WorldWideScience

Sample records for surface diffusion surface

  1. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  2. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  3. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  4. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  5. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  6. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  7. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  8. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  9. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  10. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  11. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  12. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  13. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  14. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  15. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  16. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  17. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  18. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  19. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  20. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  1. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  2. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  3. II. Inhibited Diffusion Driven Surface Transmutations

    Science.gov (United States)

    Chubb, Talbot A.

    2006-02-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

  4. II. Inhibited diffusion driven surface transmutations

    International Nuclear Information System (INIS)

    Cubb, Talbot A.

    2006-01-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  5. II. Inhibited diffusion driven surface transmutations

    Energy Technology Data Exchange (ETDEWEB)

    Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

    2006-07-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  6. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  7. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  8. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  9. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  10. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  11. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  12. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  13. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  14. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  15. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  16. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  17. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  18. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  19. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  20. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  1. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  2. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  3. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  4. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  5. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  6. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  7. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  8. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  9. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  10. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  11. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  12. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  13. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  14. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  15. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  16. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  17. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  18. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  19. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  20. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  1. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  2. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  3. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  4. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  5. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  6. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  7. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  8. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  9. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  10. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  11. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  12. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  13. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  14. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  15. Surface modification of polyethylene by diffuse barrier discharge plasma

    Czech Academy of Sciences Publication Activity Database

    Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

    2013-01-01

    Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

  16. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  17. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  18. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  19. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  20. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  1. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  2. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  3. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  4. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  5. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  6. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  7. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  8. Scaling and diffusion of oil spills in the Ocean Surface

    Science.gov (United States)

    Tarquis, A. M.; Platonov, A.; Grau, J.; Sekula, E.

    2010-05-01

    The region of the Gulf of Lions at the northwestern Mediterranean Sea has been studied within a ten-year period from December 1996 until November 2006. More than 1000 synthetic aperture radar (SAR) images, which have been acquired by the Second European Remote Sensing Satellite (ERS 1/2) as well as from ENVISAT. We present statistical results of the structure of several features revealed by SAR such as oil spills and tensioactive slicks dynamic. We compare oil splils obtained from the projects Clean Seas,ENVA4/CT/0334, RC2003/005700, ESP2005/07551 and ESA/AO/IP2240. Since natural (caused by plankton, fish, etc.) slicks as well as man-made oil slicks dampen the small-scale surface waves, which are responsible for the radar backscattering from the ocean surface, both types of effects may be confused and give look/alike false oil spill detections. The early SAR images were processed at a resolution of 1 pixel=200m and were provided by the RApid Information Dissemination System (RAIDS) SAR processing facility in West Freugh, UK. Recent ENVISAT images directly from ESA allow a higher resolution of 1 pixel = 26 m, improving the detected turbulent scaling range. The occurrence of marine oil pollution as well as several dynamic features near Barcelona (frames 8-10, 19, 20; 200 SAR images)is itself a random multi-scale process. The use of different multifractal techniques, both using limits to the smallest and largest available scales, show that the scaling laws are very complex and depend strongly on intermittency of the assumed turbulent cascade, the shapes of the multifractal spectra functions are seen to deviate from an homogeneous multifractal and depend both on the initial conditions of the spill or slick, and on the transit time that the spill has been subjected to the local turbulence.

  9. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  10. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  11. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  12. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  13. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  14. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  15. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  16. Magnetoresistance of films and strips with the diffuse surface scattering

    International Nuclear Information System (INIS)

    Aronov, A.G.

    1993-08-01

    Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs

  17. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  18. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  19. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  20. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  1. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  2. INTRODUCTION: Surface Dynamics, Phonons, Adsorbate Vibrations and Diffusion

    Science.gov (United States)

    Bruch, L. W.

    2004-07-01

    understanding of the underlying factors determining the optical quality of GaInNAs, such as composition, growth and annealing conditions. We are still far from establishing an understanding of the band structure and its dependence on composition. Fundamental electronic interactions such as electron-electron and electron-phonon scattering, dependence of effective mass on composition, strain and orientation, quantum confinement effects, effects of localized nitrogen states on high field transport and on galvanometric properties, and mechanisms for light emission in these materials, are yet to be fully understood. Nature and formation mechanisms of grown-in and processing-induced defects that are important for material quality and device performance are still unknown. Such knowledge is required in order to design strategies to efficiently control and eliminate harmful defects. For many potential applications (such as solar cells, HBTs) it is essential to get more information on the transport properties of dilute nitride materials. The mobility of minority carriers is known to be low in GaInNAs and related material. The experimental values are far from reaching the theoretical ones, due to defects and impurities introduced in the material during the growth. The role of the material inhomogeneities on the lateral carrier transport also needs further investigation. From the device's point of view most attention to date has been focused on the GaInNAs/GaAs system, mainly because of its potential for optoelectronic devices covering the 1.3-1.55 µm data and telecommunications wavelength bands. As is now widely appreciated, these GaAs-compatible structures allow monolithic integration of AlGaAs-based distributed Bragg reflector mirrors (DBRs) for vertical cavity surface-emitting lasers with low temperature sensitivity and compatibility with AlOx-based confinement techniques. In terms of conventional edge-emitting lasers (EELs), the next step is to extend the wavelength range for cw room

  3. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  4. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Diffuse emission and control of copper in urban surface runoff.

    Science.gov (United States)

    Boller, M A; Steiner, M

    2002-01-01

    Copper washed off from roofs and roads is considered to be a major contribution to diffuse copper pollution of urban environments. In order to guarantee sustainable protection of soils and water, the long-term strategy is to avoid or replace copper containing materials on roofs and fagades. Until achievement of this goal, a special adsorber system is suggested to control the diffuse copper fluxes by retention of copper by a mixture of granulated iron-hydroxide (GEH) and calcium carbonate. Since future stormwater runoff concepts are based on decentralised runoff infiltration into the underground, solutions are proposed which provide for copper retention in infiltration sites using GEH adsorption layers. The example of a large copper façade of which the runoff is treated in an adsorption trench reveals the first full-scale data on façade runoff and adsorber performance. During the first year of investigation average façade runoff concentrations in the range of 1-10 mg Cu/l are reduced by 96-99% in the adsorption ditch.

  6. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  7. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  8. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  9. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  10. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  11. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  12. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  13. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  14. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  15. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  16. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  17. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  18. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  19. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  20. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  1. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  2. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  3. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  5. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  6. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  7. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  8. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  9. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  10. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  11. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  12. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  13. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  14. Surface Water & Surface Drainage

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This data set contains boundaries for all surface water and surface drainage for the state of New Mexico. It is in a vector digital data structure digitized from a...

  15. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  16. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  17. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  18. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  19. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  20. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  1. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  2. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  3. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  4. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  5. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  6. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  7. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  8. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  9. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  10. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  11. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  12. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  13. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  14. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  15. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  16. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  17. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  18. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  19. Surface channeling

    International Nuclear Information System (INIS)

    Sizmann, R.; Varelas, C.

    1976-01-01

    There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)

  20. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  1. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  2. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  3. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  4. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  5. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  6. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  7. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  8. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  9. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  10. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  11. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  12. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  13. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  14. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  15. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  16. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  17. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  18. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  19. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  20. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  1. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  2. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  3. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  4. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  5. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  6. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  7. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  8. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  9. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  10. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  11. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  12. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  13. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  14. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  15. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  16. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  17. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  18. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas

    2012-01-01

    in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices

  19. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  20. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    Energy Technology Data Exchange (ETDEWEB)

    Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

    2015-12-28

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

  1. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    International Nuclear Information System (INIS)

    Mirigian, Stephen; Schweizer, Kenneth S.

