 1980/02/01 - 2009/03/31 (NODC Accession 0063296)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Satellite-tracked drifting buoys ("drifters") collect measurements of upper ocean currents and sea surface temperatures (SST) around the world as part of the Global...

  5. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  6. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  7. Magnetoresistance of films and strips with the diffuse surface scattering

    International Nuclear Information System (INIS)

    Aronov, A.G.

    1993-08-01

    Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs

  8. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  9. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  10. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  11. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  12. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  13. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  14. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  15. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  16. Energy drift in reversible time integration

    International Nuclear Information System (INIS)

    McLachlan, R I; Perlmutter, M

    2004-01-01

    Energy drift is commonly observed in reversible integrations of systems of molecular dynamics. We show that this drift can be modelled as a diffusion and that the typical energy error after time T is O(√T). (letter to the editor)

  17. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  18. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  19. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  20. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  1. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  2. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  3. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  4. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  5. Diffuse emission and control of copper in urban surface runoff.

    Science.gov (United States)

    Boller, M A; Steiner, M

    2002-01-01

    Copper washed off from roofs and roads is considered to be a major contribution to diffuse copper pollution of urban environments. In order to guarantee sustainable protection of soils and water, the long-term strategy is to avoid or replace copper containing materials on roofs and fagades. Until achievement of this goal, a special adsorber system is suggested to control the diffuse copper fluxes by retention of copper by a mixture of granulated iron-hydroxide (GEH) and calcium carbonate. Since future stormwater runoff concepts are based on decentralised runoff infiltration into the underground, solutions are proposed which provide for copper retention in infiltration sites using GEH adsorption layers. The example of a large copper façade of which the runoff is treated in an adsorption trench reveals the first full-scale data on façade runoff and adsorber performance. During the first year of investigation average façade runoff concentrations in the range of 1-10 mg Cu/l are reduced by 96-99% in the adsorption ditch.

  6. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  7. Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

    Science.gov (United States)

    Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

    2006-12-01

    Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

  8. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  9. Facile synthesis of surface N-doped Bi{sub 2}O{sub 2}CO{sub 3}: Origin of visible light photocatalytic activity and in situ DRIFTS studies

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Ying, E-mail: yzhou@swpu.edu.cn [State Key Laboratory of Oil and Gas Reservoir Geology and Exploitation, Southwest Petroleum University, Xindu Rd. 8, Chengdu 610500 (China); The Center of New Energy Materials and Technology, School of Materials Science and Engineering, Southwest Petroleum University, Xindu Rd. 8, Chengdu 610500 (China); Insititute for Chemical Technology and Polymer Chemistry, Karlsruhe Institute of Technology (KIT), 76131 Karlsruhe (Germany); Zhao, Ziyan [State Key Laboratory of Oil and Gas Reservoir Geology and Exploitation, Southwest Petroleum University, Xindu Rd. 8, Chengdu 610500 (China); The Center of New Energy Materials and Technology, School of Materials Science and Engineering, Southwest Petroleum University, Xindu Rd. 8, Chengdu 610500 (China); Wang, Fang; Cao, Kun [The Center of New Energy Materials and Technology, School of Materials Science and Engineering, Southwest Petroleum University, Xindu Rd. 8, Chengdu 610500 (China); Doronkin, Dmitry E. [Insititute for Chemical Technology and Polymer Chemistry, Karlsruhe Institute of Technology (KIT), 76131 Karlsruhe (Germany); Dong, Fan [College of Environmental and Biological Engineering, Chonqing Technology and Business University, Chongqing 400067 (China); Grunwaldt, Jan-Dierk, E-mail: grunwaldt@kit.edu [Insititute for Chemical Technology and Polymer Chemistry, Karlsruhe Institute of Technology (KIT), 76131 Karlsruhe (Germany)

    2016-04-15

    Graphical abstract: Surfactant (CTAB) can induce nitrogen interstitially doping in the Bi{sub 2}O{sub 2}CO{sub 3} surface, leading to the formation of localized states from N−O bond, which probably account for the origin of the visible light activity. Moreover, the photocatalytic NO oxidation processes over Bi{sub 2}O{sub 2}CO{sub 3} were successfully monitored for the first time by in situ DRIFTS. - Highlights: • Interstitially doping N in the Bi{sub 2}O{sub 2}CO{sub 3} surface was achieved at room temperature. • N-doped Bi{sub 2}O{sub 2}CO{sub 3} exhibited significantly enhanced visible light photocatalytic activity compared to the pristine Bi{sub 2}O{sub 2}CO{sub 3}. • The formation of localized states from N−O bond could account for the visible light activity of Bi{sub 2}O{sub 2}CO{sub 3}. • The photocatalytic NO oxidation process was monitored by in situ DRIFTS. - Abstract: Bi{sub 2}O{sub 2}CO{sub 3} nanosheets with exposed {001} facets were prepared by a facile room temperature chemical method. Due to the high oxygen atom density in {001} facets of Bi{sub 2}O{sub 2}CO{sub 3}, the addition of cetyltrimethylammonium bromide (CTAB) does not only influence the growth of crystalline Bi{sub 2}O{sub 2}CO{sub 3}, but also modifies the surface properties of Bi{sub 2}O{sub 2}CO{sub 3} through the interaction between CTAB and Bi{sub 2}O{sub 2}CO{sub 3}. Nitrogen from CTAB as dopant interstitially incorporates in the Bi{sub 2}O{sub 2}CO{sub 3} surface evidenced by both experimental and theoretical investigations. Hence, the formation of localized states from N−O bond improves the visible light absorption and charge separation efficiency, which leads to an enhancement of visible light photocatalytic activity toward to the degradation of Rhodamine B (RhB) and oxidation of NO. In addition, the photocatalytic NO oxidation over Bi{sub 2}O{sub 2}CO{sub 3} nanosheets was successfully monitored for the first time using in situ diffuse reflectance infrared Fourier

  10. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  11. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  12. Surface modification of polyethylene by diffuse barrier discharge plasma

    Czech Academy of Sciences Publication Activity Database

    Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

    2013-01-01

    Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

  13. Construction update and drift velocity calibration for the CLAS drift chamber system

    International Nuclear Information System (INIS)

    Mestayer, M.D.; Barbosa, F.J.; Bonneau, P.; Burtin, E.; Christo, S.; Doolittle, G.; Dytman, S.A.; Gilfoyle, G.P.; Hyde-Wright, C.E.; Klein, A.; Kossov, M.V.; Kuhn, S.E.; Magahiz, R.; Miskimen, R.A.; Murphy, L.Y.; O'Meara, J.E.; Pyron, T.D.; Qin, L.; Raue, B.A.; Schumacher, R.A.; Tuzel, W.; Weinstein, L.B.; Yegneswaran, A.

    1995-01-01

    We briefly describe the drift chamber system for the CLAS detector at CEBAF, concentrating on the method which will be used to calibrate the drift velocity function. We identify key features of the function which should apply to any small-cell drift chamber geometry in which the cathode and anode surfaces are wires. Using these ideas, we describe a simple method to compensate for variations in the drift velocity function due to environmental changes. (orig.)

  14. Construction update and drift velocity calibration for the CLAS drift chamber system

    Energy Technology Data Exchange (ETDEWEB)

    Mestayer, M.D. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Barbosa, F.J. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Bonneau, P. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Burtin, E. [University of South Carolina, Columbia, SC (United States); Christo, S. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Doolittle, G. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Dytman, S.A. [University of Pittsburg, Pittsburg, PA (United States); Gilfoyle, G.P. [University of Richmond, Richmond, VA (United States); Hyde-Wright, C.E. [Old Dominion University, Norfolk, VA (United States); Klein, A. [Old Dominion University, Norfolk, VA (United States); Kossov, M.V. [Christopher Newport University, Newport News, VA (United States); Kuhn, S.E. [Old Dominion University, Norfolk, VA (United States); Magahiz, R. [Carnegie-Mellon Univ., Pittsburgh, PA (United States); Miskimen, R.A. [University of Massachussetts, Amherst, MA (United States); Murphy, L.Y. [CE Saclay, Gif sur Yvette (France); O`Meara, J.E. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Pyron, T.D. [Old Dominion University, Norfolk, VA (United States); Qin, L. [Old Dominion University, Norfolk, VA (United States); Raue, B.A. [Old Dominion University, Norfolk, VA (United States); Schumacher, R.A. [Carnegie-Mellon Univ., Pittsburgh, PA (United States); Tuzel, W. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Weinstein, L.B. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States); Yegneswaran, A. [Continuous Electron Beam Accelerator Facility, Newport News, VA (United States)

    1995-12-11

    We briefly describe the drift chamber system for the CLAS detector at CEBAF, concentrating on the method which will be used to calibrate the drift velocity function. We identify key features of the function which should apply to any small-cell drift chamber geometry in which the cathode and anode surfaces are wires. Using these ideas, we describe a simple method to compensate for variations in the drift velocity function due to environmental changes. (orig.).

  15. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  16. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  17. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  18. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  20. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  1. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  2. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  3. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  4. Mean-Square Convergence of Drift-Implicit One-Step Methods for Neutral Stochastic Delay Differential Equations with Jump Diffusion

    Directory of Open Access Journals (Sweden)

    Lin Hu

    2011-01-01

    Full Text Available A class of drift-implicit one-step schemes are proposed for the neutral stochastic delay differential equations (NSDDEs driven by Poisson processes. A general framework for mean-square convergence of the methods is provided. It is shown that under certain conditions global error estimates for a method can be inferred from estimates on its local error. The applicability of the mean-square convergence theory is illustrated by the stochastic θ-methods and the balanced implicit methods. It is derived from Theorem 3.1 that the order of the mean-square convergence of both of them for NSDDEs with jumps is 1/2. Numerical experiments illustrate the theoretical results. It is worth noting that the results of mean-square convergence of the stochastic θ-methods and the balanced implicit methods are also new.

  5. Scaling and diffusion of oil spills in the Ocean Surface

    Science.gov (United States)

    Tarquis, A. M.; Platonov, A.; Grau, J.; Sekula, E.

    2010-05-01

    The region of the Gulf of Lions at the northwestern Mediterranean Sea has been studied within a ten-year period from December 1996 until November 2006. More than 1000 synthetic aperture radar (SAR) images, which have been acquired by the Second European Remote Sensing Satellite (ERS 1/2) as well as from ENVISAT. We present statistical results of the structure of several features revealed by SAR such as oil spills and tensioactive slicks dynamic. We compare oil splils obtained from the projects Clean Seas,ENVA4/CT/0334, RC2003/005700, ESP2005/07551 and ESA/AO/IP2240. Since natural (caused by plankton, fish, etc.) slicks as well as man-made oil slicks dampen the small-scale surface waves, which are responsible for the radar backscattering from the ocean surface, both types of effects may be confused and give look/alike false oil spill detections. The early SAR images were processed at a resolution of 1 pixel=200m and were provided by the RApid Information Dissemination System (RAIDS) SAR processing facility in West Freugh, UK. Recent ENVISAT images directly from ESA allow a higher resolution of 1 pixel = 26 m, improving the detected turbulent scaling range. The occurrence of marine oil pollution as well as several dynamic features near Barcelona (frames 8-10, 19, 20; 200 SAR images)is itself a random multi-scale process. The use of different multifractal techniques, both using limits to the smallest and largest available scales, show that the scaling laws are very complex and depend strongly on intermittency of the assumed turbulent cascade, the shapes of the multifractal spectra functions are seen to deviate from an homogeneous multifractal and depend both on the initial conditions of the spill or slick, and on the transit time that the spill has been subjected to the local turbulence.

  6. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  7. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  8. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  9. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  10. INTRODUCTION: Surface Dynamics, Phonons, Adsorbate Vibrations and Diffusion

    Science.gov (United States)

    Bruch, L. W.

    2004-07-01

    understanding of the underlying factors determining the optical quality of GaInNAs, such as composition, growth and annealing conditions. We are still far from establishing an understanding of the band structure and its dependence on composition. Fundamental electronic interactions such as electron-electron and electron-phonon scattering, dependence of effective mass on composition, strain and orientation, quantum confinement effects, effects of localized nitrogen states on high field transport and on galvanometric properties, and mechanisms for light emission in these materials, are yet to be fully understood. Nature and formation mechanisms of grown-in and processing-induced defects that are important for material quality and device performance are still unknown. Such knowledge is required in order to design strategies to efficiently control and eliminate harmful defects. For many potential applications (such as solar cells, HBTs) it is essential to get more information on the transport properties of dilute nitride materials. The mobility of minority carriers is known to be low in GaInNAs and related material. The experimental values are far from reaching the theoretical ones, due to defects and impurities introduced in the material during the growth. The role of the material inhomogeneities on the lateral carrier transport also needs further investigation. From the device's point of view most attention to date has been focused on the GaInNAs/GaAs system, mainly because of its potential for optoelectronic devices covering the 1.3-1.55 µm data and telecommunications wavelength bands. As is now widely appreciated, these GaAs-compatible structures allow monolithic integration of AlGaAs-based distributed Bragg reflector mirrors (DBRs) for vertical cavity surface-emitting lasers with low temperature sensitivity and compatibility with AlOx-based confinement techniques. In terms of conventional edge-emitting lasers (EELs), the next step is to extend the wavelength range for cw room

  11. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  12. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  13. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  14. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  15. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  16. Bio-optical properties of Arctic drift ice and surface waters north of Svalbard from winter to spring

    Science.gov (United States)

    Kowalczuk, Piotr; Meler, Justyna; Kauko, Hanna M.; Pavlov, Alexey K.; Zabłocka, Monika; Peeken, Ilka; Dybwad, Christine; Castellani, Giulia; Granskog, Mats A.

    2017-06-01

    We have quantified absorption by CDOM, aCDOM(λ), particulate matter, ap(λ), algal pigments, aph(λ), and detrital material, aNAP(λ), coincident with chlorophyll a in sea ice and surface waters in winter and spring 2015 in the Arctic Ocean north of Svalbard. The aCDOM(λ) was low in contrast to other regions of the Arctic Ocean, while ap(λ) has the largest contribution to absorption variability in sea ice and surface waters. ap(443) was 1.4-2.8 times and 1.3-1.8 times higher than aCDOM(443) in surface water and sea ice, respectively. aph(λ) contributed 90% and 81% to ap(λ), in open leads and under-ice waters column, and much less (53%-74%) in sea ice, respectively. Both aCDOM(λ) and ap(λ) followed closely the vertical distribution of chlorophyll a in sea ice and the water column. We observed a tenfold increase of the chlorophyll a concentration and nearly twofold increase in absorption at 443 nm in sea ice from winter to spring. The aCDOM(λ) dominated the absorption budget in the UV both in sea ice and surface waters. In the visible range, absorption was dominated by aph(λ), which contributed more than 50% and aCDOM(λ), which contributed 43% to total absorption in water column. Detrital absorption contributed significantly (33%) only in surface ice layer. Algae dynamics explained more than 90% variability in ap(λ) and aph(λ) in water column, but less than 70% in the sea ice. This study presents detailed absorption budget that is relevant for modeling of radiative transfer and primary production.

  17. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  18. A comprehensive evaluation of water uptake on atmospherically relevant mineral surfaces: DRIFT spectroscopy, thermogravimetric analysis and aerosol growth measurements

    Directory of Open Access Journals (Sweden)

    R. J. Gustafsson

    2005-01-01

    Full Text Available The hygroscopicity of mineral aerosol samples has been examined by three independent methods: diffuse reflectance infrared Fourier transform spectroscopy, thermogravimetric analysis and differential mobility analysis. All three methods allow an evaluation of the water coverage of two samples, CaCO3 and Arizona Test dust, as a function of relative humidity. For the first time, a correlation between absolute gravimetric measurements and the other two (indirect methods has been established. Water uptake isotherms were reliably determined for both solids which at 298 K and 80% relative humidity exhibited similar coverages of ~4 monolayers. However, the behaviour at low relative humidity was markedly different in the two cases, with Arizona Test Dust showing a substantially higher affinity for water in the contact layer. This is understandable in terms of the chemical composition of these two materials. The mobility analysis results are in good accord with field observations and with our own spectroscopic and gravimetric measurements. These findings are of value for an understanding of atmospheric chemical processes.

  19. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  20. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  1. Surface drift prediction in the Adriatic Sea using hyper-ensemble statistics on atmospheric, ocean and wave models: Uncertainties and probability distribution areas

    Science.gov (United States)

    Rixen, M.; Ferreira-Coelho, E.; Signell, R.

