A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Science.gov (United States)

Naderi, Ebadollah; Ghaisas, S. V.

2016-08-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

International Nuclear Information System (INIS)

Naderi, Ebadollah; Ghaisas, S. V.

2016-01-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A diffuse radar scattering model from Martian surface rocks

Science.gov (United States)

Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

1987-01-01

Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

Friction and diffusion dynamics of adsorbates at surfaces

NARCIS (Netherlands)

Fusco, C.

2005-01-01

A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

International Nuclear Information System (INIS)

Ma, Z.; Whitley, R.D.; Wang, N.H.L.

1996-01-01

A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

Nonthermal Effects of Photon Illumination on Surface Diffusion

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

1998-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

Linear response theory of activated surface diffusion with interacting adsorbates

Energy Technology Data Exchange (ETDEWEB)

Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

2010-05-12

Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

Laser-induced desorption determinations of surface diffusion on Rh(111)

International Nuclear Information System (INIS)

Seebauer, E.G.; Schmidt, L.D.

1987-01-01

Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

Radiation induced diffusion as a method to protect surface

International Nuclear Information System (INIS)

Baumvol, I.J.R.

1980-01-01

Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

Diffusion accessibility as a method for visualizing macromolecular surface geometry.

Science.gov (United States)

Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

2015-10-01

Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

Diffusion of particles adsorbed on reconstructive surface

Czech Academy of Sciences Publication Activity Database

Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

2005-01-01

Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

DEFF Research Database (Denmark)

Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

2012-01-01

This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

International Nuclear Information System (INIS)

Ionescu, M.

1977-01-01

An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

Palladium diffusion into bulk copper via the (100) surface

Energy Technology Data Exchange (ETDEWEB)

Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

2009-08-05

Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

Semiconductor surface diffusion: Nonthermal effects of photon illumination

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

2000-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

Science.gov (United States)

Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

2017-06-01

Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

Stochastic models for surface diffusion of molecules

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2014-07-28

We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

International Nuclear Information System (INIS)

Hou, W C; Hong, Franklin Chau-Nan

2009-01-01

This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

OpenAIRE

M. R. Monazzam

2006-01-01

Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

Atomic diffusion in laser surface modified AISI H13 steel

Science.gov (United States)

Aqida, S. N.; Brabazon, D.; Naher, S.

2013-07-01

This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

International Nuclear Information System (INIS)

Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

2007-01-01

Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

Bulk-mediated surface diffusion: non-Markovian desorption dynamics

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

2005-01-01

Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

Cholesterol enhances surface water diffusion of phospholipid bilayers

Energy Technology Data Exchange (ETDEWEB)

Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

2014-12-14

Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1988-09-01

The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

Science.gov (United States)

Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

2017-07-01

Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

Science.gov (United States)

Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

Science.gov (United States)

Hatakeyama, S.; Horiuchi, W.; Kohama, A.

2018-05-01

The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

Surface modifications by field induced diffusion.

Directory of Open Access Journals (Sweden)

Martin Olsen

Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

International Nuclear Information System (INIS)

Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

2016-01-01

The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

Investigation of ion diffusion towards plasmonic surfaces

International Nuclear Information System (INIS)

Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

2013-01-01

Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

International Nuclear Information System (INIS)

Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

2016-01-01

Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

A new approach to the problem of bulk-mediated surface diffusion.

Science.gov (United States)

Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

2015-08-28

This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

On the diffusion and self-trapping of surface dimers

Science.gov (United States)

Kappus, W.

1982-03-01

The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

International Nuclear Information System (INIS)

Ferrieri, R.A.; Wolf, A.P.

1984-01-01

A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

Science.gov (United States)

Lee, Myoung-Jae; Jung, Young-Dae

2017-02-01

The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

Science.gov (United States)

Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

2015-05-21

Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

Jump rates for surface diffusion of large molecules from first principles

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2015-04-21

We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

Transient enhanced diffusion in preamorphized silicon: the role of the surface

Science.gov (United States)

Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

1999-01-01

Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

Science.gov (United States)

Chu, Khim Hoong

2017-11-09

Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

DEFF Research Database (Denmark)

Johannesson, Björn

2008-01-01

Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

Diffusion of particles on a fluctuating surface

Czech Academy of Sciences Publication Activity Database

Tarasenko, Alexander; Jastrabík, Lubomír

2011-01-01

Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

Directory of Open Access Journals (Sweden)

N. Tsukahara

2012-01-01

Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

Dynamics of an optically confined nanoparticle diffusing normal to a surface.

Science.gov (United States)

Schein, Perry; O'Dell, Dakota; Erickson, David

2016-06-01

Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

Plateau diffusion coefficient for arbitrary flux surface geometry

International Nuclear Information System (INIS)

Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

1981-03-01

A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

International Nuclear Information System (INIS)

Durakanoglu, S.

2004-01-01

Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

Coupling between diffusion and orientation of pentacene molecules on an organic surface.

Science.gov (United States)

Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

2016-04-01

The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

Diffusion of N adatoms on the Fe(100) surface

DEFF Research Database (Denmark)

Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

2000-01-01

The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

KAUST Repository

Chroneos, Alexander I.

2012-01-26

In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

Science.gov (United States)

Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

2014-05-01

Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

Classically exact surface diffusion constants at arbitrary temperature

International Nuclear Information System (INIS)

Voter, A.F.; Cohen, J.M.

1989-01-01

An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

Energy Technology Data Exchange (ETDEWEB)

Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

2016-05-15

Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

International Nuclear Information System (INIS)

Luniakov, Yu V

2013-01-01

A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

Science.gov (United States)

M. C. Sagis, Leonard

2001-03-01

In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

Directory of Open Access Journals (Sweden)

Ivan E Collier

Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

OpenAIRE

Li, Xiaofan; Nie, Qing

2009-01-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

DEFF Research Database (Denmark)

Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

2017-01-01

Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

Energy Technology Data Exchange (ETDEWEB)

Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

1976-08-01

The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

Directory of Open Access Journals (Sweden)

Szajnar J.

2014-10-01

Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

Science.gov (United States)

Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

2015-01-01

We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

Surface mobilities on solid materials

International Nuclear Information System (INIS)

Binh, V.T.

1983-01-01

This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

Science.gov (United States)

Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

2011-01-01

Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

Energy Technology Data Exchange (ETDEWEB)

Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

2012-06-08

Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

International Nuclear Information System (INIS)

Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

2014-01-01

Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

Cleaning of diffusion bonding surface by argon ion bombardment treatment

International Nuclear Information System (INIS)

Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

2003-01-01

The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

Dimer-flipping-assisted diffusion on a Si(001) surface

International Nuclear Information System (INIS)

Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

2000-01-01

The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

Oxidative Corrosion of the UO ₂ (001) Surface by Nonclassical Diffusion

Energy Technology Data Exchange (ETDEWEB)

Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

2017-11-07

Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

Collisional diffusion in a torus with imperfect magnetic surfaces

International Nuclear Information System (INIS)

White, R.B.

1983-03-01

A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

Non-rigid registration of breast surfaces using the laplace and diffusion equations

Directory of Open Access Journals (Sweden)

Ou Jao J

2010-02-01

Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

Energy Technology Data Exchange (ETDEWEB)

Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

1988-03-31

In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Tang Jianfeng

2011-01-01

The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

DEFF Research Database (Denmark)

Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

2015-01-01

We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

Science.gov (United States)

Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

2018-02-01

The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

Convergence of surface diffusion parameters with model crystal size

Science.gov (United States)

Cohen, Jennifer M.; Voter, Arthur F.

1994-07-01

A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

Diffusion of zinc into an unpassivated surface of indium phosphide

International Nuclear Information System (INIS)

Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

1989-01-01

Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

Science.gov (United States)

Ku, Bon Ki; Kulkarni, Pramod

2012-05-01

We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

Energy Technology Data Exchange (ETDEWEB)

Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

2007-02-21

During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

Directory of Open Access Journals (Sweden)

Muhammad Qasim

2013-01-01

Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

Energy Technology Data Exchange (ETDEWEB)

Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

2017-02-01

Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

Science.gov (United States)

Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

2018-02-01

Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

DEFF Research Database (Denmark)

Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

2009-01-01

form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

2005-01-01

We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

International Nuclear Information System (INIS)

Kim, Sung Hoon

2001-01-01

Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

DEFF Research Database (Denmark)

Mejlbro, Leif

1996-01-01

Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

NARCIS (Netherlands)

Schoots, Koen

2007-01-01

This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

International Nuclear Information System (INIS)

Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

2014-01-01

The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

International Nuclear Information System (INIS)

Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

2012-01-01

The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

Science.gov (United States)

Zhan, Hanyu; Voelz, David G.

2016-12-01

The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

Energy Technology Data Exchange (ETDEWEB)

Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

2014-12-15

Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

DEFF Research Database (Denmark)

Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

1996-01-01

and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

International Nuclear Information System (INIS)

Goddard, P.J.

1989-01-01

The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

Novel exchange mechanisms in the surface diffusion of oxides

International Nuclear Information System (INIS)

Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

2004-01-01

We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO ₂ (110)

Energy Technology Data Exchange (ETDEWEB)

Goldman, Nir; Browning, Nigel D.

2011-06-16

Gold clusters on rutile TiO₂ are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO₂(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

Science.gov (United States)

Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

2018-01-01

Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

DEFF Research Database (Denmark)

Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

2002-01-01

We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

Science.gov (United States)

Kapranov, Sergey V.; Kouzaev, Guennadi A.

2018-01-01

Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

Nitrogen diffusion in near-surface range of ion doped molybdenum

CERN Document Server

Zamalin, E Y

2001-01-01

The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

Directory of Open Access Journals (Sweden)

María I. Vázquez

2015-12-01

Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

International Nuclear Information System (INIS)

Livadiotis, George

2007-01-01

The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2015-01-15

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Science.gov (United States)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

International Nuclear Information System (INIS)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

Science.gov (United States)

Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

2017-01-01

Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

The effect of step thickness on the surface diffusion of a Pt adatom

International Nuclear Information System (INIS)

Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

2009-01-01

The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

Czech Academy of Sciences Publication Activity Database

Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

2008-01-01

Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

International Nuclear Information System (INIS)

Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

International Nuclear Information System (INIS)

Vree, C; Mayr, S G

2010-01-01

The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

Evaporation rates and surface profiles on heterogeneous surfaces with mass transfer and surface reaction

Energy Technology Data Exchange (ETDEWEB)

Flytzani-Stephanopoulos, M; Schmidt, L D

1979-01-01

Simple models incorporating surface reaction and diffusion of volatile products through a boundary layer are developed to calculate effective rates of evaporation and local surface profiles on surfaces having active and inactive regions. The coupling between surface heterogeneities with respect to a particular reaction and external mass transfer may provide a mechanism for the surface rearrangement and metal loss encountered in several catalytic systems of practical interest. Calculated transport rates for the volatilization of platinum in oxidizing environments and the rearrangement of this metal during the ammonia oxidation reaction agree well with published experimental data.

First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

2014-01-01

Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

Science.gov (United States)

Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

2018-05-01

Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

Energy Technology Data Exchange (ETDEWEB)

Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

1996-01-12

The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

Energy Technology Data Exchange (ETDEWEB)

Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

2014-02-28

A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

Science.gov (United States)

O'Neill, Kelly C; Lee, Young Jin

2018-05-01

The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

DEFF Research Database (Denmark)

Hjelt, T.; Vattulainen, Ilpo Tapio

2000-01-01

stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

Science.gov (United States)

1992-11-01

is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

Transport and diffusion on crystalline surfaces under external forces

International Nuclear Information System (INIS)

Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

2005-01-01

We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

Science.gov (United States)

Tränkle, B; Ruh, D; Rohrbach, A

2016-03-14

Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

Directory of Open Access Journals (Sweden)

Yan-Zi Yu

2015-01-01

Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

International Nuclear Information System (INIS)

Lou, D.C.; Solberg, J.K.; Borvik, T.

2009-01-01

This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

Science.gov (United States)

Boisvert, Ghyslain

Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

Radiative heat exchange between surfaces

International Nuclear Information System (INIS)

Yener, Y.; Yuncu, H.

1987-01-01

The geometrical features of radiative heat exchange between surfaces are discussed first by developing various radiation shape factor relations. The governing equations for enclosures with diffusely emitting and diffusely reflecting surfaces, as well as the equations for enclosures with gray surfaces having specular component of reflectivity are introduced next. Finally, a simplified model for enclosures with isothermal surfaces under the assumption of uniform radiosity over the surfaces is discussed, and various working relations for different conditions are presented

Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

Energy Technology Data Exchange (ETDEWEB)

Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

1996-11-01

The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

Science.gov (United States)

Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

2016-04-01

Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

International Nuclear Information System (INIS)

Strubelj, Luka; Tiselj, Izrok

2008-01-01

Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

International Nuclear Information System (INIS)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-01-01

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

Energy Technology Data Exchange (ETDEWEB)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-12-14

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

Modeling diffuse sources of surface water contamination with plant protection products

Science.gov (United States)

Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

2015-04-01

Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

Science.gov (United States)

Skoch, Gary J.

2002-01-01

Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

Science.gov (United States)

Li, Xiaofan; Nie, Qing

2009-07-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

DEFF Research Database (Denmark)

Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

2017-01-01

) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Wu, M H; Liu, X H; Gu, J F; Jin, Z H

2013-01-01

Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Chen Shuguang

2010-01-01

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

International Nuclear Information System (INIS)

Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

2014-01-01

We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

International Nuclear Information System (INIS)

El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

2010-01-01

The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

Energy Technology Data Exchange (ETDEWEB)

Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

2013-12-14

The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

Science.gov (United States)

Cox, Trevor John

Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

Science.gov (United States)

Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

2017-01-01

The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

A volume-based method for denoising on curved surfaces

KAUST Repository

Biddle, Harry

2013-09-01

We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

A volume-based method for denoising on curved surfaces

KAUST Repository

Biddle, Harry; von Glehn, Ingrid; Macdonald, Colin B.; Marz, Thomas

2013-01-01

We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

International Nuclear Information System (INIS)

Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

1979-01-01

Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

A model for diffuse and global irradiation on horizontal surface

International Nuclear Information System (INIS)

Jain, P.C.

1984-01-01

The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

Science.gov (United States)

Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

2014-08-21

The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

Surface migration in sorption processes

International Nuclear Information System (INIS)

Rasmuson, A.; Neretnieks, J.

1983-03-01

Diffusion rates of sorbing chemical species in granites and clays are in several experiments within the KBS study, higher than can be explained by pore diffusion only. One possible additional transport mechanism is transport of of sorbed molecules/ions along the intrapore surfaces. As a first step a literature investigation on on solid surfaces has been conducted. A lot of experimental evidence of the mobility of the sorbed molecules has been gathered through the years, particulary for metal surfaces and chemical engineering systems. For clays however, there are only a few articles, and for granites none. Two types of surface migration models have been proposed in the litterature: i) Surface flow as a result of a gradient in spreading pressure. ii) Surface diffusion as a result of a gradient in concentration. The surface flow model has only been applied to gaseous systems. However, it should be equally applicable to liquid systems. The models i) and ii) are conceptually very different. However, the resulting expressions for surface flux are complicated and it will not be an easy task to distinguish between them. There seem to be three ways of discriminating between the transport mechanisms: a) Temperature dependence. b) Concentration dependence. c) Order of magnitude. (Forf)

First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

International Nuclear Information System (INIS)

Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

2014-01-01

First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

Energy Technology Data Exchange (ETDEWEB)

Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

2014-07-28

Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

Directory of Open Access Journals (Sweden)

Sorenson Donna J

2009-12-01

Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

Energy Technology Data Exchange (ETDEWEB)

Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

2010-05-03

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

International Nuclear Information System (INIS)

Melkior, T.; Motellier, S.; Yahiaoui, S.

2005-01-01

Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

Energy Technology Data Exchange (ETDEWEB)

Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

2016-09-15

Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

Growth morphologies of crystal surfaces

Science.gov (United States)

Xiao, Rong-Fu; Alexander, J. Iwan D.; Rosenberger, Franz

1991-03-01

We have expanded our earlier Monte Carlo model [Phys. Rev. A 38, 2447 (1988); J. Crystal Growth 100, 313 (1990)] to three dimensions and included reevaporation after accommodation and growth on dislocation-induced steps. We found again that, for a given set of growth parameters, the critical size, beyond which a crystal cannot retain its macroscopically faceted shape, scales linearly with the mean free path in the vapor. However, the three-dimensional (3D) the systems show increased shape stability compared to corresponding 2D cases. Extrapolation of the model results to mean-free-path conditions used in morphological stability experiments leads to order-of-magnitude agreement of the predicted critical size with experimental findings. The stability region for macroscopically smooth (faceted) surfaces in the parameter space of temperature and supersaturation depends on both the surface and bulk diffusion. While surface diffusion is seen to smooth the growth morphology on the scale of the surface diffusion length, bulk diffusion is always destabilizing. The atomic surface roughness increases with increase in growth temperature and supersaturation. That is, the tendency of surface kinetics anisotropies to stabilize the growth shape is reduced through thermal and kinetic roughening. It is also found that the solid-on-solid assumption, which can be advantageously used at low temperatures and supersaturations, is insufficient to describe the growth dynamics of atomically rough interfaces where bulk diffusion governs the process. For surfaces with an emerging screw dislocation, we find that the spiral growth mechanism dominates at low temperatures and supersaturations. The polygonization of a growth spiral decreases with increasing temperature or supersaturation. When the mean free path in the nutrient is comparable to the lattice constant, the combined effect of bulk and surface diffusion reduces the terrace width of a growth spiral in its center region. At elevated

Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

International Nuclear Information System (INIS)

Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

2015-01-01

Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

NARCIS (Netherlands)

Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

Directory of Open Access Journals (Sweden)

N. Javid Rouzi

2009-04-01

Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

Surface energy anisotropy of tungsten

Energy Technology Data Exchange (ETDEWEB)

Kumar, R; Grenga, H E [Georgia Inst. of Tech., Atlanta (USA). School of Chemical Engineering

1976-10-01

Field-ion microscopy was used to study the faceting behavior and/or surface energy anisotropy of tungsten in vacuum and in hydrogen. In vacuum below 1700 K the activation energy for (110) facet growth agreed with values previously reported for surface diffusion on tungsten. The observed anisotropy values at 0.5 Tsub(m), where Tsub(m) is the absolute melting temperature of tungsten (approximately 3680 K), were different from those previously reported at higher temperatures and more nearly agreed with broken bond calculations based on Mie potential using m=5, n=8, and a 1.5% lattice expansion. Hydrogen appeared to have a negligible effect on surface energy anisotropy, but did preferentially increase surface diffusion rates on (310) regions.

Surface and sub-surface thermal oxidation of thin ruthenium films

Energy Technology Data Exchange (ETDEWEB)

Coloma Ribera, R.; Kruijs, R. W. E. van de; Yakshin, A. E.; Bijkerk, F. [MESA+ Institute for Nanotechnology, University of Twente, P.O. Box 217, 7500 AE Enschede (Netherlands); Kokke, S.; Zoethout, E. [FOM Dutch Institute for Fundamental Energy Research (DIFFER), P.O. Box 1207, 3430 BE Nieuwegein (Netherlands)

2014-09-29

A mixed 2D (film) and 3D (nano-column) growth of ruthenium oxide has been experimentally observed for thermally oxidized polycrystalline ruthenium thin films. Furthermore, in situ x-ray reflectivity upon annealing allowed the detection of 2D film growth as two separate layers consisting of low density and high density oxides. Nano-columns grow at the surface of the low density oxide layer, with the growth rate being limited by diffusion of ruthenium through the formed oxide film. Simultaneously, with the growth of the columns, sub-surface high density oxide continues to grow limited by diffusion of oxygen or ruthenium through the oxide film.

Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

Energy Technology Data Exchange (ETDEWEB)

Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

2013-09-30

Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo₂C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo₂C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft² at a feed pressure of only 20 psig. The highest H₂/N₂ selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo₂C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo₂C catalyst layers. We have fabricated a Mo₂C/V composite membrane that in pure gas testing delivered a H₂ flux of 238 SCFH/ft² at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft².psi. However, during testing of a Mo₂C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft².psi was obtained which was stable during the entire test, meeting the permeance associated with

Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

International Nuclear Information System (INIS)

Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

2009-01-01

Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

International Nuclear Information System (INIS)

Posadillo, R.; Lopez Luque, R.

2009-01-01

The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1989-01-01

Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

Surface electrical resistivity of insulators

International Nuclear Information System (INIS)

Senn, B. C.; Liesegang, J.

1996-01-01

A method is presented here for measuring surface charge decay, and theory has been developed so as to produce determinations of resistivity in the surface region of insulator films or wafers. This method incorporates the use of a coaxial cylindrical capacitor arrangement and an electrometer interfaced to a PC. The charge transport theory given here is based on Mott-Gurney diffusion, and allows easy interpretation of the experimental data, especially for the initial phase of surface charge decay. Resistivity measurements are presented for glass, mica, perspex and polyethylene, covering a range of 10 9 to 10 18 Ωm, as an illustration of the useful range of the instrument for static and antistatic materials, particularly in film or sheet form. Values for the surface charge diffusion constants of the materials are also presented. The charge transport theory has also been extended to allow the experimental and computational theoretical comparison of surface charge decay not only over the initial phase of charge decay, but also over longer times. The theoretical predictions show excellent agreement with experiment using the values for the diffusion constants referred to above

Surface channeling

International Nuclear Information System (INIS)

Sizmann, R.; Varelas, C.

1976-01-01

There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)

Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

Directory of Open Access Journals (Sweden)

Saiful Islam

2008-01-01

Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

Science.gov (United States)

Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

2017-05-17

A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

DEFF Research Database (Denmark)

Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

1999-01-01

in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

Near-surface and bulk behavior of Ag in SiC

International Nuclear Information System (INIS)

Xiao, H.Y.; Zhang, Y.; Snead, L.L.; Shutthanandan, V.; Xue, H.Z.; Weber, W.J.