    2015-01-01

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

  2. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  3. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  4. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  5. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  6. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  7. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  8. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  9. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  10. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  11. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  12. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, Rizwan M; Oral, Ebru; Muratoglu, Orhun K

    2014-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E

  13. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, R. M.; Oral, E.; Muratoglu, O. K.

    2013-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E. (author)

  14. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  15. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  16. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  17. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

    2006-01-01

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  18. Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

    Science.gov (United States)

    1979-01-01

    A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

  19. Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

    Science.gov (United States)

    Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

    2015-01-01

    The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

  20. Minimal surfaces

    CERN Document Server

    Dierkes, Ulrich; Sauvigny, Friedrich; Jakob, Ruben; Kuster, Albrecht

    2010-01-01

    Minimal Surfaces is the first volume of a three volume treatise on minimal surfaces (Grundlehren Nr. 339-341). Each volume can be read and studied independently of the others. The central theme is boundary value problems for minimal surfaces. The treatise is a substantially revised and extended version of the monograph Minimal Surfaces I, II (Grundlehren Nr. 295 & 296). The first volume begins with an exposition of basic ideas of the theory of surfaces in three-dimensional Euclidean space, followed by an introduction of minimal surfaces as stationary points of area, or equivalently

  1. Rumble surfaces

    CSIR Research Space (South Africa)

    National Institute for Transport and Road

    1977-01-01

    Full Text Available Rumble surfaces are intermittent short lengths of coarse-textured road surfacings on which vehicle tyres produce a rumbling sound. used in conjunction with appropriate roadsigns and markings, they can reduce accidents on rural roads by alerting...

  2. Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

    Science.gov (United States)

    Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

    2018-04-01

    The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

  3. Surface thermodynamics

    International Nuclear Information System (INIS)

    Garcia-Moliner, F.

    1975-01-01

    Basic thermodynamics of a system consisting of two bulk phases with an interface. Solid surfaces: general. Discussion of experimental data on surface tension and related concepts. Adsorption thermodynamics in the Gibbsian scheme. Adsorption on inert solid adsorbents. Systems with electrical charges: chemistry and thermodynamics of imperfect crystals. Thermodynamics of charged surfaces. Simple models of charge transfer chemisorption. Adsorption heat and related concepts. Surface phase transitions

  4. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  5. Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

    Science.gov (United States)

    Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

    2015-06-03

    Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  7. Surface tension phenomena in the xylem sap of three diffuse porous temperate tree species

    Science.gov (United States)

    K. K. Christensen-Dalsgaard; M. T. Tyree; P. G. Mussone

    2011-01-01

    In plant physiology models involving bubble nucleation, expansion or elimination, it is typically assumed that the surface tension of xylem sap is equal to that of pure water, though this has never been tested. In this study we collected xylem sap from branches of the tree species Populus tremuloides, Betula papyrifera and Sorbus...

  8. Modification of the glass surface induced by redox reactions and internal diffusion processes

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    In this paper we report a novel way to modify the glass surface in favor of some physical performances. The main step is to perform iso-thermal treatments on the selected silicate glasses containing transition metal at temperatures near the glass transition temperature for various durations under...

  9. Simultaneous Retrieval of Aerosol and Surface Optical Properties from Combined Airborne- and Ground-Based Direct and Diffuse Radiometric Measurements

    Science.gov (United States)

    Gatebe, C. K.; Dubovik, O.; King, M. D.; Sinyuk, A.

    2010-01-01

    This paper presents a new method for simultaneously retrieving aerosol and surface reflectance properties from combined airborne and ground-based direct and diffuse radiometric measurements. The method is based on the standard Aerosol Robotic Network (AERONET) method for retrieving aerosol size distribution, complex index of refraction, and single scattering albedo, but modified to retrieve aerosol properties in two layers, below and above the aircraft, and parameters on surface optical properties from combined datasets (Cloud Absorption Radiometer (CAR) and AERONET data). A key advantage of this method is the inversion of all available spectral and angular data at the same time, while accounting for the influence of noise in the inversion procedure using statistical optimization. The wide spectral (0.34-2.30 m) and angular range (180 ) of the CAR instrument, combined with observations from an AERONET sunphotometer, provide sufficient measurement constraints for characterizing aerosol and surface properties with minimal assumptions. The robustness of the method was tested on observations made during four different field campaigns: (a) the Southern African Regional Science Initiative 2000 over Mongu, Zambia, (b) the Intercontinental Transport Experiment-Phase B over Mexico City, Mexico (c) Cloud and Land Surface Interaction Campaign over the Atmospheric Radiation Measurement (ARM) Central Facility, Oklahoma, USA, and (d) the Arctic Research of the Composition of the Troposphere from Aircraft and Satellites (ARCTAS) over Elson Lagoon in Barrow, Alaska, USA. The four areas are dominated by different surface characteristics and aerosol types, and therefore provide good test cases for the new inversion method.

  10. Surface mining

    Science.gov (United States)

    Robert Leopold; Bruce Rowland; Reed Stalder

    1979-01-01

    The surface mining process consists of four phases: (1) exploration; (2) development; (3) production; and (4) reclamation. A variety of surface mining methods has been developed, including strip mining, auger, area strip, open pit, dredging, and hydraulic. Sound planning and design techniques are essential to implement alternatives to meet the myriad of laws,...

  11. Superhydrophobic surfaces

    Science.gov (United States)

    Wang, Evelyn N; McCarthy, Matthew; Enright, Ryan; Culver, James N; Gerasopoulos, Konstantinos; Ghodssi, Reza

    2015-03-24

    Surfaces having a hierarchical structure--having features of both microscale and nanoscale dimensions--can exhibit superhydrophobic properties and advantageous condensation and heat transfer properties. The hierarchical surfaces can be fabricated using biological nanostructures, such as viruses as a self-assembled nanoscale template.

  12. Surface characterization

    Science.gov (United States)

    Mandla A. Tshabalala

    2005-01-01

    Surface properties of wood play an important role when wood is used or processed into different commodities such as siding, joinery, textiles, paper, sorption media or wood composites. Thus, for example, the quality and durability of a wood coating are determined by the surface properties of the wood and the coating. The same is true for wood composites, as the...

  13. Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-09-15

    Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

  14. Surface mobilities on solid materials

    International Nuclear Information System (INIS)

    Binh, V.T.

    1983-01-01

    This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

  15. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  16. THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

    Energy Technology Data Exchange (ETDEWEB)

    Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

    2012-10-01

    To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

  17. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  18. Radiative heat exchange between surfaces

    International Nuclear Information System (INIS)

    Yener, Y.; Yuncu, H.

    1987-01-01

    The geometrical features of radiative heat exchange between surfaces are discussed first by developing various radiation shape factor relations. The governing equations for enclosures with diffusely emitting and diffusely reflecting surfaces, as well as the equations for enclosures with gray surfaces having specular component of reflectivity are introduced next. Finally, a simplified model for enclosures with isothermal surfaces under the assumption of uniform radiosity over the surfaces is discussed, and various working relations for different conditions are presented

  19. Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Sun Jianzhong; Wang Zhikang; Gong Xiangyang

    2006-01-01

    Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

  20. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  1. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  2. Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

    Science.gov (United States)

    Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

    2014-03-01

    Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

  3. Convex surfaces

    CERN Document Server

    Busemann, Herbert

    2008-01-01

    This exploration of convex surfaces focuses on extrinsic geometry and applications of the Brunn-Minkowski theory. It also examines intrinsic geometry and the realization of intrinsic metrics. 1958 edition.

  4. Surface boxplots

    KAUST Repository

    Genton, Marc G.