    2008-01-01

    Despite numerous and regular improvements in underlying models, surface drift prediction in the ocean remains a challenging task because of our yet limited understanding of all processes involved. Hence, deterministic approaches to the problem are often limited by empirical assumptions on underlying physics. Multi-model hyper-ensemble forecasts, which exploit the power of an optimal local combination of available information including ocean, atmospheric and wave models, may show superior forecasting skills when compared to individual models because they allow for local correction and/or bias removal. In this work, we explore in greater detail the potential and limitations of the hyper-ensemble method in the Adriatic Sea, using a comprehensive surface drifter database. The performance of the hyper-ensembles and the individual models are discussed by analyzing associated uncertainties and probability distribution maps. Results suggest that the stochastic method may reduce position errors significantly for 12 to 72??h forecasts and hence compete with pure deterministic approaches. ?? 2007 NATO Undersea Research Centre (NURC).

  2. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  3. Double Diffusive Natural Convection in a Nuclear Waste Repository

    International Nuclear Information System (INIS)

    Y. Hao; J. Nitao; T.A. Buscheck; Y. Sun

    2006-01-01

    In this study, we conduct a two-dimensional numerical analysis of double diffusive natural convection in an emplacement drift for a nuclear waste repository. In-drift heat and moisture transport is driven by combined thermal- and compositional-induced buoyancy forces. Numerical results demonstrate buoyancy-driven convective flow patterns and configurations during both repository heat-up and cool-down phases. It is also shown that boundary conditions, particularly on the drip-shield surface, have strong impacts on the in-drift convective flow and transport

  4. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  5. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  6. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  7. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  8. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  9. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  10. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  12. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  13. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  14. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  15. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  16. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  17. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  18. Drift estimation from a simple field theory

    International Nuclear Information System (INIS)

    Mendes, F. M.; Figueiredo, A.

    2008-01-01

    Given the outcome of a Wiener process, what can be said about the drift and diffusion coefficients? If the process is stationary, these coefficients are related to the mean and variance of the position displacements distribution. However, if either drift or diffusion are time-dependent, very little can be said unless some assumption about that dependency is made. In Bayesian statistics, this should be translated into some specific prior probability. We use Bayes rule to estimate these coefficients from a single trajectory. This defines a simple, and analytically tractable, field theory.

  19. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  20. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  1. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  2. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  3. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  4. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  5. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  6. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  7. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  8. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  9. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  10. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  11. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  12. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  13. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  14. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  15. Optimization of drift gases for accuracy in pressurized drift tubes

    CERN Document Server

    Kirchner, J J; Dinner, A R; Fidkowski, K J; Wyatt, J H

    2001-01-01

    Modern detectors such as ATLAS use pressurized drift tubes to minimize diffusion and achieve high coordinate accuracy. However, the coordinate accuracy depends on the exact knowledge of converting measured times into coordinates. Linear space-time relationships are best for reconstruction, but difficult to achieve in the $E \\propto \\frac{1}{r}$ field. Previous mixtures, which contained methane or other organic quenchers, are disfavored because of ageing problems. From our studies of nitrogen and carbon dioxide, two mixtures with only small deviations from linearity were determined and measured. Scaling laws for different pressures and magnetic fields are also given.

  16. Optimization of drift gases for accuracy in pressurized drift tubes

    International Nuclear Information System (INIS)

    Kirchner, J.J.; Becker, U.J.; Dinner, R.B.; Fidkowski, K.J.; Wyatt, J.H.

    2001-01-01

    Modern detectors such as ATLAS use pressurized drift tubes to minimize diffusion and achieve high coordinate accuracy. However, the coordinate accuracy depends on the exact knowledge of converting measured times into coordinates. Linear space-time relationships are best for reconstruction, but difficult to achieve in the E∝1/r field. Previous mixtures, which contained methane or other organic quenchers, are disfavored because of ageing problems. From our studies of nitrogen and carbon dioxide, two mixtures with only small deviations from linearity were determined and measured. Scaling laws for different pressures and magnetic fields are also given

  17. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  18. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  19. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  20. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  1. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  2. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  3. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  4. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  5. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  6. The Drift Burst Hypothesis

    OpenAIRE

    Christensen, Kim; Oomen, Roel; Renò, Roberto

    2016-01-01

    The Drift Burst Hypothesis postulates the existence of short-lived locally explosive trends in the price paths of financial assets. The recent US equity and Treasury flash crashes can be viewed as two high profile manifestations of such dynamics, but we argue that drift bursts of varying magnitude are an expected and regular occurrence in financial markets that can arise through established mechanisms such as feedback trading. At a theoretical level, we show how to build drift bursts into the...

  7. Rectangular drift tube characteristics

    International Nuclear Information System (INIS)

    Denisov, D.S.; Musienko, Yu.V.

    1985-01-01

    Results on the study of the characteristics of a 50 x 100 mm aluminium drift tube are presented. The tube was filled with argon-methane and argon-isobutane mixtures. With 16 per cent methane concentration the largest deviation from a linear relation between the drift time and the drift path over 50 mm is less than 2 mm. The tube filled with argon-isobutane mixture is capable of operating in a limited streamer mode

  8. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  9. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  10. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  11. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  12. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  13. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  14. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  15. Drift Degradation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Dwayne C. Kicker

    2001-09-28

    A statistical description of the probable block sizes formed by fractures around the emplacement drifts has been developed for each of the lithologic units of the repository host horizon. A range of drift orientations with the drift azimuth varied in 15{sup o} increments has been considered in the static analysis. For the quasi-static seismic analysis, and the time-dependent and thermal effects analysis, two drift orientations have been considered: a drift azimuth of 105{sup o} and the current emplacement drift azimuth of 75{sup o}. The change in drift profile resulting from progressive deterioration of the emplacement drifts has been assessed both with and without backfill. Drift profiles have been determined for four different time increments, including static (i.e., upon excavation), 200 years, 2,000 years, and 10,000 years. The effect of seismic events on rock fall has been analyzed. Block size distributions and drift profiles have been determined for three seismic levels, including a 1,000-year event, a 5,000-year event, and a 10,000-year event. Data developed in this modeling and analysis activity have been entered into the TDMS (DTN: MO0109RDDAAMRR.003). The following conclusions have resulted from this drift degradation analysis: (1) The available fracture data are suitable for supporting a detailed key block analysis of the repository host horizon rock mass. The available data from the north-south Main Drift and the east-west Cross Drift provide a sufficient representative fracture sample of the repository emplacement drift horizon. However, the Tptpln fracture data are only available from a relatively small section of the Cross Drift, resulting in a smaller fracture sample size compared to the other lithologic units. This results in a lower degree of confidence that the key block data based on the Tptpln data set is actually representative of the overall Tptpln key block population. (2) The seismic effect on the rock fall size distribution for all events

  16. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  17. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  18. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  19. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  20. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  1. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  2. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  3. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  4. Modeling concept drift

    DEFF Research Database (Denmark)

    Borchani, Hanen; Martinez, Ana Maria; Masegosa, Andrés R.

    2015-01-01

    An often used approach for detecting and adapting to concept drift when doing classification is to treat the data as i.i.d. and use changes in classification accuracy as an indication of concept drift. In this paper, we take a different perspective and propose a framework, based on probabilistic ...... data set from a Spanish bank....

  5. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  6. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  7. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  8. Time dependent drift Hamiltonian

    International Nuclear Information System (INIS)

    Boozer, A.H.

    1982-04-01

    The motion of individual charged particles in a given magnetic and an electric fields is discussed. An idea of a guiding center distribution function f is introduced. The guiding center distribution function is connected to the asymptotic Hamiltonian through the drift kinetic equation. The general non-stochastic magnetic field can be written in a contravariant and a covariant forms. The drift Hamiltonian is proposed, and the canonical gyroradius is presented. The proposed drift Hamiltonian agrees with Alfven's drift velocity to lowest non-vanishing order in the gyroradius. The relation between the exact, time dependent equations of motion and the guiding center equation is clarified by a Lagrangian analysis. The deduced Lagrangian represents the drift motion. (Kato, T.)

  9. Abstraction of Drift Seepage

    International Nuclear Information System (INIS)

    J.T. Birkholzer

    2004-01-01

    This model report documents the abstraction of drift seepage, conducted to provide seepage-relevant parameters and their probability distributions for use in Total System Performance Assessment for License Application (TSPA-LA). Drift seepage refers to the flow of liquid water into waste emplacement drifts. Water that seeps into drifts may contact waste packages and potentially mobilize radionuclides, and may result in advective transport of radionuclides through breached waste packages [''Risk Information to Support Prioritization of Performance Assessment Models'' (BSC 2003 [DIRS 168796], Section 3.3.2)]. The unsaturated rock layers overlying and hosting the repository form a natural barrier that reduces the amount of water entering emplacement drifts by natural subsurface processes. For example, drift seepage is limited by the capillary barrier forming at the drift crown, which decreases or even eliminates water flow from the unsaturated fractured rock into the drift. During the first few hundred years after waste emplacement, when above-boiling rock temperatures will develop as a result of heat generated by the decay of the radioactive waste, vaporization of percolation water is an additional factor limiting seepage. Estimating the effectiveness of these natural barrier capabilities and predicting the amount of seepage into drifts is an important aspect of assessing the performance of the repository. The TSPA-LA therefore includes a seepage component that calculates the amount of seepage into drifts [''Total System Performance Assessment (TSPA) Model/Analysis for the License Application'' (BSC 2004 [DIRS 168504], Section 6.3.3.1)]. The TSPA-LA calculation is performed with a probabilistic approach that accounts for the spatial and temporal variability and inherent uncertainty of seepage-relevant properties and processes. Results are used for subsequent TSPA-LA components that may handle, for example, waste package corrosion or radionuclide transport

  10. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  11. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  12. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  13. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  14. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  15. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  16. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  17. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  18. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  19. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  20. Ponderomotive modification of drift tearing modes

    International Nuclear Information System (INIS)

    Urquijo, G.; Singh, R.; Sen, A.

    1997-01-01

    The linear characteristics of drift tearing modes are investigated in the presence of a significant background of radio-frequency (RF) waves in the ion cyclotron range of frequencies. The ponderomotive force, arising from the radial gradients in the RF field energy, is found to significantly modify the inner layer solutions of the drift tearing modes. It can have a stabilizing influence, even at moderate RF powers, provided the field energy has a decreasing radial profile at the mode rational surface. (author)

  1. Properties of low-pressure drift chambers

    International Nuclear Information System (INIS)

    Breskin, A.; Trautner, N.

    1976-01-01

    Drift chambers operated with methylal vapour or ethylene at pressures in the range of 10-110 torr are described. A systematic study of position resolution, pulse height and rise time shows that especially for ethylene they are strongly influenced by electron diffusion. Intrinsic position resolution was found to be at least as good as found at atmospheric pressure. A relative pulse height resolution of 10% was obtained with 5.5 MeV alpha-particles. A simple mathematical model which can describe the processes in the drift chamber is presented. (Auth.)

  2. Drift Degradation Analysis

    International Nuclear Information System (INIS)

    G.H. Nieder-Westermann

    2005-01-01

    The outputs from the drift degradation analysis support scientific analyses, models, and design calculations, including the following: (1) Abstraction of Drift Seepage; (2) Seismic Consequence Abstraction; (3) Structural Stability of a Drip Shield Under Quasi-Static Pressure; and (4) Drip Shield Structural Response to Rock Fall. This report has been developed in accordance with ''Technical Work Plan for: Regulatory Integration Modeling of Drift Degradation, Waste Package and Drip Shield Vibratory Motion and Seismic Consequences'' (BSC 2004 [DIRS 171520]). The drift degradation analysis includes the development and validation of rockfall models that approximate phenomenon associated with various components of rock mass behavior anticipated within the repository horizon. Two drift degradation rockfall models have been developed: the rockfall model for nonlithophysal rock and the rockfall model for lithophysal rock. These models reflect the two distinct types of tuffaceous rock at Yucca Mountain. The output of this modeling and analysis activity documents the expected drift deterioration for drifts constructed in accordance with the repository layout configuration (BSC 2004 [DIRS 172801])

  3. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from Surface underway observations using Barometric pressure sensor, Carbon dioxide (CO2) gas analyzer and other instruments from the Drifting Buoy in the Indian Ocean, South Atlantic Ocean and others from 2001-11-20 to 2007-05-08 (NODC Accession 0117495)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0117495 includes Surface underway, biological, chemical, meteorological and physical data collected from Drifting Buoy in the Indian Ocean, South...

  4. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  5. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  6. Collisional drift fluids and drift waves

    International Nuclear Information System (INIS)

    Pfirsch, D.; Correa-Restrepo, D.

    1995-05-01

    The usual theoretical description of drift-wave turbulence (considered to be one possible cause of anomalous transport in a plasma), e.g. the Hasegawa-Wakatani theory, makes use of various approximations, the effect of which is extremely difficult to assess. This concerns in particular the conservation laws for energy and momentum. The latter is important as concerns charge separation and resulting electric fields which are possibly related to the L-H transition. Energy conservation is crucial for the stability behaviour; it will be discussed via an example. New collisional multispecies drift-fluid equations were derived by a new method which yields in a transparent way conservation of energy and total angular momentum, and the law for energy dissipation. Both electrostatic and electromagnetic field variations are considered. The method is based primarily on a Lagrangian for dissipationless fluids in drift approximation with isotropic pressures. The dissipative terms are introduced by adding corresponding terms to the ideal equations of motion and of the pressures. The equations of motion, of course, no longer result from a Lagrangian via Hamilton's principle. Their relation to the ideal equations imply, however, also a relation to the ideal Lagrangian of which one can take advantage. Instead of introducing heat conduction one can also assume isothermal behaviour, e.g. T ν (x)=const. Assumptions of this kind are often made in the literature. The new method of introducing dissipation is not restricted to the present kind of theories; it can equally well be applied to theories such as multi-fluid theories without using the drift approximation of the present paper. Linear instability is investigated via energy considerations and the implications of taking ohmic resistivity into account are discussed. (orig./WL)

  7. Electron Drift Properties in High Pressure Gaseous Xenon

    Energy Technology Data Exchange (ETDEWEB)

    Simón, A.; et al.

    2018-04-05

    Gaseous time projection chambers (TPC) are a very attractive detector technology for particle tracking. Characterization of both drift velocity and diffusion is of great importance to correctly assess their tracking capabilities. NEXT-White is a High Pressure Xenon gas TPC with electroluminescent amplification, a 1:2 scale model of the future NEXT-100 detector, which will be dedicated to neutrinoless double beta decay searches. NEXT-White has been operating at Canfranc Underground Laboratory (LSC) since December 2016. The drift parameters have been measured using $^{83m}$Kr for a range of reduced drift fields at two different pressure regimes, namely 7.2 bar and 9.1 bar. The results have been compared with Magboltz simulations. Agreement at the 5% level or better has been found for drift velocity, longitudinal diffusion and transverse diffusion.

  8. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  9. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  10. Noise-induced drift in two-dimensional anisotropic systems

    Science.gov (United States)

    Farago, Oded

    2017-10-01

    We study the isothermal Brownian dynamics of a particle in a system with spatially varying diffusivity. Due to the heterogeneity of the system, the particle's mean displacement does not vanish even if it does not experience any physical force. This phenomenon has been termed "noise-induced drift," and has been extensively studied for one-dimensional systems. Here, we examine the noise-induced drift in a two-dimensional anisotropic system, characterized by a symmetric diffusion tensor with unequal diagonal elements. A general expression for the mean displacement vector is derived and presented as a sum of two vectors, depicting two distinct drifting effects. The first vector describes the tendency of the particle to drift toward the high diffusivity side in each orthogonal principal diffusion direction. This is a generalization of the well-known expression for the noise-induced drift in one-dimensional systems. The second vector represents a novel drifting effect, not found in one-dimensional systems, originating from the spatial rotation in the directions of the principal axes. The validity of the derived expressions is verified by using Langevin dynamics simulations. As a specific example, we consider the relative diffusion of two transmembrane proteins, and demonstrate that the average distance between them increases at a surprisingly fast rate of several tens of micrometers per second.

  11. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  12. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  13. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  14. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  15. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  16. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  17. Drift Scale THM Model

    International Nuclear Information System (INIS)

    Rutqvist, J.

    2004-01-01

    This model report documents the drift scale coupled thermal-hydrological-mechanical (THM) processes model development and presents simulations of the THM behavior in fractured rock close to emplacement drifts. The modeling and analyses are used to evaluate the impact of THM processes on permeability and flow in the near-field of the emplacement drifts. The results from this report are used to assess the importance of THM processes on seepage and support in the model reports ''Seepage Model for PA Including Drift Collapse'' and ''Abstraction of Drift Seepage'', and to support arguments for exclusion of features, events, and processes (FEPs) in the analysis reports ''Features, Events, and Processes in Unsaturated Zone Flow and Transport and Features, Events, and Processes: Disruptive Events''. The total system performance assessment (TSPA) calculations do not use any output from this report. Specifically, the coupled THM process model is applied to simulate the impact of THM processes on hydrologic properties (permeability and capillary strength) and flow in the near-field rock around a heat-releasing emplacement drift. The heat generated by the decay of radioactive waste results in elevated rock temperatures for thousands of years after waste emplacement. Depending on the thermal load, these temperatures are high enough to cause boiling conditions in the rock, resulting in water redistribution and altered flow paths. These temperatures will also cause thermal expansion of the rock, with the potential of opening or closing fractures and thus changing fracture permeability in the near-field. Understanding the THM coupled processes is important for the performance of the repository because the thermally induced permeability changes potentially effect the magnitude and spatial distribution of percolation flux in the vicinity of the drift, and hence the seepage of water into the drift. This is important because a sufficient amount of water must be available within a

  18. Drift effects in CANDU reactors

    International Nuclear Information System (INIS)

    Koclas, J.; Roy, R.; Marleau, G.