2012-01-01

Highlights: ► Ag release from SiC poses problems in safe operation of nuclear reactors. ► Near-surface and bulk behavior of Ag are studied by ab initio and ion beam methods. ► Ag prefers to adsorb on the surface rather than in the bulk SiC. ► At high temperature Ag desorbs from the surface instead of diffusion into bulk SiC. ► Surface diffusion may be a dominating mechanism accounting for Ag release from SiC. - Abstract: The diffusive release of fission products, such as Ag, from TRISO particles at high temperatures has raised concerns regarding safe and economic operation of advanced nuclear reactors. Understanding the mechanisms of Ag diffusion is thus of crucial importance for effective retention of fission products. Two mechanisms, i.e., grain boundary diffusion and vapor or surface diffusion through macroscopic structures such as nano-pores or nano-cracks, remain in debate. In the present work, an integrated computational and experimental study of the near-surface and bulk behavior of Ag in silicon carbide (SiC) has been carried out. The ab initio calculations show that Ag prefers to adsorb on the SiC surface rather than in the bulk, and the mobility of Ag on the surface is high. The energy barrier for Ag desorption from the surface is calculated to be 0.85–1.68 eV, and Ag migration into bulk SiC through equilibrium diffusion process is not favorable. Experimentally, Ag ions are implanted into SiC to produce Ag profiles buried in the bulk and peaked at the surface. High-temperature annealing leads to Ag release from the surface region instead of diffusion into the interior of SiC. It is suggested that surface diffusion through mechanical structural imperfection, such as vapor transport through cracks in SiC coatings, may be a dominating mechanism accounting for Ag release from the SiC in the nuclear reactor.

Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

International Nuclear Information System (INIS)

Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

2016-01-01

A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

Radioactive Ions for Surface Characterization

CERN Multimedia

2002-01-01

The collaboration has completed a set of pilot experiments with the aim to develop techniques for using radioactive nuclei in surface physics. The first result was a method for thermal deposition of isolated atoms (Cd, In, Rb) on clean metallic surfaces. \\\\ \\\\ Then the diffusion history of deposited Cd and In atoms on two model surfaces, Mo(110) and Pd(111), was followed through the electric field gradients (efg) acting at the probe nuclei as measured with the Perturbed Angular Correlation technique. For Mo(110) a rather simple history of the adatoms was inferred from the experiments: Atoms initially landing at terrace sites diffuse from there to ledges and then to kinks, defects always present at real surfaces. The next stage is desorption from the surface. For Pd a scenario that goes still further was found. Following the kink stage the adatoms get incorporated into ledges and finally into the top surface layer. For all these five sites the efg's could be measured.\\\\ \\\\ In preparation for a further series o...

Solid surface vs. liquid surface: nanoarchitectonics, molecular machines, and DNA origami.

Science.gov (United States)

Ariga, Katsuhiko; Mori, Taizo; Nakanishi, Waka; Hill, Jonathan P

2017-09-13

The investigation of molecules and materials at interfaces is critical for the accumulation of new scientific insights and technological advances in the chemical and physical sciences. Immobilization on solid surfaces permits the investigation of different properties of functional molecules or materials with high sensitivity and high spatial resolution. Liquid surfaces also present important media for physicochemical innovation and insight based on their great flexibility and dynamicity, rapid diffusion of molecular components for mixing and rearrangements, as well as drastic spatial variation in the prevailing dielectric environment. Therefore, a comparative discussion of the relative merits of the properties of materials when positioned at solid or liquid surfaces would be informative regarding present-to-future developments of surface-based technologies. In this perspective article, recent research examples of nanoarchitectonics, molecular machines, DNA nanotechnology, and DNA origami are compared with respect to the type of surface used, i.e. solid surfaces vs. liquid surfaces, for future perspectives of interfacial physics and chemistry.

Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

International Nuclear Information System (INIS)

Seddeek, M.A.; Abdelmeguid, M.S.

2006-01-01

The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

OpenAIRE

Bläckberg, Lisa

2014-01-01

This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

Science.gov (United States)

Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

2016-03-01

Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

Directory of Open Access Journals (Sweden)

K.A. Widi

2016-09-01

Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

Classification Order of Surface-Confined Intermixing at Epitaxial Interface

Science.gov (United States)

Michailov, M.

The self-organization phenomena at epitaxial interface hold special attention in contemporary material science. Being relevant to the fundamental physical problem of competing, long-range and short-range atomic interactions in systems with reduced dimensionality, these phenomena have found exacting academic interest. They are also of great technological importance for their ability to bring spontaneous formation of regular nanoscale surface patterns and superlattices with exotic properties. The basic phenomenon involved in this process is surface diffusion. That is the motivation behind the present study which deals with important details of diffusion scenarios that control the fine atomic structure of epitaxial interface. Consisting surface imperfections (terraces, steps, kinks, and vacancies), the interface offers variety of barriers for surface diffusion. Therefore, the adatoms and clusters need a certain critical energy to overcome the corresponding diffusion barriers. In the most general case the critical energies can be attained by variation of the system temperature. Hence, their values define temperature limits of system energy gaps associated with different diffusion scenarios. This systematization imply classification order of surface alloying: blocked, incomplete, and complete. On that background, two diffusion problems, related to the atomic-scale surface morphology, will be discussed. The first problem deals with diffusion of atomic clusters on atomically smooth interface. On flat domains, far from terraces and steps, we analyzed the impact of size, shape, and cluster/substrate lattice misfit on the diffusion behavior of atomic clusters (islands). We found that the lattice constant of small clusters depends on the number N of building atoms at 1 < N ≤ 10. In heteroepitaxy, this effect of variable lattice constant originates from the enhanced charge transfer and the strong influence of the surface potential on cluster atomic arrangement. At constant

A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

Science.gov (United States)

Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

2014-02-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

Advection and diffusion in random media implications for sea surface temperature anomalies

CERN Document Server

Piterbarg, Leonid I

1997-01-01

The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

Method of coating the interior surface of hollow objects with a diffusion coating

Science.gov (United States)

Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

2005-03-15

A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

2014-01-01

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

International Nuclear Information System (INIS)

Olin, M.; Valkiainen, M.; Aalto, H.

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

Energy Technology Data Exchange (ETDEWEB)

Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

Science.gov (United States)

Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

2018-04-01

The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

Czech Academy of Sciences Publication Activity Database

Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

2015-01-01

Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

Active colloidal propulsion over a crystalline surface

Science.gov (United States)

Choudhury, Udit; Straube, Arthur V.; Fischer, Peer; Gibbs, John G.; Höfling, Felix

2017-12-01

We study both experimentally and theoretically the dynamics of chemically self-propelled Janus colloids moving atop a two-dimensional crystalline surface. The surface is a hexagonally close-packed monolayer of colloidal particles of the same size as the mobile one. The dynamics of the self-propelled colloid reflects the competition between hindered diffusion due to the periodic surface and enhanced diffusion due to active motion. Which contribution dominates depends on the propulsion strength, which can be systematically tuned by changing the concentration of a chemical fuel. The mean-square displacements (MSDs) obtained from the experiment exhibit enhanced diffusion at long lag times. Our experimental data are consistent with a Langevin model for the effectively two-dimensional translational motion of an active Brownian particle in a periodic potential, combining the confining effects of gravity and the crystalline surface with the free rotational diffusion of the colloid. Approximate analytical predictions are made for the MSD describing the crossover from free Brownian motion at short times to active diffusion at long times. The results are in semi-quantitative agreement with numerical results of a refined Langevin model that treats translational and rotational degrees of freedom on the same footing.

Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

Energy Technology Data Exchange (ETDEWEB)

Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

2014-09-15

An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

Mirror reactor surface study

Energy Technology Data Exchange (ETDEWEB)

Hunt, A. L.; Damm, C. C.; Futch, A. H.; Hiskes, J. R.; Meisenheimer, R. G.; Moir, R. W.; Simonen, T. C.; Stallard, B. W.; Taylor, C. E.

1976-09-01

A general survey is presented of surface-related phenomena associated with the following mirror reactor elements: plasma first wall, ion sources, neutral beams, director converters, vacuum systems, and plasma diagnostics. A discussion of surface phenomena in possible abnormal reactor operation is included. Several studies which appear to merit immediate attention and which are essential to the development of mirror reactors are abstracted from the list of recommended areas for surface work. The appendix contains a discussion of the fundamentals of particle/surface interactions. The interactions surveyed are backscattering, thermal desorption, sputtering, diffusion, particle ranges in solids, and surface spectroscopic methods. A bibliography lists references in a number of categories pertinent to mirror reactors. Several complete published and unpublished reports on surface aspects of current mirror plasma experiments and reactor developments are also included.

Mirror reactor surface study

International Nuclear Information System (INIS)

Hunt, A.L.; Damm, C.C.; Futch, A.H.; Hiskes, J.R.; Meisenheimer, R.G.; Moir, R.W.; Simonen, T.C.; Stallard, B.W.; Taylor, C.E.

1976-01-01

A general survey is presented of surface-related phenomena associated with the following mirror reactor elements: plasma first wall, ion sources, neutral beams, director converters, vacuum systems, and plasma diagnostics. A discussion of surface phenomena in possible abnormal reactor operation is included. Several studies which appear to merit immediate attention and which are essential to the development of mirror reactors are abstracted from the list of recommended areas for surface work. The appendix contains a discussion of the fundamentals of particle/surface interactions. The interactions surveyed are backscattering, thermal desorption, sputtering, diffusion, particle ranges in solids, and surface spectroscopic methods. A bibliography lists references in a number of categories pertinent to mirror reactors. Several complete published and unpublished reports on surface aspects of current mirror plasma experiments and reactor developments are also included

Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

Science.gov (United States)

Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

2017-09-01

Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

International Nuclear Information System (INIS)

Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

2012-01-01

The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

Science.gov (United States)

Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

2014-01-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

Dynamics of Phenanthrenequinone on Carbon Nano-Onion Surfaces Probed by Quasielastic Neutron Scattering

International Nuclear Information System (INIS)

Mamontov, Eugene; Brown, Gilbert M.; Overbury, Steven H.; Mavila Chathoth, Suresh

2012-01-01

We used quasielastic neutron scattering (QENS) to study the dynamics of phenanthrenequinone (PQ) on the surface of onion-like carbon (OLC), or so called carbon onions, as a function of surface coverage and temperature. For both the high- and low-coverage samples, we observed two diffusion processes; a faster process and nearly an order of magnitude slower process. On the high-coverage surface, the slow diffusion process is of long-range translational character, whereas the fast diffusion process is spatially localized on the length scale of ∼ 4.7. On the low-coverage surface, both diffusion processes are spatially localized; on the same length scale of ∼ 4.7 for the fast diffusion and a somewhat larger length scale for the slow diffusion. Arrhenius temperature dependence is observed except for the long-range diffusion on the high-coverage surface. We attribute the fast diffusion process to the generic localized in-cage dynamics of PQ molecules, and the slow diffusion process to the long-range translational dynamics of PQ molecules, which, depending on the coverage, may be either spatially restricted, or long-range. On the low-coverage surface, uniform surface coverage is not attained, and the PQ molecules experience the effect of spatial constraints on their long-range translational dynamics. Unexpectedly, the dynamics of PQ molecules on OLC as a function of temperature and surface coverage bears qualitative resemblance to the dynamics of water molecules on oxide surfaces, including practically temperature-independent residence times for the low-coverage surface. The dynamics features that we observed may be universal across different classes of surface adsorbates.

Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

Science.gov (United States)

1979-01-01

A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

International Nuclear Information System (INIS)

Sun Jianzhong; Wang Zhikang; Gong Xiangyang

2006-01-01

Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

International Nuclear Information System (INIS)

Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

2016-01-01

We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

Au nanowire junction breakup through surface atom diffusion

Science.gov (United States)

Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

2018-01-01

Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

Science.gov (United States)

Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

2018-01-01

Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

KMC Simulation of Surface Growth of Semiconductors

International Nuclear Information System (INIS)

Esen, M.

2004-01-01

In this work we have studied the growth and equilibration of semiconductor surfaces consisting of monoatomic steps separated by flat terraces using kinetic Monte Carlo method. Atomistic processes such as diffusion on terraces, attachment/detachment particles to/from step edges, attachment of particles from an upper terrace to a bounding step, diffusion of particles along step edges are considered. A rate equation for each, these processes is written and the overall transition probabilities are calculated where processes are ordered to make the distinction between slow and fast processes Iractal The interaction of steps is also included in the calculation of rate equations. The growth of such a surface is simulated when there is a particle flux to the surface. The rough of the surface and its dependence on both temperature and kinetic parameters such edge diffusion barrier are investigated. The formation of islands on terraces is prohibited and the distribution of their number and sizes are investigated as a function of temperature and appropriate kinetic parameters. In the absence of a flux to the surface, the equilibration of the surface is investigated paying particular attention to the top of the profile when the initial surface is a periodic profile where parallel monoatomic steps separated by terraces. It is observed that during equilibration of the profile, the topmost step disintegrates quickly and leads to many islands on the top of the profile due to. collision and annihilation of step edges of opposite sign. The islands then quickly disintegrate due to the line tension effect and this scenario repeats itself until the surface completely flattens

Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

Energy Technology Data Exchange (ETDEWEB)

Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

1990-04-01

A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

Science.gov (United States)

Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

2015-01-01

The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

Radionuclide transfer onto ground surface in surface water flow, 1

International Nuclear Information System (INIS)

Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

1991-07-01

Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

Surface Modifications in Adhesion and Wetting

Science.gov (United States)

Longley, Jonathan

within the framework of the unresolved problem of how to best characterize rough surfaces. Initially, the fractal dimension is used to characterize grit-blasted and sanded surfaces. It is found that, contrary to what has been suggested in the literature, the fractal dimension is independent of the roughening mechanism. Instead, the use of an anomalous diffusion coefficient is proposed as a more effective way to characterize a rough surface. Surface modification by preparation of surface energy gradients is then investigated. Materials with gradients in surface energy are useful in the areas of microfluidics, heat transfer and protein adsorption, to name a few. Gradients are prepared by vapor deposition of a reactive silane from a filter paper source. The technique gives control over the size and shape of the gradient. This surface modification is then used to induce droplet motion through repeated stretching and compression of a water drop between two gradient surfaces. This inchworm type motion is studied in detail and offers an alternative method to surface vibration for moving drops in microfluidic devices. The final surface modification considered is the application of a thin layer of rubber to a rigid surface. While this technique has many practical uses, such as easy release coatings in marine environments, it is applied herein to enable spontaneous healing between a rubber surface and a glass cover slip. Study of the diffusion controlled healing of a blister can be made by trapping an air filled blister between a glass cover slip and a rubber film. Through this study we find evidence for an interfacial diffusion process. This mechanism of diffusion is likely to be important in many biological systems.

Surface morphology of laser superheated Pb(100)

Energy Technology Data Exchange (ETDEWEB)

Zhang, Z.H.; Lin, B.; Elsayed-Ali, H.E.

1999-11-01

The change in the surface vacancy density after heating of Pb(100) with {approximately}100 ps laser pulses is investigated using reflection high-energy electron diffraction. The surface vacancy density remains unchanged when the surface is superheated without melting. However, when the laser fluence is high enough to cause surface melting, the surface vacancy density increases. This increase in vacancy density is attributed to fast diffusion of atoms in the liquid film formed on Pb(100) during laser melting.

Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

Directory of Open Access Journals (Sweden)

Kaewploy Somsak

2015-01-01

Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

Carbon surface diffusion and SiC nanocluster self-ordering

International Nuclear Information System (INIS)

Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

2006-01-01

The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

Energy Technology Data Exchange (ETDEWEB)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

Science.gov (United States)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

Science.gov (United States)

Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

2005-09-01

We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

Application of various surface passivation layers in solar cells

International Nuclear Information System (INIS)

Lee, Ji Youn; Lee, Soo Hong

2004-01-01

In this work, we have used different techniques for surface passivation: conventional thermal oxidation (CTO), rapid thermal oxidation (RTO), and plasma-enhanced chemical vapour deposition (PECVD). The surface passivation qualities of eight different single and combined double layers have been investigated both on phosphorus non-diffused p-type Float Zone (FZ) silicon wafers and on diffused emitters (100 Ω/□ and 40 Ω/□). CTO/SiN 1 passivates very well not only on a non-diffused surface (τ eff = 1361 μs) but also on an emitter (τ eff = 414 μs). However, we concluded that RTO/SiN 1 and RTO/SiN 2 stacks were more suitable than CTO/SiN stacks for surface passivation in solar cells since those stacks had relatively good passivation qualities and suitable optical reflections. RTO/SiN 1 for rear-surface passivation and RTO/SiN 2 for front-surface passivation were applied to the fabrication of solar cells. We achieved efficiencies of 18.5 % and 18.8 % on 0.5 Ω-cm (FZ) silicon with planar and textured front surfaces, respectively. An excellent open circuit voltage (V oc ) of 675.6 mV was obtained for the planar cell.

Self-diffusion on copper surfaces

DEFF Research Database (Denmark)

Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

1991-01-01

The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

International Nuclear Information System (INIS)

Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

2002-01-01

The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

Hydrogenation of nitriles on a well-characterized nickel surface: From surface science studies to liquid phase catalytic activity measurements

Energy Technology Data Exchange (ETDEWEB)

Gardin, Denis Emmanuel [Univ. of California, Berkeley, CA (United States)

1993-12-01

Nitrile hydrogenation is the most commonly used method for preparing diverse amines. This thesis is aimed at the mechanism and factors affecting the performance of Ni-based catalysts in nitrile hydrogenations. Surface science techniques are used to study bonding of nitriles and amines to a Ni(111) surface and to identify surface intermediates. Liquid-phase hydrogenations of cyclohexene and 1-hexene on a Pt foil were carried out successfully. Finally, knowledge about the surface structure, surface chemical bond, dynamics of surface atoms (diffusion, growth), and reactivity of metal surfaces from solid-gas interface studies, is discussed.

Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

Energy Technology Data Exchange (ETDEWEB)

Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

2017-11-01

In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

CURVATURE-DRIVEN MOLECULAR FLOW ON MEMBRANE SURFACE.

Science.gov (United States)

Mikucki, Michael; Zhou, Y C

2017-01-01

This work presents a mathematical model for the localization of multiple species of diffusion molecules on membrane surfaces. Morphological change of bilayer membrane in vivo is generally modulated by proteins. Most of these modulations are associated with the localization of related proteins in the crowded lipid environments. We start with the energetic description of the distributions of molecules on curved membrane surface, and define the spontaneous curvature of bilayer membrane as a function of the molecule concentrations on membrane surfaces. A drift-diffusion equation governs the gradient flow of the surface molecule concentrations. We recast the energetic formulation and the related governing equations by using an Eulerian phase field description to define membrane morphology. Computational simulations with the proposed mathematical model and related numerical techniques predict (i) the molecular localization on static membrane surfaces at locations with preferred mean curvatures, and (ii) the generation of preferred mean curvature which in turn drives the molecular localization.

Ion beam surface treatment: A new capability for rapid melt and resolidification of surfaces

International Nuclear Information System (INIS)

Stinnett, R.W.; McIntyre, D.C.; Buchheit, R.G.; Greenly, J.B.; Thompson, M.O.

1994-01-01

The emerging capability to produce high average power (5--250 kW) pulsed ion beams at 0.2--2 MeV energies is enabling us to develop a new, commercial-scale thermal surface treatment technology called Ion Beam Surface Treatment (IBEST). This technique uses high energy, pulsed (≤100 ns) ion beams to directly deposit energy in the top 2--20 micrometers of the surface of any material. Depth of treatment is controllable by varying the ion energy and species. Deposition of the energy with short pulses in a thin surface layer allows melting of the layer with relatively small energies and allows rapid cooling of the melted layer by thermal diffusion into the underlying substrate. Typical cooling rates of this process (10 9 10 10 K/sec) cause rapid resolidification, resulting in production of non-equilibrium microstructures (nano-crystalline and metastable phases) that have significantly improved corrosion, wear, and hardness properties. We have conducted IBEST feasibility experiments with results confirming surface hardening, nanocrystaline grain formation, metal surface polishing, controlled melt of ceramic surfaces, and surface cleaning

Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-08-15

Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

Concentration polarization, surface currents, and bulk advection in a microchannel

DEFF Research Database (Denmark)

Nielsen, Christoffer Peder; Bruus, Henrik

2014-01-01

. A remarkable outcome of the investigations is the discovery of strong couplings between bulk advection and the surface current; without a surface current, bulk advection is strongly suppressed. The numerical simulations are supplemented by analytical models valid in the long channel limit as well...... as in the limit of negligible surface charge. By including the effects of diffusion and advection in the diffuse part of the electric double layers, we extend a recently published analytical model of overlimiting current due to surface conduction....

Surface transport mechanisms in molecular glasses probed by the exposure of nano-particles

Science.gov (United States)

Ruan, Shigang; Musumeci, Daniele; Zhang, Wei; Gujral, Ankit; Ediger, M. D.; Yu, Lian

2017-05-01

For a glass-forming liquid, the mechanism by which its surface contour evolves can change from bulk viscous flow at high temperatures to surface diffusion at low temperatures. We show that this mechanistic change can be conveniently detected by the exposure of nano-particles native in the material. Despite its high chemical purity, the often-studied molecular glass indomethacin contains low-concentration particles approximately 100 nm in size and 0.3% in volume fraction. Similar particles are present in polystyrene, another often-used model. In the surface-diffusion regime, particles are gradually exposed in regions vacated by host molecules, for example, the peak of a surface grating and the depletion zone near a surface crystal. In the viscous-flow regime, particle exposure is not observed. The surface contour around an exposed particle widens over time in a self-similar manner as 3 (Bt)1/4, where B is a surface mobility constant and the same constant obtained by surface grating decay. This work suggests that in a binary system composed of slow- and fast-diffusing molecules, slow-diffusing molecules can be stranded in surface regions vacated by fast-diffusing molecules, effectively leading to phase separation.

Investigation of aluminum surface cleaning using cavitating fluid flow

Energy Technology Data Exchange (ETDEWEB)

Ralys, Aurimas; Striška, Vytautas; Mokšin, Vadim [Vilnius Gediminas Technical University, Faculty of Mechanics, Department of Machine Engineering, J. Basanavičiaus str.28, 03224, Vilnius (Lithuania)

2013-12-16

This paper investigates efficiency of specially designed atomizer used to spray water and cavitate microbubbles in water flow. Surface cleaning system was used to clean machined (grinded) aluminum surface from abrasive particles. It is established that cleaning efficiency depends on diameter of the diffuser, water pressure and distance between nozzle and metal surface. It is obtained that the best cleaning efficiency (100%) is achieved at pressure 36 bar, when diameter of diffuser is 0.4 mm and distance between nozzle and surface is 1 mm. It is also established that satisfactory cleaning efficiency (80%) is achieved not only when atomizer is placed closer to metal surface, but also at larger (120 mm) distances.