    2014-01-22

    In this paper, we introduce a surface boxplot as a tool for visualization and exploratory analysis of samples of images. First, we use the notion of volume depth to order the images viewed as surfaces. In particular, we define the median image. We use an exact and fast algorithm for the ranking of the images. This allows us to detect potential outlying images that often contain interesting features not present in most of the images. Second, we build a graphical tool to visualize the surface boxplot and its various characteristics. A graph and histogram of the volume depth values allow us to identify images of interest. The code is available in the supporting information of this paper. We apply our surface boxplot to a sample of brain images and to a sample of climate model outputs.

  5. Surface boxplots

    KAUST Repository

    Genton, Marc G.; Johnson, Christopher; Potter, Kristin; Stenchikov, Georgiy L.; Sun, Ying

    2014-01-01

    In this paper, we introduce a surface boxplot as a tool for visualization and exploratory analysis of samples of images. First, we use the notion of volume depth to order the images viewed as surfaces. In particular, we define the median image. We use an exact and fast algorithm for the ranking of the images. This allows us to detect potential outlying images that often contain interesting features not present in most of the images. Second, we build a graphical tool to visualize the surface boxplot and its various characteristics. A graph and histogram of the volume depth values allow us to identify images of interest. The code is available in the supporting information of this paper. We apply our surface boxplot to a sample of brain images and to a sample of climate model outputs.

  6. Martian surface

    International Nuclear Information System (INIS)

    Carr, M.H.

    1987-01-01

    The surface of Mars is characterized on the basis of reformatted Viking remote-sensing data, summarizing results published during the period 1983-1986. Topics examined include impact craters, ridges and faults, volcanic studies (modeling of surface effects on volcanic activity, description and interpretation of volcanic features, and calculations on lava-ice interactions), the role of liquid water on Mars, evidence for abundant ground ice at high latitudes, water-cycle modeling, and the composition and dynamics of Martian dust

  7. Surface decontamination

    International Nuclear Information System (INIS)

    Silva, S. da; Teixeira, M.V.

    1986-06-01

    The general methods of surface decontamination used in laboratory and others nuclear installations areas, as well as the procedures for handling radioactive materials and surfaces of work are presented. Some methods for decontamination of body external parts are mentioned. The medical supervision and assistance are required for internal or external contamination involving or not lesion in persons. From this medical radiation protection decontamination procedures are determined. (M.C.K.) [pt

  8. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  9. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)

    International Nuclear Information System (INIS)

    Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.

    2013-01-01

    In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)

  10. Surface phonons

    CERN Document Server

    Wette, Frederik

    1991-01-01

    In recent years substantial progress has been made in the detection of surface phonons owing to considerable improvements in inelastic rare gas scattering tech­ niques and electron energy loss spectroscopy. With these methods it has become possible to measure surface vibrations in a wide energy range for all wave vectors in the two-dimensional Brillouin zone and thus to deduce the complete surface phonon dispersion curves. Inelastic atomic beam scattering and electron energy loss spectroscopy have started to play a role in the study of surface phonons similar to the one played by inelastic neutron scattering in the investigation of bulk phonons in the last thirty years. Detailed comparison between experimen­ tal results and theoretical studies of inelastic surface scattering and of surface phonons has now become feasible. It is therefore possible to test and to improve the details of interaction models which have been worked out theoretically in the last few decades. At this point we felt that a concise, co...

  11. Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

    Directory of Open Access Journals (Sweden)

    H. Hammami

    2017-08-01

    Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

  12. Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

    Czech Academy of Sciences Publication Activity Database

    Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

    2016-01-01

    Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

  13. Microscale anechoic architecture: acoustic diffusers for ultra low power microparticle separation via traveling surface acoustic waves.

    Science.gov (United States)

    Behrens, Jan; Langelier, Sean; Rezk, Amgad R; Lindner, Gerhard; Yeo, Leslie Y; Friend, James R

    2015-01-07

    We present a versatile and very low-power traveling SAW microfluidic sorting device able to displace and separate particles of different diameter in aqueous suspension; the travelling wave propagates through the fluid bulk and diffuses via a Schröder diffuser, adapted from its typical use in concert hall acoustics to be the smallest such diffuser to be suitable for microfluidics. The effective operating power range is two to three orders of magnitude less than current SAW devices, uniquely eliminating the need for amplifiers, and by using traveling waves to impart forces directly upon suspended microparticles, they can be separated by size.

  14. Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

    Directory of Open Access Journals (Sweden)

    Xi Shao

    2016-03-01

    Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

  15. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  17. Mostly surfaces

    CERN Document Server

    Schwartz, Richard Evan

    2011-01-01

    This book presents a number of topics related to surfaces, such as Euclidean, spherical and hyperbolic geometry, the fundamental group, universal covering surfaces, Riemannian manifolds, the Gauss-Bonnet Theorem, and the Riemann mapping theorem. The main idea is to get to some interesting mathematics without too much formality. The book also includes some material only tangentially related to surfaces, such as the Cauchy Rigidity Theorem, the Dehn Dissection Theorem, and the Banach-Tarski Theorem. The goal of the book is to present a tapestry of ideas from various areas of mathematics in a clear and rigorous yet informal and friendly way. Prerequisites include undergraduate courses in real analysis and in linear algebra, and some knowledge of complex analysis.

  18. Surface rights

    Directory of Open Access Journals (Sweden)

    Regina Célia Corrêa Landim

    2009-06-01

    Full Text Available In many cities of Brazil, social inequality is illustrated by violence, poverty, and unemployment located next to luxurious residential towers and armored passenger cars. In the face of this situation, the National Movement of Urban Reform encouraged the inclusion of the social function of property in Brazil's new constitution of 1988. Surface rights represent an urbanistic instrument in the city statute that is best aligned to the constitutional principles and urban policies. The current article compares two laws that govern the principle of surface rights and provides a brief history of the evolution of the state based on illuminism and the consequent change in paradigm affecting individual rights, including property and civil rights, and their interpretation under the Constitution. The article concludes by suggesting the use of land surface rights in a joint operation, matching the ownership of the property with urban planning policies and social interest.

  19. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  20. Off-lattice self-learning kinetic Monte Carlo: application to 2D cluster diffusion on the fcc(111) surface

    International Nuclear Information System (INIS)

    Kara, Abdelkader; Yildirim, Handan; Rahman, Talat S; Trushin, Oleg

    2009-01-01

    We report developments of the kinetic Monte Carlo (KMC) method with improved accuracy and increased versatility for the description of atomic diffusivity on metal surfaces. The on-lattice constraint built into our recently proposed self-learning KMC (SLKMC) (Trushin et al 2005 Phys. Rev. B 72 115401) is released, leaving atoms free to occupy 'off-lattice' positions to accommodate several processes responsible for small-cluster diffusion, periphery atom motion and heteroepitaxial growth. This technique combines the ideas embedded in the SLKMC method with a new pattern-recognition scheme fitted to an off-lattice model in which relative atomic positions are used to characterize and store configurations. Application of a combination of the 'drag' and the repulsive bias potential (RBP) methods for saddle point searches allows the treatment of concerted cluster, and multiple- and single-atom, motions on an equal footing. This tandem approach has helped reveal several new atomic mechanisms which contribute to cluster migration. We present applications of this off-lattice SLKMC to the diffusion of 2D islands of Cu (containing 2-30 atoms) on Cu and Ag(111), using the interatomic potential from the embedded-atom method. For the hetero-system Cu/Ag(111), this technique has uncovered mechanisms involving concerted motions such as shear, breathing and commensurate-incommensurate occupancies. Although the technique introduces complexities in storage and retrieval, it does not introduce noticeable extra computational cost.