    1993-01-01

    The diffusion equation is an approximation to the transport equation which relies on the validity of Fick's law. Since this law is not explicitly integrated in the transport equation it can only be derived approximately using homogenization theories. However, such homogenization theories state that when the cell is not symmetric Fick's law breaks down due to the presence of an additional term to the neutron current, called the drift term. In fact, this term can be interpreted as a transport correction to Fick's law which tends to increase the neutron current in a direction opposite to that specified by the flux gradient. In this paper, we investigate how the presence of asymmetric liquid zone controllers will modify the flux distribution inside a CANDU core. 5 refs., 2 figs., 1 tab

  19. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  20. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  1. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  2. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  3. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    Energy Technology Data Exchange (ETDEWEB)

    Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

    2015-12-28

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

  4. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    International Nuclear Information System (INIS)

    Mirigian, Stephen; Schweizer, Kenneth S.

    2015-01-01

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

  5. Drift Degradation Analysis

    International Nuclear Information System (INIS)

    D. Kicker

    2004-01-01

    Degradation of underground openings as a function of time is a natural and expected occurrence for any subsurface excavation. Over time, changes occur to both the stress condition and the strength of the rock mass due to several interacting factors. Once the factors contributing to degradation are characterized, the effects of drift degradation can typically be mitigated through appropriate design and maintenance of the ground support system. However, for the emplacement drifts of the geologic repository at Yucca Mountain, it is necessary to characterize drift degradation over a 10,000-year period, which is well beyond the functional period of the ground support system. This document provides an analysis of the amount of drift degradation anticipated in repository emplacement drifts for discrete events and time increments extending throughout the 10,000-year regulatory period for postclosure performance. This revision of the drift degradation analysis was developed to support the license application and fulfill specific agreement items between the U.S. Nuclear Regulatory Commission (NRC) and the U.S. Department of Energy (DOE). The earlier versions of ''Drift Degradation Analysis'' (BSC 2001 [DIRS 156304]) relied primarily on the DRKBA numerical code, which provides for a probabilistic key-block assessment based on realistic fracture patterns determined from field mapping in the Exploratory Studies Facility (ESF) at Yucca Mountain. A key block is defined as a critical block in the surrounding rock mass of an excavation, which is removable and oriented in an unsafe manner such that it is likely to move into an opening unless support is provided. However, the use of the DRKBA code to determine potential rockfall data at the repository horizon during the postclosure period has several limitations: (1) The DRKBA code cannot explicitly apply dynamic loads due to seismic ground motion. (2) The DRKBA code cannot explicitly apply loads due to thermal stress. (3) The DRKBA

  6. Drift Degradation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    D. Kicker

    2004-09-16

    Degradation of underground openings as a function of time is a natural and expected occurrence for any subsurface excavation. Over time, changes occur to both the stress condition and the strength of the rock mass due to several interacting factors. Once the factors contributing to degradation are characterized, the effects of drift degradation can typically be mitigated through appropriate design and maintenance of the ground support system. However, for the emplacement drifts of the geologic repository at Yucca Mountain, it is necessary to characterize drift degradation over a 10,000-year period, which is well beyond the functional period of the ground support system. This document provides an analysis of the amount of drift degradation anticipated in repository emplacement drifts for discrete events and time increments extending throughout the 10,000-year regulatory period for postclosure performance. This revision of the drift degradation analysis was developed to support the license application and fulfill specific agreement items between the U.S. Nuclear Regulatory Commission (NRC) and the U.S. Department of Energy (DOE). The earlier versions of ''Drift Degradation Analysis'' (BSC 2001 [DIRS 156304]) relied primarily on the DRKBA numerical code, which provides for a probabilistic key-block assessment based on realistic fracture patterns determined from field mapping in the Exploratory Studies Facility (ESF) at Yucca Mountain. A key block is defined as a critical block in the surrounding rock mass of an excavation, which is removable and oriented in an unsafe manner such that it is likely to move into an opening unless support is provided. However, the use of the DRKBA code to determine potential rockfall data at the repository horizon during the postclosure period has several limitations: (1) The DRKBA code cannot explicitly apply dynamic loads due to seismic ground motion. (2) The DRKBA code cannot explicitly apply loads due to thermal

  7. Spiral silicon drift detectors

    International Nuclear Information System (INIS)

    Rehak, P.; Gatti, E.; Longoni, A.; Sampietro, M.; Holl, P.; Lutz, G.; Kemmer, J.; Prechtel, U.; Ziemann, T.

    1988-01-01

    An advanced large area silicon photodiode (and x-ray detector), called Spiral Drift Detector, was designed, produced and tested. The Spiral Detector belongs to the family of silicon drift detectors and is an improvement of the well known Cylindrical Drift Detector. In both detectors, signal electrons created in silicon by fast charged particles or photons are drifting toward a practically point-like collection anode. The capacitance of the anode is therefore kept at the minimum (0.1pF). The concentric rings of the cylindrical detector are replaced by a continuous spiral in the new detector. The spiral geometry detector design leads to a decrease of the detector leakage current. In the spiral detector all electrons generated at the silicon-silicon oxide interface are collected on a guard sink rather than contributing to the detector leakage current. The decrease of the leakage current reduces the parallel noise of the detector. This decrease of the leakage current and the very small capacities of the detector anode with a capacitively matched preamplifier may improve the energy resolution of Spiral Drift Detectors operating at room temperature down to about 50 electrons rms. This resolution is in the range attainable at present only by cooled semiconductor detectors. 5 refs., 10 figs

  8. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  9. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  10. Radial semiconductor drift chambers

    International Nuclear Information System (INIS)

    Rawlings, K.J.

    1987-01-01

    The conditions under which the energy resolution of a radial semiconductor drift chamber based detector system becomes dominated by the step noise from the detector dark current have been investigated. To minimise the drift chamber dark current attention should be paid to carrier generation at Si/SiO 2 interfaces. This consideration conflicts with the desire to reduce the signal risetime: a higher drift field for shorter signal pulses requires a larger area of SiO 2 . Calculations for the single shaping and pseudo Gaussian passive filters indicate that for the same degree of signal risetime sensitivity in a system dominated by the step noise from the detector dark current, the pseudo Gaussian filter gives only a 3% improvement in signal/noise and 12% improvement in rate capability compared with the single shaper performance. (orig.)

  11. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  12. Nonlinear drift tearing mode

    International Nuclear Information System (INIS)

    Zelenyj, L.M.; Kuznetsova, M.M.

    1989-01-01

    Nonlinear study of magnetic perturbation development under single-mode conditions in collision-free plasma in configurations with the magnetic field shear is investigated. Results are obtained with regard of transverse component of electrical field and its effect on ion dynamics within wide range of ion Larmor radius value and values of magnetic field shear. Increments of nonlinear drift tearing mode are obtained and it is shown that excitation drastic conditions of even linearly stable modes are possible. Mechanism of instability nonlinear stabilization is considered and the value of magnetic island at the saturation threshold is estimeted. Energy of nonlinear drift tearing mode is discussed

  13. The Drift Burst Hypothesis

    DEFF Research Database (Denmark)

    Christensen, Kim; Oomen, Roel; Renò, Roberto

    are an expected and regular occurrence in financial markets that can arise through established mechanisms such as feedback trading. At a theoretical level, we show how to build drift bursts into the continuous-time Itô semi-martingale model in such a way that the fundamental arbitrage-free property is preserved......, currencies and commodities. We find that the majority of identified drift bursts are accompanied by strong price reversals and these can therefore be regarded as “flash crashes” that span brief periods of severe market disruption without any material longer term price impacts....

  14. Turbulent flux and the diffusion of passive tracers in electrostatic turbulence

    DEFF Research Database (Denmark)

    Basu, R.; Jessen, T.; Naulin, V.

    2003-01-01

    The connection between the diffusion of passive tracer particles and the anomalous turbulent flux in electrostatic drift-wave turbulence is investigated by direct numerical solutions of the 2D Hasegawa-Wakatani equations. The probability density functions for the point-wise and flux surface...

  15. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  16. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  17. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, Rizwan M; Oral, Ebru; Muratoglu, Orhun K

    2014-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E

  18. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, R. M.; Oral, E.; Muratoglu, O. K.

    2013-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E. (author)

  19. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  20. Tapping with intentional drift

    NARCIS (Netherlands)

    Vardy, A.N.; Daffertshofer, A.; Beek, P.J.

    2009-01-01

    When tapping a desired frequency, subjects tend to drift away from this target frequency. This compromises the estimate of the correlation between inter-tap intervals (ITIs) as predicted by the two-level model of Wing and Kristofferson which consists of an internal timer ('clock') and motor delays.

  1. The KLOE drift chamber

    International Nuclear Information System (INIS)

    Ferrari, A.

    2002-01-01

    The design and construction of the large drift chamber of the KLOE experiment is presented. The track reconstruction is described, together with the calibration method and the monitoring systems. The stability of operation and the performance are studied with samples of e + e - , K S K L and K + K - events

  2. High resolution drift chambers

    International Nuclear Information System (INIS)

    Va'vra, J.

    1985-07-01

    High precision drift chambers capable of achieving less than or equal to 50 μm resolutions are discussed. In particular, we compare so called cool and hot gases, various charge collection geometries, several timing techniques and we also discuss some systematic problems. We also present what we would consider an ''ultimate'' design of the vertex chamber. 50 refs., 36 figs., 6 tabs

  3. Argus drift chamber

    Energy Technology Data Exchange (ETDEWEB)

    Danilov, M; Nagovizin, V; Hasemann, H; Michel, E; Schmidt-Parzefall, W; Wurth, R; Kim, P

    1983-11-15

    The ARGUS detector came into operation at the DORIS-II e/sup +/s/sup -/ storage ring at the end of 1982. Its two meter long drift chamber contains 5940 sense and 24588 field wires organized in uniform 18x18.8 mm/sup 2/ drift cells filling the whole volume. These cells form 36 layers, 18 of which provide stereo views. Each sense wire is equipped with a single hit TDC and ADC for coordinate and dE/dx measurements. The chamber is operated with propane to improve momentum and dE/dx resolution. The drift chamber design and initial performance are presented. With a very crude space-time relation approximation and without all the necessary corrections applied a spatial resolution of about 200 ..mu..m was obtained for half of the drift cell volume. Further corrections should improve this result. An intrinsic dE/dx resolution of 4.2% and an actual resolution of 5% were obtained for cosmic muons and also for Bhabha scattered electrons. An actual dE/dx resolution of 5.6% was obtained for pions from e/sup +/e/sup -/ annihilation data with almost no track selection. A relativistic rise of 30% was observed in good agreement with theory. The long-term stability is still to be investigated.

  4. Inland drift sand landscapes

    NARCIS (Netherlands)

    Fanta, J.; Siepel, H.

    2010-01-01

    Man has had a complex relationship with inland drift sands through the ages. For some centuries these landscapes were seen as a threat to society, especially agriculture and housing. At present we conserve these landscapes as important Natura 2000 priority habitats. In this book you may find these

  5. Guiding center drift equations

    International Nuclear Information System (INIS)

    Boozer, A.H.

    1979-03-01

    The quations for particle guiding center drift orbits are given in a new magnetic coordinate system. This form of the equations not only separates the fast motion along the lines from the slow motion across, but also requires less information about the magnetic field than many other formulations of the problem

  6. IN DRIFT CORROSION PRODUCTS

    Energy Technology Data Exchange (ETDEWEB)

    D.M. Jolley

    1999-12-02

    As directed by a written development plan (CRWMS M&O 1999a), a conceptual model for steel and corrosion products in the engineered barrier system (EBS) is to be developed. The purpose of this conceptual model is to assist Performance Assessment Operations (PAO) and its Engineered Barrier Performance Department in modeling the geochemical environment within a repository drift, thus allowing PAO to provide a more detailed and complete in-drift geochemical model abstraction and to answer the key technical issues (KTI) raised in the NRC Issue Resolution Status Report (IRSR) for the Evolution of the Near-Field Environment (NFE) Revision 2 (NRC 1999). This document provides the conceptual framework for the in-drift corrosion products sub-model to be used in subsequent PAO analyses including the EBS physical and chemical model abstraction effort. This model has been developed to serve as a basis for the in-drift geochemical analyses performed by PAO. However, the concepts discussed within this report may also apply to some near and far-field geochemical processes and may have conceptual application within the unsaturated zone (UZ) and saturated zone (SZ) transport modeling efforts.

  7. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)

    International Nuclear Information System (INIS)

    Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.

    2013-01-01

    In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)

  8. Dike Propagation Near Drifts

    International Nuclear Information System (INIS)

    2002-01-01

    The purpose of this Analysis and Model Report (AMR) supporting the Site Recommendation/License Application (SR/LA) for the Yucca Mountain Project is the development of elementary analyses of the interactions of a hypothetical dike with a repository drift (i.e., tunnel) and with the drift contents at the potential Yucca Mountain repository. This effort is intended to support the analysis of disruptive events for Total System Performance Assessment (TSPA). This AMR supports the Process Model Report (PMR) on disruptive events (CRWMS M and O 2000a). This purpose is documented in the development plan (DP) ''Coordinate Modeling of Dike Propagation Near Drifts Consequences for TSPA-SR/LA'' (CRWMS M and O 2000b). Evaluation of that Development Plan and the work to be conducted to prepare Interim Change Notice (ICN) 1 of this report, which now includes the design option of ''Open'' drifts, indicated that no revision to that DP was needed. These analyses are intended to provide reasonable bounds for a number of expected effects: (1) Temperature changes to the waste package from exposure to magma; (2) The gas flow available to degrade waste containers during the intrusion; (3) Movement of the waste package as it is displaced by the gas, pyroclasts and magma from the intruding dike (the number of packages damaged); (4) Movement of the backfill (Backfill is treated here as a design option); (5) The nature of the mechanics of the dike/drift interaction. These analyses serve two objectives: to provide preliminary analyses needed to support evaluation of the consequences of an intrusive event and to provide a basis for addressing some of the concerns of the Nuclear Regulatory Commission (NRC) expressed in the Igneous Activity Issue Resolution Status Report

  9. Effects of Drifting Macroalgae in Eelgrass Ecosystems

    DEFF Research Database (Denmark)

    Canal Vergés, Paula; Valdemarsen, Thomas Bruun; Kristensen, Erik

    2010-01-01

    and physical damage on eelgrass can occur when macroalgae are drifting as bedload. The ballistic effect of moving macroalgae on surface sediment was tested in the field as well as in a series of annular flume experiments, where simultaneous measurements of macroalgae transport and turbidity were measured...

  10. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  11. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  12. The Pearson diffusions: A class of statistically tractable diffusion processes

    DEFF Research Database (Denmark)

    Forman, Julie Lyng; Sørensen, Michael

    The Pearson diffusions is a flexible class of diffusions defined by having linear drift and quadratic squared diffusion coefficient. It is demonstrated that for this class explicit statistical inference is feasible. Explicit optimal martingale estimating func- tions are found, and the corresponding...

  13. Style drift in private equity

    NARCIS (Netherlands)

    Cumming, D.; Fleming, G.; Schwienbacher, A.

    2009-01-01

    We introduce the concept of style drift to private equity investment. We present theory and evidence pertaining to style drifts in terms of a fund manager's stated focus on particular stages of entrepreneurial development. We develop a model that derives conditions under which style drifts are less

  14. Real-space quasilinear theory of drift waves in a sheared magnetic field

    International Nuclear Information System (INIS)

    1977-02-01

    A real-space quasilinear theory is developed for the collisional and the collisionless drift waves in a plasma with a sheared magnetic field of slab geometry. The equation obtained describes the interaction between many localized modes around different rational surfaces through the density modulation of the energy source region of each mode. The wave amplitudes approach to the stationary values through a relaxation oscillation process. When the width x sub(s) of the energy source region becomes comparable to the spacing Δx of the two adjacent rational surfaces, diffusion coefficient due to the wave is enhanced over the classical value, while the nonlocal heat transport due to the wave propagation is shown to be negligible compared to that associated with the diffusion process. (auth.)