Thermophoretically driven water droplets on graphene and boron nitride surfaces

Science.gov (United States)

Rajegowda, Rakesh; Kannam, Sridhar Kumar; Hartkamp, Remco; Sathian, Sarith P.

2018-05-01

We investigate thermally driven water droplet transport on graphene and hexagonal boron nitride (h-BN) surfaces using molecular dynamics simulations. The two surfaces considered here have different wettabilities with a significant difference in the mode of droplet transport. The water droplet travels along a straighter path on the h-BN sheet than on graphene. The h-BN surface produced a higher driving force on the droplet than the graphene surface. The water droplet is found to move faster on h-BN surface compared to graphene surface. The instantaneous contact angle was monitored as a measure of droplet deformation during thermal transport. The characteristics of the droplet motion on both surfaces is determined through the moment scaling spectrum. The water droplet on h-BN surface showed the attributes of the super-diffusive process, whereas it was sub-diffusive on the graphene surface.

Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

International Nuclear Information System (INIS)

Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

2011-01-01

The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

Science.gov (United States)

Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

2012-09-24

We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

OpenAIRE

Bläckberg, Lisa

2011-01-01

This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

Surface-structure dependence of healing radiation-damage mechanism in nanoporous tungsten

Science.gov (United States)

Duan, Guohua; Li, Xiangyan; Sun, Jingjing; Hao, Congyu; Xu, Yichun; Zhang, Yange; Liu, Wei; Liu, C. S.

2018-01-01

Under nuclear fusion environments, displacement damage in tungsten (W) is usually caused by neutrons irradiation through producing large quantities of vacancies (Vs) and self-interstitial atoms (SIAs). These defects not only affect the mechanical properties of W, but also act as the trap sites for implanted hydrogen isotopes and helium. Nano-porous (NP) W with a high fraction of free surfaces has been developed to mitigate the radiation damage. However, the mechanism of the surface reducing defects accumulation is not well understood. By using multi-scale simulation methods, we investigated the interaction of the SIA and V with different surfaces on across length and time scales. We found that, at a typical operation temperature of 1000 K, surface (1 1 0) preferentially heals radiation damage of W compared with surface (1 0 0) and boundary (3 1 0). On surface (1 1 0), the diffusion barrier for the SIA is only 0.68 eV. The annihilation of the SIA-V happens via the coupled motion of the V segregation towards the surface from the bulk and the two-dimensional diffusion of the SIA on the surface. Such mechanism makes the surface (1 1 0) owe better healing capability. On surface (1 0 0), the diffusion energy barrier for the SIA is 2.48 eV, higher than the diffusion energy barrier of the V in bulk. The annihilation of the SIA-V occurs via the V segregation and recombination. The SIA was found to migrate one-dimensionally along a boundary (3 1 0) with a barrier of 0.21 eV, leading to a lower healing efficiency in the boundary. This study suggested that the on-surface process plays an important role in healing radiation damage of NP W in addition to surface-enhanced diffusion and annihilation near the surface. A certain surface structure renders nano-structured W more radiation-tolerant.

Surface atomic relaxation and magnetism on hydrogen-adsorbed Fe(110) surfaces from first principles

Energy Technology Data Exchange (ETDEWEB)

Chohan, Urslaan K.; Jimenez-Melero, Enrique [School of Materials, The University of Manchester, Manchester M13 9PL (United Kingdom); Dalton Cumbrian Facility, The University of Manchester, Moor Row CA24 3HA (United Kingdom); Koehler, Sven P.K., E-mail: sven.koehler@manchester.ac.uk [Dalton Cumbrian Facility, The University of Manchester, Moor Row CA24 3HA (United Kingdom); School of Chemistry, The University of Manchester, Manchester M13 9PL (United Kingdom); Photon Science Institute, The University of Manchester, Manchester M13 9PL (United Kingdom)

2016-11-30

Highlights: • Potential energy surfaces for H diffusion on Fe(110) calculated. • Full vibrational analysis of surface modes performed. • Vibrational analysis establishes lb site as a transition state to the 3f site. • Pronounced buckling observed in the Fe surface layer. - Abstract: We have computed adsorption energies, vibrational frequencies, surface relaxation and buckling for hydrogen adsorbed on a body-centred-cubic Fe(110) surface as a function of the degree of H coverage. This adsorption system is important in a variety of technological processes such as the hydrogen embrittlement in ferritic steels, which motivated this work, and the Haber–Bosch process. We employed spin-polarised density functional theory to optimise geometries of a six-layer Fe slab, followed by frozen mode finite displacement phonon calculations to compute Fe–H vibrational frequencies. We have found that the quasi-threefold (3f) site is the most stable adsorption site, with adsorption energies of ∼3.0 eV/H for all coverages studied. The long-bridge (lb) site, which is close in energy to the 3f site, is actually a transition state leading to the stable 3f site. The calculated harmonic vibrational frequencies collectively span from 730 to 1220 cm{sup −1}, for a range of coverages. The increased first-to-second layer spacing in the presence of adsorbed hydrogen, and the pronounced buckling observed in the Fe surface layer, may facilitate the diffusion of hydrogen atoms into the bulk, and therefore impact the early stages of hydrogen embrittlement in steels.

Second generation diffusion model of interacting gravity waves on the surface of deep fluid

Directory of Open Access Journals (Sweden)

A. Pushkarev

2004-01-01

Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

International Nuclear Information System (INIS)

Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

2010-01-01

Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

Science.gov (United States)

Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

2010-09-29

Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

Capillary waves with surface viscosity

Science.gov (United States)

Shen, Li; Denner, Fabian; Morgan, Neal; van Wachem, Berend; Dini, Daniele

2017-11-01

Experiments over the last 50 years have suggested a correlation between the surface (shear) viscosity and the stability of a foam or emulsion. With recent techniques allowing more accurate measurements of the elusive surface viscosity, we examine this link theoretically using small-amplitude capillary waves in the presence of the Marangoni effect and surface viscosity modelled via the Boussinesq-Scriven model. The surface viscosity effect is found to contribute a damping effect on the amplitude of the capillary wave with subtle differences to the effect of the convective-diffusive Marangoni transport. The general wave dispersion is augmented to take into account the Marangoni and surface viscosity effects, and a first-order correction to the critical damping wavelength is derived. The authors acknowledge the financial support of the Shell University Technology Centre for fuels and lubricants.

Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

International Nuclear Information System (INIS)

Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

1985-06-01

A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

Science.gov (United States)

Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

2013-06-01

In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

Czech Academy of Sciences Publication Activity Database

Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

2016-01-01

Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

Dynamic Equilibrium Mechanism for Surface Nanobubble Stabilization

NARCIS (Netherlands)

Brenner, Michael P.; Lohse, Detlef

2008-01-01

Recent experiments have convincingly demonstrated the existence of surface nanobubbles on submerged hydrophobic surfaces. However, classical theory dictates that small gaseous bubbles quickly dissolve because their large Laplace pressure causes a diffusive outflux of gas. Here we suggest that the

PREFACE: Vibrations at surfaces Vibrations at surfaces

Science.gov (United States)

Rahman, Talat S.

2011-12-01

Central Florida, Orlando, in March 2010. Several speakers at this meeting were invited to contribute to the special section in this issue. As is clear from the articles in this special section, the phenomenon of vibrations at surfaces continues to be a dynamic field of investigation. In fact, there is a resurgence of effort because the insights provided by surface dynamics are still fundamental to the development of an understanding of the microscopic factors that control surface structure formation, diffusion, reaction and structural stability. Examination of dynamics at surfaces thus complements and supplements the wealth of information that is obtained from real-space techniques such as scanning tunneling microscopy. Vibrational dynamics is, of course, not limited to surfaces. Surfaces are important since they provide immediate deviation from the bulk. They display how lack of symmetry can lead to new structures, new local atomic environments and new types of dynamical modes. Nanoparticles, large molecules and nanostructures of all types, in all kinds of local environments, provide further examples of regions of reduced symmetry and coordination, and hence display characteristic vibrational modes. Given the tremendous advance in the synthesis of a variety of nanostructures whose functionalization would pave the way for nanotechnology, there is even greater need to engage in experimental and theoretical techniques that help extract their vibrational dynamics. Such knowledge would enable a more complete understanding and characterization of these nanoscale systems than would otherwise be the case. The papers presented here provide excellent examples of the kind of information that is revealed by vibrations at surfaces. Vibrations at surface contents Poisoning and non-poisoning oxygen on Cu(410)L Vattuone, V Venugopal, T Kravchuk, M Smerieri, L Savio and M Rocca Modifying protein adsorption by layers of glutathione pre-adsorbed on Au(111)Anne Vallée, Vincent Humblot

Theoretical study of fractal growth and stability on surface

DEFF Research Database (Denmark)

Dick, Veronika V.; Solov'yov, Ilia; Solov'yov, Andrey V.

2009-01-01

We perform a theoretical study of the fractal growing process on surface by using the deposition, diffusion, aggregation method. We present a detailed analysis of the post-growth processes occurring in a nanofractal on surface. For this study we developed a method which describes the internal...... dynamics of particles in a fractal and accounts for their diffusion and detachment. We demonstrate that these kinetic processes are responsible for the formation of the final shape of the islands on surface after the post-growth relaxation....

Studies of nanosecond pulse surface ionization wave discharges over solid and liquid dielectric surfaces

International Nuclear Information System (INIS)

Petrishchev, Vitaly; Leonov, Sergey; Adamovich, Igor V

2014-01-01

Surface ionization wave discharges generated by high-voltage nanosecond pulses, propagating over a planar quartz surface and over liquid surfaces (distilled water and 1-butanol) have been studied in a rectangular cross section test cell. The discharge was initiated using a custom-made, alternating polarity, high-voltage nanosecond pulse plasma generator, operated at a pulse repetition rate of 100–500 Hz, with a pulse peak voltage and current of 10–15 kV and 7–20 A, respectively, a pulse FWHM of ∼100 ns, and a coupled pulse energy of 2–9 mJ/pulse. Wave speed was measured using a capacitive probe. ICCD camera images demonstrated that the ionization wave propagated predominantly over the quartz wall or over the liquid surface adjacent to the grounded waveguide placed along the bottom wall of the test cell. Under all experimental conditions tested, the surface plasma ‘sheet’ was diffuse and fairly uniform, both for positive and negative polarities. The parameters of ionization wave discharge propagating over distilled water and 1-butanol surfaces were close to those of the discharge over a quartz wall. No perturbation of the liquid surface by the discharge was detected. In most cases, the positive polarity surface ionization wave propagated at a higher speed and over a longer distance compared to the negative polarity wave. For all three sets of experiments (surface ionization wave discharge over quartz, water and 1-butanol), wave speed and travel distance decreased with pressure. Diffuse, highly reproducible surface ionization wave discharge was also observed over the liquid butanol–saturated butanol vapor interface, as well as over the distilled water–saturated water vapor interface, without buffer gas flow. No significant difference was detected between surface ionization discharges sustained using single-polarity (positive or negative), or alternating polarity high-voltage pulses. Plasma emission images yielded preliminary evidence of charge

Modeling of hydrogen desorption from tungsten surface

Energy Technology Data Exchange (ETDEWEB)

Guterl, J., E-mail: jguterl@ucsd.edu [University of California, San Diego, La Jolla, CA 92093 (United States); Smirnov, R.D. [University of California, San Diego, La Jolla, CA 92093 (United States); Krasheninnikov, S.I. [University of California, San Diego, La Jolla, CA 92093 (United States); Nuclear Research National University MEPhI, Moscow 115409 (Russian Federation); Uberuaga, B.; Voter, A.F.; Perez, D. [Los Alamos National Laboratory, Los Alamos, NM 8754 (United States)

2015-08-15

Hydrogen retention in metallic plasma-facing components is among key-issues for future fusion devices. For tungsten, which has been chosen as divertor material in ITER, hydrogen desorption parameters experimentally measured for fusion-related conditions show large discrepancies. In this paper, we therefore investigate hydrogen recombination and desorption on tungsten surfaces using molecular dynamics simulations and accelerated molecular dynamics simulations to analyze adsorption states, diffusion, hydrogen recombination into molecules, and clustering of hydrogen on tungsten surfaces. The quality of tungsten hydrogen interatomic potential is discussed in the light of MD simulations results, showing that three body interactions in current interatomic potential do not allow to reproduce hydrogen molecular recombination and desorption. Effects of surface hydrogen clustering on hydrogen desorption are analyzed by introducing a kinetic model describing the competition between surface diffusion, clustering and recombination. Different desorption regimes are identified and reproduce some aspects of desorption regimes experimentally observed.

Surface and impurity studies in ORMAK and ISX

Energy Technology Data Exchange (ETDEWEB)

Colchin, R.J.; Clausing, R.E.; Emerson, L.C.; Heatherly, L.; Isler, R.C.

1977-02-01

The ORMAK vacuum liner is constructed of stainless steel overcoated with a thin platinum diffusion barrier and a final layer of gold. Gold was selected as the vacuum surface because it is chemically inert to the adsorption of common gases. However, gold surfaces do adsorb hydrocarbons, and carbon (along with oxygen) was the principal plasma contaminant during the first two years of ORMAK operation. Upon switching discharge-cleaning gases from hydrogen to oxygen, carbon levels dropped until carbon is no longer a significant contaminant; residual hydrocarbons can now be controlled either by hydrogen or by oxygen discharge cleaning. The principal measured plasma contaminant in ORMAK is now oxygen. Samples taken from the ORMAK liner and analyzed by Auger electron spectroscopy reveal the presence of iron and oxygen. There is evidence from a SXAPS (Soft X-ray Appearance Potential Spectroscopy) probe of iron and chromium diffusion from the stainless steel through the gold surface in spite of the platinum diffusion barrier. The iron and chromium provide surface oxidation sites, and SXAPS analysis shows that these metals exist as oxides.

Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

Science.gov (United States)

Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

2017-11-01

Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

International Nuclear Information System (INIS)

Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

1997-01-01

The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

Energy Technology Data Exchange (ETDEWEB)

Lawrenz, M.

2007-10-30

In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

2016-04-15

We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

The influence of the solar radiation model on the calcutated solar radiation from a horizontal surface to a tilted surface

DEFF Research Database (Denmark)

Andersen, Elsa; Lund, Hans; Furbo, Simon

2004-01-01

Measured solar radiation data are most commonly available as total solar radiation on a horizontal surface. When using solar radiation measured on horizontal to calculate the solar radiation on tilted surfaces and thereby the thermal performance of different applications such as buildings and solar...... heating systems, different solar radiation models can be used. The calculation of beam radiation from a horizontal surface to a tilted surface can be done exactly whereas different solar radiation models can calculate the sky diffuse radiation. The sky diffuse radiation can either be assumed evenly...... in the calculation. The weather data are measured at the solar radiation measurement station, SMS at the Department of Civil Engineering at the Technical University of Denmark. In this study the weather data are combined with solar collector calculations based on solar collector test carried out at Solar Energy...

Electrodiffusion of lipids on membrane surfaces.

Science.gov (United States)

Zhou, Y C

2012-05-28

Lateral translocation of lipids and proteins is a universal process on membrane surfaces. Local aggregation or organization of lipids and proteins can be induced when the random lateral motion is mediated by the electrostatic interactions and membrane curvature. Although the lateral diffusion rates of lipids on membranes of various compositions are measured and the electrostatic free energies of predetermined protein-membrane-lipid systems can be computed, the process of the aggregation and the evolution to the electrostatically favorable states remain largely undetermined. Here we propose an electrodiffusion model, based on the variational principle of the free energy functional, for the self-consistent lateral drift-diffusion of multiple species of charged lipids on membrane surfaces. Finite sizes of lipids are modeled to enforce the geometrical constraint of the lipid concentration on membrane surfaces. A surface finite element method is developed to appropriate the Laplace-Beltrami operators in the partial differential equations of the model. Our model properly describes the saturation of lipids on membrane surfaces, and correctly predicts that the MARCKS peptide can consistently sequester three multivalent phosphatidylinositol 4,5-bisphosphate lipids through its basic amino acid residues, regardless of a wide range of the percentage of monovalent phosphatidylserine in the membrane.

Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

Directory of Open Access Journals (Sweden)

Louena Shtrepi

2017-02-01

Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

Radon transport processes below the earth's surface

International Nuclear Information System (INIS)

Wilkening, M.

1980-01-01

Processes by which 222 Rn is transported from the soil to the earth's surface are reviewed. The mechanisms effective in transporting 222 Rn to the surface are related to the size and configuration of the spaces occupied by the soil gas which may vary from molecular interstices to large underground caverns. The near-surface transport processes are divided into two categories: (1) a microscopic process that includes molecular diffusion and viscous flow in fine capillaries and (2) macroscopic flow in fissures and channels. Underground air rich in 222 Rn can also reach the surface through cracks, fissures, and underground channels. This type of transport is shown for (1) a horizontal tunnel penetrating a fractured hillside, (2) a large underground cave, and (3) volcanic activity. Pressure differentials having various natural origins and thermal gradients are responsible for the transport in these examples. 222 Rn transport by ordinary molecular diffusion appears to be the dominant process

Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

Science.gov (United States)

Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

2004-07-05

Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

Dissolution model for a glass having an adherent insoluble surface layer

International Nuclear Information System (INIS)

Harvey, K.B.; Larocque, C.A.B.

1990-01-01

Waste form glasses that contain substantial quantities of iron, manganese, and aluminum oxides, such as the Savannah River SRL TDS-131 glass, form a thick, hydrated surface layer when placed in contact with water. The dissolution of such a glass has been modeled with the Savannah River Model. The authors showed previously that the equations of the Savannah River Model could be fitted to published experimental data if a time-dependent diffusion coefficient was assumed for species of diffusing through the surface layer. The Savannah River Model assumes that all of the material dissolved from the glass enters solution, whereas it was observed that substantial quantities of material were retained in the surface layer. An alternative model, presented contains a mass balance equation that allows material either to enter solution or to be retained in the surface layer. It is shown that the equations derived using this model can be fitted to the published experimental data assuming a constant diffusion coefficient for species diffusing through the surface layer

A nucleation theory of cell surface capping

International Nuclear Information System (INIS)

Coutsias, E.A.; Wester, M.J.; Perelson, A.S.

1997-01-01

We propose a new theory of cell surface capping based on the principles of nucleation. When antibody interacts with cell surface molecules, the molecules initially form small aggregates called patches that later coalesce into a large aggregate called a cap. While a cap can form by patches being pulled together by action of the cell''s cytoskeleton, in the case of some molecules, disruption of the cytoskeleton does not prevent cap formation. Diffusion of large aggregates on a cell surface is slow, and thus we propose that a cap can form solely through the diffusion of small aggregates containing just one or a few cell surface molecules. Here we consider the extreme case in which single molecules are mobile, but aggregates of all larger sizes are immobile. We show that a set of patches in equilibrium with a open-quotes seaclose quotes of free cell surface molecules can undergo a nucleation-type phase transition in which the largest patch will bind free cell surface molecules, deplete the concentration of such molecules in the open-quotes seaclose quotes and thus cause the other patches to shrink in size. We therefore show that a cap can form without patches having to move, collide with each other, and aggregate

Designing Pulse Laser Surface Modification of H13 Steel Using Response Surface Method

Science.gov (United States)

Aqida, S. N.; Brabazon, D.; Naher, S.

2011-01-01

This paper presents a design of experiment (DOE) for laser surface modification process of AISI H13 tool steel in achieving the maximum hardness and minimum surface roughness at a range of modified layer depth. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 tool steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, overlap percentage and pulse repetition frequency (PRF). The response surface method with Box-Behnken design approach in Design Expert 7 software was used to design the H13 laser surface modification process. Metallographic study and image analysis were done to measure the modified layer depth. The modified surface roughness was measured using two-dimensional surface profilometer. The correlation of the three laser processing parameters and the modified surface properties was specified by plotting three-dimensional graph. The hardness properties were tested at 981 mN force. From metallographic study, the laser modified surface depth was between 37 μm and 150 μm. The average surface roughness recorded from the 2D profilometry was at a minimum value of 1.8 μm. The maximum hardness achieved was between 728 and 905 HV0.1. These findings are significant to modern development of hard coatings for wear resistant applications.

Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

Science.gov (United States)

Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

2016-12-01

The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

General aspects of surface alloy formation

Energy Technology Data Exchange (ETDEWEB)

Bergbreiter, Andreas; Engstfeld, Albert K.; Roetter, Ralf T.; Hoster, Harry E.; Behm, R. Juergen [Institute of Surface Chemistry and Catalysis, Ulm University, D-89069 Ulm (Germany); Berko, Andras

2010-07-01

Surface confined alloys are excellent model systems for studies of structure-property relationships of bimetallic surfaces. They are formed by deposition of a guest metal B onto a substrate A, followed by annealing to a temperature, where place exchange between adatoms and atoms from the underlying surface layer becomes possible and diffusion into the bulk is sufficiently slow. We exemplarily confirmed by scanning tunneling microscopy and Auger electron spectroscopy for PtRu/Ru(0001), PdRu/Ru(0001), AuPt/Pt(111), AgPt/Pt(111), and AgPd/Pd(111), surface alloys are obtained for systems where metal B has a negative surface segregation energy within metal A. By exchanging A and B, however, AB surface alloys are most likely overgrown by metal B, which we demonstrate for RuPt/Pt(111) in comparison to PtRu/Ru(0001).

Three modes of interdecadal trends in sea surface temperature and sea surface height

Science.gov (United States)

Gnanadesikan, A.; Pradal, M.