  1. Fem Simulation of Triple Diffusive Natural Convection Along Inclined Plate in Porous Medium: Prescribed Surface Heat, Solute and Nanoparticles Flux

    Directory of Open Access Journals (Sweden)

    Goyal M.

    2017-12-01

    Full Text Available In this paper, triple diffusive natural convection under Darcy flow over an inclined plate embedded in a porous medium saturated with a binary base fluid containing nanoparticles and two salts is studied. The model used for the nanofluid is the one which incorporates the effects of Brownian motion and thermophoresis. In addition, the thermal energy equations include regular diffusion and cross-diffusion terms. The vertical surface has the heat, mass and nanoparticle fluxes each prescribed as a power law function of the distance along the wall. The boundary layer equations are transformed into a set of ordinary differential equations with the help of group theory transformations. A wide range of parameter values are chosen to bring out the effect of buoyancy ratio, regular Lewis number and modified Dufour parameters of both salts and nanofluid parameters with varying angle of inclinations. The effects of parameters on the velocity, temperature, solutal and nanoparticles volume fraction profiles, as well as on the important parameters of heat and mass transfer, i.e., the reduced Nusselt, regular and nanofluid Sherwood numbers, are discussed. Such problems find application in extrusion of metals, polymers and ceramics, production of plastic films, insulation of wires and liquid packaging.

  2. Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

    International Nuclear Information System (INIS)

    Singh, Gyanendra; Mehta, Dalip Singh

    2013-01-01

    We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

  3. Exciton diffusion length in some thermocleavable polythiophenes by the surface photovoltage method

    DEFF Research Database (Denmark)

    Tousek, J.; Touskova, J.; Remes, Z.

    2012-01-01

    property is that P3MHOCT can serve as a precursor which, after thermal annealing, converts into more rigid and insoluble P3CT and further thermal treatment produces native unsubstituted PT. Ellipsometric measurement yielded data on the thickness of the spin coated layers; absorption coefficients were...... be ascribed to the increase of the crystalline fraction. The highest diffusion length was found in P3CT polymer but its large resistivity represents a disadvantage in application in solar cells. Taking into account just these parameters, relatively low resistivity together with quite high diffusion length (13...

  4. Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

    Science.gov (United States)

    Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

    2006-12-01

    Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

  5. Self-diffusion dynamics processes relevant to 2D homoepitaxy growth of Ni adatom on Ni(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Fusheng [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Chen, Yifeng, E-mail: yefengc63@sina.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Wang, Yufei, E-mail: yejin802@126.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Liu, Zhulin; Hu, Zhongliang [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Yang, Xiyuan [Department of Physics, Hunan University of Arts and Science, Changde 415000 (China); Luo, Wenhua [Department of Physics and Electronic Information Science, Hunan Institute of Science and Technology, Yueyang 414006 (China)

    2014-07-01

    Using molecular dynamics and modified analytic embedded atom methods, the atomic self-diffusion dynamics behaviors relevant to 2D crystal growth on Ni(111) surface have been studied between 150 and 600 K. On perfect Ni(111) surface, the activation energy and prefactor are 0.058±0.001 eV and 4.2×10{sup −4} cm{sup 2}/s between 150 and 350 K, and 0.082±0.003 eV and 7.8×10{sup −4} cm{sup 2}/s from 400 to 600 K. Ni adatom just hops along the directions of close-packed steps on stepped Ni(111) surface, the corresponding activation energies and prefactors are 0.188±0.002 eV and (3.8–4.4)×10{sup −3} cm{sup 2}/s along the direction of A-type step, 0.140±0.001 eV and (1.1–1.2)×10{sup −3} cm{sup 2}/s along the direction of B-type step, and both fitting lines of Arrhenius law intersect at T{sub c}=420–440 K. Our results show that the atomic growth dynamics under nonequilibrium conditions is gradually dominated by the prefactor with increasing temperature. In addition, the shape-change of the 2D nanometer-size island has been discussed on stepped Ni(111) surface in different temperature range.

  6. Attack surfaces

    DEFF Research Database (Denmark)

    Gruschka, Nils; Jensen, Meiko

    2010-01-01

    The new paradigm of cloud computing poses severe security risks to its adopters. In order to cope with these risks, appropriate taxonomies and classification criteria for attacks on cloud computing are required. In this work-in-progress paper we present one such taxonomy based on the notion...... of attack surfaces of the cloud computing scenario participants....

  7. Numerical modeling of turbulent jet diffusion flames in the atmospheric surface layer

    NARCIS (Netherlands)

    Hernández, J.; Crespo, A.; Duijm, N.J.

    1995-01-01

    The evolution of turbulent jet diffusion flames of natural gas in air is predicted using a finite-volume procedure for solving the flow equations. The model is three dimensional, elliptic and based on the conserved-scalar approach and the laminar flamelet concept. A laminar flamelet prescription for

  8. Diffusion Coefficient in the Zinc Coating Shaped on the Surface of Cast Iron and Steel Alloys

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2015-06-01

    Full Text Available The article presents the method to assess the diffusion coefficient D in the sub-layer of intermetallic phases formed during hot-dip galvanizing “Armco” iron and ductile cast iron EN-GJS-500-7. Hot-dip galvanizing is one of the most popular forms of long-term protection of Fe-C alloys against corrosion. The process for producing a protective layer of sufficient quality is closely related to diffusion of atoms of zinc and iron. The simulation consist in performed a hot-dip galvanizing in laboratory condition above Fe-C alloys, in the Department of Engineering of Cast Alloys and Composites. Galvanizing time ranged from 15 to 300 seconds. Then metallographic specimens were prepared, intermetallic layers were measured and diffusion coefficient (D were calculated. It was found that the diffusion coefficient obtained during hot-dip galvanizing “Armco” iron and zinc is about two orders of magnitude less than the coefficient obtained on ductile cast iron EN-GJS-500-7.

  9. Mirror reactor surface study

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, A. L.; Damm, C. C.; Futch, A. H.; Hiskes, J. R.; Meisenheimer, R. G.; Moir, R. W.; Simonen, T. C.; Stallard, B. W.; Taylor, C. E.

    1976-09-01

    A general survey is presented of surface-related phenomena associated with the following mirror reactor elements: plasma first wall, ion sources, neutral beams, director converters, vacuum systems, and plasma diagnostics. A discussion of surface phenomena in possible abnormal reactor operation is included. Several studies which appear to merit immediate attention and which are essential to the development of mirror reactors are abstracted from the list of recommended areas for surface work. The appendix contains a discussion of the fundamentals of particle/surface interactions. The interactions surveyed are backscattering, thermal desorption, sputtering, diffusion, particle ranges in solids, and surface spectroscopic methods. A bibliography lists references in a number of categories pertinent to mirror reactors. Several complete published and unpublished reports on surface aspects of current mirror plasma experiments and reactor developments are also included.

  10. Mirror reactor surface study

    International Nuclear Information System (INIS)

    Hunt, A.L.; Damm, C.C.; Futch, A.H.; Hiskes, J.R.; Meisenheimer, R.G.; Moir, R.W.; Simonen, T.C.; Stallard, B.W.; Taylor, C.E.