  15. Approximate Stokes Drift Profiles in Deep Water

    Science.gov (United States)

    Breivik, Øyvind; Janssen, Peter A. E. M.; Bidlot, Jean-Raymond

    2014-09-01

    A deep-water approximation to the Stokes drift velocity profile is explored as an alternative to the monochromatic profile. The alternative profile investigated relies on the same two quantities required for the monochromatic profile, viz the Stokes transport and the surface Stokes drift velocity. Comparisons with parametric spectra and profiles under wave spectra from the ERA-Interim reanalysis and buoy observations reveal much better agreement than the monochromatic profile even for complex sea states. That the profile gives a closer match and a more correct shear has implications for ocean circulation models since the Coriolis-Stokes force depends on the magnitude and direction of the Stokes drift profile and Langmuir turbulence parameterizations depend sensitively on the shear of the profile. The alternative profile comes at no added numerical cost compared to the monochromatic profile.

  16. Diogene pictorial drift chamber

    International Nuclear Information System (INIS)

    Gosset, J.

    1984-01-01

    A pictorial drift chamber, called DIOGENE, has been installed at Saturne in order to study central collisions of high energy heavy ions. It has been adapted from the JADE internal detector, with two major differences to be taken into account. First, the center-of-mass of these collisions is not identical to the laboratory reference frame. Second, the energy loss and the momentum ranges of the particles to be detected are different from the ones in JADE. It was also tried to keep the cost as small as possible, hence the choice of minimum size and minimum number of sensitive wires. Moreover the wire planes are shifted from the beam axis: this trick helps very much to quickly reject the bad tracks caused by the ambiguity of measuring drift distances (positive or negative) through times (always positive)

  17. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  18. THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

    Energy Technology Data Exchange (ETDEWEB)

    Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

    2012-10-01

    To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

  19. Negative Drift in Populations

    DEFF Research Database (Denmark)

    Lehre, Per Kristian

    2011-01-01

    An important step in gaining a better understanding of the stochastic dynamics of evolving populations, is the development of appropriate analytical tools. We present a new drift theorem for populations that allows properties of their long-term behaviour, e.g. the runtime of evolutionary algorithms......, to be derived from simple conditions on the one-step behaviour of their variation operators and selection mechanisms....

  20. Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-09-15

    Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

  1. Microscale anechoic architecture: acoustic diffusers for ultra low power microparticle separation via traveling surface acoustic waves.

    Science.gov (United States)

    Behrens, Jan; Langelier, Sean; Rezk, Amgad R; Lindner, Gerhard; Yeo, Leslie Y; Friend, James R

    2015-01-07

    We present a versatile and very low-power traveling SAW microfluidic sorting device able to displace and separate particles of different diameter in aqueous suspension; the travelling wave propagates through the fluid bulk and diffuses via a Schröder diffuser, adapted from its typical use in concert hall acoustics to be the smallest such diffuser to be suitable for microfluidics. The effective operating power range is two to three orders of magnitude less than current SAW devices, uniquely eliminating the need for amplifiers, and by using traveling waves to impart forces directly upon suspended microparticles, they can be separated by size.

  2. Point vortex description of drift wave vortices: Dynamics and transport

    International Nuclear Information System (INIS)

    Kono, M.; Horton, W.

    1991-05-01

    Point-vortex description for drift wave vortices is formulated based on the Hasegawa-Mima equation to study elementary processes for the interactions of vortices as well as statistical properties like vortex diffusion. Dynamical properties of drift wave vortices known by numerical experiments are recovered. Furthermore a vortex diffusion model discussed by Horton based on numerical simulations is shown to be analytically obtained. A variety of phenomena arising from the short-range nature of the interaction force of point vortices are suggested. 12 refs., 10 figs

  3. Consistent guiding center drift theories

    International Nuclear Information System (INIS)

    Wimmel, H.K.

    1982-04-01

    Various guiding-center drift theories are presented that are optimized in respect of consistency. They satisfy exact energy conservation theorems (in time-independent fields), Liouville's theorems, and appropriate power balance equations. A theoretical framework is given that allows direct and exact derivation of associated drift-kinetic equations from the respective guiding-center drift-orbit theories. These drift-kinetic equations are listed. Northrop's non-optimized theory is discussed for reference, and internal consistency relations of G.C. drift theories are presented. (orig.)

  4. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  5. Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

    Science.gov (United States)

    Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

    2015-06-03

    Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Spin-drift transport in semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M Idrish [Nanoscale Science and Technology Centre and School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong, Chittagong-4331 (Bangladesh)

    2008-02-07

    We present a study on spin transport in semiconductors under applied electric fields. Our experiments detect photoinjected electron spins and their relaxation during drift transport in intrinsic and moderately n-doped GaAs, based on the extraordinary Hall (eH) effect. For relatively low electric field (E), the optically spin-induced eH effect in n-doped GaAs is found to be enhanced with increasing doping density and not to depend much on E, indicating that a substantial amount of optical spin polarization is preserved during the drift transport in these extrinsic semiconductors. However, when the spin-oriented electrons are injected with a high E, a very significant decrease is observed in the eH voltage (V{sub eH}) due to an increase in the spin precession frequency of the hot electrons. Spin relaxation by the D'yakonov-Perel' mechanism is calculated, and is suggested to be the reason for such a rapid spin relaxation for hot electrons under a high E. However, in an intrinsic GaAs (i-GaAs), a much weaker V{sub eH} is observed and, as the electron spins scattered by holes due to the Coulomb interaction in i-GaAs, the spin relaxation by the Bir-Aronov-Pikus mechanism is considered. Skew scattering and side jump as possible mechanisms of the optically spin-induced transverse Hall currents are discussed. Based on a spin drift-diffusion model, drift and diffusion contributions to the V{sub eH} are examined. The results are also discussed in comparison with theoretical investigations.

  7. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  8. Wind tunnel measurements and model predictions for estimating spray drift reduction under field conditions

    NARCIS (Netherlands)

    Butler Ellis, M.C.; Alanis, R.; Lane, A.G.; Tuck, C.R.; Nuyttens, D.; Zande, van de J.C.

    2017-01-01

    A UK scheme to enable the protection of surface water from spray drift allows farmers to reduce the size of a buffer zone according to the drift-reducing capability of the sprayer. Recent changes to UK regulations have allowed buffer zones greater than 6 m to be included, providing that 75% drift

  9. Mean Lagrangian drift in continental shelf waves

    Science.gov (United States)

    Drivdal, M.; Weber, J. E. H.

    2012-04-01

    The time- and depth-averaged mean drift induced by barotropic continental shelf waves (CSW's) is studied theoretically for idealized shelf topography by calculating the mean volume fluxes to second order in wave amplitude. The waves suffer weak spatial damping due to bottom friction, which leads to radiation stress forcing of the mean fluxes. In terms of the total wave energy density E¯ over the shelf region, the radiation stress tensor component S¯11 for CSW's is found to be different from that of shallow water surface waves in a non-rotating ocean. For CSW's, the ratio ¯S11/¯E depends strongly on the wave number. The mean Lagrangian flow forced by the radiation stress can be subdivided into a Stokes drift and a mean Eulerian drift current. The magnitude of the latter depends on the ratio between the radiation stress and the bottom stress acting on the mean flow. When the effect of bottom friction acts equally strong on the waves and the mean current, calculations for short CSW's show that the Stokes drift and the friction-dependent wave-induced mean Eulerian current varies approximately in anti-phase over the shelf, and that the latter is numerically the largest. For long CSW's they are approximately in phase. In both cases the mean Lagrangian current, which is responsible for the net particle drift, has its largest numerical value at the coast on the shallow part of the shelf. Enhancing the effect of bottom friction on the Eulerian mean flow, results in a general current speed reduction, as well as a change in spatial structure for long waves. Applying realistic physical parameters for the continental shelf west of Norway, calculations yield along-shelf mean drift velocities for short CSW's that may be important for the transport of biological material, neutral tracers, and underwater plumes of dissolved oil from deep water drilling accidents.

  10. Travelling fronts in stochastic Stokes’ drifts

    KAUST Repository

    Blanchet, Adrien

    2008-10-01

    By analytical methods we study the large time properties of the solution of a simple one-dimensional model of stochastic Stokes\\' drift. Semi-explicit formulae allow us to characterize the behaviour of the solutions and compute global quantities such as the asymptotic speed of the center of mass or the effective diffusion coefficient. Using an equivalent tilted ratchet model, we observe that the speed of the center of mass converges exponentially to its limiting value. A diffuse, oscillating front attached to the center of mass appears. The description of the front is given using an asymptotic expansion. The asymptotic solution attracts all solutions at an algebraic rate which is determined by the effective diffusion coefficient. The proof relies on an entropy estimate based on homogenized logarithmic Sobolev inequalities. In the travelling frame, the macroscopic profile obeys to an isotropic diffusion. Compared with the original diffusion, diffusion is enhanced or reduced, depending on the regime. At least in the limit cases, the rate of convergence to the effective profile is always decreased. All these considerations allow us to define a notion of efficiency for coherent transport, characterized by a dimensionless number, which is illustrated on two simple examples of travelling potentials with a sinusoidal shape in the first case, and a sawtooth shape in the second case. © 2008 Elsevier B.V. All rights reserved.

  11. Drifting black aurorae?

    International Nuclear Information System (INIS)

    Schoute-Vanneck, H.; Scourfield, M.W.J.; Nielsen, E.

    1990-01-01

    Characteristics of eastward drifting forms, previously described in the literature as black aurorae, have been identified in low-light level TV camera data. The TV field of view was within the field of view of STARE and that of an all-sky camera. On the basis of these observations the authors propose that these auroral forms are a manifestation of folds or waves on the borders of auroral bands propagating along the dark regions between neighboring auroral bands. Conditions under which the folds or waves occur are compatible with their formation by the Kelvin-Helmholtz electrostatic instability

  12. ABSTRACTION OF DRIFT SEEPAGE

    International Nuclear Information System (INIS)

    Wilson, Michael L.

    2001-01-01

    Drift seepage refers to flow of liquid water into repository emplacement drifts, where it can potentially contribute to degradation of the engineered systems and release and transport of radionuclides within the drifts. Because of these important effects, seepage into emplacement drifts is listed as a ''principal factor for the postclosure safety case'' in the screening criteria for grading of data in Attachment 1 of AP-3.15Q, Rev. 2, ''Managing Technical Product Inputs''. Abstraction refers to distillation of the essential components of a process model into a form suitable for use in total-system performance assessment (TSPA). Thus, the purpose of this analysis/model is to put the information generated by the seepage process modeling in a form appropriate for use in the TSPA for the Site Recommendation. This report also supports the Unsaturated-Zone Flow and Transport Process Model Report. The scope of the work is discussed below. This analysis/model is governed by the ''Technical Work Plan for Unsaturated Zone Flow and Transport Process Model Report'' (CRWMS MandO 2000a). Details of this activity are in Addendum A of the technical work plan. The original Work Direction and Planning Document is included as Attachment 7 of Addendum A. Note that the Work Direction and Planning Document contains tasks identified for both Performance Assessment Operations (PAO) and Natural Environment Program Operations (NEPO). Only the PAO tasks are documented here. The planning for the NEPO activities is now in Addendum D of the same technical work plan and the work is documented in a separate report (CRWMS MandO 2000b). The Project has been reorganized since the document was written. The responsible organizations in the new structure are the Performance Assessment Department and the Unsaturated Zone Department, respectively. The work plan for the seepage abstraction calls for determining an appropriate abstraction methodology, determining uncertainties in seepage, and providing

  13. Phenomena accompanying gradient-B drift injection of energetic ions into Tokamak plasmas

    International Nuclear Information System (INIS)

    Goldston, R.J.; Jassby, D.L.

    1976-01-01

    The application of vertically asymmetric toroidal-field ripple, in order to permit the gradient B-drift injection and subsequent capture of energetic ions, results in a new radial diffusion of banana orbits. The nearly mono-kinetic velocity distribution of gradient B-drifting ions in the outer plasma region represents a large source of free energy; and the nonambipolar inward drift of these ions modifies the radial electric field

  14. Drift velocity monitoring of the CMS muon drift chambers

    CERN Document Server

    Sonnenschein, Lars

    2010-01-01

    The drift velocity in drift tubes of the CMS muon chambers is a key parameter for the muon track reconstruction and trigger. It needs to be monitored precisely in order to detect any deviation from its nominal value. A change in absolute pressure, a variation of the gas admixture or a contamination of the chamber gas by air affect the drift velocity. Furthermore the temperature and magnetic field influence its value. First data, taken with a dedicated Velocity Drift Chamber (VDC) built by RWTH Aachen IIIA are presented.

  15. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  16. Exciton diffusion length in some thermocleavable polythiophenes by the surface photovoltage method

    DEFF Research Database (Denmark)

    Tousek, J.; Touskova, J.; Remes, Z.

    2012-01-01

    property is that P3MHOCT can serve as a precursor which, after thermal annealing, converts into more rigid and insoluble P3CT and further thermal treatment produces native unsubstituted PT. Ellipsometric measurement yielded data on the thickness of the spin coated layers; absorption coefficients were...... be ascribed to the increase of the crystalline fraction. The highest diffusion length was found in P3CT polymer but its large resistivity represents a disadvantage in application in solar cells. Taking into account just these parameters, relatively low resistivity together with quite high diffusion length (13...

  17. The CLEO III drift chamber

    CERN Document Server

    Peterson, D; Briere, R A; Chen, G; Cronin-Hennessy, D; Csorna, S; Dickson, M; Dombrowski, S V; Ecklund, K M; Lyon, A; Marka, S; Meyer, T O; Patterson, J R; Sadoff, A; Thies, P; Thorndike, E H; Urner, D

    2002-01-01

    The CLEO group at the Cornell Electron Storage Ring has constructed and commissioned a new central drift chamber. With 9796 cells arranged in 47 layers ranging in radius from 13.2 to 79 cm, the new drift chamber has a smaller outer radius and fewer wires than the drift chamber it replaces, but allows the CLEO tracking system to have improved momentum resolution. Reduced scattering material in the chamber gas and in the inner skin separating the drift chamber from the silicon vertex detector provides a reduction of the multiple scattering component of the momentum resolution and an extension of the usable measurement length into the silicon. Momentum resolution is further improved through quality control in wire positioning and symmetry of the electric fields in the drift cells which have provided a reduction in the spatial resolution to 88 mu m (averaged over the full drift range).

  18. Perturbed GUE Minor Process and Warren's Process with Drifts

    Science.gov (United States)

    Ferrari, Patrik L.; Frings, René

    2014-01-01

    We consider the minor process of (Hermitian) matrix diffusions with constant diagonal drifts. At any given time, this process is determinantal and we provide an explicit expression for its correlation kernel. This is a measure on the Gelfand-Tsetlin pattern that also appears in a generalization of Warren's process (Electron. J. Probab. 12:573-590, 2007), in which Brownian motions have level-dependent drifts. Finally, we show that this process arises in a diffusion scaling limit from an interacting particle system in the anisotropic KPZ class in 2+1 dimensions introduced in Borodin and Ferrari (Commun. Math. Phys., 2008). Our results generalize the known results for the zero drift situation.

  19. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  20. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  1. Numerical modeling of turbulent jet diffusion flames in the atmospheric surface layer

    NARCIS (Netherlands)

    Hernández, J.; Crespo, A.; Duijm, N.J.

    1995-01-01

    The evolution of turbulent jet diffusion flames of natural gas in air is predicted using a finite-volume procedure for solving the flow equations. The model is three dimensional, elliptic and based on the conserved-scalar approach and the laminar flamelet concept. A laminar flamelet prescription for

  2. Diffusion Coefficient in the Zinc Coating Shaped on the Surface of Cast Iron and Steel Alloys

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2015-06-01

    Full Text Available The article presents the method to assess the diffusion coefficient D in the sub-layer of intermetallic phases formed during hot-dip galvanizing “Armco” iron and ductile cast iron EN-GJS-500-7. Hot-dip galvanizing is one of the most popular forms of long-term protection of Fe-C alloys against corrosion. The process for producing a protective layer of sufficient quality is closely related to diffusion of atoms of zinc and iron. The simulation consist in performed a hot-dip galvanizing in laboratory condition above Fe-C alloys, in the Department of Engineering of Cast Alloys and Composites. Galvanizing time ranged from 15 to 300 seconds. Then metallographic specimens were prepared, intermetallic layers were measured and diffusion coefficient (D were calculated. It was found that the diffusion coefficient obtained during hot-dip galvanizing “Armco” iron and zinc is about two orders of magnitude less than the coefficient obtained on ductile cast iron EN-GJS-500-7.