2013-12-01

It might be thought that sea surface height and sea surface temperature would be tightly related. We show that this is not necessarily the case on a global scale. We analysed this relationship in a suite of coupled climate models run under 1860 forcing conditions. The models are low-resolution variants of the GFDL Earth System Model, reported in Galbraith et al. (J. Clim. 2011). 1. Correlated changes in global sea surface height and global sea surface temperature. This mode corresponds to opening and closing of convective chimneys in the Southern Ocean. As the Southern Ocean destratifies, sea ice formation is suppressed during the winter and more heat is taken up during the summer. This mode of variability is highly correlated with changes in the top of the atmosphere radiative budget and weakly correlated with changes in the deep ocean circulation. 2. Uncorrelated changes in global sea surface height and global sea surface temperature. This mode of variability is associated with interdecadal variabliity in tropical winds. Changes in the advective flux of heat to the surface ocean play a critical role in driving these changes, which also result in significant local changes in sea level. Changes sea ice over the Southern Ocean still result in changes in solar absorption, but these are now largely cancelled by changes in outgoing longwave radiation. 3. Anticorrelated changes in global sea surface height and global sea surface temperatures. By varying the lateral diffusion coefficient in the ocean model, we are able to enhance and suppress convection in the Southern and Northern Pacific Oceans. Increasing the lateral diffusion coefficients shifts the balance sources of deep water away from the warm salty deep water of the North Atlantic and towards cold fresh deep water from the other two regions. As a result, even though the planet as a whole warms, the deep ocean cools and sea level falls, with changes of order 30 cm over 500 years. The increase in solar absorption

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam

2014-05-20

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

Reactions between monolayer Fe and Si(001) surfaces

Energy Technology Data Exchange (ETDEWEB)

Hasegawa, M; Kobayashi, N; Hayashi, N [Electrotechnical Lab., Tsukuba, Ibaraki (Japan)

1997-03-01

Reactions between 1.5 monolayer(ML) Fe deposited on Si(001)-2x1 and -dihydride surfaces were studied in situ by reflection high-energy electron diffraction and time-of-flight ion scattering spectrometry with the use of 25 keV H ions. The reactions between Fe and Si which were successively deposited on Si(001)-dihydride surface were also studied. After the room temperature deposition Fe reacted with Si(001)-2x1 substrate resulting in the formation of polycrystalline Fe5Si3. By annealing to 560-650degC composite heteroepitaxial layer of both type A and type B {beta}-FeSi2 was formed. On the dihydride surface polycrystalline Fe was observed after 1.5ML Fe deposition at room temperature, and reaction between Fe and Si(001)-dihydride surface is not likely at room temperature. We observed 3D rough surface when we deposited only Fe layer on the dihydride surface and annealed above 700degC. The hydrogen termination of Si(001) surface prevents the deposited Fe from diffusing into the substrate below 500degC, however the annealing above 710degC leads to the diffusion. We obtained 2D ordered surface, which showed 3x3 RHEED pattern as referenced to the primitive unreconstructed Si(001) surface net, when we deposited 2.5ML Fe and 5.8ML Si successively onto Si(001)-dihydride surface and annealed to 470degC. (author)

Surface segregation during irradiation

International Nuclear Information System (INIS)

Rehn, L.E.; Lam, N.Q.

1985-10-01

Gibbsian adsorption is known to alter the surface composition of many alloys. During irradiation, four additional processes that affect the near-surface alloy composition become operative: preferential sputtering, displacement mixing, radiation-enhanced diffusion and radiation-induced segregation. Because of the mutual competition of these five processes, near-surface compositional changes in an irradiation environment can be extremely complex. Although ion-beam induced surface compositional changes were noted as long as fifty years ago, it is only during the past several years that individual mechanisms have been clearly identified. In this paper, a simple physical description of each of the processes is given, and selected examples of recent important progress are discussed. With the notable exception of preferential sputtering, it is shown that a reasonable qualitative understanding of the relative contributions from the individual processes under various irradiation conditions has been attained. However, considerably more effort will be required before a quantitative, predictive capability can be achieved. 29 refs., 8 figs

Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

Science.gov (United States)

Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

2017-08-01

We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

Science.gov (United States)

Matrane, I.; Mazroui, M.; Sbiaai, K.

2018-03-01

We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-09-15

Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

Turbulent transport in the atmospheric surface layer

Energy Technology Data Exchange (ETDEWEB)

Tagesson, Torbern [Dept. of Physical Geography and Ecosystem Science, Lund Univ., Lund (Sweden)

2012-04-15

In the modelling of transport and accumulation of the radioactive isotope carbon-14 (C-14) in the case of a potential release from a future repository of radioactive waste, it is important to describe the transport of the isotope in the atmosphere. This report aims to describe the turbulent transport within the lower part of the atmosphere; the inertial surface layer and the roughness sublayer. Transport in the inertial surface layer is dependent on several factors, whereof some can be neglected under certain circumstances. Under steady state conditions, fully developed turbulent conditions, in flat and horizontal homogeneous areas, it is possible to apply an eddy diffusivity approach for estimating vertical transport of C. The eddy diffusivity model assumes that there is proportionality between the vertical gradient and the transport of C. The eddy diffusivity is depending on the atmospheric turbulence, which is affected by the interaction between mean wind and friction of the ground surface and of the sensible heat flux in the atmosphere. In this report, it is described how eddy diffusivity of the inertial surface layer can be estimated from 3-d wind measurements and measurements of sensible heat fluxes. It is also described how to estimate the eddy diffusivity in the inertial surface layer from profile measurements of temperature and wind speed. Close to the canopy, wind and C profiles are influenced by effects of the surface roughness; this section of the atmosphere is called the roughness sublayer. Its height is up to {approx}3 times the height of the plant canopy. When the mean wind interacts with the canopy, turbulence is not only produced by shear stress and buoyancy, it is additionally created by wakes, which are formed behind the plants. Turbulence is higher than it would be over a flat surface, and the turbulent transport is hereby more efficient. Above the plant canopy, but still within the roughness sublayer, a function that compensates for the effect

Turbulent transport in the atmospheric surface layer

International Nuclear Information System (INIS)

Tagesson, Torbern

2012-04-01

In the modelling of transport and accumulation of the radioactive isotope carbon-14 (C-14) in the case of a potential release from a future repository of radioactive waste, it is important to describe the transport of the isotope in the atmosphere. This report aims to describe the turbulent transport within the lower part of the atmosphere; the inertial surface layer and the roughness sublayer. Transport in the inertial surface layer is dependent on several factors, whereof some can be neglected under certain circumstances. Under steady state conditions, fully developed turbulent conditions, in flat and horizontal homogeneous areas, it is possible to apply an eddy diffusivity approach for estimating vertical transport of C. The eddy diffusivity model assumes that there is proportionality between the vertical gradient and the transport of C. The eddy diffusivity is depending on the atmospheric turbulence, which is affected by the interaction between mean wind and friction of the ground surface and of the sensible heat flux in the atmosphere. In this report, it is described how eddy diffusivity of the inertial surface layer can be estimated from 3-d wind measurements and measurements of sensible heat fluxes. It is also described how to estimate the eddy diffusivity in the inertial surface layer from profile measurements of temperature and wind speed. Close to the canopy, wind and C profiles are influenced by effects of the surface roughness; this section of the atmosphere is called the roughness sublayer. Its height is up to ∼3 times the height of the plant canopy. When the mean wind interacts with the canopy, turbulence is not only produced by shear stress and buoyancy, it is additionally created by wakes, which are formed behind the plants. Turbulence is higher than it would be over a flat surface, and the turbulent transport is hereby more efficient. Above the plant canopy, but still within the roughness sublayer, a function that compensates for the effect of

Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

International Nuclear Information System (INIS)

Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

2010-01-01

Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

Directory of Open Access Journals (Sweden)

H. Hammami

2017-08-01

Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

Overview of surface alloying by ion, electron, and laser beams

International Nuclear Information System (INIS)

Rehn, L.E.; Picraux, S.T.; Wiedersich, H.

1986-01-01

Surface composition and microstructure play critical roles in determining the usefulness of many technological materials. For example, the mechanical interactions of an alloy with its environment such as friction and wear, chemical effects such as oxidation and corrosion, and even its outward appearance are all controlled by the properties of a very thin layer of material at the surface. For this reason, the properties required at the surface of an alloy for a given application are often different from, and frequently even incompatible with, property requirements for the bulk material. This constraint has spawned a great variety of traditional surface alloying and coating techniques, ranging from the simple application of paints, to considerably more sophisticated electroplating, nitriding, and surface diffusion treatments. In favorable circumstances, surface alloying can be used to independently optimize the surface and bulk properties of a material for a given application. Unfortunately, equilibrium solubility limits and low solid-state diffusivities impose severe restrictions on conventional surface alloying methods, and problems of adhesion frequently plague coating techniques

Surface engineering for enhanced performance against wear

CERN Document Server

2013-01-01

Surface Engineering constitutes a variety of processes and sub processes. Each chapter of this work covers specific processes by experts working in the area. Included for each topic are tribological performances for each process as well as results of recent research. The reader also will benefit from in-depth studies of diffusion coatings, nanocomposite films for wear resistance, surfaces for biotribological applications, thin-film wear, tribology of thermal sprayed coatings, hardfacing, plating for tribology and high energy beam surface modifications. Material scientists as well as engineers working with surface engineering for tribology will be particularly interested in this work.

Influence of surface vacancy defects on the carburisation of Fe 110 surface by carbon monoxide

Energy Technology Data Exchange (ETDEWEB)

Chakrabarty, Aurab, E-mail: aurab.chakrabarty@qatar.tamu.edu; Bouhali, Othmane [Texas A& M University at Qatar, P.O. Box 23874, Doha (Qatar); Mousseau, Normand [Département de Physique and RQMP, Université de Montréal, Case Postale 6128, Succursale Centre-Ville, Montréal (QC) H3C 3J7 (Canada); Becquart, Charlotte S. [UMET, UMR CNRS 8207, ENSCL, Université Lille I, 59655 Villeneuve d’Ascq cédex (France); El-Mellouhi, Fedwa, E-mail: felmellouhi@qf.org.qa [Qatar Environment and Energy Research Institute, Hamad Bin Khalifa University, P.O. Box 5825 Doha (Qatar)

2016-07-28

Adsorption and dissociation of gaseous carbon monoxide (CO) on metal surfaces is one of the most frequently occurring processes of carburisation, known as primary initiator of metal dusting corrosion. Among the various factors that can significantly influence the carburisation process are the intrinsic surface defects such as single surface vacancies occurring at high concentrations due to their low formation energy. Intuitively, adsorption and dissociation barriers of CO are expected to be lowered in the vicinity of a surface vacancy, due to the strong attractive interaction between the vacancy and the C atom. Here the adsorption energies and dissociation pathways of CO on clean and defective Fe 110 surface are explored by means of density functional theory. Interestingly, we find that the O adatom, resulting from the CO dissociation, is unstable in the electron-deficit neighbourhood of the vacancy due to its large electron affinity, and raises the barrier of the carburisation pathway. Still, a full comparative study between the clean surface and the vacancy-defected surface reveals that the complete process of carburisation, starting from adsorption to subsurface diffusion of C, is more favourable in the vicinity of a vacancy defect.

Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

Science.gov (United States)

Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

2015-06-03

Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Soil Carbon Dioxide Production and Surface Fluxes: Subsurface Physical Controls

Science.gov (United States)

Risk, D.; Kellman, L.; Beltrami, H.

Soil respiration is a critical determinant of landscape carbon balance. Variations in soil temperature and moisture patterns are important physical processes controlling soil respiration which need to be better understood. Relationships between soil respi- ration and physical controls are typically addressed using only surface flux data but other methods also exist which permit more rigorous interpretation of soil respira- tion processes. Here we use a combination of subsurface CO_{2} concentrations, surface CO_{2} fluxes and detailed physical monitoring of the subsurface envi- ronment to examine physical controls on soil CO_{2} production at four climate observatories in Eastern Canada. Results indicate that subsurface CO_{2} produc- tion is more strongly correlated to the subsurface thermal environment than the surface CO_{2} flux. Soil moisture was also found to have an important influence on sub- surface CO_{2} production, particularly in relation to the soil moisture - soil profile diffusivity relationship. Non-diffusive profile CO_{2} transport appears to be im- portant at these sites, resulting in a de-coupling of summertime surface fluxes from subsurface processes and violating assumptions that surface CO_{2} emissions are the result solely of diffusion. These results have implications for the study of soil respiration across a broad range of terrestrial environments.

A fundamental approach to adhesion: Synthesis, surface analysis, thermodynamics and mechanics. [acid-base properties of titanium 6-4 surfaces

Science.gov (United States)

Siriwardane, R.; Wightman, J. P.

1980-01-01

The acid-base properties of titanium 6-4 plates (low surface area) were investigated after three different pretreatments, namely Turco, phosphate-fluoride and Pasa-Jell. A series of indicators was used and color changes were detected using diffuse reflectance visible spectroscopy. Electron spectroscopy for chemical analysis was used to examine the indicator on the Ti 6-4 surface. Specular reflectance infra-red spectroscopy was used to study the adsorption of stearic acid from cyclohexane solutions on the Ti 6-4 surface.

Multifractal scaling analysis of autopoisoning reactions over a rough surface

International Nuclear Information System (INIS)

Chaudhari, Ajay; Yan, Ching-Cher Sanders; Lee, S.-L.

2003-01-01

Decay type diffusion-limited reactions (DLR) over a rough surface generated by a random deposition model were performed. To study the effect of the decay profile on the reaction probability distribution (RPD), multifractal scaling analysis has been carried out. The dynamics of these autopoisoning reactions are controlled by the two parameters in the decay function, namely, the initial sticking probability (P ini ) of every site and the decay rate (m). The smaller the decay rate, the narrower is the range of α values in the α-f(α) multifractal spectrum. The results are compared with the earlier work of DLR over a surface of diffusion-limited aggregation (DLA). We also considered here the autopoisoning reactions over a smooth surface for comparing our results, which show clearly how the roughness affects the chemical reactions. The q-τ(q) multifractal curves for the smooth surface are linear whereas those for the rough surface are nonlinear. The range of α values in the case of a rough surface is wider than that of the smooth surface

A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

Science.gov (United States)

Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

2016-01-01

Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

Coexistence and competition of surface diffusion and geometric shielding in the growth of 1D bismuth nanostructures and their ohmic contact

International Nuclear Information System (INIS)

Tian, Ye; Jiang, Lianjun; Zhang, Xuejun; Deng, Yangbao; Deng, Shuguang

2014-01-01

We study the physical-vapor-deposition of 1D bismuth nanostructures. Bi nanowire elongating along [012] and/or [110] direction as well as anisotropic Bi nano-columns are physical-vapor-deposited successfully. The coexistence and competition of surface diffusion and geometric shielding are critical to their formation as well as growth mode transition among them. Since physical-vapor-deposition is a vacuum process, we make use of it to fabricate the ohmic contact to prevent the damage to the bismuth nanostructures brought by the etching to their thick surface oxide layer. (paper)

Surface-Assisted Dynamic Search Processes.

Science.gov (United States)

Shin, Jaeoh; Kolomeisky, Anatoly B

2018-03-01

Many chemical and biological systems exhibit intermittent search phenomena when participating particles alternate between dynamic regimes with different dimensionalities. Here we investigate theoretically a dynamic search process of finding a small target on a two-dimensional surface starting from a bulk solution, which is an example of such an intermittent search process. Both continuum and discrete-state stochastic descriptions are developed. It is found that depending on the scanning length λ, which describes the area visited by the reacting molecule during one search cycle, the system can exhibit three different search regimes: (i) For small λ values, the reactant finds the target mostly via three-dimensional bulk diffusion; (ii) for large λ values, the reactant molecule associates to the target mostly via surface diffusion; and (iii) for intermediate λ values, the reactant reaches the target via a combination of three-dimensional and two-dimensional search cycles. Our analysis also shows that the mean search times have different scalings as a function of the size of the surface segment depending on the nature of the dynamic search regime. Search dynamics are also sensitive to the position of the target for large scanning lengths. In addition, it is argued that the continuum description underestimates mean search times and does not always correctly describe the most optimal conditions for the surface-assisted dynamic processes. The importance of our findings for real natural systems is discussed.

II. Inhibited Diffusion Driven Surface Transmutations

Science.gov (United States)

Chubb, Talbot A.

2006-02-01

This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

II. Inhibited diffusion driven surface transmutations

International Nuclear Information System (INIS)

Cubb, Talbot A.

2006-01-01

This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

Mechanisms and energetics of surface atomic processes

International Nuclear Information System (INIS)

Tsong, T.T.

1991-01-01

The energies involved in various surface atomic processes such as surface diffusion, the binding of small atomic clusters on the surface, the interaction between two adsorbed atoms, the dissociation of an atom from a small cluster or from a surface layer, the binding of kink size atoms or atoms at different adsorption sites to the surface etc., can be derived from an analysis of atomically resolved field ion microscope images and a kinetic energy measurement of low temperature field desorbed ions using the time-of-flight atom-probe field ion microscope. These energies can be used to compare with theories and to understand the transport of atoms on the surface in atomic reconstructions, epitaxial growth of surface layers and crystal growth, adsorption layer superstructure formation, and also why an atomic ordering or atomic reconstruction at the surface is energetically favored. Mechanisms of some of the surface atomic processes are also clarified from these quantitative, atomic resolution studies. In this paper work in this area is bris briefly reviewed

Effects of temperature and surface orientation on migration behaviours of helium atoms near tungsten surfaces

Energy Technology Data Exchange (ETDEWEB)

Wang, Xiaoshuang; Wu, Zhangwen; Hou, Qing, E-mail: qhou@scu.edu.cn

2015-10-15

Molecular dynamics simulations were performed to study the dependence of migration behaviours of single helium atoms near tungsten surfaces on the surface orientation and temperature. For W{100} and W{110} surfaces, He atoms can quickly escape out near the surface without accumulation even at a temperature of 400 K. The behaviours of helium atoms can be well-described by the theory of continuous diffusion of particles in a semi-infinite medium. For a W{111} surface, the situation is complex. Different types of trap mutations occur within the neighbouring region of the W{111} surface. The trap mutations hinder the escape of He atoms, resulting in their accumulation. The probability of a He atom escaping into vacuum from a trap mutation depends on the type of the trap mutation, and the occurrence probabilities of the different types of trap mutations are dependent on the temperature. This finding suggests that the escape rate of He atoms on the W{111} surface does not show a monotonic dependence on temperature. For instance, the escape rate at T = 1500 K is lower than the rate at T = 1100 K. Our results are useful for understanding the structural evolution and He release on tungsten surfaces and for designing models in other simulation methods beyond molecular dynamics.

X-Ray Reflectivity from the Surface of a Liquid Crystal:

DEFF Research Database (Denmark)

Pershan, P.S.; Als-Nielsen, Jens Aage

1984-01-01

X-ray reflectivity from the surface of a nematic liquid crystal is interpreted as the coherent superposition of Fresnel reflection from the surface and Bragg reflection from smectic order induced by the surface. Angular dependence of the Fresnel effect yields information on surface structure....... Measurement of the intensity of diffuse critical scattering relative to the Fresnel reflection yields the absolute value of the critical part of the density-density correlation function....

Self-diffusion dynamics processes relevant to 2D homoepitaxy growth of Ni adatom on Ni(111) surface

Energy Technology Data Exchange (ETDEWEB)

Liu, Fusheng [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Chen, Yifeng, E-mail: yefengc63@sina.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Wang, Yufei, E-mail: yejin802@126.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Liu, Zhulin; Hu, Zhongliang [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Yang, Xiyuan [Department of Physics, Hunan University of Arts and Science, Changde 415000 (China); Luo, Wenhua [Department of Physics and Electronic Information Science, Hunan Institute of Science and Technology, Yueyang 414006 (China)

2014-07-01

Using molecular dynamics and modified analytic embedded atom methods, the atomic self-diffusion dynamics behaviors relevant to 2D crystal growth on Ni(111) surface have been studied between 150 and 600 K. On perfect Ni(111) surface, the activation energy and prefactor are 0.058±0.001 eV and 4.2×10{sup −4} cm{sup 2}/s between 150 and 350 K, and 0.082±0.003 eV and 7.8×10{sup −4} cm{sup 2}/s from 400 to 600 K. Ni adatom just hops along the directions of close-packed steps on stepped Ni(111) surface, the corresponding activation energies and prefactors are 0.188±0.002 eV and (3.8–4.4)×10{sup −3} cm{sup 2}/s along the direction of A-type step, 0.140±0.001 eV and (1.1–1.2)×10{sup −3} cm{sup 2}/s along the direction of B-type step, and both fitting lines of Arrhenius law intersect at T{sub c}=420–440 K. Our results show that the atomic growth dynamics under nonequilibrium conditions is gradually dominated by the prefactor with increasing temperature. In addition, the shape-change of the 2D nanometer-size island has been discussed on stepped Ni(111) surface in different temperature range.

II. Inhibited diffusion driven surface transmutations

Energy Technology Data Exchange (ETDEWEB)

Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

2006-07-01

This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

Surface phase transitions in cu-based solid solutions

Science.gov (United States)

Zhevnenko, S. N.; Chernyshikhin, S. V.

2017-11-01

We have measured surface energy in two-component Cu-based systems in H2 + Ar gas atmosphere. The experiments on solid Cu [Ag] and Cu [Co] solutions show presence of phase transitions on the surfaces. Isotherms of the surface energy have singularities (the minimum in the case of copper solid solutions with silver and the maximum in the case of solid solutions with cobalt). In both cases, the surface phase transitions cause deficiency of surface miscibility: formation of a monolayer (multilayer) (Cu-Ag) or of nanoscale particles (Cu-Co). At the same time, according to the volume phase diagrams, the concentration and temperature of the surface phase transitions correspond to the solid solution within the volume. The method permits determining the rate of diffusional creep in addition to the surface energy. The temperature and concentration dependence of the solid solutions' viscosity coefficient supports the fact of the surface phase transitions and provides insights into the diffusion properties of the transforming surfaces.