    1976-01-01

    A general survey is presented of surface-related phenomena associated with the following mirror reactor elements: plasma first wall, ion sources, neutral beams, director converters, vacuum systems, and plasma diagnostics. A discussion of surface phenomena in possible abnormal reactor operation is included. Several studies which appear to merit immediate attention and which are essential to the development of mirror reactors are abstracted from the list of recommended areas for surface work. The appendix contains a discussion of the fundamentals of particle/surface interactions. The interactions surveyed are backscattering, thermal desorption, sputtering, diffusion, particle ranges in solids, and surface spectroscopic methods. A bibliography lists references in a number of categories pertinent to mirror reactors. Several complete published and unpublished reports on surface aspects of current mirror plasma experiments and reactor developments are also included

  11. Diffusion coefficients-surface and interfacial tensions - Particular study of some lauryl compounds

    International Nuclear Information System (INIS)

    Morel, Jean-Emile

    1969-01-01

    Two important results of the double lipophilic and hydrophilic character of some heavy organic compounds with a polar group at the end of the chain, were studied: - In a first part, molecular diffusion coefficients were measured in order to prove the micellar aggregation of tri-laurylammonium nitrate in some organic solutions; - In a second part, the tensioactivity of some lauryl compounds (lauric acid, lauric alcohol, mono-laurylamine, etc.), was studied. (author) [fr

  12. Reflection Matrix Method for Controlling Light After Reflection From a Diffuse Scattering Surface

    Science.gov (United States)

    2016-12-22

    of Philosophy Kenneth W. Burgi, BS, MS Major, USAF 22 December 2016 DISTRIBUTION STATEMENT A APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT...refocusing light through thin films of a turbid medium. When coherent light is trans- mitted through a stationary diffuser (i.e. a turbid medium), a fine...resultant light scatter [14, 15, 21, 23]. Transmission matrices were measured with microscopic objectives and thin films of turbid media, resulting in

  13. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  14. Mean field diffusion models for precipitation in crystalline GaAs including surface tension and bulk stresses

    Energy Technology Data Exchange (ETDEWEB)

    Dreyer, Wolfgang [Weierstrass-Institut fuer Angewandte Analysis und Stochastik (WIAS) im Forschungsverbund Berlin e.V. (Germany); Kimmerle, Sven-Joachim [Humboldt-Univ. Berlin (Germany). Dept. of Mathematics

    2009-07-01

    Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first class of models treats the diffusion-controlled regime of interface motion, while the second class is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. We consider homogenised models, where different length scales of the experimental situation have been exploited in order to simplify the equations. These homogenised models generalise the well-known Lifshitz-Slyozov-Wagner model for Ostwald ripening. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

  15. Density profile evolution and nonequilibrium effects in partial and full spreading measurements of surface diffusion

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2001-01-01

    in D-C(theta) depend on the initial density gradient and the initial state from which the spreading starts. To this end, we carry out extensive Monte Carlo simulations for a lattice-gas model of the O/W(110) system. Studies of submonolayer spreading from an initially ordered p(2x1) phase at theta = 1....../2 reveal that the spreading and diffusion rates in directions parallel and perpendicular to rows of oxygen atoms are significantly different within the ordered phase. Aside from this effect, we find that the degree of ordering in the initial phase has a relatively small impact on the overall behavior of D...

  16. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  17. Surface smoothness

    DEFF Research Database (Denmark)

    Tummala, Sudhakar; Dam, Erik B.

    2010-01-01

    accuracy, such novel markers must therefore be validated against clinically meaningful end-goals such as the ability to allow correct diagnosis. We present a method for automatic cartilage surface smoothness quantification in the knee joint. The quantification is based on a curvature flow method used....... We demonstrate that the fully automatic markers eliminate the time required for radiologist annotations, and in addition provide a diagnostic marker superior to the evaluated semi-manual markers....

  18. A versatile optical profilometer based on conoscopic holography sensors for acquisition of specular and diffusive surfaces in artworks

    Science.gov (United States)

    Gaburro, Nicola; Marchioro, Giacomo; Daffara, Claudia

    2017-07-01

    Surface metrology of artworks requires the design of suitable devices for in-situ non-destructive measurement together with reliable procedures for an effective analysis of such non-engineered variegate objects. To advance the state-of-the-art it has been implemented a versatile optical micro-profilometry taking advantage of the adapt- ability of conoscopic holography sensors, able to operate with irregular shapes and composite materials (diffusive, specular, and polychrome) of artworks. The scanning technique is used to obtain wide field and high spatially resolved areal profilometry. The prototype has a modular scheme based on a set of conoscopic sensors, extending the typical design based on a scanning stage and a single probe with a limited bandwidth, thus allowing the collection of heights data from surface with different scales and materials with variegate optical response. The system was optimized by characterizing the quality of the measurement with the probes triggered in continuous scanning modality. The results obtained on examples of cultural heritage objects (2D paintings, 3D height-relief) and materials (pictorial, metallic) demonstrate the versatility of the implemented device.

  19. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-04-05

    Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

  20. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-01-01

    Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

  1. Surface morphology and molecular bonding of CaCO3 nanocrystallites by gas diffusion method

    Science.gov (United States)

    Sulimai, N. H.; Rani, Rozina Abdul; Khusaimi, Z.; Abdullah, S.; Salifairus, M. J.; Alrokayan, Salman; Khan, Haseeb; Rusop, M.

    2018-05-01

    Calcium carbonate with the chemical formula of (CaCO3) is the most abundant element in the world. Its usage on certain applications is largely affected by its properties. The best means to control its properties is through controlled preparation of CaCO3. This study uses diffusion method between the precursors Calcium Chloride and Ammonium Carbonate. Instead of using water, ethanol was used to prepare the salt. Reaction was done in room temperature (RT) for 6h-24h. Smallest average crystallite size measured by FESEM micrograph is 500nm produced by synthesis of CaCO3 reacted for 168 hours. From energy-dispersive X-ray spectrum also indicated the smallest particle size is by CaCO3 reacted for 168 hours. Changes was seen for element Ca at 3.7keV.

  2. Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

    Science.gov (United States)

    Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

    2017-12-01

    This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

  3. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  4. Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

    International Nuclear Information System (INIS)

    Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

    2010-01-01

    This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

  5. Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

    Science.gov (United States)

    Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

    2005-09-01

    We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

  6. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  7. PREFACE: Vibrations at surfaces Vibrations at surfaces

    Science.gov (United States)

    Rahman, Talat S.

    2011-12-01

    Central Florida, Orlando, in March 2010. Several speakers at this meeting were invited to contribute to the special section in this issue. As is clear from the articles in this special section, the phenomenon of vibrations at surfaces continues to be a dynamic field of investigation. In fact, there is a resurgence of effort because the insights provided by surface dynamics are still fundamental to the development of an understanding of the microscopic factors that control surface structure formation, diffusion, reaction and structural stability. Examination of dynamics at surfaces thus complements and supplements the wealth of information that is obtained from real-space techniques such as scanning tunneling microscopy. Vibrational dynamics is, of course, not limited to surfaces. Surfaces are important since they provide immediate deviation from the bulk. They display how lack of symmetry can lead to new structures, new local atomic environments and new types of dynamical modes. Nanoparticles, large molecules and nanostructures of all types, in all kinds of local environments, provide further examples of regions of reduced symmetry and coordination, and hence display characteristic vibrational modes. Given the tremendous advance in the synthesis of a variety of nanostructures whose functionalization would pave the way for nanotechnology, there is even greater need to engage in experimental and theoretical techniques that help extract their vibrational dynamics. Such knowledge would enable a more complete understanding and characterization of these nanoscale systems than would otherwise be the case. The papers presented here provide excellent examples of the kind of information that is revealed by vibrations at surfaces. Vibrations at surface contents Poisoning and non-poisoning oxygen on Cu(410)L Vattuone, V Venugopal, T Kravchuk, M Smerieri, L Savio and M Rocca Modifying protein adsorption by layers of glutathione pre-adsorbed on Au(111)Anne Vallée, Vincent Humblot

  8. Surfaces of Building Practice

    OpenAIRE

    Surynková, Petra

    2009-01-01

    My diploma thesis Surfaces of Building Practice deals with the basic properties of surfaces, their mathematical description, categorization, and application in technical practice. Each studied surface is defined and its process of construction and parametrical description is listed. The thesis studies selected types of surfaces in details - these surfaces include surfaces of revolution, ruled surfaces, screw surfaces, and translational surfaces. An application of each studied surfaces is show...