  3. Electronics for proportional drift tubes

    International Nuclear Information System (INIS)

    Fremont, G.; Friend, B.; Mess, K.H.; Schmidt-Parzefall, W.; Tarle, J.C.; Verweij, H.; CERN-Hamburg-Amsterdam-Rome-Moscow Collaboration); Geske, K.; Riege, H.; Schuett, J.; CERN-Hamburg-Amsterdam-Rome-Moscow Collaboration); Semenov, Y.; CERN-Hamburg-Amsterdam-Rome-Moscow Collaboration)

    1980-01-01

    An electronic system for the read-out of a large number of proportional drift tubes (16,000) has been designed. This system measures deposited charge and drift-time of the charge of a particle traversing a proportional drift tube. A second event can be accepted during the read-out of the system. Up to 40 typical events can be collected and buffered before a data transfer to a computer is necessary. (orig.)

  4. In situ observation of lithium hydride hydrolysis by DRIFT spectroscopy

    International Nuclear Information System (INIS)

    Awbery, Roy P.; Broughton, Duncan A.; Tsang, S.C.

    2008-01-01

    Polycrystalline LiH was studied in situ using diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy to investigate the effect water vapour has on the rate of production of the corrosion products, particularly LiOH. The reaction rate of the formation of surface LiOH was monitored by measurement of the hydroxyl (OH) band at 3676 cm -1 . The initial hydrolysis rate of LiH exposed to water vapour at 50% relative humidity was found to be almost two times faster than LiH exposed to water vapour at 2% relative humidity. The hydrolysis rate was shown to be initially very rapid followed by a much slower, almost linear rate. The change in hydrolysis rate was attributed to the formation of a coherent layer of LiOH on the LiH surface. Exposure to lower levels of water vapour appeared to result in the formation of a more coherent corrosion product, resulting in effective passivation of the surface to further attack from water

  5. Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

    Science.gov (United States)

    Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

    2015-01-01

    The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

  6. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas

    2012-01-01

    in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices

  7. Electron transport parameters in CO$_2$: scanning drift tube measurements and kinetic computations

    OpenAIRE

    Vass, M.; Korolov, I.; Loffhagen, D.; Pinhao, N.; Donko, Z.

    2016-01-01

    This work presents transport coefficients of electrons (bulk drift velocity, longitudinal diffusion coefficient, and effective ionization frequency) in CO2 measured under time-of-flight conditions over a wide range of the reduced electric field, 15Td

  8. Analytical drift-current threshold voltage model of long-channel double-gate MOSFETs

    International Nuclear Information System (INIS)

    Shih, Chun-Hsing; Wang, Jhong-Sheng

    2009-01-01

    This paper presents a new, physical threshold voltage model to solve the ambiguity in determining the threshold voltage of double-gate (DG) MOSFETs. To avoid the difficulties of the conventional 2ψ B model in nearly undoped DG MOSFETs, this study proposes to define the on–off switching based on the actual roles of the drift and diffusion components in the total drain current. The drift current strongly enhances beyond the threshold voltage, while the diffusion current plays a major role in the subthreshold. The threshold voltage is defined as the drift component that exceeds the diffusion counterpart. From the solutions of Poisson's equation, the drift and diffusion currents of DG MOSFETs are separately formulated to derive the analytical expressions of the threshold voltage and associated threshold current. This model provides a comprehensive description of the switching behavior of DG MOSFET devices, and offers a physical onset threshold current to determine the threshold voltage in practical extraction

  9. Diffusion coefficients-surface and interfacial tensions - Particular study of some lauryl compounds

    International Nuclear Information System (INIS)

    Morel, Jean-Emile

    1969-01-01

    Two important results of the double lipophilic and hydrophilic character of some heavy organic compounds with a polar group at the end of the chain, were studied: - In a first part, molecular diffusion coefficients were measured in order to prove the micellar aggregation of tri-laurylammonium nitrate in some organic solutions; - In a second part, the tensioactivity of some lauryl compounds (lauric acid, lauric alcohol, mono-laurylamine, etc.), was studied. (author) [fr

  10. Reflection Matrix Method for Controlling Light After Reflection From a Diffuse Scattering Surface

    Science.gov (United States)

    2016-12-22

    of Philosophy Kenneth W. Burgi, BS, MS Major, USAF 22 December 2016 DISTRIBUTION STATEMENT A APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT...refocusing light through thin films of a turbid medium. When coherent light is trans- mitted through a stationary diffuser (i.e. a turbid medium), a fine...resultant light scatter [14, 15, 21, 23]. Transmission matrices were measured with microscopic objectives and thin films of turbid media, resulting in

  11. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  12. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  13. Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

    Science.gov (United States)

    Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

    2014-03-01

    Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

  14. Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

    Science.gov (United States)

    1979-01-01

    A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

  15. Progress in semiconductor drift detectors

    International Nuclear Information System (INIS)

    Rehak, P.; Walton, J.; Gatti, E.

    1985-01-01

    Progress in testing semiconductor drift detectors is reported. Generally better position and energy resolutions were obtained than resolutions published previously. The improvement is mostly due to new electronics better matched to different detectors. It is shown that semiconductor drift detectors are becoming versatile and reliable detectors for position and energy measurements

  16. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  17. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  18. Ocean modelling aspects for drift applications

    Science.gov (United States)

    Stephane, L.; Pierre, D.

    2010-12-01

    Nowadays, many authorities in charge of rescue-at-sea operations lean on operational oceanography products to outline research perimeters. Moreover, current fields estimated with sophisticated ocean forecasting systems can be used as input data for oil spill/ adrift object fate models. This emphasises the necessity of an accurate sea state forecast, with a mastered level of reliability. This work focuses on several problems inherent to drift modeling, dealing in the first place with the efficiency of the oceanic current field representation. As we want to discriminate the relevance of a particular physical process or modeling option, the idea is to generate series of current fields of different characteristics and then qualify them in term of drift prediction efficiency. Benchmarked drift scenarios were set up from real surface drifters data, collected in the Mediterranean sea and off the coasts of Angola. The time and space scales that we are interested in are about 72 hr forecasts (typical timescale communicated in case of crisis), for distance errors that we hope about a few dozen of km around the forecast (acceptable for reconnaissance by aircrafts) For the ocean prediction, we used some regional oceanic configurations based on the NEMO 2.3 code, nested into Mercator 1/12° operational system. Drift forecasts were computed offline with Mothy (Météo France oil spill modeling system) and Ariane (B. Blanke, 1997), a Lagrangian diagnostic tool. We were particularly interested in the importance of the horizontal resolution, vertical mixing schemes, and any processes that may impact the surface layer. The aim of the study is to ultimately point at the most suitable set of parameters for drift forecast use inside operational oceanic systems. We are also motivated in assessing the relevancy of ensemble forecasts regarding determinist predictions. Several tests showed that mis-described observed trajectories can finally be modelled statistically by using uncertainties

  19. Off-lattice self-learning kinetic Monte Carlo: application to 2D cluster diffusion on the fcc(111) surface

    International Nuclear Information System (INIS)

    Kara, Abdelkader; Yildirim, Handan; Rahman, Talat S; Trushin, Oleg

    2009-01-01

    We report developments of the kinetic Monte Carlo (KMC) method with improved accuracy and increased versatility for the description of atomic diffusivity on metal surfaces. The on-lattice constraint built into our recently proposed self-learning KMC (SLKMC) (Trushin et al 2005 Phys. Rev. B 72 115401) is released, leaving atoms free to occupy 'off-lattice' positions to accommodate several processes responsible for small-cluster diffusion, periphery atom motion and heteroepitaxial growth. This technique combines the ideas embedded in the SLKMC method with a new pattern-recognition scheme fitted to an off-lattice model in which relative atomic positions are used to characterize and store configurations. Application of a combination of the 'drag' and the repulsive bias potential (RBP) methods for saddle point searches allows the treatment of concerted cluster, and multiple- and single-atom, motions on an equal footing. This tandem approach has helped reveal several new atomic mechanisms which contribute to cluster migration. We present applications of this off-lattice SLKMC to the diffusion of 2D islands of Cu (containing 2-30 atoms) on Cu and Ag(111), using the interatomic potential from the embedded-atom method. For the hetero-system Cu/Ag(111), this technique has uncovered mechanisms involving concerted motions such as shear, breathing and commensurate-incommensurate occupancies. Although the technique introduces complexities in storage and retrieval, it does not introduce noticeable extra computational cost.

  20. Fem Simulation of Triple Diffusive Natural Convection Along Inclined Plate in Porous Medium: Prescribed Surface Heat, Solute and Nanoparticles Flux

    Directory of Open Access Journals (Sweden)

    Goyal M.

    2017-12-01

    Full Text Available In this paper, triple diffusive natural convection under Darcy flow over an inclined plate embedded in a porous medium saturated with a binary base fluid containing nanoparticles and two salts is studied. The model used for the nanofluid is the one which incorporates the effects of Brownian motion and thermophoresis. In addition, the thermal energy equations include regular diffusion and cross-diffusion terms. The vertical surface has the heat, mass and nanoparticle fluxes each prescribed as a power law function of the distance along the wall. The boundary layer equations are transformed into a set of ordinary differential equations with the help of group theory transformations. A wide range of parameter values are chosen to bring out the effect of buoyancy ratio, regular Lewis number and modified Dufour parameters of both salts and nanofluid parameters with varying angle of inclinations. The effects of parameters on the velocity, temperature, solutal and nanoparticles volume fraction profiles, as well as on the important parameters of heat and mass transfer, i.e., the reduced Nusselt, regular and nanofluid Sherwood numbers, are discussed. Such problems find application in extrusion of metals, polymers and ceramics, production of plastic films, insulation of wires and liquid packaging.

  1. Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

    International Nuclear Information System (INIS)

    Singh, Gyanendra; Mehta, Dalip Singh

    2013-01-01

    We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

  2. Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

    International Nuclear Information System (INIS)

    Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

    2010-01-01

    This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

  3. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  4. Investigation of long drift chambers for a nucleon-decay detector

    International Nuclear Information System (INIS)

    Price, L.E.; Dawson, J.; Ayres, D.; Denis, R.S.

    1981-01-01

    The use of long drift chambers for a nucleon-decay detector is discussed as a means of achieving a detector with very fine tracking, but with a modest number of readout channels. Strategies for reducing the attenuation of drifting electrons are considered, particularly the necessity of shaping the electric field to reduce the effects of diffusion and of nearby grounded conductors. Measured results are presented for a chamber with 1 cm drift gap and 50 cm maximum drift distance. The measured attenuation is 12%

  5. Dynamics of zonal flows and self-regulating drift-wave turbulence

    International Nuclear Information System (INIS)

    Diamond, P.H.; Fleischer, J.; Rosenbluth, M.N.; Hinton, F.L.; Malkov, M.; Smolyakov, A.

    1999-01-01

    We present a theory of zonal flow - drift wave dynamics. Zonal flows are generated by modulational instability of a drift wave spectrum, and are damped by collisions. Drift waves undergo random shearing-induced refraction, resulting in increased mean square radial wavenumber. Drift waves and zonal flows together form a simple dynamical system, which has a single stable fixed point. In this state, the fluctuation intensity and turbulent diffusivity are ultimately proportional to the collisional zonal flow damping. The implications of these results for transport models is discussed. (author)

  6. Dynamics of zonal flows and self-regulating drift-wave turbulence

    International Nuclear Information System (INIS)

    Diamond, P.H.; Fleischer, J.; Rosenbluth, M.; Hinton, F.L.; Malkov, M.; Smolyakov, A.

    2001-01-01

    We present a theory of zonal flow - drift wave dynamics. Zonal flows are generated by modulational instability of a drift wave spectrum, and are damped by collisions. Drift waves undergo random shearing-induced refraction, resulting in increased mean square radial wavenumber. Drift waves and zonal flows together form a simple dynamical system, which has a single stable fixed point. In this state, the fluctuation intensity and turbulent diffusivity are ultimately proportional to the collisional zonal flow damping. The implications of these results for transport models is discussed. (author)

  7. Density profile evolution and nonequilibrium effects in partial and full spreading measurements of surface diffusion

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2001-01-01

    in D-C(theta) depend on the initial density gradient and the initial state from which the spreading starts. To this end, we carry out extensive Monte Carlo simulations for a lattice-gas model of the O/W(110) system. Studies of submonolayer spreading from an initially ordered p(2x1) phase at theta = 1....../2 reveal that the spreading and diffusion rates in directions parallel and perpendicular to rows of oxygen atoms are significantly different within the ordered phase. Aside from this effect, we find that the degree of ordering in the initial phase has a relatively small impact on the overall behavior of D...

  8. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

    2006-01-01

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  9. Drift chambers on the basis of Mylar tube blocks

    Science.gov (United States)

    Budagov, Yu.; Chirikov-Zorin, I.; Golovanov, L.; Khazins, D.; Kuritsin, A.; Pukhov, O.; Zhukov, V.

    1993-06-01

    Prototypes of drift chambers constructed of Mylar tube blocks were tested. The purpose of developing tube blocks technology was to create long chambers (up to 3-4 m). Counting and drift characteristics of the chambers for different values of the gas pressure and different diameters of sense wires are presented. The lifetime of the chambers is determined. A photoeffect in the visible spectrum on the surface of the thin film aluminium cathode, which covers the Mylar tubes was observed.

  10. Drift chambers on the basis of Mylar tube blocks

    International Nuclear Information System (INIS)

    Budagov, Yu.; Chirikov-Zorin, I.; Golovanov, L.; Khazins, D.; Kuritsin, A.; Pukhov, U.; Zhukov, V.

    1993-01-01

    Prototypes of drift chambers constructed of Mylar tube blocks were tested. The purpose of developing tube blocks technology was to create chambers (up to 3-4 m). Counting and drift chracteristics of the chambers for different values of the gas pressure and different diameters of sense wires are presented. The lifetime of the chambers is determined. A photoeffect in the visible spectrum on the surface of the thin film aluminium cathode, which covers the Mylar tubes was observed. (orig.)

  11. Simultaneous Retrieval of Aerosol and Surface Optical Properties from Combined Airborne- and Ground-Based Direct and Diffuse Radiometric Measurements

    Science.gov (United States)

    Gatebe, C. K.; Dubovik, O.; King, M. D.; Sinyuk, A.

    2010-01-01

    This paper presents a new method for simultaneously retrieving aerosol and surface reflectance properties from combined airborne and ground-based direct and diffuse radiometric measurements. The method is based on the standard Aerosol Robotic Network (AERONET) method for retrieving aerosol size distribution, complex index of refraction, and single scattering albedo, but modified to retrieve aerosol properties in two layers, below and above the aircraft, and parameters on surface optical properties from combined datasets (Cloud Absorption Radiometer (CAR) and AERONET data). A key advantage of this method is the inversion of all available spectral and angular data at the same time, while accounting for the influence of noise in the inversion procedure using statistical optimization. The wide spectral (0.34-2.30 m) and angular range (180 ) of the CAR instrument, combined with observations from an AERONET sunphotometer, provide sufficient measurement constraints for characterizing aerosol and surface properties with minimal assumptions. The robustness of the method was tested on observations made during four different field campaigns: (a) the Southern African Regional Science Initiative 2000 over Mongu, Zambia, (b) the Intercontinental Transport Experiment-Phase B over Mexico City, Mexico (c) Cloud and Land Surface Interaction Campaign over the Atmospheric Radiation Measurement (ARM) Central Facility, Oklahoma, USA, and (d) the Arctic Research of the Composition of the Troposphere from Aircraft and Satellites (ARCTAS) over Elson Lagoon in Barrow, Alaska, USA. The four areas are dominated by different surface characteristics and aerosol types, and therefore provide good test cases for the new inversion method.

  12. Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

    Directory of Open Access Journals (Sweden)

    Xi Shao

    2016-03-01

    Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

  13. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Nonlinear evolution of the lower-hybrid drift instability

    International Nuclear Information System (INIS)

    Brackbill, J.U.; Forslund, D.W.; Quest, K.B.; Winske, D.

    1984-01-01

    The results of simulations of the lower-hybrid drift instability in a neutral sheet configuration are described. The simulations use an implicit formulation to relax the usual time step limitations and thus extend previous explicit calculations to weaker gradients, larger mass ratios, and long times compared with the linear growth time. The numerical results give the scaling of the saturation level, heating rates, resistivity, and cross-field diffusion and a demonstration by comparison with a fluid electron model that dissipation in the lower-hybrid drift instability is caused by electron kinetic effects

  15. Toroidal effects on drift wave turbulence

    Energy Technology Data Exchange (ETDEWEB)

    LeBrun, M.J.; Tajima, T.; Gray, M.G.; Furnish, G.; Horton, W.

    1992-09-23

    The universal drift instability and other drift instabilities driven by density and temperature gradients in a toroidal system are investigated in both linear and nonlinear regimes via particle simulation. Runs in toroidal and cylindrical geometry show dramatic differences in plasma behavior, primarily due to the toroidicity-induced coupling of rational surfaces through the poloidal mode number m. In the toroidal system studied, the eigenmodes are seen to possess (i) an elongated, nearly global radial extent (ii) a higher growth rate than in the corresponding cylindrical system, (iii) an eigenfrequency nearly constant with radius, (iv) a global temperature relaxation and enhancement of thermal heat conduction. Most importantly, the measured Xi shows an increase with radius and an absolute value on the order of that observed in experiment. On the basis of our observations, we argue that the increase in Xi with radius observed in experiment is caused by the global nature of heat convection in the presence of toroidicity-induced mode coupling.