Radiation exchange factors between specular inner surfaces of a rectangular enclosure such as transplant production unit

International Nuclear Information System (INIS)

Abdel-Ghany, Ahmed M.; Kozai, Toyoki

2006-01-01

General mathematical relations are presented for the specular exchange factors, F S , of diffuse radiation exchange between the inner surfaces of a rectangular enclosure. Three of these surfaces are specular reflectors, diffuse emitters and the fourth surface is a diffuse reflector, diffuse emitter. This enclosure can be used as a transplant production unit with artificial lighting for electric energy saving purposes. An image system and the crossed string method are used to derive these relations. The resulting expressions are conceptually simple and similar to the commonly known expressions of the exchange factors between diffuse surfaces, F. The accuracy of the presented F S relations was examined for different numbers of multiple reflections, N, on the specular surfaces and for different aspect ratios (ratio of the width, w to the height, h). The results proved that the relations are accurate and strongly satisfy the well-known relation of the radiation exchange between enclosure surfaces and satisfy the reciprocity relation. For any aspect ratio, considering N of 150 between highly reflective surfaces (ρ = 0.99) is sufficient to estimate the F S factors without any possible error. Using specular reflecting surfaces in such cases significantly reduces the electric energy consumption used for lighting

Surface self-organization in multilayer film coatings

Science.gov (United States)

Shuvalov, Gleb M.; Kostyrko, Sergey A.

2017-12-01

It is a recognized fact that during film deposition and subsequent thermal processing the film surface evolves into an undulating profile. Surface roughness affects many important aspects in the engineering application of thin film materials such as wetting, heat transfer, mechanical, electromagnetic and optical properties. To accurately control the morphological surface modifications at the micro- and nanoscale and improve manufacturing techniques, we design a mathematical model of the surface self-organization process in multilayer film materials. In this paper, we consider a solid film coating with an arbitrary number of layers under plane strain conditions. The film surface has a small initial perturbation described by a periodic function. It is assumed that the evolution of the surface relief is governed by surface and volume diffusion. Based on Gibbs thermodynamics and linear theory of elasticity, we present a procedure for constructing a governing equation that gives the amplitude change of the surface perturbation with time. A parametric study of the evolution equation leads to the definition of a critical undulation wavelength that stabilizes the surface. As a numerical result, the influence of geometrical and physical parameters on the morphological stability of an isotropic two-layered film coating is analyzed.

Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

Directory of Open Access Journals (Sweden)

Murat Kuscu

Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

Science.gov (United States)

Kuscu, Murat; Akan, Ozgur B

2018-01-01

We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

Adsorption and diffusion of H and NH{sub x} as key steps of the NH{sub x} dehydrogenation reaction at the V{sub 2}O{sub 5} (010) surface

Energy Technology Data Exchange (ETDEWEB)

Gruber, Mathis; Hermann, Klaus [Fritz-Haber-Institut der MPG, und Sfb 546, Berlin (Germany)

2009-07-01

Various selective oxidation reactions as the selective catalytic reduction (SCR) of NO{sub x} or the ammoxidation of propane/propene to acrylonitrile are processed on vanadium based metal-oxide catalysts in the presence of ammonia. In the reactions the intermediates NH{sub 2}, NH{sub 3}, and NH{sub 4} are involved indicating that the adsorption and dehydrogenation of NH{sub x}, x < 4, are important steps. We have performed theoretical studies of corresponding reaction steps where the catalyst is simulated by a finite section of the V{sub 2}O{sub 5} (010) surface. The calculations apply density-functional theory combined with clusters modeling the adsorbate system. The substrate lowers corresponding dehydrogenation energies considerably compared with values for the gas phase reaction. However, the lowering is too small to make dehydrogenation of NH{sub 3} likely to happen. Our results on the role of oxygen vacancies for the dehydrogenation indicate that such surface defects become important for the reaction. Besides the energetics also the diffusion at the surface influences the reaction. A nudged elastic band (NEB) routine has been implemented to evaluate diffusion paths and barriers. Hydrogen diffusion on the surface will be discussed and additional examples for NH{sub x} diffusion will be shown. Based on these results possible reaction scenarios for the dehydrogenation reaction will be presented.

Surface excitation parameter for rough surfaces

International Nuclear Information System (INIS)

Da, Bo; Salma, Khanam; Ji, Hui; Mao, Shifeng; Zhang, Guanghui; Wang, Xiaoping; Ding, Zejun

2015-01-01

Graphical abstract: - Highlights: • Instead of providing a general mathematical model of roughness, we directly use a finite element triangle mesh method to build a fully 3D rough surface from the practical sample. • The surface plasmon excitation can be introduced to the realistic sample surface by dielectric response theory and finite element method. • We found that SEP calculated based on ideal plane surface model are still reliable for real sample surface with common roughness. - Abstract: In order to assess quantitatively the importance of surface excitation effect in surface electron spectroscopy measurement, surface excitation parameter (SEP) has been introduced to describe the surface excitation probability as an average number of surface excitations that electrons can undergo when they move through solid surface either in incoming or outgoing directions. Meanwhile, surface roughness is an inevitable issue in experiments particularly when the sample surface is cleaned with ion beam bombardment. Surface roughness alters not only the electron elastic peak intensity but also the surface excitation intensity. However, almost all of the popular theoretical models for determining SEP are based on ideal plane surface approximation. In order to figure out whether this approximation is efficient or not for SEP calculation and the scope of this assumption, we proposed a new way to determine the SEP for a rough surface by a Monte Carlo simulation of electron scattering process near to a realistic rough surface, which is modeled by a finite element analysis method according to AFM image. The elastic peak intensity is calculated for different electron incident and emission angles. Assuming surface excitations obey the Poisson distribution the SEPs corrected for surface roughness are then obtained by analyzing the elastic peak intensity for several materials and for different incident and emission angles. It is found that the surface roughness only plays an

Radionuclide transfer onto ground surface in surface water flow. 2. Undisturbed tuff rock

International Nuclear Information System (INIS)

Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu

1994-09-01

Radionuclide migration with ground surface water flow is considered to be one of path ways in the scenario for environmental migration of the radionuclide leaked from LLRW depository. To study the radionuclide migration demonstratively, a ground surface radionuclide migration test was carried out by simulating radioactive solution flowing on the sloped tuff rock surface. Tuff rock sample of 240 cm in length taken from the Shimokita district was used to test the transfer of 60 Co, 85 Sr and 137 Cs onto the sample surface from the flowing radioactive solution under restricted infiltration condition at flow rates of 25, 80, 160ml/min and duration of 56h. The concentration change of the radionuclides in effluent was nearly constant as a function of elapsed time during the experimental period, but decreased with lower flow rates. Among the three radionuclides, 137 Cs was greatly decreased its concentration to 30% of the inflow. Adsorbed distribution of the radionuclides concentration on the ground surface decreased gradually with the distance from the inlet, and showed greater gradient at lower flow rate. Analyzing the result by the migration model, where a vertical advection distribution and two-dimensional diffusion in surface water are adopted with a first order adsorption reaction, value of migration parameters was obtained relating to the radionuclide adsorption and the surface water flow, and the measured distribution could be well simulated by adopting the value to the model. By comparing the values with the case of loamy soil layer, all values of the migration parameters showed not so great difference between two samples for 60 Co and 85 Sr. For 137 Cs, reflecting a few larger value of adsorption to the tuff rock, larger ability to reduce the concentration of flowing radioactive solution could be indicated than that to the loamy soil surface by estimation for long flowed distance. (author)

Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

KAUST Repository

Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas

2012-01-01

in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices

The boundary condition for vertical velocity and its interdependence with surface gas exchange

Science.gov (United States)

Kowalski, Andrew S.

2017-07-01

The law of conservation of linear momentum is applied to surface gas exchanges, employing scale analysis to diagnose the vertical velocity (w) in the boundary layer. Net upward momentum in the surface layer is forced by evaporation (E) and defines non-zero vertical motion, with a magnitude defined by the ratio of E to the air density, as w = E/ρ. This is true even right down at the surface where the boundary condition is w|0 = E/ρ|0 (where w|0 and ρ|0 represent the vertical velocity and density of air at the surface). This Stefan flow velocity implies upward transport of a non-diffusive nature that is a general feature of the troposphere but is of particular importance at the surface, where it assists molecular diffusion with upward gas migration (of H2O, for example) but opposes that of downward-diffusing species like CO2 during daytime. The definition of flux-gradient relationships (eddy diffusivities) requires rectification to exclude non-diffusive transport, which does not depend on scalar gradients. At the microscopic scale, the role of non-diffusive transport in the process of evaporation from inside a narrow tube - with vapour transport into an overlying, horizontal airstream - was described long ago in classical mechanics and is routinely accounted for by chemical engineers, but has been neglected by scientists studying stomatal conductance. Correctly accounting for non-diffusive transport through stomata, which can appreciably reduce net CO2 transport and marginally boost that of water vapour, should improve characterisations of ecosystem and plant functioning.

Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

Energy Technology Data Exchange (ETDEWEB)

Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

2015-12-28

We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

International Nuclear Information System (INIS)

Mirigian, Stephen; Schweizer, Kenneth S.

2015-01-01

We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

Science.gov (United States)

Ma, Shu-Cui; Wang, Zhi-Gang; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia

2015-02-01

The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation-deprotonation behavior was determined by continuous acid-base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m2/g and large numbers of surface hydroxyl functional groups (i.e. tbnd Si-OH, tbnd Fe-OH, and tbnd Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K1, log K2) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation-deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent.

Conformation evolution of oil contaminants onto aluminum oxide surface in aqueous solution: The effect of surface coverage

Energy Technology Data Exchange (ETDEWEB)

Xie, Wenkun; Liu, Haitao, E-mail: xwk584523412@126.com; Sun, Yazhou; Fu, Hongya; Liang, Yingchun

2017-01-15

Highlights: • The dynamic conformational change of oil contaminations, at various surface coverages onto perfect α-Al{sub 2}O{sub 3}(0001) surface in aqueous solution is given. • The effect of surface coverage of oil molecules on the driving forces for the conformational change of oil contaminations is described. • The effect of interfacial water on the conformational change and even detachment of oil contaminations is considered. - Abstract: The microscopic conformational change process of oil contaminants adhered onto perfect α-Al{sub 2}O{sub 3} (0001) surface in aqueous solution was investigated by using all-atom classic molecular dynamics simulations. The change in removal mechanism of oil contaminants induced by surface coverage (surface area per molecule) was emphatically explored. Our simulation results strongly reveal that the increase in oil surface coverage induces an evident difference in microscopic detachment processes of oil contaminants. At a low surface coverage, oil contaminants can be thoroughly detached from solid surface. The whole detachment process could be divided into multi stages, including conformational change of oil contaminants on solid surface, dynamic motion of those in bulk solution and rapid migration of those from bulk solution to air/water interface. With surface coverage increasing, water diffusion becomes the key to induce conformational change and promote the detachment of oil contaminants. When oil surface coverage exceeds a threshold value, oil contaminants also undertake an evident conformational change process exhibiting typical characteristics but an incomplete detachment process occurs. All findings of the present study are helpful for the interpretation of the removal mechanism of oil contaminants on solid surface.

Ion-induced surface modification of alloys

International Nuclear Information System (INIS)

Wiedersich, H.

1983-11-01

In addition to the accumulation of the implanted species, a considerable number of processes can affect the composition of an alloy in the surface region during ion bombardment. Collisions of energetic ions with atoms of the alloy induce local rearrangement of atoms by displacements, replacement sequences and by spontaneous migration and recombination of defects within cascades. Point defects form clusters, voids, dislocation loops and networks. Preferential sputtering of elements changes the composition of the surface. At temperatures sufficient for thermal migration of point defects, radiation-enhanced diffusion promotes alloy component redistribution within and beyond the damage layer. Fluxes of interstitials and vacancies toward the surface and into the interior of the target induce fluxes of alloying elements leading to depth-dependent compositional changes. Moreover, Gibbsian surface segregation may affect the preferential loss of alloy components by sputtering when the kinetics of equilibration of the surface composition becomes competitive with the sputtering rate. Temperature, time, current density and ion energy can be used to influence the individual processes contributing to compositional changes and, thus, produce a rich variety of composition profiles near surfaces. 42 references

Electrodiffusion of Lipids on Membrane Surfaces

OpenAIRE

Zhou, Y. C.

2011-01-01

Random lateral translocation of lipids and proteins is a universal process on membrane surfaces. Local aggregation or organization of lipids and proteins can be induced when this lateral random diffusion is mediated by the electrostatic interactions and membrane curvature. Though the lateral diffusion rates of lipids on membrane of various compositions are measured and the electrostatic free energies of predetermined protein-membrane-lipid systems can be computed, the process of the aggregati...

The precipitation behavior of titanium carbide on the surface of SUS 321 stainless steel

International Nuclear Information System (INIS)

Yoshihara, Kazuhiro; Nii, Kazuyoshi

1982-01-01

The surface composition of SUS 321 stainless steel at high temperatures was observed in vacuum with Auger electron spectroscopy. The precipitation of titanium carbide was found on the surface of SUS 321. The thickness of precipitated titanium carbide layer increased in proportion to the square root of annealing time and became about 0.05 μm after heated at 1100 K for 432 ks. The precipitated titanium carbide was not replaced by the most surface active element sulfur, and remained stable on the surface. The precipitated layer, however, was not even and had many holes about 1 μm in diameter. The bottom of a hole was SUS 321, on which phosphorus, oxygen and sulfur segregated. As the annealing time was prolonged, these segregants were replaced one by one in the order of the surface activity, and finally the most surface active element, sulfur, remained on the bottom of the hole. Moreover, sulfur diffused over the outside of the hole. The precipitation of titanium carbide on the surface occurred according to the following processes: (1) The titanium and carbon which had been dissolved in the bulk diffused onto the surface of the stainless steel. (2) The titanium carbide which had been precipitated in the bulk dissolved because the concentration of titanum and carbon fell under their solubility limits in the bulk. (3) The titanium and carbon diffused onto the surface which was exposed to vacuum. (4) The titanium and carbon recombined into titanium carbide and precipitated on the surface. The growth rate of the thickness of the precipitated layer was controlled by the diffusion of titanium and carbon in the precipitated titanium carbide. (J.P.N.)

Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

NARCIS (Netherlands)

van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

2014-01-01

Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in

Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

Science.gov (United States)

Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

2016-04-05

Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

Science.gov (United States)

Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

2016-01-01

Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

The boundary condition for vertical velocity and its interdependence with surface gas exchange

Directory of Open Access Journals (Sweden)

A. S. Kowalski

2017-07-01

Full Text Available The law of conservation of linear momentum is applied to surface gas exchanges, employing scale analysis to diagnose the vertical velocity (w in the boundary layer. Net upward momentum in the surface layer is forced by evaporation (E and defines non-zero vertical motion, with a magnitude defined by the ratio of E to the air density, as w = E/ρ. This is true even right down at the surface where the boundary condition is w|0 = E/ρ|0 (where w|0 and ρ|0 represent the vertical velocity and density of air at the surface. This Stefan flow velocity implies upward transport of a non-diffusive nature that is a general feature of the troposphere but is of particular importance at the surface, where it assists molecular diffusion with upward gas migration (of H2O, for example but opposes that of downward-diffusing species like CO2 during daytime. The definition of flux–gradient relationships (eddy diffusivities requires rectification to exclude non-diffusive transport, which does not depend on scalar gradients. At the microscopic scale, the role of non-diffusive transport in the process of evaporation from inside a narrow tube – with vapour transport into an overlying, horizontal airstream – was described long ago in classical mechanics and is routinely accounted for by chemical engineers, but has been neglected by scientists studying stomatal conductance. Correctly accounting for non-diffusive transport through stomata, which can appreciably reduce net CO2 transport and marginally boost that of water vapour, should improve characterisations of ecosystem and plant functioning.

Spontaneous formation of optically induced surface relief gratings

International Nuclear Information System (INIS)

Leblond, H; Barille, R; Ahmadi-Kandjani, S; Nunzi, J-M; Ortyl, E; Kucharski, S

2009-01-01

We develop a model based on Fick's law of diffusion as a phenomenological description of the molecular motion, and on the coupled mode theory, to describe single-beam surface relief grating formation in azopolymer thin films. The model allows us to explain the mechanism of spontaneous patterning, and self-organization. It allows us to compute the surface relief profile and its evolution, with good agreement with experiments.

Relating surface chemistry and oxygen surface exchange in LnBaCo2O(5+δ) air electrodes.

Science.gov (United States)

Téllez, Helena; Druce, John; Kilner, John A; Ishihara, Tatsumi

2015-01-01

The surface and near-surface chemical composition of electroceramic materials often shows significant deviations from that of the bulk. In particular, layered materials, such as cation-ordered LnBaCo2O(5+δ) perovskites (Ln = lanthanide), undergo surface and sub-surface restructuring due to the segregation of the divalent alkaline-earth cation. These processes can take place during synthesis and processing steps (e.g. deposition, sintering or annealing), as well as at temperatures relevant for the operation of these materials as air electrodes in solid oxide fuel cells and electrolysers. Furthermore, the surface segregation in these double perovskites shows fast kinetics, starting at temperatures as low as 400 °C over short periods of time and leading to a decrease in the transition metal surface coverage exposed to the gas phase. In this work, we use a combination of stable isotope tracer labeling and surface-sensitive ion beam techniques to study the oxygen transport properties and their relationship with the surface chemistry in ordered LnBaCo2O(5+δ) perovskites. Time-of-Flight Secondary-Ion Mass Spectrometry (ToF-SIMS) combined with (18)O isotope exchange was used to determine the oxygen tracer diffusion (D*) and surface exchange (k*) coefficients. Furthermore, Low Energy Ion Scattering (LEIS) was used for the analysis of the surface and near surface chemistry as it provides information from the first mono-atomic layer of the materials. In this way, we could relate the compositional modifications (e.g. cation segregation) taking place at the electrochemically-active surface during the exchange at high temperatures and the oxygen transport properties in double perovskite electrode materials to further our understanding of the mechanism of the surface exchange process.

Choice of crystal surface finishing for a dual-ended readout depth-of-interaction (DOI) detector

International Nuclear Information System (INIS)

Fan, Peng; Ma, Tianyu; Liu, Yaqiang; Wang, Shi; Wei, Qingyang; Yao, Rutao

2016-01-01

The objective of this study was to choose the crystal surface finishing for a dual-ended readout (DER) DOI detector. Through Monte Carlo simulations and experimental studies, we evaluated 4 crystal surface finishing options as combinations of crystal surface polishing (diffuse or specular) and reflector (diffuse or specular) options on a DER detector. We also tested one linear and one logarithm DOI calculation algorithm. The figures of merit used were DOI resolution, DOI positioning error, and energy resolution. Both the simulation and experimental results show that (1) choosing a diffuse type in either surface polishing or reflector would improve DOI resolution but degrade energy resolution; (2) crystal surface finishing with a diffuse polishing combined with a specular reflector appears a favorable candidate with a good balance of DOI and energy resolution; and (3) the linear and logarithm DOI calculation algorithms show overall comparable DOI error, and the linear algorithm was better for photon interactions near the ends of the crystal while the logarithm algorithm was better near the center. These results provide useful guidance in DER DOI detector design in choosing the crystal surface finishing and DOI calculation methods. (paper)

Simultaneous Retrieval of Aerosol and Surface Optical Properties from Combined Airborne- and Ground-Based Direct and Diffuse Radiometric Measurements

Science.gov (United States)

Gatebe, C. K.; Dubovik, O.; King, M. D.; Sinyuk, A.

2010-01-01

This paper presents a new method for simultaneously retrieving aerosol and surface reflectance properties from combined airborne and ground-based direct and diffuse radiometric measurements. The method is based on the standard Aerosol Robotic Network (AERONET) method for retrieving aerosol size distribution, complex index of refraction, and single scattering albedo, but modified to retrieve aerosol properties in two layers, below and above the aircraft, and parameters on surface optical properties from combined datasets (Cloud Absorption Radiometer (CAR) and AERONET data). A key advantage of this method is the inversion of all available spectral and angular data at the same time, while accounting for the influence of noise in the inversion procedure using statistical optimization. The wide spectral (0.34-2.30 m) and angular range (180 ) of the CAR instrument, combined with observations from an AERONET sunphotometer, provide sufficient measurement constraints for characterizing aerosol and surface properties with minimal assumptions. The robustness of the method was tested on observations made during four different field campaigns: (a) the Southern African Regional Science Initiative 2000 over Mongu, Zambia, (b) the Intercontinental Transport Experiment-Phase B over Mexico City, Mexico (c) Cloud and Land Surface Interaction Campaign over the Atmospheric Radiation Measurement (ARM) Central Facility, Oklahoma, USA, and (d) the Arctic Research of the Composition of the Troposphere from Aircraft and Satellites (ARCTAS) over Elson Lagoon in Barrow, Alaska, USA. The four areas are dominated by different surface characteristics and aerosol types, and therefore provide good test cases for the new inversion method.

Morphometric partitioning of the respiratory surface area and diffusion capacity of the gills and swim bladder in juvenile Amazonian air-breathing fish, Arapaima gigas.

Science.gov (United States)

Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin

2012-09-01

The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.

Similarity scaling of surface-released smoke plumes

DEFF Research Database (Denmark)

Mikkelsen, T.; Ejsing Jørgensen, Hans; Nielsen, M.

2002-01-01

Concentration fluctuation data from surface-layer released smoke plumes have been investigated with the purpose of finding suitable scaling parameters for the corresponding two-particle, relative diffusion process. Dispersion properties have been measured at downwind ranges between 0.1 and 1 km...... from a continuous, neutrally buoyant ground level source. A combination of SF6 and chemical smoke (aerosols) was used as tracer. Instantaneous crosswind concentration profiles of high temporal (up to 55 Hz) and spatial resolution (down to 0.375 m) were obtained from aerosol-backscatter Lidar detection...... and duration statistics. The diffusion experiments were accompanied by detailed in-situ micrometeorological mean and turbulence measurements. In this paper, a new distance-neighbour function for surface-released smoke plumes is proposed, accompanied by experimental evidence in its support. The new distance...

Coal surface structure and thermodynamics. Final report

Energy Technology Data Exchange (ETDEWEB)

Larsen, J.W.; Wernett, P.C.; Glass, A.S.; Quay, D.; Roberts, J.

1994-05-01

Coals surfaces were studied using static surface adsorption measurements, low angle x-ray scattering (LAXS), inverse gas chromatography (IGC) and a new {sup 13}C NMR relaxation technique. A comparison of surface areas determined by hydrocarbon gas adsorption and LAXS led to the twin conclusions that the hydrocarbons had to diffuse through the solid to reach isolated pores and that the coal pores do not form interconnected networks, but are largely isolated. This conclusion was confirmed when IGC data for small hydrocarbons showed no discontinuities in their size dependence as usually observed with porous solids. IGC is capable of providing adsorption thermodynamics of gases on coal surfaces. The interactions of non-polar molecules and coal surfaces are directly proportioned to the gas molecular polarizability. For bases, the adsorption enthalpy is equal to the polarizability interaction plus the heat of hydrogen bond formation with phenol. Amphoteric molecules have more complex interactions. Mineral matter can have highly specific effects on surface interactions, but with most of the molecules studied is not an important factor.

Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

International Nuclear Information System (INIS)

Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

2010-01-01

This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

Surface desorption and bulk diffusion models of tritium release from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles

Energy Technology Data Exchange (ETDEWEB)

Avila, R.E., E-mail: ravila@cchen.c [Departamento de Materiales Nucleares, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile); Pena, L.A.; Jimenez, J.C. [Departamento de Produccion y Servicios, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile)

2010-10-30

The release of tritium from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles, in batch experiments, is studied by means of temperature programmed desorption. Data reduction focuses on the analysis of the non-oxidized and oxidized tritium components in terms of release limited by diffusion from the bulk of ceramic grains, or by first or second order surface desorption. By analytical and numerical methods the in-furnace tritium release is deconvoluted from the ionization chamber transfer functions, for which a semi-empirical form is established. The release from Li{sub 2}TiO{sub 3} follows second order desorption kinetics, requiring a temperature for a residence time of 1 day (T{sub 1dRes}) of 620 K, and 603 K, of the non-oxidized, and the oxidized components, respectively. The release from Li{sub 2}ZrO{sub 3} appears as limited by either diffusion from the bulk of the ceramic grains, or by first order surface desorption, the first possibility being the more probable. The respective values of T{sub 1dRes} for the non-oxidized component are 661 K, according to the first order surface desorption model, and 735 K within the bulk diffusion limited model.

Scattering of x-ray from crystal surfaces

International Nuclear Information System (INIS)

Andrews, S.R.; Cowley, R.A.

1985-01-01

X-ray measurements performed on a variety of materials demonstrate that it is possible to observe diffuse scattering that originates in the abrupt change of density at a crystal surface. Such a discontinuity gives rise, in general, to rods of scattering in reciprocal space which are most intense close to the Bragg peaks tau and are well defined for sufficiently smooth surfaces. For wave-vector transfer Q=tau+q the q-dependence of the intensity of scattering gives information on the topographic structure of the crystal surface. Experimental results on crystals of GaAs and KTaO 3 , with surfaces prepared in various ways, were obtained using conventional x-ray techniques with a rotating anode source and can be described by a continuum model of the surface. There are discrepancies between the predictions of the models and the experimental results and the suggest that further experiments are needed to achieve a more complete understanding. (author)

Surface resistivity measurement of plasma treated polymers

International Nuclear Information System (INIS)

Simon, D.; Pigram, P.J.; Liesegang, J.

2000-01-01

Full text: Resistivity of insulators is an important property of materials used within the integrated circuit and packaging industries. The measurement of electrical resistivity of insulator materials in the surface region in this work is interpreted through observations of surface charge decay. A self-field driven and diffusion charge transport theory is used to model the process and resistivity values obtained computationally. Data for the charge decay of surface charged samples are collected by suspending them inside a coaxial cylinder connected to an electrometer. Samples used have been low density polyethylene LDPE sheet, both pristine and surface treated. Some samples have been treated by air plasma at low vacuum pressures for different periods of time; others have been washed in ethyl acetate and then plasma treated before the resistivity measurement. The sets of resistivity measurements form the various treatments are compared below. X-ray photoelectron spectroscopy (XPS) has also been used to investigate and account for the observed variations in surface resistivity

Surface studies of feldspar dissolution using surface replication combined with electron microscopic and spectroscopic techniques

Energy Technology Data Exchange (ETDEWEB)

Fung, P C [Petro-Canada, Calgary, Alberta; Sanipelli, G G

1982-04-01

The replica of a microcline cleavage surface was examined before and at various stages of interaction with water and acid solutions at 70/sup 0/C, as part of basic geochemical research for the Canadian Nuclear Fuel Waste Management Program to investigate the feasibility of disposal of these wastes in repositories mined in crystalline rocks. The objective of the report presented was to investigate the mechanism for Al and Si removal during incongruent dissolution of feldspars and its effect on dissolution rate. It was found that phase transformation, like dissolution occured preferentially along crystal defects on the surfaces of the feldspars. Secondary minerals always occured as discrete particles occupying only a very small fraction of the total parent surface, and hence, their presence would not affect the bulk composition or, in this regard, the overall dissolution rate of the feldspars by the formation of diffusion barriers.

Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

Science.gov (United States)

Lai, King C.; Liu, Da-Jiang; Evans, James W.

2017-12-01

For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.

Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

International Nuclear Information System (INIS)

Ma, Shu-Cui; Wang, Zhi-Gang; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia

2015-01-01

Highlights: • To examine surface hydroxyl functional groups of the calcined diatomite by TGA-DSC, FTIR, and XPS. • To calculate the optimized log K 1 , log K 2 and log C values and the surface species distribution of each surface reactive site using ProtoFit and PHREEQC, respectively. - Abstract: The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation–deprotonation behavior was determined by continuous acid–base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m 2 /g and large numbers of surface hydroxyl functional groups (i.e. ≡Si-OH, ≡Fe-OH, and ≡Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K 1 , log K 2 ) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation–deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent

Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

Energy Technology Data Exchange (ETDEWEB)

Ma, Shu-Cui [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Key Laboratory of Applied Chemistry and Nanotechnology at Universities of Jilin Province, Changchun University of Science and Technology, Changchun 130022 (China); Wang, Zhi-Gang [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Zhang, Ji-Lin, E-mail: zjl@ciac.ac.cn [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Sun, De-Hui [Changchun Institute Technology, Changchun 130012 (China); Liu, Gui-Xia, E-mail: liuguixia22@163.com [Key Laboratory of Applied Chemistry and Nanotechnology at Universities of Jilin Province, Changchun University of Science and Technology, Changchun 130022 (China)

2015-02-01

Highlights: • To examine surface hydroxyl functional groups of the calcined diatomite by TGA-DSC, FTIR, and XPS. • To calculate the optimized log K{sub 1}, log K{sub 2} and log C values and the surface species distribution of each surface reactive site using ProtoFit and PHREEQC, respectively. - Abstract: The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation–deprotonation behavior was determined by continuous acid–base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m{sup 2}/g and large numbers of surface hydroxyl functional groups (i.e. ≡Si-OH, ≡Fe-OH, and ≡Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K{sub 1}, log K{sub 2}) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation–deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent.

Effects of diffusion and surface interactions on the line shape of electron paramagnetic resonances in the presence of a magnetic field gradient

International Nuclear Information System (INIS)

Schaden, M.; Zhao, K. F.; Wu, Z.

2007-01-01

In an evanescent wave magnetometer the Zeeman polarization is probed at micrometer to submicrometer distances from the cell surface. The electron paramagnetic resonance lines of an evanescent wave magnetometer in the presence of a magnetic field gradient exhibit edge enhancement seen previously in nuclear magnetic resonance lines. We present a theoretical model that describes quantitatively the shape of the magnetic resonance lines of an evanescent wave magnetometer under a wide range of experimental conditions. It accounts for diffusion broadening in the presence of a magnetic field gradient as well as interactions of spin polarized Rb atoms with the coated Pyrex glass surfaces. Depending on the field gradient, cell thickness, and buffer gas pressure, the resonance line may have the form of a single asymmetric peak or two peaks localized near the front and back surfaces in frequency space. The double-peaked response depends on average characteristics of the surface interactions. Its shape is sensitive to the dwell time, relaxation probability, and average phase shift of adsorbed spin polarized Rb atoms

Spontaneous formation of optically induced surface relief gratings

Energy Technology Data Exchange (ETDEWEB)

Leblond, H; Barille, R; Ahmadi-Kandjani, S; Nunzi, J-M [Laboratoire POMA, Universite d' Angers, CNRS FRE 2988, 2, Bd Lavoisier, 49045 Angers (France); Ortyl, E; Kucharski, S, E-mail: herve.leblond@univ-angers.f [Wroclaw University of Technology, Faculty of Chemistry, Department of Polymer Engineering and Technology, 50-370 Wroclaw (Poland)

2009-10-28

We develop a model based on Fick's law of diffusion as a phenomenological description of the molecular motion, and on the coupled mode theory, to describe single-beam surface relief grating formation in azopolymer thin films. The model allows us to explain the mechanism of spontaneous patterning, and self-organization. It allows us to compute the surface relief profile and its evolution, with good agreement with experiments.

Finite Element Methods On Very Large, Dynamic Tubular Grid Encoded Implicit Surfaces

DEFF Research Database (Denmark)

Nemitz, Oliver; Nielsen, Michael Bang; Rumpf, Martin

2009-01-01

dynamic tubular grid encoding format for a narrow band. A reaction diffusion model on a fixed surface and surface evolution driven by a nonlinear geometric diffusion approach, by isotropic or truly anisotropic curvature motion, are investigated as characteristic model problems. The proposed methods...

Mathematical modeling of synthesis gas fueled electrochemistry and transport including H2/CO co-oxidation and surface diffusion in solid oxide fuel cell

Science.gov (United States)

Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin

2015-10-01

Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.

Simple surface modification of poly(dimethylsiloxane) for DNA hybridization

Science.gov (United States)

Zhou, Jinwen; Voelcker, Nicolas H.; Ellis, Amanda V.

2010-01-01

Here, we present a simple chemical modification of poly(dimethylsiloxane) (PDMS) by curing a mixture of 2 wt% undecylenic acid (UDA) in PDMS prepolymer on a gold-coated glass slide. This gold slide had been previously pretreated with a self-assembled hydrophilic monolayer of 3-mercaptopropionic acid (MPA). During curing of the UDA∕PDMS prepolymer, the hydrophilic UDA carboxyl moieties diffuses toward the hydrophilic MPA carboxyl moieties on the gold surface. This diffusion of the UDA within the PDMS prepolymer to the surface is a direct result of surface energy minimization. Once completely cured, the PDMS is peeled off the gold substrate, thereby exposing the interfacial carboxyl groups. These groups are then available for subsequent attachment of 5′-amino terminated DNA oligonucleotides via amide linkages. Our results show that the covalently tethered oligonucleotides can successfully capture fluorescein-labeled complementary oligonucleotides via hybridization, which are visualized using fluorescence microscopy. PMID:21264061

Effect of substrate surface on electromigration-induced sliding at hetero-interfaces

International Nuclear Information System (INIS)

Kumar, Praveen; Dutta, Indranath

2013-01-01

Electromigration (EM)-induced interfacial sliding between a metal film and Si substrate occurs when (i) only few grains exist across the width of the film and (ii) diffusivity through the interfacial region is significantly greater than diffusivity through the film. Here, the effect of the substrate surface layer on the kinetics of EM-induced interfacial sliding is assessed using Si substrates coated with various thin film interlayers. The kinetics of interfacial sliding, and therefore the EM-driven mass flow rate, strongly depends on the type of the interlayer (and hence the substrate surface composition), such that strongly bonded interfaces with slower interfacial diffusivity produce slower sliding. (paper)

Surface Water Protection by Productive Buffers

DEFF Research Database (Denmark)

Christen, Benjamin

Vegetated riparian buffer zones are a widely recommended best management practice in agriculture for protecting surface and coastal waters from diffuse nutrient pollution. On the background of the EU funded research project NitroEurope (NEU; www.NitroEurope.eu), this study concentrates...... on the mitigation of nitrogen pollution in surface and groundwater, using riparian buffer zones for biomass production. The objectives are to map suitable areas for buffer implementation across the six NEU study landscapes, model tentative N-loss mitigation, calculate biomass production potential and economic...... designed for local conditions could be a way of protecting water quality attractive to many stakeholders....

Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

Science.gov (United States)

Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

2006-12-01

Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

International Nuclear Information System (INIS)

Singh, Gyanendra; Mehta, Dalip Singh

2013-01-01

We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

The Importance Of Surface Topography For The Biological Properties Of Nitrided Diffusion Layers Produced On Ti6Al4V Titanium Alloy

Directory of Open Access Journals (Sweden)

Wierzchoń T.

2015-09-01

Full Text Available Diffusion nitrided layers produced on titanium and its alloys are widely studied in terms of their application for cardiac and bone implants. The influence of the structure, the phase composition, topography and surface morphology on their biological properties is being investigated. The article presents the results of a study of the topography (nanotopography of the surface of TiN+Ti2N+αTi(N nitrided layers produced in low-temperature plasma on Ti6Al4V titanium alloy and their influence on the adhesion of blood platelets and their aggregates. The TEM microstructure of the produced layers have been examined and it was demonstrated that the interaction between platelets and the surface of the titanium implants subjected to glow-discharge nitriding can be shaped via modification of the roughness parameters of the external layer of the TiN titanium nitride nanocrystalline zone.

Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

Directory of Open Access Journals (Sweden)

Xi Shao

2016-03-01

Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

International Nuclear Information System (INIS)

Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

1976-01-01

Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

Self-diffusion on (100), (110), and (111) surfaces of Ni and Cu: A detailed study of prefactors and activation energies

International Nuclear Information System (INIS)

Ku'rpick, Ulrike

2001-01-01

We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values

Evaporation kinetics of sessile water droplets on micropillared superhydrophobic surfaces.

Science.gov (United States)

Xu, Wei; Leeladhar, Rajesh; Kang, Yong Tae; Choi, Chang-Hwan

2013-05-21

Evaporation modes and kinetics of sessile droplets of water on micropillared superhydrophobic surfaces are experimentally investigated. The results show that a constant contact radius (CCR) mode and a constant contact angle (CCA) mode are two dominating evaporation modes during droplet evaporation on the superhydrophobic surfaces. With the decrease in the solid fraction of the superhydrophobic surfaces, the duration of a CCR mode is reduced and that of a CCA mode is increased. Compared to Rowan's kinetic model, which is based on the vapor diffusion across the droplet boundary, the change in a contact angle in a CCR (pinned) mode shows a remarkable deviation, decreasing at a slower rate on the superhydrophobic surfaces with less-solid fractions. In a CCA (receding) mode, the change in a contact radius agrees well with the theoretical expectation, and the receding speed is slower on the superhydrophobic surfaces with lower solid fractions. The discrepancy between experimental results and Rowan's model is attributed to the initial large contact angle of a droplet on superhydrophobic surfaces. The droplet geometry with a large contact angle results in a narrow wedge region of air along the contact boundary, where the liquid-vapor diffusion is significantly restricted. Such an effect becomes minor as the evaporation proceeds with the decrease in a contact angle. In both the CCR and CCA modes, the evaporative mass transfer shows the linear relationship between mass(2/3) and evaporation time. However, the evaporation rate is slower on the superhydrophobic surfaces, which is more significant on the surfaces with lower solid fractions. As a result, the superhydrophobic surfaces slow down the drying process of a sessile droplet on them.

Capillary condensation of water between mica surfaces above and below zero-effect of surface ions.

Science.gov (United States)

Nowak, Dominika; Christenson, Hugo K

2009-09-01

We have studied the capillary condensation of water from saturated vapor below 0 degrees C in the annular wedge-pore formed around two mica surfaces in contact in a surface force apparatus. The condensed water remains liquid down to at least -9 degrees C, and the measured condensate size is close to the predictions of a recent model for the dependence of the interfacial curvature of supercooled capillary condensates on temperature and surface tension. The small deviation observed may be accounted for by assuming that solute as K(2)CO(3) from the mica-condensate interface dissolves in the condensates and gives rise to an additional depression of the freezing point apart from that caused by the interface curvature. By contrast, measurements of the interface curvature at relative vapor pressures of 0.95-0.99 at 20 degrees C confirm a significantly larger deviation from the Kelvin equation. The magnitude of the deviation is in remarkable agreement with that calculated from the results of an earlier study of capillary condensation of water from a nonpolar liquid, also at T = 20 degrees C. Evidently, additional solute from the surrounding mica surface migrates into the condensates at room temperature. We conclude that the surface diffusion of ions on mica is much slower at subzero temperatures than at room temperature.

Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

Science.gov (United States)

Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

2014-03-01

Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

CHEMICAL REACTIONS ON ADSORBING SURFACE: KINETIC LEVEL OF DESCRIPTION

Directory of Open Access Journals (Sweden)

P.P.Kostrobii

2003-01-01

Full Text Available Based on the effective Hubbard model we suggest a statistical description of reaction-diffusion processes for bimolecular chemical reactions of gas particles adsorbed on the metallic surface. The system of transport equations for description of particles diffusion as well as reactions is obtained. We carry out the analysis of the contributions of all physical processes to the formation of diffusion coefficients and chemical reactions constants.

Surface characterization of self-assembled N-Cu nanostructures

Energy Technology Data Exchange (ETDEWEB)

Cristina, Lucila J.; Moreno-Lopez, Juan C. [Laboratorio de Superficies e Interfaces, Instituto de Desarrollo Tecnologico para la Industria Quimica (CONICET-UNL), Gueemes 3450, (S3000GLN) Santa Fe (Argentina); Sferco, Silvano J. [Laboratorio de Superficies e Interfaces, Instituto de Desarrollo Tecnologico para la Industria Quimica (CONICET-UNL), Gueemes 3450, (S3000GLN) Santa Fe (Argentina); Departamento de Fisica, Facultad de Bioquimica y Ciencias Biologicas, Universidad Nacional del Litoral, Ciudad Universitaria, C.C. 242, (S3000ZAA) Santa Fe (Argentina); Passeggi, Mario C.G.; Vidal, Ricardo A. [Laboratorio de Superficies e Interfaces, Instituto de Desarrollo Tecnologico para la Industria Quimica (CONICET-UNL), Gueemes 3450, (S3000GLN) Santa Fe (Argentina); Ferron, Julio, E-mail: jferron@intec.unl.edu.ar [Laboratorio de Superficies e Interfaces, Instituto de Desarrollo Tecnologico para la Industria Quimica (CONICET-UNL), Gueemes 3450, (S3000GLN) Santa Fe (Argentina); Departamento de Materiales, Facultad de Ingenieria Quimica, Universidad Nacional del Litoral, Santiago del Estero 2829,(S3000AOM) Santa Fe (Argentina)

2012-01-01

We report on the process of low energy N{sub 2}{sup +} implantation and annealing of a Cu(0 0 1) surface. Through AES we study the N diffusion process as a function of the substrate temperature. With STM and LEIS we characterize the surface morphology and the electronic structure is analyzed with ARUPS. Under annealing (500 < T < 700 K) N migrates to the surface and reacts forming a Cu{sub x}N compound that decomposes at temperatures above 700 K. LEIS measurements show that N locates on the four-fold hollow sites of the Cu(0 0 1) surface in a c(2 Multiplication-Sign 2) arrangement. Finally, a gap along the [0 0 1] azimuthal direction is determined by ARUPS. DFT calculations provide support to our conclusions.

Beneficial Effect of Surface Decorations on the Surface Exchange of Lanthanum Strontium Ferrite and Dual Phase Composites

DEFF Research Database (Denmark)

Ovtar, Simona; Søgaard, Martin; Song, Jia

2016-01-01

. These perovskites possess a mixed ionic and electronic conductivity (MIEC), which can be highly beneficial for the processes on oxygen electrode surfaces. The oxygen transport through a MIEC is determined by the rate of the oxygen exchange over the gas-solid interface and the diffusivity of oxide ions and electrons...

X-ray scattering studies of surfaces and interfaces

International Nuclear Information System (INIS)

Sanyal, M.K.

1998-01-01

Here we shall briefly review the basics and some applications of x-ray specular reflectivity and diffuse scattering techniques. These x-ray scattering techniques are uniquely suited to study of the structure of surfaces and interfaces at atomic resolutions as they are nondestructive and can probe even interfaces which are buried. The study of structure of surfaces and interfaces is not only required in understanding physics in reduced dimensions but is also essential in developing technologically important materials

Density functional theory study of hydrogenation mechanism in Fe-doped Mg(0 0 0 1) surface

International Nuclear Information System (INIS)

Wu Guangxin; Zhang Jieyu; Wu Yongquan; Li Qian; Chou Kuochih; Bao Xinhua

2009-01-01

Using density functional theory (DFT) in combination with nudged elastic band (NEB) method, the dissociative chemisorptions and diffusion processes of hydrogen on both pure and Fe-doped Mg(0 0 0 1) surfaces are studied. Firstly, the dissociation pathway of H 2 and the relative barrier were investigated. The calculated dissociation barrier (1.08 eV) of hydrogen molecule on a pure Mg(0 0 0 1) surface is in good agreement with comparable experimental and theoretical studies. For the Fe-doped Mg(0 0 0 1) surface, the activated barrier decreases to 0.101 eV due to the strong interaction between the s orbital of H and the d orbital of Fe. Then, the diffusion processes of atomic hydrogen on pure and Fe-doped Mg(0 0 0 1) are presented. The obtained diffusion barrier to the first subsurface is 0.45 eV and 0.98 eV, respectively. Finally, Chou method was used to investigate the hydrogen sorption kinetic mechanism of pure MgH 2 and Mg mixed with 5 at.% Fe atoms composites. The obtained activation energies are 0.87 ± 0.02 and 0.31 ± 0.01 eV for H 2 dissociation on the pure surface and H atom diffusion in Fe-doped Mg surfaces, respectively. It suggests that the rate-controlling step is dissociation of H 2 on the pure Mg surface while it is diffusion of H atom in the Fe-doped Mg surface. And both of fitting data are matching well with our calculation results.

A thermal spike analysis of low energy ion activated surface processes

International Nuclear Information System (INIS)

Gilmore, G.M.; Haeri, A.; Sprague, J.A.