  9. Coverage dependent desorption dynamics of deuterium on Si(100) surfaces: interpretation with a diffusion-promoted desorption model.

    Science.gov (United States)

    Matsuno, T; Niida, T; Tsurumaki, H; Namiki, A

    2005-01-08

    We studied coverage dependence of time-of-flight (TOF) spectra of D2 molecules thermally desorbed from the D/Si(100) surface. The mean translational energies Et of desorbed D2 molecules were found to increase from 0.20+/-0.05 eV to 0.40+/-0.04 eV as the desorption coverage window was decreased from 1.0 ML> or =thetaD> or =0.9 ML to 0.2 ML> or =thetaD> or =0 ML, being consistent with the kinetics switch predicted in the interdimer mechanism. The measured TOF spectra were deconvoluted into 2H, 3H, and 4H components by a curve fitting method along the principle of detailed balance. As a result, it turned out that the desorption kinetics changes from the 4H to the 3H situation at high coverage above thetaD=0.9 ML, while the 2H desorption is dominant for a quite wide coverage region up to thetaD=0.8 ML. A dynamic desorption mechanism by which the desorption is promoted by D-atom diffusion to dangling bonds was proposed. 2005 American Institute of Physics.

  10. Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

    2016-09-15

    Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

  11. The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

    Directory of Open Access Journals (Sweden)

    K.A. Widi

    2016-09-01

    Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

  12. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  13. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

    Energy Technology Data Exchange (ETDEWEB)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  14. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

    Science.gov (United States)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  15. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  16. Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

    International Nuclear Information System (INIS)

    Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

    1985-06-01

    A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

  17. Coexistence and competition of surface diffusion and geometric shielding in the growth of 1D bismuth nanostructures and their ohmic contact

    International Nuclear Information System (INIS)

    Tian, Ye; Jiang, Lianjun; Zhang, Xuejun; Deng, Yangbao; Deng, Shuguang

    2014-01-01

    We study the physical-vapor-deposition of 1D bismuth nanostructures. Bi nanowire elongating along [012] and/or [110] direction as well as anisotropic Bi nano-columns are physical-vapor-deposited successfully. The coexistence and competition of surface diffusion and geometric shielding are critical to their formation as well as growth mode transition among them. Since physical-vapor-deposition is a vacuum process, we make use of it to fabricate the ohmic contact to prevent the damage to the bismuth nanostructures brought by the etching to their thick surface oxide layer. (paper)

  18. Surface excitation parameter for rough surfaces

    International Nuclear Information System (INIS)

    Da, Bo; Salma, Khanam; Ji, Hui; Mao, Shifeng; Zhang, Guanghui; Wang, Xiaoping; Ding, Zejun

    2015-01-01

    Graphical abstract: - Highlights: • Instead of providing a general mathematical model of roughness, we directly use a finite element triangle mesh method to build a fully 3D rough surface from the practical sample. • The surface plasmon excitation can be introduced to the realistic sample surface by dielectric response theory and finite element method. • We found that SEP calculated based on ideal plane surface model are still reliable for real sample surface with common roughness. - Abstract: In order to assess quantitatively the importance of surface excitation effect in surface electron spectroscopy measurement, surface excitation parameter (SEP) has been introduced to describe the surface excitation probability as an average number of surface excitations that electrons can undergo when they move through solid surface either in incoming or outgoing directions. Meanwhile, surface roughness is an inevitable issue in experiments particularly when the sample surface is cleaned with ion beam bombardment. Surface roughness alters not only the electron elastic peak intensity but also the surface excitation intensity. However, almost all of the popular theoretical models for determining SEP are based on ideal plane surface approximation. In order to figure out whether this approximation is efficient or not for SEP calculation and the scope of this assumption, we proposed a new way to determine the SEP for a rough surface by a Monte Carlo simulation of electron scattering process near to a realistic rough surface, which is modeled by a finite element analysis method according to AFM image. The elastic peak intensity is calculated for different electron incident and emission angles. Assuming surface excitations obey the Poisson distribution the SEPs corrected for surface roughness are then obtained by analyzing the elastic peak intensity for several materials and for different incident and emission angles. It is found that the surface roughness only plays an

  19. Oxygen tracer diffusion and surface exchange kinetics in Ba0.5Sr0.5Co0.8Fe0.2O3-δ

    NARCIS (Netherlands)

    Berenov, A.; Atkinson, A.; Kilner, J.; Ananyev, M.; Eremin, V.; Porotnikova, N.; Farlenkov, A.; Kurumchin, E.; Bouwmeester, Henricus J.M.; Bucher, E.; Sitte, W.

    2014-01-01

    The oxygen tracer diffusion coefficient, Db⁎, and the oxygen tracer surface exchange coefficient, k, were measured in Ba0.5Sr0.5Co0.8Fe0.2O3 − δ (BSCF5582) over the temperature range of 310–800 °C and the oxygen partial pressure range of 1.3 × 10−3–0.21 bar. Several measurement techniques were used:

  20. Evaporation rates and surface profiles on heterogeneous surfaces with mass transfer and surface reaction

    Energy Technology Data Exchange (ETDEWEB)

    Flytzani-Stephanopoulos, M; Schmidt, L D

    1979-01-01

    Simple models incorporating surface reaction and diffusion of volatile products through a boundary layer are developed to calculate effective rates of evaporation and local surface profiles on surfaces having active and inactive regions. The coupling between surface heterogeneities with respect to a particular reaction and external mass transfer may provide a mechanism for the surface rearrangement and metal loss encountered in several catalytic systems of practical interest. Calculated transport rates for the volatilization of platinum in oxidizing environments and the rearrangement of this metal during the ammonia oxidation reaction agree well with published experimental data.

  1. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

    International Nuclear Information System (INIS)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-01-01

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

  2. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

    Science.gov (United States)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-09-29

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

  3. The diffusion mechanism and convective transport in the formation of surface anomalies of RADON-222 generated at depth

    International Nuclear Information System (INIS)

    Pereira, E.B.; Hamza, V.M.

    1982-01-01

    A preliminar study on the importance of a thermally-activated convective transport of radon is made in order to explain radon anomalies at surface generated at great depth. It is theoretically shown that convective currents should be of the order of 10 μm/s or larger to explain such anomalies. The influence of surface temperature changes on the convective transport is also discussed. Seasonal changes in temperature typical of climates such as that of southern Brazil can develop thermal inversion layers at depths up to 20 metres. The optimum period of the year for the employment of surface emanometric techniques is during the second and the third months after the winter peak when the thermal inversion barriers are less intense. (Author) [pt

  4. The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

    2016-04-15

    We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

  5. The Importance Of Surface Topography For The Biological Properties Of Nitrided Diffusion Layers Produced On Ti6Al4V Titanium Alloy

    Directory of Open Access Journals (Sweden)

    Wierzchoń T.

    2015-09-01

    Full Text Available Diffusion nitrided layers produced on titanium and its alloys are widely studied in terms of their application for cardiac and bone implants. The influence of the structure, the phase composition, topography and surface morphology on their biological properties is being investigated. The article presents the results of a study of the topography (nanotopography of the surface of TiN+Ti2N+αTi(N nitrided layers produced in low-temperature plasma on Ti6Al4V titanium alloy and their influence on the adhesion of blood platelets and their aggregates. The TEM microstructure of the produced layers have been examined and it was demonstrated that the interaction between platelets and the surface of the titanium implants subjected to glow-discharge nitriding can be shaped via modification of the roughness parameters of the external layer of the TiN titanium nitride nanocrystalline zone.