  16. Toroidal effects on drift wave turbulence

    International Nuclear Information System (INIS)

    LeBrun, M.J.; Tajima, T.; Gray, M.G.; Furnish, G.; Horton, W.

    1992-01-01

    The universal drift instability and other drift instabilities driven by density and temperature gradients in a toroidal system are investigated in both linear and nonlinear regimes via particle simulation. Runs in toroidal and cylindrical geometry show dramatic differences in plasma behavior, primarily due to the toroidicity-induced coupling of rational surfaces through the poloidal mode number m. In the toroidal system studied, the eigenmodes are seen to possess (i) an elongated, nearly global radial extent (ii) a higher growth rate than in the corresponding cylindrical system, (iii) an eigenfrequency nearly constant with radius, (iv) a global temperature relaxation and enhancement of thermal heat conduction. Most importantly, the measured Xi shows an increase with radius and an absolute value on the order of that observed in experiment. On the basis of our observations, we argue that the increase in Xi with radius observed in experiment is caused by the global nature of heat convection in the presence of toroidicity-induced mode coupling

  17. Drifting oscillations in axion monodromy

    Energy Technology Data Exchange (ETDEWEB)

    Flauger, Raphael [Department of Physics, Carnegie Mellon University, Pittsburgh, PA 15213 (United States); McAllister, Liam [Department of Physics, Cornell University, Ithaca, NY 14853 (United States); Silverstein, Eva [Stanford Institute for Theoretical Physics, Stanford University, Stanford, CA 94305 (United States); Westphal, Alexander, E-mail: flauger@physics.ucsd.edu, E-mail: mcallister@cornell.edu, E-mail: evas@stanford.edu, E-mail: alexander.westphal@desy.de [Theory Group, Deutsches Elektronen-Synchrotron DESY, D-22603 Hamburg (Germany)

    2017-10-01

    We study the pattern of oscillations in the primordial power spectrum in axion monodromy inflation, accounting for drifts in the oscillation period that can be important for comparing to cosmological data. In these models the potential energy has a monomial form over a super-Planckian field range, with superimposed modulations whose size is model-dependent. The amplitude and frequency of the modulations are set by the expectation values of moduli fields. We show that during the course of inflation, the diminishing energy density can induce slow adjustments of the moduli, changing the modulations. We provide templates capturing the effects of drifting moduli, as well as drifts arising in effective field theory models based on softly broken discrete shift symmetries, and we estimate the precision required to detect a drifting period. A non-drifting template suffices over a wide range of parameters, but for the highest frequencies of interest, or for sufficiently strong drift, it is necessary to include parameters characterizing the change in frequency over the e-folds visible in the CMB. We use these templates to perform a preliminary search for drifting oscillations in a part of the parameter space in the Planck nominal mission data.

  18. Drifting oscillations in axion monodromy

    International Nuclear Information System (INIS)

    Flauger, Raphael; Westphal, Alexander

    2014-12-01

    We study the pattern of oscillations in the primordial power spectrum in axion monodromy inflation, accounting for drifts in the oscillation period that can be important for comparing to cosmological data. In these models the potential energy has a monomial form over a super-Planckian field range, with superimposed modulations whose size is model-dependent. The amplitude and frequency of the modulations are set by the expectation values of moduli fields. We show that during the course of inflation, the diminishing energy density can induce slow adjustments of the moduli, changing the modulations. We provide templates capturing the effects of drifting moduli, as well as drifts arising in effective field theory models based on softly broken discrete shift symmetries, and we estimate the precision required to detect a drifting period. A non-drifting template suffices over a wide range of parameters, but for the highest frequencies of interest, or for sufficiently strong drift, it is necessary to include parameters characterizing the change in frequency over the e-folds visible in the CMB. We use these templates to perform a preliminary search for drifting oscillations in a part of the parameter space in the Planck nominal mission data.

  19. Stochastic electron dynamics due to drift waves in a sheared magnetic field and other drift motion problems

    International Nuclear Information System (INIS)

    Robertson, J.A.

    1986-12-01

    Electron motion in a single electrostatic wave in a sheared magnetic field is shown to become stochastic in the presence of a second wave at an amplitude well below that obtained from the overlapping pendulum resonance approximation. The enhanced stochasticity occurs for low parallel velocity electrons for which the parallel trapping motion from eE/sub parallel//m interacts strongly with the E x B trapping motion due to the presence of magnetic shear. The guiding-center equations for single particle electron orbits in given fields are investigated using both analytical and numerical techniques. The model assumes a slab magnetic field geometry with shear and two electrostatic plane waves propagating at an angle with respect to each other. Collisions and the self-consistent effect of the electron motion upon the fields are ignored. The guiding-center motion in an inertial reference frame moving in phase with the two waves is given by a two degree-of-freedom, autonomous Hamiltonian system. The single wave particle motion may be reduced to a two parameter family of one degree-of-freedom Hamiltonians which bifurcate from a pendulum phase space to a topology with three chains of elliptic and hyperbolic fixed points separated in radius about the mode-rational surface. In the presence of a perturbing wave with a different helicity, electrons in the small parallel velocity regime become stochastic at an amplitude scaling as the fourth root of the wave potential. The results obtained for stochastic motion apply directly to the problem of electron diffusion in drift waves occurring in toroidal fusion confinement devices. The effect of an adiabatically changing radial electric field upon guiding-center orbits in tokamaks is also investigated. This perturbation causes a radial polarization drift of trapped particle tokamak orbits

  20. Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

    Science.gov (United States)

    Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

    2017-12-01

    This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

  1. 'LTE-diffusion approximation' for arc calculations

    International Nuclear Information System (INIS)

    Lowke, J J; Tanaka, M

    2006-01-01

    This paper proposes the use of the 'LTE-diffusion approximation' for predicting the properties of electric arcs. Under this approximation, local thermodynamic equilibrium (LTE) is assumed, with a particular mesh size near the electrodes chosen to be equal to the 'diffusion length', based on D e /W, where D e is the electron diffusion coefficient and W is the electron drift velocity. This approximation overcomes the problem that the equilibrium electrical conductivity in the arc near the electrodes is almost zero, which makes accurate calculations using LTE impossible in the limit of small mesh size, as then voltages would tend towards infinity. Use of the LTE-diffusion approximation for a 200 A arc with a thermionic cathode gives predictions of total arc voltage, electrode temperatures, arc temperatures and radial profiles of heat flux density and current density at the anode that are in approximate agreement with more accurate calculations which include an account of the diffusion of electric charges to the electrodes, and also with experimental results. Calculations, which include diffusion of charges, agree with experimental results of current and heat flux density as a function of radius if the Milne boundary condition is used at the anode surface rather than imposing zero charge density at the anode

  2. Surface morphology and molecular bonding of CaCO3 nanocrystallites by gas diffusion method

    Science.gov (United States)

    Sulimai, N. H.; Rani, Rozina Abdul; Khusaimi, Z.; Abdullah, S.; Salifairus, M. J.; Alrokayan, Salman; Khan, Haseeb; Rusop, M.

    2018-05-01

    Calcium carbonate with the chemical formula of (CaCO3) is the most abundant element in the world. Its usage on certain applications is largely affected by its properties. The best means to control its properties is through controlled preparation of CaCO3. This study uses diffusion method between the precursors Calcium Chloride and Ammonium Carbonate. Instead of using water, ethanol was used to prepare the salt. Reaction was done in room temperature (RT) for 6h-24h. Smallest average crystallite size measured by FESEM micrograph is 500nm produced by synthesis of CaCO3 reacted for 168 hours. From energy-dispersive X-ray spectrum also indicated the smallest particle size is by CaCO3 reacted for 168 hours. Changes was seen for element Ca at 3.7keV.

  3. Nearshore drift dynamics of natural versus artificial seagrass wrack

    Science.gov (United States)

    Baring, Ryan J.; Fairweather, Peter G.; Lester, Rebecca E.

    2018-03-01

    Drifting macrophytes such as seagrass and macroalgae are commonly found washed ashore on sandy beaches but few studies have investigated the drift trajectories of macrophytes whilst near to the coast. This is the first study to investigate the surface drifting of small clumps of seagrass released at various distances from shore, across multiple days with contrasting wind and tidal conditions, in a large gulf in southern Australia. Natural and artificial radio-tagged seagrass units generally travelled in the same directions as tides but trajectories were variable across sampling days and when tagged units were released at different distances from shore. Natural and artificial units diverged from each other particularly on days when wind speeds increased but generally drifted in the same direction and ended up within close proximity to each other at the 6-h endpoint. During calm conditions, tagged seagrass units drifted with tides for 0.25-5 km and, during one sampling day when wind speeds increased, drifted for >5 km over the 6-h time period. Only tagged units that were released closest to shore stranded on sandy beaches within the six hours of observation, so it would be difficult to predict the eventual stranding location on shorelines for macrophytes released further offshore. This study provides evidence of the variability of macrophyte drift dynamics near to coastlines. Acknowledging this variability is essential for further understanding of the ecological significance of allochthonous material arriving at shorelines, which should be integrated into future research and management of sandy-beach ecosystems.

  4. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  5. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  6. Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

    Czech Academy of Sciences Publication Activity Database

    Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

    2016-01-01

    Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

  7. Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Sun Jianzhong; Wang Zhikang; Gong Xiangyang

    2006-01-01

    Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

  8. Radial thermal diffusivity of toroidal plasma affected by resonant magnetic perturbations

    International Nuclear Information System (INIS)

    Kanno, Ryutaro; Nunami, Masanori; Satake, Shinsuke; Takamaru, Hisanori; Okamoto, Masao

    2012-04-01

    We investigate how the radial thermal diffusivity of an axisymmetric toroidal plasma is modified by effect of resonant magnetic perturbations (RMPs), using a drift kinetic simulation code for calculating the thermal diffusivity in the perturbed region. The perturbed region is assumed to be generated on and around the resonance surfaces, and is wedged in between the regular closed magnetic surfaces. It has been found that the radial thermal diffusivity χ r in the perturbed region is represented as χ r = χ r (0) {1 + c r parallel 2 >}. Here r parallel 2 > 1/2 is the strength of the RMPs in the radial directions, means the flux surface average defined by the unperturbed (i.e., original) magnetic field, χ r (0) is the neoclassical thermal diffusivity, and c is a positive coefficient. In this paper, dependence of the coefficient c on parameters of the toroidal plasma is studied in results given by the δ f simulation code solving the drift kinetic equation under an assumption of zero electric field. We find that the dependence of c is given as c ∝ ω b /ν eff m in the low collisionality regime ν eff b , where ν eff is the effective collision frequency, ω b is the bounce frequency and m is the particle mass. In case of ν eff > ω b , the thermal diffusivity χ r evaluated by the simulations becomes close to the neoclassical thermal diffusivity χ r (0) . (author)

  9. Surface tension phenomena in the xylem sap of three diffuse porous temperate tree species

    Science.gov (United States)

    K. K. Christensen-Dalsgaard; M. T. Tyree; P. G. Mussone

    2011-01-01

    In plant physiology models involving bubble nucleation, expansion or elimination, it is typically assumed that the surface tension of xylem sap is equal to that of pure water, though this has never been tested. In this study we collected xylem sap from branches of the tree species Populus tremuloides, Betula papyrifera and Sorbus...

  10. Modification of the glass surface induced by redox reactions and internal diffusion processes

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    In this paper we report a novel way to modify the glass surface in favor of some physical performances. The main step is to perform iso-thermal treatments on the selected silicate glasses containing transition metal at temperatures near the glass transition temperature for various durations under...

  11. Drift chamber data readout system

    International Nuclear Information System (INIS)

    Basiladze, S.G.; Lokhonyai, L.

    1980-01-01

    An electronic system for processing drift chamber signals is described. The system consists of 4-channel fast amplifier-discriminators of low threshold, 16-channel time-expanders transforming 0.5 μs time intervals to 10 μs and a 9-bit time-to-digital converter (TDC) recording up to 16 expanded time intervals. If the average track multiplicity is small, TDC is capable to process signals from 4 time-expanders (i.e., 64 drift gaps). In order to record multiple tracks per drift gap discriminator outputs can be connected to a number of time-expander channels. The fast clear input enables the system to be cleared within 0.5 μs. Efficient readout from TDC is facilated by reading only those channels which contain non-zero data (9 bits - drift time; 6 bits - wire number)

  12. Drift tubes of Linac 2

    CERN Multimedia

    Photographic Service

    1977-01-01

    Being redied for installation, those at the right are for tank 1, those on the left for tank 2. Contrary to Linac 1, which had drift-tubes supported on stems, here the tubes are suspended, for better mechanical stability.

  13. Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

    Directory of Open Access Journals (Sweden)

    H. Hammami

    2017-08-01

    Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

  14. On nonlinear periodic drift waves

    International Nuclear Information System (INIS)

    Kauschke, U.; Schlueter, H.

    1990-09-01

    Nonlinear periodic drift waves are investigated on the basis of a simple perturbation scheme for both the amplitude and inverse frequency. The coefficients for the generation of the forced harmonics are derived, a nonlinear dispersion relation is suggested and a criterion for the onset of the modulational instability is obtained. The results are compared with the ones obtained with the help of a standard KBM-treatment. Moreover cnoidal drift waves are suggested and compared to an experimental observation. (orig.)

  15. The OPAL vertex drift chamber

    International Nuclear Information System (INIS)

    Carter, J.R.; Elcombe, P.A.; Hill, J.C.; Roach, C.M.; Armitage, J.C.; Carnegie, R.K.; Estabrooks, P.; Hemingway, R.; Karlen, D.; McPherson, A.; Pinfold, J.; Roney, J.M.; Routenburg, P.; Waterhouse, J.; Hargrove, C.K.; Klem, D.; Oakham, F.G.; Carter, A.A.; Jones, R.W.L.; Lasota, M.M.B.; Lloyd, S.L.; Pritchard, T.W.; Wyatt, T.R.

    1990-01-01

    A high precision vertex drift chamber has been installed in the OPAL experiment at LEP. The design of the chamber and the associated readout electronics is described. The performance of the system has been studied using cosmic ray muons and the results of these studies are presented. A space resolution of 50 μm in the drift direction is obtained using the OPAL central detector gas mixture at 4 bar. (orig.)

  16. Dφ vertex drift chamber construction and test results

    International Nuclear Information System (INIS)

    Clark, A.R.; Goozen, F.; Grudberg, P.; Klopfenstein, C.; Kerth, L.T.; Loken, S.C.; Oltman, E.; Strovink, M.; Trippe, T.G.

    1991-05-01

    A jet-cell based vertex chamber has been built for the D OE experiment at Fermilab and operated in a test beam there. Low drift velocity and diffusion properties were achieved using CO 2 (95%)-ethane(5%) at atmospheric pressure. The drift velocity is found to be consistent with [9.74+8.68(|E|-1.25)] μm/nsec where E is the electric field strength in (kV/cm < |E| z 1.6 kV/cm.) An intrinsic spatial resolution of 60 μm or better for drift distances greater than 2 mm is measured. The track pair efficiency is estimated to be better than 90% for separations greater than 630 μm. 8 refs., 6 figs., 1 tab

  17. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  18. Generalized drift-flux correlation

    International Nuclear Information System (INIS)

    Takeuchi, K.; Young, M.Y.; Hochreiter, L.E.