1989-01-01

This paper reports a thermal spike analysis utilized to predict the time evolution of energy propagation through a solid resulting from energetic particle impact. An analytical solution was developed that can predict the number of surface excitations such as desorption, diffusion or chemical reaction activated by an energetic particle. The analytical solution is limited to substrates at zero Kelvin and to materials with constant thermal diffusivities. These limitations were removed by developing a computer numerical integration of the propagation of the thermal spike through the solid and the subsequent activation of surface processes

CFD simulation of simultaneous monotonic cooling and surface heat transfer coefficient

International Nuclear Information System (INIS)

Mihálka, Peter; Matiašovský, Peter

2016-01-01

The monotonic heating regime method for determination of thermal diffusivity is based on the analysis of an unsteady-state (stabilised) thermal process characterised by an independence of the space-time temperature distribution on initial conditions. At the first kind of the monotonic regime a sample of simple geometry is heated / cooled at constant ambient temperature. The determination of thermal diffusivity requires the determination rate of a temperature change and simultaneous determination of the first eigenvalue. According to a characteristic equation the first eigenvalue is a function of the Biot number defined by a surface heat transfer coefficient and thermal conductivity of an analysed material. Knowing the surface heat transfer coefficient and the first eigenvalue the thermal conductivity can be determined. The surface heat transport coefficient during the monotonic regime can be determined by the continuous measurement of long-wave radiation heat flow and the photoelectric measurement of the air refractive index gradient in a boundary layer. CFD simulation of the cooling process was carried out to analyse local convective and radiative heat transfer coefficients more in detail. Influence of ambient air flow was analysed. The obtained eigenvalues and corresponding surface heat transfer coefficient values enable to determine thermal conductivity of the analysed specimen together with its thermal diffusivity during a monotonic heating regime.

Structured light optical microscopy for three-dimensional reconstruction of technical surfaces

Science.gov (United States)

Kettel, Johannes; Reinecke, Holger; Müller, Claas

2016-04-01

In microsystems technology quality control of micro structured surfaces with different surface properties is playing an ever more important role. The process of quality control incorporates three-dimensional (3D) reconstruction of specularand diffusive reflecting technical surfaces. Due to the demand on high measurement accuracy and data acquisition rates, structured light optical microscopy has become a valuable solution to solve this problem providing high vertical and lateral resolution. However, 3D reconstruction of specular reflecting technical surfaces still remains a challenge to optical measurement principles. In this paper we present a measurement principle based on structured light optical microscopy which enables 3D reconstruction of specular- and diffusive reflecting technical surfaces. It is realized using two light paths of a stereo microscope equipped with different magnification levels. The right optical path of the stereo microscope is used to project structured light onto the object surface. The left optical path is used to capture the structured illuminated object surface with a camera. Structured light patterns are generated by a Digital Light Processing (DLP) device in combination with a high power Light Emitting Diode (LED). Structured light patterns are realized as a matrix of discrete light spots to illuminate defined areas on the object surface. The introduced measurement principle is based on multiple and parallel processed point measurements. Analysis of the measured Point Spread Function (PSF) by pattern recognition and model fitting algorithms enables the precise calculation of 3D coordinates. Using exemplary technical surfaces we demonstrate the successful application of our measurement principle.

New sensitive micro-measurements of dynamic surface tension and diffusion coefficients: Validated and tested for the adsorption of 1-Octanol at a microscopic air-water interface and its dissolution into water.

Science.gov (United States)

Kinoshita, Koji; Parra, Elisa; Needham, David

2017-02-15

Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain "dead time" at initial measurement. These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the "micropipette interfacial area-expansion method" was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion controlled molecular adsorption at the air-water interfaces. To validate the new technique, the diffusion coefficient of 1-Octanol in water was investigated with existing models: the Ward Tordai model for the long time adsorption regime (1-100s), and the Langmuir and Frumkin adsorption isotherm models for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2±0.8×10 -6 cm 2 /s, showed excellent agreement with the result from an alternative method, "single microdroplet catching method", to measure the diffusion coefficient from diffusion-controlled microdroplet dissolution, 7.3±0.1×10 -6 cm 2 /s. These new techniques for determining adsorption and diffusion coefficients can apply for a range of surface active molecules, especially the less-characterized ionic surfactants, and biological compounds such as lipids, peptides, and proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Surface Wettability of Oxygen Plasma Treated Porous Silicon

Directory of Open Access Journals (Sweden)

Lei Jiang

2014-01-01

Full Text Available Oxygen plasma treatment on porous silicon (p-Si surfaces was studied as a practical and effective means to modify wetting properties of as-fabricated p-Si surfaces, that is, contact angles of the p-Si materials. P-Si samples spanning a wide range of surface nanostructures have been fabricated which were subjected to a series of oxygen plasma treatments. Reduction of the p-Si surface contact angles has been systematically observed, and the surface activation rate constant as a function of different pore geometries has been analyzed to achieve an empirical equation. The underlying diffusion mechanisms have been discussed by taking into account of different pore diameters of p-Si samples. It is envisaged that such an approach as well as the corresponding empirical equation may be used to provide relevant process guidance in order to achieve precise control of p-Si contact angles, which is essential for many p-Si applications especially in biosensor areas.

The impact of changes in parameterizations of surface drag and vertical diffusion on the large-scale circulation in the Community Atmosphere Model (CAM5)

Science.gov (United States)

Lindvall, Jenny; Svensson, Gunilla; Caballero, Rodrigo

2017-06-01

Simulations with the Community Atmosphere Model version 5 (CAM5) are used to analyze the sensitivity of the large-scale circulation to changes in parameterizations of orographic surface drag and vertical diffusion. Many GCMs and NWP models use enhanced turbulent mixing in stable conditions to improve simulations, while CAM5 cuts off all turbulence at high stabilities and instead employs a strong orographic surface stress parameterization, known as turbulent mountain stress (TMS). TMS completely dominates the surface stress over land and reduces the near-surface wind speeds compared to simulations without TMS. It is found that TMS is generally beneficial for the large-scale circulation as it improves zonal wind speeds, Arctic sea level pressure and zonal anomalies of the 500-hPa stream function, compared to ERA-Interim. It also alleviates atmospheric blocking frequency biases in the Northern Hemisphere. Using a scheme that instead allows for a modest increase of turbulent diffusion at higher stabilities only in the planetary boundary layer (PBL) appears to in some aspects have a similar, although much smaller, beneficial effect as TMS. Enhanced mixing throughout the atmospheric column, however, degrades the CAM5 simulation. Evaluating the simulations in comparison with detailed measurements at two locations reveals that TMS is detrimental for the PBL at the flat grassland ARM Southern Great Plains site, giving too strong wind turning and too deep PBLs. At the Sodankylä forest site, the effect of TMS is smaller due to the larger local vegetation roughness. At both sites, all simulations substantially overestimate the boundary layer ageostrophic flow.

Surface dynamics of micellar diblock copolymer films

Science.gov (United States)

Song, Sanghoon; Cha, Wonsuk; Kim, Hyunjung; Jiang, Zhang; Narayanan, Suresh

2011-03-01

We studied the structure and surface dynamics of poly(styrene)-b-poly(dimethylsiloxane) (PS-b-PDMS) diblock copolymer films with micellar PDMS surrounded by PS shells. By `in-situ' high resolution synchrotron x-ray reflectivity and diffuse scattering, we obtained exact thickness, electron density and surface tension. A segregation layer near the top surface was appeared with increasing temperature Surface dynamics were measured as a function of film thickness and temperature by x-ray photon correlation spectroscopy. The best fit to relaxation time constants as a function of in-plane wavevectors were analyzed with a theory based on capillary waves with hydrodynamics with bilayer model Finally the viscosities for the top segregated layer as well as for the bottom layer are obtained at given temperatures This work was supported by National Research Foundation of Korea (R15-2008-006-01001-0), Seoul Research and Business Development Program (10816), and Sogang University Research Grant (2010).

Surface energy of very neutron rich nuclei

CERN Document Server

Von Groote, H

1976-01-01

For a microscopic model calculation of the nuclear surface-energy coefficient sigma the surface energy is defined as the energy loss of an uncharged, semiinfinite (inhomogeneous) two-component system compared to an infinite (homogeneous) system with the same particle asymmetry delta . Using the Thomas-Fermi model the calculations are performed for a series of systems with increasing delta , starting from symmetric matter ( delta =0) and extending beyond the drip line of the neutrons, until the system undergoes a phase transition to a homogeneous system. The results for the surface energy as well as for the neutron skin and for the surface diffuseness are compared to the macroscopic approach of the Droplet Model (DM), which turns out to be a good approximation for small asymmetries typical for the region of the valley of beta -stability. For larger asymmetries, close to the drip lines, terms of higher order than contained in the DM approach are no longer negligible. Beyond the drip lines the pressure of the ou...

Surface Water & Surface Drainage

Data.gov (United States)

Earth Data Analysis Center, University of New Mexico — This data set contains boundaries for all surface water and surface drainage for the state of New Mexico. It is in a vector digital data structure digitized from a...

Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

International Nuclear Information System (INIS)

Kutovyi, V.A.; Komir, A.I.

2013-01-01

The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

Irreversible adsorption of particles on heterogeneous surfaces.

Science.gov (United States)

Adamczyk, Zbigniew; Jaszczółt, Katarzyna; Michna, Aneta; Siwek, Barbara; Szyk-Warszyńska, Lilianna; Zembala, Maria

2005-12-30

Methods of theoretical and experimental evaluation of irreversible adsorption of particles, e.g., colloids and globular proteins at heterogeneous surfaces were reviewed. The theoretical models were based on the generalized random sequential adsorption (RSA) approach. Within the scope of these models, localized adsorption of particles occurring as a result of short-ranged attractive interactions with discrete adsorption sites was analyzed. Monte-Carlo type simulations performed according to this model enabled one to determine the initial flux, adsorption kinetics, jamming coverage and the structure of the particle monolayer as a function of the site coverage and the particle/site size ratio, denoted by lambda. It was revealed that the initial flux increased significantly with the site coverage theta(s) and the lambda parameter. This behavior was quantitatively interpreted in terms of the scaled particle theory. It also was demonstrated that particle adsorption kinetics and the jamming coverage increased significantly, at fixed site coverage, when the lambda parameter increased. Practically, for alpha = lambda2theta(s) > 1 the jamming coverage at the heterogeneous surfaces attained the value pertinent to continuous surfaces. The results obtained prove unequivocally that spherically shaped sites were more efficient in binding particles in comparison with disk-shaped sites. It also was predicted that for particle size ratio lambda charge. Particle deposition occurred under diffusion-controlled transport conditions and their coverage was evaluated by direct particle counting using the optical and electron microscopy. Adsorption kinetics was quantitatively interpreted in terms of numerical solutions of the governing diffusion equation with the non-linear boundary condition derived from Monte-Carlo simulations. It was proven that for site coverage as low as a few percent the initial flux at heterogeneous surfaces attained the maximum value pertinent to homogeneous

Surface Mediated Self-Assembly of Amyloid Peptides

Science.gov (United States)

Fakhraai, Zahra

2015-03-01

Amyloid fibrils have been considered as causative agents in many neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, type II diabetes and amyloidosis. Amyloid fibrils form when proteins or peptides misfold into one dimensional crystals of stacked beta-sheets. In solution, amyloid fibrils form through a nucleation and growth mechanism. The rate limiting nucleation step requires a critical concentration much larger than those measured in physiological conditions. As such the exact origins of the seeds or oligomers that result in the formation of fully mature fibrils in the body remain topic intense studies. It has been suggested that surfaces and interfaces can enhance the fibrillization rate. However, studies of the mechanism and kinetics of the surface-mediated fibrillization are technologically challenging due to the small size of the oligomer and protofibril species. Using smart sample preparation technique to dry the samples after various incubation times we are able to study the kinetics of fibril formation both in solution and in the vicinity of various surfaces using high-resolution atomic force microscopy. These studies elucidate the role of surfaces in catalyzing amyloid peptide formation through a nucleation-free process. The nucleation free self-assembly is rapid and requires much smaller concentrations of peptides or proteins. We show that this process resembles diffusion limited aggregation and is governed by the peptide adhesion rate, two -dimensional diffusion of the peptides on the surface, and preferential interactions between the peptides. These studies suggest an alternative pathway for amyloid formation may exist, which could lead to new criteria for disease prevention and alternative therapies. Research was partially supported by a seed grant from the National Institute of Aging of the National Institutes of Health (NIH) under Award Number P30AG010124 (PI: John Trojanowski) and the University of Pennsylvania.

Transmittance enhancement of sapphires with antireflective subwavelength grating patterned UV polymer surface structures by soft lithography.

Science.gov (United States)

Lee, Soo Hyun; Leem, Jung Woo; Yu, Jae Su

2013-12-02

We report the total and diffuse transmission enhancement of sapphires with the ultraviolet curable SU8 polymer surface structures consisting of conical subwavelength gratings (SWGs) at one- and both-side surfaces for different periods. The SWGs patterns on the silicon templates were transferred into the SU8 polymer film surface on sapphires by a simple and cost-effective soft lithography technique. For the fabricated samples, the surface morphologies, wetting behaviors, and optical characteristics were investigated. For theoretical optical analysis, a rigorous coupled-wave analysis method was used. At a period of 350 nm, the sample with SWGs on SU8 film/sapphire exhibited a hydrophobic surface and higher total transmittance compared to the bare sapphire over a wide wavelength of 450-1000 nm. As the period of SWGs was increased, the low total transmittance region of < 85% was shifted towards the longer wavelengths and became broader while the diffuse transmittance was increased (i.e., larger haze ratio). For the samples with SWGs at both-side surfaces, the total and diffuse transmittance spectra were further enhanced compared to the samples with SWGs at one-side surface. The theoretical optical calculation results showed a similar trend to the experimentally measured data.

Surface modification of polyethylene by diffuse barrier discharge plasma

Czech Academy of Sciences Publication Activity Database

Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

2013-01-01

Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

Functionalized granular activated carbon and surface complexation with chromates and bi-chromates in wastewater

International Nuclear Information System (INIS)

Singha, Somdutta; Sarkar, Ujjaini; Luharuka, Pallavi

2013-01-01

Cr(VI) is present in the aqueous medium as chromate (CrO 4 2− ) and bi-chromate (HCrO 4 − ). Functionalized granular activated carbons (FACs) are used as adsorbents in the treatment of wastewaters containing hexavalent chromium. The FACs are prepared by chemical modifications of granular activated carbons (GACs) using functionalizing agents like HNO 3 , HCl and HF. The Brunauer, Emmett and Teller surface areas of FAC-HCl (693.5 m 2 /g), FAC-HNO 3 (648.8 m 2 /g) and FAC-HF (726.2 m 2 /g) are comparable to the GAC (777.7 m 2 /g). But, the adsorption capacity of each of the FAC-HNO 3 , FAC-HCl and FAC-HF is found to be higher than the GAC. The functional groups play an important role in the adsorption process and pH has practically no role in this specific case. The FACs have hydrophilic protonated external surfaces in particular, along with the functional surface sites capable to make complexes with the CrO 4 2− and HCrO 4 − present. Surface complex formation is maximized in the order FAC-HNO 3 > FAC-HF > FAC-HCl, in proportion to the total surface acidity. This is also confirmed by the well-known pseudo second-order kinetic model. Physi-sorption equilibrium isotherms are parameterized by using standard Freundlich and Langmuir models. Langmuir fits better. The formation of surface complexes with the functional groups and hexavalent chromium is also revealed in the images of field emission scanning electron micrograph; energy dispersive X-ray spectroscopy and Fourier transform infrared spectroscopy analysis after adsorption. The intra-particle diffusion is not the only rate-controlling factor. The Boyd's film diffusion model fits very well with R 2 as high as 98.1% for FAC-HNO 3 . This result demonstrates that the functionalization of the GAC by acid treatments would increase the diffusion rate, predominantly with a boundary layer diffusion effect. - Highlights: ► Physico-chemical adsorption using functionalized activated carbon (FACs) is applied. ► FACs

Diffusion bonding

International Nuclear Information System (INIS)

Anderson, R.C.

1976-01-01

A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

Friction and surface chemistry of some ferrous-base metallic glasses

Science.gov (United States)

Miyoshi, K.; Buckley, D. H.

1982-01-01

The friction properties of some ferrous-base metallic glasses were measured both in argon and in vacuum to a temperature of 350 C. The alloy surfaces were also analyzed with X-ray photoelectron spectroscopy to identify the compounds and elements present on the surface. The results of the investigation indicate that even when the surfaces of the amorphous alloys, or metallic glasses, are atomically clean, bulk contaminants such as boric oxide and silicon dioxide diffuse to the surfaces. Friction measurements in both argon and vacuum indicate that the alloys exhibit higher coefficients of friction in the crystalline state than they do in the amorphous state.

Modification of rubber surface by UV surface grafting

International Nuclear Information System (INIS)

Shanmugharaj, A.M.; Kim, Jin Kuk; Ryu, Sung Hun

2006-01-01

Rubber surface is subjected to ultraviolet radiation (UV) in the presence of allylamine and radiation sensitizer benzophenone (BP). Fourier transform infrared spectral studies reveal the presence of allylamine on the surface. The presence of irregular needle shapes on the surface as observed in scanning electron micrographs also confirms the polymerized allylamine on the surface. Allylamine coatings have been further confirmed from atomic force microscopy (AFM) analysis. Thermogravimetric analysis (TGA) reveals that allylamine coating on the rubber surface lowers the thermal degradation rate. The contact angle between the water and rubber surface decreases for the modified rubber surface confirming the surface modification due to UV surface grafting

X-ray scattering at liquid surfaces and interfaces

International Nuclear Information System (INIS)

Daillant, Jean

2000-01-01

X-ray and neutron reflectivity techniques have become quite popular for the analysis of surfaces and interfaces over the last ten years. In this review, we discuss the specific aspects of both specular and diffuse x-ray reflectivity at liquid interfaces. We start from a model liquid surface for which the scattering cross-section can be calculated in terms of thermally excited capillary and acoustic waves, and we examine in detail the experimental consequences of the large bulk scattering and of the low q divergence of the surface scattering. Deviations from the simple calculated behaviour point to interesting phenomena which can be studied in detail, like the appearance of a bending stiffness. The method is illustrated through the discussion of representative studies of liquid surfaces, of surfactant monolayers, of liquid-liquid interfaces and of microemulsions. (author)

Surface Topography Hinders Bacterial Surface Motility.

Science.gov (United States)

Chang, Yow-Ren; Weeks, Eric R; Ducker, William A

2018-03-21

We demonstrate that the surface motility of the bacterium, Pseudomonas aeruginosa, is hindered by a crystalline hemispherical topography with wavelength in the range of 2-8 μm. The motility was determined by the analysis of time-lapse microscopy images of cells in a flowing growth medium maintained at 37 °C. The net displacement of bacteria over 5 min is much lower on surfaces containing 2-8 μm hemispheres than on flat topography, but displacement on the 1 μm hemispheres is not lower. That is, there is a threshold between 1 and 2 μm for response to the topography. Cells on the 4 μm hemispheres were more likely to travel parallel to the local crystal axis than in other directions. Cells on the 8 μm topography were less likely to travel across the crowns of the hemispheres and were also more likely to make 30°-50° turns than on flat surfaces. These results show that surface topography can act as a significant barrier to surface motility and may therefore hinder surface exploration by bacteria. Because surface exploration can be a part of the process whereby bacteria form colonies and seek nutrients, these results help to elucidate the mechanism by which surface topography hinders biofilm formation.

High-Density Infrared Surface Treatments of Refractories

Energy Technology Data Exchange (ETDEWEB)

Tiegs, T.N.

2005-03-31

Refractory materials play a crucial role in all energy-intensive industries and are truly a crosscutting technology for the Industries of the Future (IOF). One of the major mechanisms for the degradation of refractories and a general decrease in their performance has been the penetration and corrosion by molten metals or glass. Methods and materials that would reduce the penetration, wetting, and corrosive chemistry would significantly improve refractory performance and also maintain the quality of the processed liquid, be it metal or glass. This report presents the results of an R&D project aimed at investigating the use of high-density infrared (HDI) heating to surface treat refractories to improve their performance. The project was a joint effort between Oak Ridge National Laboratory (ORNL) and the University of Missouri-Rolla (UMR). HDI is capable of heating the near-surface region of materials to very high temperatures where sintering, diffusion, and melting can occur. The intended benefits of HDI processing of refractories were to (1) reduce surface porosity (by essentially sealing the surface to prevent liquid penetration), (2) allow surface chemistry changes to be performed by bonding an adherent coating onto the underlying refractory (in order to inhibit wetting and/or improve corrosion resistance), and (3) produce noncontact refractories with high-emissivity surface coatings.

A comparison of UV surface brightness and HI surface densities for spiral galaxies

International Nuclear Information System (INIS)

Federman, S.R.; Strom, C.

1990-01-01

Shaya and Federman (1987) suggested that the ambient ultraviolet flux at 1000 A permeating a spiral galaxy controls the neutral hydrogen (HI) surface density in the galaxy. They found that the atomic envelopes surrounding small molecular clouds, because of their great number, provide the major contribution to the HI surface density over the stellar disk. The increase in HI surface density with later Hubble types was ascribed to the stronger UV fields from more high-mass stars in later Hubble types. These hypotheses are based on the observations of nearby diffuse interstellar clouds, which show a sharp atomic-to-molecular transition (Savage et al. 1977), and on the theoretical framework introduced by Federman, Glassgold, and Kwan (1979). Atomic envelopes around interstellar clouds in the solar neighborhood arise when a steady state is reached between photodissociation of H2 and the formation of H2 on grains. The photodissociation process involves photons with wavelengths between 912 A and 1108 A. Shaya and Federman used H-alpha flux as an approximate measure for the far UV flux and made their comparisons based on averages over Hubble type. Here, researchers compare, on an individual basis, UV data obtained with space-borne and balloon-borne instruments for galaxies with measurements of HI surface density (Warmels 1988a, b). The comparisons substantiate the conclusion of Shaya and Federman that the far UV field controls the HI content of spiral galaxies

A versatile optical profilometer based on conoscopic holography sensors for acquisition of specular and diffusive surfaces in artworks

Science.gov (United States)

Gaburro, Nicola; Marchioro, Giacomo; Daffara, Claudia

2017-07-01

Surface metrology of artworks requires the design of suitable devices for in-situ non-destructive measurement together with reliable procedures for an effective analysis of such non-engineered variegate objects. To advance the state-of-the-art it has been implemented a versatile optical micro-profilometry taking advantage of the adapt- ability of conoscopic holography sensors, able to operate with irregular shapes and composite materials (diffusive, specular, and polychrome) of artworks. The scanning technique is used to obtain wide field and high spatially resolved areal profilometry. The prototype has a modular scheme based on a set of conoscopic sensors, extending the typical design based on a scanning stage and a single probe with a limited bandwidth, thus allowing the collection of heights data from surface with different scales and materials with variegate optical response. The system was optimized by characterizing the quality of the measurement with the probes triggered in continuous scanning modality. The results obtained on examples of cultural heritage objects (2D paintings, 3D height-relief) and materials (pictorial, metallic) demonstrate the versatility of the implemented device.