  6. Mathematical modeling of synthesis gas fueled electrochemistry and transport including H2/CO co-oxidation and surface diffusion in solid oxide fuel cell

    Science.gov (United States)

    Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin

    2015-10-01

    Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.

  7. Tailored Formation of N-Doped Nanoarchitectures by Diffusion-Controlled on-Surface (Cyclo)-Dehydrogenation of Heteroaromatics

    Czech Academy of Sciences Publication Activity Database

    Pinardi, A. L.; Otero-Irurueta, G.; Palacio, I.; Martinez, J. I.; Sánchez-Sánchez, C.; Tello, M.; Rogero, C.; Cossaro, A.; Preobrajenski, A.; Gomez-Lor, B.; Jančařík, Andrej; Stará, Irena G.; Starý, Ivo; Lopez, M. F.; Méndez, J.; Martin-Gago, J. A.

    2013-01-01

    Roč. 7, č. 4 (2013), s. 3676-3684 ISSN 1936-0851 R&D Projects: GA ČR(CZ) GAP207/10/2207 Institutional support: RVO:61388963 Keywords : surface-assisted dehydrogenation * dibenzo[5]helicene * N-doped nanographene * heteroaromatic polymer Subject RIV: CC - Organic Chemistry Impact factor: 12.033, year: 2013

  8. [Experimental studies on the diffusion of excitation on the right ventricular surface in the dog, during normal and stimulated beats].

    Science.gov (United States)

    Arisi, G; Macchi, E; Baruffi, S; Musso, E; Spaggiari, S; Stilli, D; Taccardi, B

    1982-01-01

    Previous work on the spread of excitation on the dog's ventricular surface enabled us to locate up to 30 breakthrough points (BKTPs) where excitation reaches the ventricular surface. In particular the equipotential contour maps enabled us to detect 3 to 5 BKTPs on the anterior right ventricular surface, near the a-v groove when a large part of ventricular surface was still at rest. With a view to investigating the mechanism underlying the early excitation of these basal regions, we stimulated the heart at several right ventricular BKTPs and in other points located at a distance from the BKTPs. The instantaneous equipotential maps showed that after stimulation most right ventricular BKTPs remained in the same position as observed the normal beats. The early appearance of epicardial wavefronts in the basal region and generally in other areas of the right ventricle was attributed to the rapid propagation of excitation waves through the Purkinje network, probably associated to a short transmural crossing time, due to a local thinness of the ventricular wall.

  9. A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

    Science.gov (United States)

    Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

    2016-01-01

    Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

  10. Surface migration in sorption processes

    International Nuclear Information System (INIS)

    Rasmuson, A.; Neretnieks, J.

    1983-03-01

    Diffusion rates of sorbing chemical species in granites and clays are in several experiments within the KBS study, higher than can be explained by pore diffusion only. One possible additional transport mechanism is transport of of sorbed molecules/ions along the intrapore surfaces. As a first step a literature investigation on on solid surfaces has been conducted. A lot of experimental evidence of the mobility of the sorbed molecules has been gathered through the years, particulary for metal surfaces and chemical engineering systems. For clays however, there are only a few articles, and for granites none. Two types of surface migration models have been proposed in the litterature: i) Surface flow as a result of a gradient in spreading pressure. ii) Surface diffusion as a result of a gradient in concentration. The surface flow model has only been applied to gaseous systems. However, it should be equally applicable to liquid systems. The models i) and ii) are conceptually very different. However, the resulting expressions for surface flux are complicated and it will not be an easy task to distinguish between them. There seem to be three ways of discriminating between the transport mechanisms: a) Temperature dependence. b) Concentration dependence. c) Order of magnitude. (Forf)

  11. Does one-dimensional (1D) adatom and cluster diffusion of Pt on the Pt(110)-(1 x 2) surface lead to 1D ripening?

    International Nuclear Information System (INIS)

    Linderoth, T R; Horch, S; Petersen, L; Laegsgaard, E; Stensgaard, I; Besenbacher, F

    2005-01-01

    The technique of scanning tunnelling microscopy (STM) uniquely allows dynamic processes on surfaces to be followed directly in real space and at atomic resolution. Results for the 551225 surface diffusion of Pt adatoms and clusters on the anisotropic, missing row reconstructed Pt(110)-(1 x 2) surface are briefly reviewed. Mass transport in this system is entirely one-dimensional (1D) since, at low adatom coverage, atoms and clusters are confined to the missing row troughs. In this paper, we therefore address the question if Pt/Pt(110)-(1 x 2) is a 1D model system to study late stage growth phenomena such as island ripening? From STM measurements, we quantify the morphology changes resulting from annealing a surface configuration with small 1D Pt islands in the missing row troughs to temperatures in the interval 369-395 K. Interestingly, the resulting increase in island sizes (ripening) cannot be accounted for by the known island and adatom mobilities within a 1D model. An explanation is provided from dynamic, time-resolved 'STM-movies' that directly reveal two novel island-mediated mechanisms for inter-trough mass transport which cause the Pt/Pt(110)-(1 x 2) system not to be purely 1D at the higher surface coverage used in the annealing experiments

  12. Surface segregation during irradiation

    International Nuclear Information System (INIS)

    Rehn, L.E.; Lam, N.Q.

    1985-10-01

    Gibbsian adsorption is known to alter the surface composition of many alloys. During irradiation, four additional processes that affect the near-surface alloy composition become operative: preferential sputtering, displacement mixing, radiation-enhanced diffusion and radiation-induced segregation. Because of the mutual competition of these five processes, near-surface compositional changes in an irradiation environment can be extremely complex. Although ion-beam induced surface compositional changes were noted as long as fifty years ago, it is only during the past several years that individual mechanisms have been clearly identified. In this paper, a simple physical description of each of the processes is given, and selected examples of recent important progress are discussed. With the notable exception of preferential sputtering, it is shown that a reasonable qualitative understanding of the relative contributions from the individual processes under various irradiation conditions has been attained. However, considerably more effort will be required before a quantitative, predictive capability can be achieved. 29 refs., 8 figs

  13. Dynamic Equilibrium Mechanism for Surface Nanobubble Stabilization

    NARCIS (Netherlands)

    Brenner, Michael P.; Lohse, Detlef

    2008-01-01

    Recent experiments have convincingly demonstrated the existence of surface nanobubbles on submerged hydrophobic surfaces. However, classical theory dictates that small gaseous bubbles quickly dissolve because their large Laplace pressure causes a diffusive outflux of gas. Here we suggest that the

  14. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    Science.gov (United States)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-12-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.

  15. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    International Nuclear Information System (INIS)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-01-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.

  16. Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

    Science.gov (United States)

    Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

    2017-11-01

    Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

  17. Morphometric partitioning of the respiratory surface area and diffusion capacity of the gills and swim bladder in juvenile Amazonian air-breathing fish, Arapaima gigas.

    Science.gov (United States)

    Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin

    2012-09-01

    The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Cryogenic Selective Surfaces

    Data.gov (United States)

    National Aeronautics and Space Administration — Selective surfaces have wavelength dependent emissivity/absorption. These surfaces can be designed to reflect solar radiation, while maximizing infrared emittance,...

  19. Characterization of solid surfaces

    National Research Council Canada - National Science Library

    Kane, Philip F; Larrabee, Graydon B

    1974-01-01

    .... A comprehensive review of surface analysis, this important volume surveys both principles and techniques of surface characterization, describes instrumentation, and suggests the course of future research...