    1991-01-01

    A one-dimensional drift-flux model with five conservation equations is frequently employed in major computer codes, such as TRAC-PD2, and in simulator codes. In this method, the relative velocity between liquid and vapor phases, or slip ratio, is given by correlations, rather than by direct solution of the phasic momentum equations, as in the case of the two-fluid model used in TRAC-PF1. The correlations for churn-turbulent bubbly flow and slug flow regimes were given in terms of drift velocities by Zuber and Findlay. For the annular flow regime, the drift velocity correlations were developed by Ishii et al., using interphasic force balances. Another approach is to define the drift velocity so that flooding and liquid hold-up conditions are properly simulated, as reported here. The generalized correlation is used to reanalyze the MB-2 test data for two-phase flow in a large-diameter pipe. The results are applied to the generalized drift flux velocity, whose relationship to the other correlations is discussed. Finally, the generalized drift flux correlation is implemented in TRAC-PD2. Flow reversal from countercurrent to cocurrent flow is computed in small-diameter U-shaped tubes and is compared with the flooding curve

  19. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-04-05

    Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

  20. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-01-01

    Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

  1. Transient chaotic transport in dissipative drift motion

    Energy Technology Data Exchange (ETDEWEB)

    Oyarzabal, R.S. [Pós-Graduação em Ciências/Física, Universidade Estadual de Ponta Grossa, 84030-900, Ponta Grossa, PR (Brazil); Szezech, J.D. [Departamento de Matemática e Estatística, Universidade Estadual de Ponta Grossa, 84030-900, Ponta Grossa, PR (Brazil); Batista, A.M., E-mail: antoniomarcosbatista@gmail.com [Departamento de Matemática e Estatística, Universidade Estadual de Ponta Grossa, 84030-900, Ponta Grossa, PR (Brazil); Souza, S.L.T. de [Departamento de Física e Matemática, Universidade Federal de São João del Rei, 36420-000, Ouro Branco, MG (Brazil); Caldas, I.L. [Instituto de Física, Universidade de São Paulo, 05315-970, São Paulo, SP (Brazil); Viana, R.L. [Departamento de Física, Universidade Federal do Paraná, 81531-990, Curitiba, PR (Brazil); Sanjuán, M.A.F. [Departamento de Física, Universidad Rey Juan Carlos, Tulipán s/n, 28933 Móstoles, Madrid (Spain)

    2016-04-22

    Highlights: • We consider a situation for which a chaotic transient is present in the dynamics of the two-wave model with damping. • The damping in plasma models can be a way for study a realistic behavior of confinement due the collisional effect. • The escape time as a function of the damping obey a power-law scaling. • We have made a qualitative transport analysis with a simple model that can be useful for more complete models. • We have shown that the pattern of the basin of attraction depends on the damping parameter. - Abstract: We investigate chaotic particle transport in magnetised plasmas with two electrostatic drift waves. Considering dissipation in the drift motion, we verify that the removed KAM surfaces originate periodic attractors with their corresponding basins of attraction. We show that the properties of the basins depend on the dissipation and the space-averaged escape time decays exponentially when the dissipation increases. We find positive finite time Lyapunov exponents in dissipative drift motion, consequently the trajectories exhibit transient chaotic transport. These features indicate how the transient plasma transport depends on the dissipation.

  2. Mean field diffusion models for precipitation in crystalline GaAs including surface tension and bulk stresses

    Energy Technology Data Exchange (ETDEWEB)

    Dreyer, Wolfgang [Weierstrass-Institut fuer Angewandte Analysis und Stochastik (WIAS) im Forschungsverbund Berlin e.V. (Germany); Kimmerle, Sven-Joachim [Humboldt-Univ. Berlin (Germany). Dept. of Mathematics

    2009-07-01

    Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first class of models treats the diffusion-controlled regime of interface motion, while the second class is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. We consider homogenised models, where different length scales of the experimental situation have been exploited in order to simplify the equations. These homogenised models generalise the well-known Lifshitz-Slyozov-Wagner model for Ostwald ripening. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

  3. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  4. Advection endash diffusion past a strip. II. Oblique incidence

    International Nuclear Information System (INIS)

    Knessl, C.; Keller, J.B.

    1997-01-01

    Advection and diffusion of particles past an impenetrable strip is considered when the strip is oblique to the advection or drift velocity. The particle concentration p(x,y) is determined asymptotically for large values of vL/D, where v is the drift velocity, D is the diffusion coefficient, and 2L is the width of the strip. The results complement those of Part I, which treated a strip normal to the drift velocity. copyright 1997 American Institute of Physics

  5. The Drifting Star

    Science.gov (United States)

    2008-04-01

    By studying in great detail the 'ringing' of a planet-harbouring star, a team of astronomers using ESO's 3.6-m telescope have shown that it must have drifted away from the metal-rich Hyades cluster. This discovery has implications for theories of star and planet formation, and for the dynamics of our Milky Way. ESO PR Photo 09a/08 ESO PR Photo 09a/08 Iota Horologii The yellow-orange star Iota Horologii, located 56 light-years away towards the southern Horologium ("The Clock") constellation, belongs to the so-called "Hyades stream", a large number of stars that move in the same direction. Previously, astronomers using an ESO telescope had shown that the star harbours a planet, more than 2 times as large as Jupiter and orbiting in 320 days (ESO 12/99). But until now, all studies were unable to pinpoint the exact characteristics of the star, and hence to understand its origin. A team of astronomers, led by Sylvie Vauclair from the University of Toulouse, France, therefore decided to use the technique of 'asteroseismology' to unlock the star's secrets. "In the same way as geologists monitor how seismic waves generated by earthquakes propagate through the Earth and learn about the inner structure of our planet, it is possible to study sound waves running through a star, which forms a sort of large, spherical bell," says Vauclair. The 'ringing' from this giant musical instrument provides astronomers with plenty of information about the physical conditions in the star's interior. And to 'listen to the music', the astronomers used one of the best instruments available. The observations were conducted in November 2006 during 8 consecutive nights with the state-of-the-art HARPS spectrograph mounted on the ESO 3.6-m telescope at La Silla. Up to 25 'notes' could be identified in the unique dataset, most of them corresponding to waves having a period of about 6.5 minutes. These observations allowed the astronomers to obtain a very precise portrait of Iota Horologii: its

  6. Particle diffusion in a spheromak

    International Nuclear Information System (INIS)

    Meyerhofer, D.D.; Levinton, F.M.; Yamada, M.

    1988-01-01

    The local carbon particle diffusion coefficient was measured in the Proto S-1/C spheromak using a test particle injection scheme. When the plasma was not in a force-free Taylor state, and when there were pressure gradients in the plasma, the particle diffusion was five times that predicted by Bohm and was consistent with collisional drift wave diffusion. The diffusion appears to be driven by correlations of the fluctuating electric field and density. During the decay phase of the discharge when the plasma was in the Taylor state, the diffusion coefficient of the carbon was classical. 23 refs., 4 figs

  7. Environmental sciences: general. 1. Evaluation of Iodine Reactions with Nuclear Aerosols by DRIFT

    International Nuclear Information System (INIS)

    Riggs, C.A.; Tompson, R.V.; Ghosh, T.K.; Loyalka, S.K.

    2001-01-01

    Nuclear source term computations require databases for iodine vapor reactions with cesium compounds. We have explored measurements of iodine vapor [I 2(g) ] reactions with cesium carbonate particles [CsCO 3(s) ] using diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy in the far infrared region for iodine vapor concentrations typical of post-transient conditions in a pressurized water reactor containment. Cesium hydroxide (CsOH) in aerosol form is likely a significant source of radio-cesium released during a reactor transient. As shown in Eq. (1), CsOH (s) particles can combine with iodine gas to form cesium iodide [CsI (s) ] particles. Equations (2) and (3) present a two-step method where the CsOH (s) particles combine with carbon dioxide [CO 2(g) ] found in air to form Cs 2 CO 3(s) particles, which then react with iodine gas to form CsI (s) particles: I 2(g) + 4CsOH (s) ↔ 2CsI (s) 12CsO (s) 12H 2 O (l) , (1) CO 2(g) 12CsOH (s) ↔ Cs 2 CO 3(s) + H 2 O, (2) and Cs 2 CO 3(s) 13I 2(g) ↔ 5CsI (s) + CsIO 3(s) + 3CO 2(g) . (3) We elected to study reactions with Cs 2 CO 3(s) rather than CsOH (s) particles because of significant analytical and handling challenges with the DRIFT attachment presented by the corrosive characteristics of CsOH (s) particles. Physical modifications to the DRIFT attachment, in addition to improved handling practices, need to be evaluated prior to proceeding with the study of CsOH (s) by this method. The reaction of cesium carbonate agglomerates with iodine could occur by surface adsorption and/or absorption. Physical adsorption depends on the surface area and porosity of the solid material. Chemical adsorption depends on the chemical properties of both the gas and the solid material. Beahm et al. previously used classical wet chemical methods to monitor the reaction products after the reaction occurred. The use of DRIFT allows the study of the predicted physical and chemical adsorption occurring on the Cs 2 CO 3(s) surface

  8. Extreme event statistics in a drifting Markov chain

    Science.gov (United States)

    Kindermann, Farina; Hohmann, Michael; Lausch, Tobias; Mayer, Daniel; Schmidt, Felix; Widera, Artur

    2017-07-01

    We analyze extreme event statistics of experimentally realized Markov chains with various drifts. Our Markov chains are individual trajectories of a single atom diffusing in a one-dimensional periodic potential. Based on more than 500 individual atomic traces we verify the applicability of the Sparre Andersen theorem to our system despite the presence of a drift. We present detailed analysis of four different rare-event statistics for our system: the distributions of extreme values, of record values, of extreme value occurrence in the chain, and of the number of records in the chain. We observe that, for our data, the shape of the extreme event distributions is dominated by the underlying exponential distance distribution extracted from the atomic traces. Furthermore, we find that even small drifts influence the statistics of extreme events and record values, which is supported by numerical simulations, and we identify cases in which the drift can be determined without information about the underlying random variable distributions. Our results facilitate the use of extreme event statistics as a signal for small drifts in correlated trajectories.

  9. Relative drift between black aurora and the ionospheric plasma

    Directory of Open Access Journals (Sweden)

    E. M. Blixt

    2005-07-01

    Full Text Available Black auroras are recognized as spatially well-defined regions within uniform diffuse aurora where the optical emission is significantly reduced. Although a well studied phenomenon, there is no generally accepted theory for black auroras. One theory suggests that black regions are formed when energetic magnetospheric electrons no longer have access to the loss cone. If this blocking mechanism drifts with the source electron population in the magnetosphere, black auroras in the ionosphere should drift eastward with a velocity that increases with the energy of the precipitating electrons in the surrounding aurora, since the gradient-B curvature drift is energy dependent. It is the purpose of this paper to test this hypothesis. To do so we have used simultaneous measurements by the European Incoherent Scatter (EISCAT radar and an auroral TV camera at Tromsø, Norway. We have analyzed 8 periods in which a black aurora occurred frequently to determine their relative drift with respect to the ionospheric plasma. The black aurora was found to drift eastward with a velocity of 1.5–4km/s, which is in accordance with earlier observations. However, one case was found where a black patch was moving westward, this being the first report of such behaviour in the literature. In general, the drift was parallel to the ionospheric flow but at a much higher velocity. This suggests that the generating mechanism is not of ionospheric origin. The characteristic energy of the precipitating electron population was estimated through inversion of E-region plasma density profiles. We show that the drift speed of the black patches increased with the energy of the precipitating electrons in a way consistent with the gradient-B curvature drift, suggesting a magnetospheric mechanism for the black aurora. As expected, a comparison of the drift speeds with a rudimentary dipole field model of the gradient-B curvature drift speed only yields order-of-magnitude agreement, which

  10. Self-diffusion dynamics processes relevant to 2D homoepitaxy growth of Ni adatom on Ni(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Fusheng [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Chen, Yifeng, E-mail: yefengc63@sina.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Wang, Yufei, E-mail: yejin802@126.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Liu, Zhulin; Hu, Zhongliang [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Yang, Xiyuan [Department of Physics, Hunan University of Arts and Science, Changde 415000 (China); Luo, Wenhua [Department of Physics and Electronic Information Science, Hunan Institute of Science and Technology, Yueyang 414006 (China)

    2014-07-01

    Using molecular dynamics and modified analytic embedded atom methods, the atomic self-diffusion dynamics behaviors relevant to 2D crystal growth on Ni(111) surface have been studied between 150 and 600 K. On perfect Ni(111) surface, the activation energy and prefactor are 0.058±0.001 eV and 4.2×10{sup −4} cm{sup 2}/s between 150 and 350 K, and 0.082±0.003 eV and 7.8×10{sup −4} cm{sup 2}/s from 400 to 600 K. Ni adatom just hops along the directions of close-packed steps on stepped Ni(111) surface, the corresponding activation energies and prefactors are 0.188±0.002 eV and (3.8–4.4)×10{sup −3} cm{sup 2}/s along the direction of A-type step, 0.140±0.001 eV and (1.1–1.2)×10{sup −3} cm{sup 2}/s along the direction of B-type step, and both fitting lines of Arrhenius law intersect at T{sub c}=420–440 K. Our results show that the atomic growth dynamics under nonequilibrium conditions is gradually dominated by the prefactor with increasing temperature. In addition, the shape-change of the 2D nanometer-size island has been discussed on stepped Ni(111) surface in different temperature range.

  11. Characteristic parameters of drift chambers calculation

    International Nuclear Information System (INIS)

    Duran, I.; Martinez-Laso, L.

    1989-01-01

    We present here the methods we used to analyse the characteristic parameters of drift chambers. The algorithms to calculate the electric potential in any point for any drift chamber geometry are presented. We include the description of the programs used to calculate the electric field, the drift paths, the drift velocity and the drift time. The results and the errors are discussed. (Author) 7 refs

  12. Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

    Science.gov (United States)

    Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

    2005-09-01

    We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

  13. In-Drift Microbial Communities

    Energy Technology Data Exchange (ETDEWEB)

    D. Jolley

    2000-11-09

    As directed by written work direction (CRWMS M and O 1999f), Performance Assessment (PA) developed a model for microbial communities in the engineered barrier system (EBS) as documented here. The purpose of this model is to assist Performance Assessment and its Engineered Barrier Performance Section in modeling the geochemical environment within a potential repository drift for TSPA-SR/LA, thus allowing PA to provide a more detailed and complete near-field geochemical model and to answer the key technical issues (KTI) raised in the NRC Issue Resolution Status Report (IRSR) for the Evolution of the Near Field Environment (NFE) Revision 2 (NRC 1999). This model and its predecessor (the in-drift microbial communities model as documented in Chapter 4 of the TSPA-VA Technical Basis Document, CRWMS M and O 1998a) was developed to respond to the applicable KTIs. Additionally, because of the previous development of the in-drift microbial communities model as documented in Chapter 4 of the TSPA-VA Technical Basis Document (CRWMS M and O 1998a), the M and O was effectively able to resolve a previous KTI concern regarding the effects of microbial processes on seepage and flow (NRC 1998). This document supercedes the in-drift microbial communities model as documented in Chapter 4 of the TSPA-VA Technical Basis Document (CRWMS M and O 1998a). This document provides the conceptual framework of the revised in-drift microbial communities model to be used in subsequent performance assessment (PA) analyses.

  14. In-Drift Microbial Communities

    International Nuclear Information System (INIS)

    Jolley, D.

    2000-01-01

    As directed by written work direction (CRWMS M and O 1999f), Performance Assessment (PA) developed a model for microbial communities in the engineered barrier system (EBS) as documented here. The purpose of this model is to assist Performance Assessment and its Engineered Barrier Performance Section in modeling the geochemical environment within a potential repository drift for TSPA-SR/LA, thus allowing PA to provide a more detailed and complete near-field geochemical model and to answer the key technical issues (KTI) raised in the NRC Issue Resolution Status Report (IRSR) for the Evolution of the Near Field Environment (NFE) Revision 2 (NRC 1999). This model and its predecessor (the in-drift microbial communities model as documented in Chapter 4 of the TSPA-VA Technical Basis Document, CRWMS M and O 1998a) was developed to respond to the applicable KTIs. Additionally, because of the previous development of the in-drift microbial communities model as documented in Chapter 4 of the TSPA-VA Technical Basis Document (CRWMS M and O 1998a), the M and O was effectively able to resolve a previous KTI concern regarding the effects of microbial processes on seepage and flow (NRC 1998). This document supercedes the in-drift microbial communities model as documented in Chapter 4 of the TSPA-VA Technical Basis Document (CRWMS M and O 1998a). This document provides the conceptual framework of the revised in-drift microbial communities model to be used in subsequent performance assessment (PA) analyses

  15. A versatile optical profilometer based on conoscopic holography sensors for acquisition of specular and diffusive surfaces in artworks

    Science.gov (United States)

    Gaburro, Nicola; Marchioro, Giacomo; Daffara, Claudia

    2017-07-01

    Surface metrology of artworks requires the design of suitable devices for in-situ non-destructive measurement together with reliable procedures for an effective analysis of such non-engineered variegate objects. To advance the state-of-the-art it has been implemented a versatile optical micro-profilometry taking advantage of the adapt- ability of conoscopic holography sensors, able to operate with irregular shapes and composite materials (diffusive, specular, and polychrome) of artworks. The scanning technique is used to obtain wide field and high spatially resolved areal profilometry. The prototype has a modular scheme based on a set of conoscopic sensors, extending the typical design based on a scanning stage and a single probe with a limited bandwidth, thus allowing the collection of heights data from surface with different scales and materials with variegate optical response. The system was optimized by characterizing the quality of the measurement with the probes triggered in continuous scanning modality. The results obtained on examples of cultural heritage objects (2D paintings, 3D height-relief) and materials (pictorial, metallic) demonstrate the versatility of the implemented device.

  16. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

    Energy Technology Data Exchange (ETDEWEB)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  17. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

    Science.gov (United States)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  18. Eelgrass re-establishment in shallow estuaries is affected by drifting macroalgae

    DEFF Research Database (Denmark)

    Canal-Verges, Paula; Potthoff, M.; Hansen, F. T.