A density functional theory study of the TMG adsorption on the GaN surface

Energy Technology Data Exchange (ETDEWEB)

Ptasinska, Maria; Soltys, Jakub; Piechota, Jacek [Interdisciplinary Centre for Materials Modelling, University of Warsaw, ul. Pawinskiego 5a, 02-106 Warszawa (Poland); Krukowski, Stanislaw [Interdisciplinary Centre for Materials Modelling, University of Warsaw, ul. Pawinskiego 5a, 02-106 Warszawa (Poland); Institute of High Pressure Physics, Polish Academy of Sciences, ul. Sokolowska 29/37, 01-142 Warsaw (Poland)

2011-07-01

TMG (trimetylogallium) and NH{sub 3} (ammonia) are widely used reactants in the metal organic chemical vapor deposition (MOCVD) technique used in the growth of the GaN thin films. We have recently examined theoretically, with the help of the density functional theory (DFT), TMG adsorption on the GaN(0001) surface in order to study formation of bonds between Ga and N. Dangling bonds on the GaN(0001) surface were saturated with the hydrogen atoms. The slab polarization, which is due to the dangling bonds present on the GaN(0001) surface, and energy of the system in the vicinity of TMG was computed for different distances between the surface atoms and TMG. We also studied TMG diffusion on the GaN surface. As a result, the energy path for diffusion from Top N to Hollow was obtained.

Effect of Electropulsing-Assisted Ultrasonic Nanocrystalline Surface Modification on the Surface Mechanical Properties and Microstructure of Ti-6Al-4V Alloy

Science.gov (United States)

Ye, Yongda; Wang, Haibo; Tang, Guoyi; Song, Guolin

2018-05-01

The effect of electropulsing-assisted ultrasonic nanocrystalline surface modification (EP-UNSM) on surface mechanical properties and microstructure of Ti-6Al-4V alloy is investigated. Compared to conventional ultrasonic nanocrystalline surface modification (UNSM), EP-UNSM can effectively facilitate surface roughness and morphology, leading to excellent surface roughness (reduced from Ra 0.918 to Ra 0.028 μm by UNSM and Ra 0.019 μm by EP-UNSM) and smoother morphology with less cracks and defects. Surface friction coefficients are enhanced, resulting in lower and smoother friction coefficients. In addition, the surface-strengthened layer and ultra-refined grains are significantly enhanced with more severe plastic deformation and a greater surface hardness (a maximum hardness value of 407 HV and an effective depth of 550 μm, in comparison with the maximum hardness value of 364 HV and effective depth of 300 μm obtained by conventional UNSM). Remarkable enhancement of surface mechanical properties can be attributed to the refined gradient microstructure and the enhanced severe plastic deformation layer induced by coupling the effects of UNSM and electropulsing. The accelerated dislocation mobility and atom diffusion caused by the thermal and athermal effects of electropulsing treatment may be the primary intrinsic reasons for these improvements.

Measuring Light Reflectance of BGO Crystal Surfaces

Science.gov (United States)

Janecek, Martin; Moses, William W.

2008-10-01

A scintillating crystal's surface reflectance has to be well understood in order to accurately predict and optimize the crystal's light collection through Monte Carlo simulations. In this paper, we measure the inner surface reflectance properties for BGO. The measurements include BGO crystals with a mechanically polished surface, rough-cut surface, and chemically etched surface, and with various reflectors attached, both air-coupled and with coupling compound. The measurements are performed with a laser aimed at the center of a hemispherical shaped BGO crystal. The hemispherical shape eliminates any non-perpendicular angles for light entering and exiting the crystal. The reflected light is collected with an array of photodiodes. The laser can be set at an arbitrary angle, and the photodiode array is rotated to fully cover 2pi of solid angle. The current produced in the photodiodes is readout with a digital multimeter connected through a multiplexer. The two rows of photodiodes achieve 5-degree by 4-degree resolution, and the current measurement has a dynamic range of 105:1. The acquired data was not described by the commonly assumed linear combination of specular and diffuse (Lambertian) distributions, except for a very few surfaces. Surface roughness proved to be the most important parameter when choosing crystal setup. The reflector choice was of less importance and of almost no consequence for rough-cut surfaces. Pure specular reflection distribution for all incidence angles was measured for polished surfaces with VM2000 film, while the most Lambertian distribution for any surface finish was measured for titanium dioxide paint. The distributions acquired in this paper will be used to create more accurate Monte Carlo models for light reflection distribution within BGO crystals.

Theory of quasiparticle surface states in semiconductor surfaces

International Nuclear Information System (INIS)

Hybertsen, M.S.; Louie, S.G.

1988-01-01

A first-principles theory of the quasiparticle surface-state energies on semiconductor surfaces is developed. The surface properties are calculated using a repeated-slab geometry. Many-body effects due to the electron-electron interaction are represented by the electron self-energy operator including the full surface Green's function and local fields and dynamical screening effects in the Coulomb interaction. Calculated surface-state energies for the prototypical Si(111):As and Ge(111):As surfaces are presented. The calculated energies and dispersions for the occupied surface states (resonances) are in excellent agreement with recent angle-resolved photoemission data. Predictions are made for the position of empty surface states on both surfaces which may be experimentally accessible. The resulting surface state gap at Gamma-bar for Si(111):As agrees with recent scanning-tunneling-spectroscopy measurements. Comparison of the present results to eigenvalues from the local-density-functional calculation reveals substantial corrections for the gaps between empty and occupied surface states. This correction is found to depend on the character of the surface states involved

Surface defect chemistry and oxygen exchange kinetics in La2-xCaxNiO4+δ

Science.gov (United States)

Tropin, E. S.; Ananyev, M. V.; Farlenkov, A. S.; Khodimchuk, A. V.; Berenov, A. V.; Fetisov, A. V.; Eremin, V. A.; Kolchugin, A. A.

2018-06-01

Surface oxygen exchange kinetics and diffusion in La2-xCaxNiO4+δ (x = 0; 0.1; 0.3) have been studied by the isotope exchange method with gas phase equilibration in the temperature range of 600-800 °C and oxygen pressure range 0.13-2.5 kPa. Despite an enhanced electrical conductivity of La2-xCaxNiO4+δ theirs oxygen surface exchange (k*) and oxygen tracer diffusion (D*) coefficients were significantly lower in comparison with La2NiO4+δ. The rates of the elementary stages of oxygen exchange have been calculated. Upon Ca doping the change of the rate-determining stage was observed. The surface of the oxides was found to be inhomogeneous towards oxygen exchange process according to the recently developed model. The reasons of such inhomogeneity are discussed as well as Ca influence on the surface defect chemistry and oxygen surface exchange and diffusivity.

Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

Directory of Open Access Journals (Sweden)

Xuefeng Zhang

2015-01-01

Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

Fractional Diffusion Equations and Anomalous Diffusion

Science.gov (United States)

Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

2018-01-01

Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

Adsorption, Desorption, Surface Diffusion, Lattice Defect Formation, and Kink Incorporation Processes of Particles on Growth Interfaces of Colloidal Crystals with Attractive Interactions

Directory of Open Access Journals (Sweden)

Yoshihisa Suzuki

2016-07-01

Full Text Available Good model systems are required in order to understand crystal growth processes because, in many cases, precise incorporation processes of atoms or molecules cannot be visualized easily at the atomic or molecular level. Using a transmission-type optical microscope, we have successfully observed in situ adsorption, desorption, surface diffusion, lattice defect formation, and kink incorporation of particles on growth interfaces of colloidal crystals of polystyrene particles in aqueous sodium polyacrylate solutions. Precise surface transportation and kink incorporation processes of the particles into the colloidal crystals with attractive interactions were observed in situ at the particle level. In particular, contrary to the conventional expectations, the diffusion of particles along steps around a two-dimensional island of the growth interface was not the main route for kink incorporation. This is probably due to the number of bonds between adsorbed particles and particles in a crystal; the number exceeds the limit at which a particle easily exchanges its position to the adjacent one along the step. We also found novel desorption processes of particles from steps to terraces, attributing them to the assistance of attractive forces from additionally adsorbing particles to the particles on the steps.

THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

Energy Technology Data Exchange (ETDEWEB)

Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

2012-10-01

To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

Science.gov (United States)

Luther, M. R.

1981-01-01

The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

Ion beam effects on the surface and near-surface composition of TaSi2

International Nuclear Information System (INIS)

Valeri, S.; Di Bona, A.; Ottaviani, G.; Procop, M.

1991-01-01

Low-energy (0.7-4.5 keV) ion bombardment effects on polycrystalline TaSi 2 at sputter steady state and in various intermediate steps have been investigated, in the temperature range up to 550degC, to determine the time and temperature dependence of the altered layer formation. This in turn enables a better knowledge of the synergistic effects of the processes mentioned above. At low temperatures (T≤410degC) the surface is silicon depleted, and the depletion is even more severe in the subsurface region up to a depth of several tens of angstroems; silicon preferential sputtering and radiation-enhanced segregation assisted by the displacement mixing-induced motion of atoms are assumed to be responsible for this composition profile, while thermally activated diffusion processes become operative above 410degC, reducing progressively the concentration gradient between the surface and the subsurface zone. The composition at different depths has been determined from Auger peaks for different kinetic energies, by varying the take-off angle and finally by sputter profiling at low in energy the high energy processed surfaces. Quantitative analysis has been performed by XPS and AES by using the elemental standard method. (orig.)

Surface treatment systems for concrete in marine environment: Effect of concrete cover thickness

Directory of Open Access Journals (Sweden)

Marcelo Henrique Farias de Medeiros

Full Text Available Abstract There are some ways to extend the service life of a reinforced concrete structure. This paper focuses on the extension of the service life by treating the surface of reinforced concrete, specifically on the effect of the concrete cover thickness on the surface treatment system efficacy. Thus, chloride migration tests were performed and diffusion chloride coefficients were calculated. The service life of each case (treated or non-treated concrete was estimated using these data and Fick's second law of diffusion. Results indicated that the thicker the concrete cover is, the greater the efficacy of the concrete surface treatment system will be. The dissemination of this information is important, since it is almost intuitive to think that the effect of a surface treatment system depends only on itself and this study shows the opposite.

Influence of the growth-surface on the incorporation of phosphorus in SiC

International Nuclear Information System (INIS)

Rauls, E.; Gerstmann, U.; Frauenheim, Th.

2005-01-01

Phosphorus is a common and desired n-type dopant of SiC, but it turned out that doping by diffusion or during growth is rarely successful. To avoid the efforts and the creation of damage if ion implantation is used instead, these techniques were, though, highly desirable. In this work, we have investigated theoretically the experimental observation that phosphorus obviously hardly diffuses into the material. Not the diffusivity of the dopant but its addiction to occupy a three-fold coordinated surface site are critical, together with the way the surface affects the bulk migration barriers of the dopants. Whereas the most common growth direction for 4H-SiC, the polar silicon terminated (0001) surface, seems to be least appropriate for the incorporation of phosphorus atoms, growth along the nonpolar [112-bar 0] provides a good possibility to achieve efficient P-doping during growth

Diffusion Influenced Adsorption Kinetics.

Science.gov (United States)

Miura, Toshiaki; Seki, Kazuhiko

2015-08-27

When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

Communication: Contrasting effects of glycerol and DMSO on lipid membrane surface hydration dynamics and forces

Energy Technology Data Exchange (ETDEWEB)

Schrader, Alex M. [Department of Chemical Engineering, University of California, Santa Barbara, California 93106 (United States); Cheng, Chi-Yuan [Department of Chemistry and Biochemistry, University of California, Santa Barbara, California 93106 (United States); Israelachvili, Jacob N. [Department of Chemical Engineering, University of California, Santa Barbara, California 93106 (United States); Department of Chemistry and Biochemistry, University of California, Santa Barbara, California 93106 (United States); Materials Department, University of California, Santa Barbara, California 93106 (United States); Han, Songi [Department of Chemical Engineering, University of California, Santa Barbara, California 93106 (United States); Department of Chemistry and Biochemistry, University of California, Santa Barbara, California 93106 (United States)

2016-07-28

Glycerol and dimethyl sulfoxide (DMSO) are commonly used cryoprotectants in cellular systems, but due to the challenges of measuring the properties of surface-bound solvent, fundamental questions remain regarding the concentration, interactions, and conformation of these solutes at lipid membrane surfaces. We measured the surface water diffusivity at gel-phase dipalmitoylphosphatidylcholine (DPPC) bilayer surfaces in aqueous solutions containing ≤7.5 mol. % of DMSO or glycerol using Overhauser dynamic nuclear polarization. We found that glycerol similarly affects the diffusivity of water near the bilayer surface and that in the bulk solution (within 20%), while DMSO substantially increases the diffusivity of surface water relative to bulk water. We compare these measurements of water dynamics with those of equilibrium forces between DPPC bilayers in the same solvent mixtures. DMSO greatly decreases the range and magnitude of the repulsive forces between the bilayers, whereas glycerol increases it. We propose that the differences in hydrogen bonding capability of the two solutes leads DMSO to dehydrate the lipid head groups, while glycerol affects surface hydration only as much as it affects the bulk water properties. The results suggest that the mechanism of the two most common cryoprotectants must be fundamentally different: in the case of DMSO by decoupling the solvent from the lipid surface, and in the case of glycerol by altering the hydrogen bond structure and intermolecular cohesion of the global solvent, as manifested by increased solvent viscosity.

Reaction and Aggregation Dynamics of Cell Surface Receptors

Science.gov (United States)

Wang, Michelle Dong

This dissertation is composed of both theoretical and experimental studies of cell surface receptor reaction and aggregation. Project I studies the reaction rate enhancement due to surface diffusion of a bulk dissolved ligand with its membrane embedded target, using numerical calculations. The results show that the reaction rate enhancement is determined by ligand surface adsorption and desorption kinetic rates, surface and bulk diffusion coefficients, and geometry. In particular, we demonstrate that the ligand surface adsorption and desorption kinetic rates, rather than their ratio (the equilibrium constant), are important in rate enhancement. The second and third projects are studies of acetylcholine receptor clusters on cultured rat myotubes using fluorescence techniques after labeling the receptors with tetramethylrhodamine -alpha-bungarotoxin. The second project studies when and where the clusters form by making time-lapse movies. The movies are made from overlay of the pseudocolored total internal reflection fluorescence (TIRF) images of the cluster, and the schlieren images of the cell cultures. These movies are the first movies made using TIRF, and they clearly show the cluster formation from the myoblast fusion, the first appearance of clusters, and the eventual disappearance of clusters. The third project studies the fine structural features of individual clusters observed under TIRF. The features were characterized with six parameters by developing a novel fluorescence technique: spatial fluorescence autocorrelation. These parameters were then used to study the feature variations with age, and with treatments of drugs (oligomycin and carbachol). The results show little variation with age. However, drug treatment induced significant changes in some parameters. These changes were different for oligomycin and carbachol, which indicates that the two drugs may eliminate clusters through different mechanisms.

Quantification of chemical transport processes from the soil to surface runoff.

Science.gov (United States)

Tian, Kun; Huang, Chi-Hua; Wang, Guang-Qian; Fu, Xu-Dong; Parker, Gary

2013-01-01

There is a good conceptual understanding of the processes that govern chemical transport from the soil to surface runoff, but few studies have actually quantified these processes separately. Thus, we designed a laboratory flow cell and experimental procedures to quantify the chemical transport from soil to runoff water in the following individual processes: (i) convection with a vertical hydraulic gradient, (ii) convection via surface flow or the Bernoulli effect, (iii) diffusion, and (iv) soil loss. We applied different vertical hydraulic gradients by setting the flow cell to generate different seepage or drainage conditions. Our data confirmed the general form of the convection-diffusion equation. However, we now have additional quantitative data that describe the contribution of each individual chemical loading process in different surface runoff and soil hydrological conditions. The results of this study will be useful for enhancing our understanding of different geochemical processes in the surface soil mixing zone. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

Modification of surfaces and surface layers by non equilibrium processes

International Nuclear Information System (INIS)

Beamson, G.; Brennan, W.J.; Clark, D.T.; Howard, J.

1988-01-01

Plasmas are examples of non-equilibrium phenomena which are being used increasingly for the synthesis and modification of materials impossible by conventional routes. This paper introduces methods available by describing the construction and characteristics of some equipment used for the production of different types of plasmas and other non-equilibrium phenomena. This includes high energy ion beams. The special features, advantages and disadvantages of the techniques will be described. There are a multitude of potential application relevant to electronic, metallic, ceramic, and polymeric materials. However, scale-up from the laboratory to production equipment depends on establishing a better understanding of both the physics and chemistry of plasma as well as plasma-solid interactions. Examples are given of how such an understanding can be gained. The chemical analysis of polymer surfaces undergoing modification by inert gas, hydrogen or oxygen plasmas is shown to give physical information regarding the relative roles of diffusion of active species, and direct and radiative energy transfer from the plasma. Surface modification by plasma depositing a new material onto an existing substrate is discussed with particular reference to the deposition of amorphous carbon films. Applications of the unique properties of these films are outlined together with our current understanding of these properties based on chemical and physical methods of analysis of both the films and the plasmas producing them. Finally, surface modification by ion beams is briefly illustrated using examples from the electronics and metals industries where the modification has had a largely physical rather than chemical effect on the starting material. (orig.)

Adsorption of trace gases to ice surfaces: surface, bulk and co-adsorbate effects

Science.gov (United States)

Kerbrat, Michael; Bartels-Rausch, Thorsten; Huthwelker, Thomas; Schneebeli, Martin; Pinzer, Bernd; Ammann, Markus

2010-05-01

Atmospheric ices frequently interact with trace gases and aerosol making them an important storage, transport or reaction medium in the global ecosystem. Further, this also alters the physical properties of the ice particles with potential consequences for the global irradiation balance and for the relative humidity of surrounding air masses. We present recent results from a set of laboratory experiments of atmospheric relevance to investigate the nature of the uptake processes. The focus of this talk will be placed on the partitioning of acidic acid and nitrous acid on ice surfaces.The presented results span from very simple reversible adsorption experiments of a single trace gas onto ice surfaces to more complex, but well controlled, experimental procedures that successfully allowed us to - Disentangle surface adsorption and uptake into the ice matrix using radioactive labelled trace gases. - Show that simultaneous adsorption of acetic acid and nitrous acid to an ice surface is consistent with the Langmuir co-adsorption model. The experiments were done in a packed ice bed flow tube at atmospheric pressure and at temperatures between 213 and 253 K. The HONO gas phase mixing ratio was between 0.4 and 137 ppbv, the mixing ratio of acetic acid between 5 and 160 ppbv . The use of the radioactive labelled nitrous acid molecules for these experiments enabled in situ monitoring of the migration of trace gas in the flow tube. The measurements showed that the interactions do not only occur through adsorption but also via diffusion into polycrystalline ice. A method is suggested to disentangle the bulk and the surface processes. The co-adsorption of acetic and nitrous acids was also investigated. The measurements are well reproduced by a competitive Langmuir adsorption model.

Diffraction and diffusion in room acoustics

DEFF Research Database (Denmark)

Rindel, Jens Holger; Rasmussen, Birgit

1996-01-01

Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

Dendritic surface morphology of palladium hydride produced by electrolytic deposition

International Nuclear Information System (INIS)

Julin, Peng; Bursill, L.A.

1990-01-01

Conventional and high-resolution electron microscopic studies of electrolytically-deposited palladium hydride reveal a fascinating variety of surface profile morphologies. The observations provide direct information concerning the surface structure of palladium electrodes and the mechanism of electrolytic deposition of palladium black. Both classical electrochemical mechanisms and recent 'modified diffusion-limited-aggregation' computer simulations are discussed in comparison with the experimental results. 13 refs., 9 figs

Surface morphology of homoepitaxial GaN grown on non- and semipolar GaN substrates

Energy Technology Data Exchange (ETDEWEB)

Wernicke, Tim; Ploch, Simon [Institute of Solid State Physics, Technische Universitaet Berlin, Hardenbergstr. 36, 10623 Berlin (Germany); Hoffmann, Veit; Knauer, Arne; Weyers, Markus [Ferdinand-Braun-Institut, Leibniz Institut fuer Hoechstfrequenztechnik, Gustav-Kirchhoff-Str. 4, 12489 Berlin (Germany); Kneissl, Michael [Institute of Solid State Physics, Technische Universitaet Berlin, Hardenbergstr. 36, 10623 Berlin (Germany); Ferdinand-Braun-Institut, Leibniz Institut fuer Hoechstfrequenztechnik, Gustav-Kirchhoff-Str. 4, 12489 Berlin (Germany)

2011-03-15

GaN layers on bulk m-plane, (11 anti 22), (10 anti 12) and (10 anti 11) GaN substrates were grown by metal organic vapor phase epitaxy. XRD rocking curves have a FWHM of less than 150'', indicating excellent crystalline quality. However in many cases surface morphology exhibits hillocks with a height of 1-2 {mu}m and a lateral extension of 50-200 {mu}m whereas a smooth surface would be desirable for optoelectronic devices. The influence of growth parameters on the surface morphology was studied. The goal was, to constrain the material redistribution, that is necessary to form large hillocks. This was achieved by lowering the adatom diffusion length by a reduction of temperature and an increased reactor pressure. In the case of the (10 anti 11) and (10 anti 12) semipolar planes a reduction of the adatom diffusion length leads to a reduction of hillock density, hillock size and a smoother surface between hillocks. However, the m-plane surface does not react to a reduction of adatom mobility. Even at 890 C and 400 mbar rectangular pyramids cover the surface. In contrast to the other planes, the (11 anti 22) becomes instable, when the adatom diffusion length is reduced. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Induced surface stress at crystal surfaces