    2014-01-01

    surface sediment. Furthermore, drifting macroalgae ballistically damage eelgrass beds and increase seedling mortality. The frequency and impact of drifting macroalgae in Odense Fjord was evaluated with an agent-based model. The aims of this model were to understand and predict the mobility...... resuspension in bare bottoms and on rooted vegetation due to ballistic impacts in areas affected by algae drift. (C) 2013 Elsevier B.V. All rights reserved....

  19. Drift tubes of Linac 2

    CERN Multimedia

    CERN PhotoLab

    1977-01-01

    With the advent of the 800 MeV PS Booster in 1972, the original injector of the PS, a 50 MeV Alvarez-type proton linac, had reached its limits, in terms of intensity and stability. In 1973 one therefore decided to build a new linac (Linac 2), also with a drift-tube Alvarez structure and an energy of 50 MeV. It had a new Cockcroft-Walton preinjector with 750 keV, instead of the previous one with 500 keV. Linac 2 was put into service in 1980. The old Linac 1 was then used for the study of, and later operation with, various types of ions. This picture shows Linac 2 drift-tubes, suspended on stems coming from the top, in contrast to Linac 1, where the drift-tubes stood on stems coming from the bottom.

  20. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  1. Suspended sediment drift and dispersion at Hibernia

    International Nuclear Information System (INIS)

    Tedford, T.; Drozdowski, A.; Hannah, C.G.

    2003-01-01

    Surface water waves and near-bottom currents around the Hibernia oil production platform on the Grand Banks of Newfoundland were examined to determine how the different seasons affect changes in wave magnitude and directions of water currents. Wave observations revealed a strong correlation with seasons, with the larger waves occurring in fall and early winter. There was no obvious seasonality in the size or direction of currents. The benthic boundary layer transport (BBLT) model was used to predict the drift and dispersion pathways of suspended drilling muds discharged from the Hibernia platform. The 2-year study from March 1998 to May 2000 involved 5-day BBLT model simulations covering the complete period of current meter deployment. The study focused on the sensitivity of the drift and dispersion to variability in the physical environment and uncertainty in the bottom stress calculation and particle settling velocity. The BBLT model incorporates a stress dependent particle settling velocity that includes the main features of the flocculations of drill mud fines under marine conditions. The study provides a better understanding of how drill mud concentration levels can change with variations in waves, currents, and bottom stress. It was determined that drift is generally oriented along the northwest/southeast axis, with a typical magnitude of 0.8 cm/sec for the fast settling velocity and 3.1 cm/sec for the slow settling velocity. It was concluded that near-surface or mid-depth discharges of drilling mud in the summer may not reach the sea floor. 17 refs., 13 tabs., 36 figs

  2. Predicting public sector accountability : From agency drift to forum drift

    NARCIS (Netherlands)

    Schillemans, Thomas|info:eu-repo/dai/nl/229913881; Busuioc, Madalina

    2015-01-01

    Principal-agent theory has been the dominant theory at the heart of public sector accountability research. The notion of the potentially drifting agent-such as independent public agencies, opaque transnational institutions, or recalcitrant street-level bureaucrats-has been the guiding paradigm in

  3. Spectroscopic measurements with a silicon drift detector having a continuous implanted drift cathode-voltage divider

    CERN Document Server

    Bonvicini, V; D'Acunto, L; Franck, D; Gregorio, A; Pihet, P; Rashevsky, A; Vacchi, A; Vinogradov, L I; Zampa, N

    2000-01-01

    A silicon drift detector (SDD) prototype where the drift electrode also plays the role of a high-voltage divider has been realised and characterised for spectroscopic applications at near-room temperatures. Among the advantages of this design, is the absence of metal on the sensitive surface which makes this detector interesting for soft X-rays. The detector prototype has a large sensitive area (2x130 mm sup 2) and the charge is collected by two anodes (butterfly-like detector). The energy resolution of a such a detector has been investigated at near-room temperatures using a commercial, hybrid, low-noise charge-sensitive preamplifier. The results obtained for the X-ray lines from sup 5 sup 5 Fe and sup 2 sup 4 sup 1 Am are presented.

  4. Optimisation of a combined transient-ion-drift/rapid thermal annealing process for copper detection in silicon

    Energy Technology Data Exchange (ETDEWEB)

    Belayachi, A.; Heiser, T.; Schunck, J.P.; Bourdais, S.; Bloechl, P.; Huber, A.; Kempf, A

    2003-09-15

    The transient ion drift (TID) technique has been recently proposed for copper trace detection in silicon. Cu atoms may be present either in the vicinity of the Si surface or within the volume. In the latter case they are either gathered at secondary defects or form precipitates believed to be silicides. In order to become detectable by TID Cu atoms must be put into the highly mobile interstitial state. Depending on the initial configuration of the Cu/Si system different physical mechanisms may enable Cu atoms to become 'TID active'. In this work we study the Cu activation process using rapid thermal processing (RTP) in an attempt to minimise the thermal budget required to achieve a complete activation. Both, surface and volume contaminated samples are investigated. During RTP treatments the activation of surface Cu atoms is found to proceed significantly faster than during standard furnace anneal. We tentatively attribute this behaviour to the UV light exposure associated with the RTP, which may enhance the release of copper atoms from the surface. The dissolution kinetics of the Cu precipitates occurring during RTPs are found to be only limited by Cu diffusion. The RTP/TID process is used to study the low temperature reaction path of supersaturated Cu. If prior to the RTP process, Cu atoms are chemically removed from the surface or near surface region, TID measures only the residual bulk Cu atoms. Our results show that out-diffusion and near-surface precipitation are reducing mostly the copper supersaturation.

  5. Collisional drift fluid equations and implications for drift waves

    International Nuclear Information System (INIS)

    Pfirsch, Dieter; Correa-Restrepo, Dario

    1996-01-01

    The usual theoretical description of drift-wave turbulence (considered to be one possible cause of anomalous transport in a plasma), e.g. the Hasegawa-Wakatani theory, makes use of various approximations, the effects of which are extremely difficult to assess. This concerns in particular the conservation laws for energy and momentum. The latter law is important in relation to charge separation and the resulting electric fields, which are possibly related to the L-H transition. Energy conservation is crucial to the stability behaviour, it will be discussed by means of an example. New collisional multi-species drift-fluid equations were derived by a new method which yields, in a transparent way, conservation of energy and total angular momentum and the law for energy dissipation. Both electrostatic and electromagnetic field variations are considered. The only restriction involved is the validity of the drift approximation; in particular, there are no assumptions restricting the geometry of the system. The method is based primarily on a Lagrangian for dissipationless fluids in the drift approximation with isotropic pressures. The dissipative terms are introduced by adding corresponding terms to the ideal equations of motion and of the pressures. The equations of motion, of course, no longer result from a Lagrangian via Hamilton's principle. However, their relation to the ideal equations also implies a relation to the ideal Lagrangian, which can be used to advantage. Instead of introducing heat conduction one can also assume isothermal behaviour, e.g. T v (x) = constant. Assumptions of this kind are often made in the literature. The new method of introducing dissipation is not restricted to the present kind of theory; it can equally well be applied to theories such as multi-fluid theories without using the drift approximation of the present paper. (author)

  6. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  7. Solar Drift-Pair Bursts

    Science.gov (United States)

    Stanislavsky, A.; Volvach, Ya.; Konovalenko, A.; Koval, A.

    2017-08-01

    In this paper a new sight on the study of solar bursts historically called drift pairs (DPs) is presented. Having a simple morphology on dynamic spectra of radio records (two short components separated in time, and often they are very similar) and discovered at the dawn of radio astronomy, their features remain unexplained totally up to now. Generally, the DPs are observed during the solar storms of type III bursts, but not every storm of type III bursts is linked with DPs. Detected by ground-based instruments at decameter and meter wavelengths, the DP bursts are limited in frequency bandwidth. They can drift from high frequencies to low ones and vice versa. Their frequency drift rate may be both lower and higher than typical rates of type III bursts at the same frequency range. The development of low-frequency radio telescopes and data processing provide additional possibilities in the research. In this context the fresh analysis of DPs, made from recent observations in the summer campaign of 2015, are just considered. Their study was implemented by updated tools of the UTR-2 radio telescope at 9-33 MHz. During 10-12 July of 2015, DPs forming the longest patterns on dynamic spectra are about 7% of the total number of recorded DPs. Their marvelous resemblance in frequency drift rates with the solar S-bursts is discussed.

  8. Job satisfaction and preference drift.

    NARCIS (Netherlands)

    Maassen van den Brink, H.; Groot, W.J.N.

    1999-01-01

    Most empirical studies do not find that higher wages lead to more job satisfaction. In this paper we argue that the insignificant effect of wages on job satisfaction is due to preference drift. We adapt the standard ordered response model to allow for preference shifts. The empirical results support

  9. Drift wave vortices and anomalous transport

    International Nuclear Information System (INIS)

    Horton, W.

    1990-01-01

    Many plasma equations for drift waves and other modes possess vortex solutions, so it is important to consider the transport associated with vortex structures and their mutual interactions. Vortex structures occur when the amplitude of the fluctuation is sufficient to trap and circulate plasma around the vortex in one wave period. The vortex contribution of the diffusion of the passively convected scalar field was calculated. It was found that the field can be represented by the superposition of vortices and wave fluctuation components. For transport the computer solutions for the vortex-vortex collisions with various impact parameters while carrying along the passively convected scalar thermodynamic field were used. As the result, the inelastic collisions with b≅r 0 ≅1/k x cross-section σ(b)≅b exp(-b/r 0 )≅r 0 give the strongest transport. An example is shown in figure. As the final result, the anomalous diffusion D was derived in dimensional form. (M.T.)

  10. Past surface temperatures at the NorthGRIP drill site from the difference in firn diffusion of water isotopes

    DEFF Research Database (Denmark)

    Simonsen, Sebastian Bjerregaard; Johnsen, S. J.; Popp, T. J.

    2011-01-01

    A new ice core paleothermometer is introduced based on the temperature dependent diffusion of the stable water isotopes in the firn. A new parameter called differential diffusion length is defined as the difference between the diffusion length of the two stable water isotopologues 2H1H16O and 1H218......O. A model treatment of the diffusion process of the firn and the ice is presented along with a method of retrieving the diffusion signal from the ice core record of water isotopes using spectral methods. The model shows how the diffusion process is highly dependent on the inter-annual variations...... warmer than observed in other ice core based temperature reconstructions. The mechanisms behind this behaviour are not fully understood. The method shows the need of an expansion of high resolution stable water isotope datasets from ice cores. However, the new ice core paleothermometer presented here...

  11. Coverage dependent desorption dynamics of deuterium on Si(100) surfaces: interpretation with a diffusion-promoted desorption model.

    Science.gov (United States)

    Matsuno, T; Niida, T; Tsurumaki, H; Namiki, A

    2005-01-08

    We studied coverage dependence of time-of-flight (TOF) spectra of D2 molecules thermally desorbed from the D/Si(100) surface. The mean translational energies Et of desorbed D2 molecules were found to increase from 0.20+/-0.05 eV to 0.40+/-0.04 eV as the desorption coverage window was decreased from 1.0 ML> or =thetaD> or =0.9 ML to 0.2 ML> or =thetaD> or =0 ML, being consistent with the kinetics switch predicted in the interdimer mechanism. The measured TOF spectra were deconvoluted into 2H, 3H, and 4H components by a curve fitting method along the principle of detailed balance. As a result, it turned out that the desorption kinetics changes from the 4H to the 3H situation at high coverage above thetaD=0.9 ML, while the 2H desorption is dominant for a quite wide coverage region up to thetaD=0.8 ML. A dynamic desorption mechanism by which the desorption is promoted by D-atom diffusion to dangling bonds was proposed. 2005 American Institute of Physics.

  12. Diffusion effects in undulator radiation

    Directory of Open Access Journals (Sweden)

    Ilya Agapov

    2014-11-01

    Full Text Available Quantum diffusion effects in undulator radiation in semiclassical approximation are considered. Short-term effects on the electron beam motion are discussed and it is shown that approaches based on diffusion approximation with drift-diffusion coefficients derived from undulator or bending magnet radiation spectrum, and on Poisson statistics with radiation spectrum defined by the local beding field, all lead to similar results in terms of electron energy spread for cases of practical interest. An analytical estimate of the influence of quantum diffusion on the undulator radiation spectrum is derived.

  13. Tillage techniques to reactivate aeolian erosion on inland drift-sand

    NARCIS (Netherlands)

    Riksen, M.J.P.M.; Goossens, D.

    2005-01-01

    The inland drift-sand areas in northern Europe are characterised by a rapid decline in both aeolian activity and areal size. Many former drift-sand surfaces have become immobilised by natural or man-induced processes, such as conversion into forest or other terrain for agricultural, economic or

  14. Drift-scale thermo-hydrologic analyses for the proposed repository at Yucca Mountain, NV

    Energy Technology Data Exchange (ETDEWEB)

    Reeves, M.; Lingineni, S. [M& O/Intera, Inc., Las Vegas, NV (United States)

    1995-03-01

    Focusing on the near field of a waste package, this paper presents results obtained from a thermo-hydrologic model. Vertically, the conceptual model extends from ground surface to a depth of 1000 m below the water table. Horizontally, it is bounded by the centerlines of two pillars. Inside an assumed circular drift, an invert (backfill) surrounds the waste package. Here, a coarse-grained crushed tuff is assumed to provide a capillary barrier against infiltrating ground water. For comparison, the invert is replaced by intact tuff, corresponding to borehole emplacement. In further examining the near-field thermo-hydrology of a waste package, the study considers several values of the areal power density together with both nonenhanced and enhanced levels of vapor diffusivity. In order to characterize drift resaturation effects deriving from the latter, the calculations extend to 100,000 years. The clarity of the coding present in LBL`s integrated finite-difference model TOUGH2 has permitted us to make several code changes. For the most part, they expedite convergence on difficult applications. The paper briefly discusses these changes.

  15. Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

    International Nuclear Information System (INIS)

    Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

    1985-06-01

    A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

  16. Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

    2016-09-15

    Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

  17. The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

    Directory of Open Access Journals (Sweden)

    K.A. Widi

    2016-09-01

    Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

  18. Cooling tower drift: experiment design for comprehensive case study

    International Nuclear Information System (INIS)

    Laulainen, N.S.

    1978-01-01

    A drift experiment program to develop a data base which can be used for validation of drift deposition models has been formulated. The first field effort is designed for a suitable mechanical-draft cooling tower to be selected after site visits have been conducted. The discussion here demonstrates the importance of characterizing the droplet size spectrum emitted from the tower and to accurately account for droplet evaporation, because the downwind droplet deposition patterns and near-surface airborne concentrations are extremely sensitive to these parameters

  19. Drift chambers on the basis of mylar tubing blocks

    International Nuclear Information System (INIS)

    Budagov, Yu.A.; Golovanov, L.B.; Kuritsin, A.A.; Pukhov, O.E.; Khazins, D.M.; Chirikov-Zorin, I.E.; Joint Inst. for Nuclear Research, Dubna; Zhukov, V.Yu.

    1992-01-01

    We tested the models of the drift chambers, which are constructed of mylar tubing blocks. The purpose of the tubing block forming technology is to create long chambers (up to 3-4 meters). There are count and drift characteristics of the chambers for different gas pressures and different diameters of sense wires. The service time of the chambers is defined. We registered a photoeffect in the visible spectrum area, which is displayed on the surface of the mylar film cathode, covered by aluminium. 8 refs.; 5 figs

  20. Y chromosome diversity, human expansion, drift, and cultural evolution.

    Science.gov (United States)

    Chiaroni, Jacques; Underhill, Peter A; Cavalli-Sforza, Luca L

    2009-12-01

    The relative importance of the roles of adaptation and chance in determining genetic diversity and evolution has received attention in the last 50 years, but our understanding is still incomplete. All statements about the relative effects of evolutionary factors, especially drift, need confirmation by strong demographic observations, some of which are easier to obtain in a species like ours. Earlier quantitative studies on a variety of data have shown that the amount of genetic differentiation in living human populations indicates that the role of positive (or directional) selection is modest. We observe geographic peculiarities with some Y chromosome mutants, most probably due to a drift-related phenomenon called the surfing effect. We also compare the overall genetic diversity in Y chromosome DNA data with that of other chromosomes and their expectations under drift and natural selection, as well as the rate of fall of diversity within populations known as the serial founder effect during the recent "Out of Africa" expansion of modern humans to the whole world. All these observations are difficult to explain without accepting a major relative role for drift in the course of human expansions. The increasing role of human creativity and the fast diffusion of inventions seem to have favored cultural solutions for many of the problems encountered in the expansion. We suggest that cultural evolution has been subrogating biologic evolution in providing natural selection advantages and reducing our dependence on genetic mutations, especially in the last phase of transition from food collection to food production.