  20. Open algebraic surfaces

    CERN Document Server

    Miyanishi, Masayoshi

    2000-01-01

    Open algebraic surfaces are a synonym for algebraic surfaces that are not necessarily complete. An open algebraic surface is understood as a Zariski open set of a projective algebraic surface. There is a long history of research on projective algebraic surfaces, and there exists a beautiful Enriques-Kodaira classification of such surfaces. The research accumulated by Ramanujan, Abhyankar, Moh, and Nagata and others has established a classification theory of open algebraic surfaces comparable to the Enriques-Kodaira theory. This research provides powerful methods to study the geometry and topology of open algebraic surfaces. The theory of open algebraic surfaces is applicable not only to algebraic geometry, but also to other fields, such as commutative algebra, invariant theory, and singularities. This book contains a comprehensive account of the theory of open algebraic surfaces, as well as several applications, in particular to the study of affine surfaces. Prerequisite to understanding the text is a basic b...

  1. Migration of the guinea pig sperm membrane protein PH-20 from one localized surface domain to another does not occur by a simple diffusion-trapping mechanism.

    Science.gov (United States)

    Cowan, A E; Myles, D G; Koppel, D E

    1991-03-01

    The redistribution of membrane proteins on the surface of cells is a prevalent feature of differentiation in a variety of cells. In most cases the mechanism responsible for such redistribution is poorly understood. Two potential mechanisms for the redistribution of surface proteins are: (1) passive diffusion coupled with trapping, and (2) active translocation. We have studied the process of membrane protein redistribution for the PH-20 protein of guinea pig sperm, a surface protein required for sperm binding to the egg zona pellucida (P. Primakoff, H. Hyatt, and D. G. Myles (1985). J. Cell Biol. 101, 2239-2244). PH-20 protein is localized to the posterior head plasma menbrane of the mature sperm cell. Following the exocytotic acrosome reaction, PH-20 protein moves into the newly incorporated inner acrosomal membrane (IAM), placing it in a position favorable for a role in binding sperm to the egg zona pellucida (D. G. Myles, and P. Primakoff (1984), J. Cell Biol. 99, 1634-1641). To analyze the mechanistic basis for this protein migration, we have used fluorescence microscopy and digital image processing to characterize PH-20 protein migration in individual cells. PH-20 protein was observed to move against a concentration gradient in the posterior head plasma membrane. This result argues strongly against a model of passive diffusion followed by trapping in the IAM, and instead suggests that an active process serves to concentrate PH-20 protein toward the boundary separating the posterior head and IAM regions. A transient gradient of PH-20 concentration observed in the IAM suggests that once PH-20 protein reaches the IAM, it is freely diffusing. Additionally, we observed that migration of PH-20 protein was calcium dependent.

  2. Surface-based vertexwise analysis of morphometry and microstructural integrity for white matter tracts in diffusion tensor imaging: With application to the corpus callosum in Alzheimer's disease.

    Science.gov (United States)

    Tang, Xiaoying; Qin, Yuanyuan; Zhu, Wenzhen; Miller, Michael I

    2017-04-01

    In this article, we present a unified statistical pipeline for analyzing the white matter (WM) tracts morphometry and microstructural integrity, both globally and locally within the same WM tract, from diffusion tensor imaging. Morphometry is quantified globally by the volumetric measurement and locally by the vertexwise surface areas. Meanwhile, microstructural integrity is quantified globally by the mean fractional anisotropy (FA) and trace values within the specific WM tract and locally by the FA and trace values defined at each vertex of its bounding surface. The proposed pipeline consists of four steps: (1) fully automated segmentation of WM tracts in a multi-contrast multi-atlas framework; (2) generation of the smooth surface representations for the WM tracts of interest; (3) common template surface generation on which the localized morphometric and microstructural statistics are defined and a variety of statistical analyses can be conducted; (4) multiple comparison correction to determine the significance of the statistical analysis results. Detailed herein, this pipeline has been applied to the corpus callosum in Alzheimer's disease (AD) with significantly decreased FA values and increased trace values, both globally and locally, being detected in patients with AD when compared to normal aging populations. A subdivision of the corpus callosum in both hemispheres revealed that the AD pathology primarily affects the body and splenium of the corpus callosum. Validation analyses and two multiple comparison correction strategies are provided. Hum Brain Mapp 38:1875-1893, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  3. Effects of diffusion and surface interactions on the line shape of electron paramagnetic resonances in the presence of a magnetic field gradient

    International Nuclear Information System (INIS)

    Schaden, M.; Zhao, K. F.; Wu, Z.

    2007-01-01

    In an evanescent wave magnetometer the Zeeman polarization is probed at micrometer to submicrometer distances from the cell surface. The electron paramagnetic resonance lines of an evanescent wave magnetometer in the presence of a magnetic field gradient exhibit edge enhancement seen previously in nuclear magnetic resonance lines. We present a theoretical model that describes quantitatively the shape of the magnetic resonance lines of an evanescent wave magnetometer under a wide range of experimental conditions. It accounts for diffusion broadening in the presence of a magnetic field gradient as well as interactions of spin polarized Rb atoms with the coated Pyrex glass surfaces. Depending on the field gradient, cell thickness, and buffer gas pressure, the resonance line may have the form of a single asymmetric peak or two peaks localized near the front and back surfaces in frequency space. The double-peaked response depends on average characteristics of the surface interactions. Its shape is sensitive to the dwell time, relaxation probability, and average phase shift of adsorbed spin polarized Rb atoms

  4. The impact of changes in parameterizations of surface drag and vertical diffusion on the large-scale circulation in the Community Atmosphere Model (CAM5)

    Science.gov (United States)

    Lindvall, Jenny; Svensson, Gunilla; Caballero, Rodrigo

    2017-06-01

    Simulations with the Community Atmosphere Model version 5 (CAM5) are used to analyze the sensitivity of the large-scale circulation to changes in parameterizations of orographic surface drag and vertical diffusion. Many GCMs and NWP models use enhanced turbulent mixing in stable conditions to improve simulations, while CAM5 cuts off all turbulence at high stabilities and instead employs a strong orographic surface stress parameterization, known as turbulent mountain stress (TMS). TMS completely dominates the surface stress over land and reduces the near-surface wind speeds compared to simulations without TMS. It is found that TMS is generally beneficial for the large-scale circulation as it improves zonal wind speeds, Arctic sea level pressure and zonal anomalies of the 500-hPa stream function, compared to ERA-Interim. It also alleviates atmospheric blocking frequency biases in the Northern Hemisphere. Using a scheme that instead allows for a modest increase of turbulent diffusion at higher stabilities only in the planetary boundary layer (PBL) appears to in some aspects have a similar, although much smaller, beneficial effect as TMS. Enhanced mixing throughout the atmospheric column, however, degrades the CAM5 simulation. Evaluating the simulations in comparison with detailed measurements at two locations reveals that TMS is detrimental for the PBL at the flat grassland ARM Southern Great Plains site, giving too strong wind turning and too deep PBLs. At the Sodankylä forest site, the effect of TMS is smaller due to the larger local vegetation roughness. At both sites, all simulations substantially overestimate the boundary layer ageostrophic flow.

  5. Shaping optimal zinc coating on the surface of high-quality ductile iron casting. Part II – Technological formula and value of diffusion coefficient

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2017-03-01

    Full Text Available The completed research presented in the first part of the article has allowed linking the manufacturing technology of ductile iron castings with the process of hot dip galvanizing. On the basis of these data simulations were carried out to examine the behaviour of zinc diffusion coefficient D in the galvanized coating. The adopted model of zinc coating growth helped to explain the cases of excessive growth of the intermetallic phases in this type of coating. The paper analyzes covered the relationship between the roughness and phase composition of the top layer of product and the thickness and kinetics of zinc coating growth referred to individual sub-layers of the intermetallic phases.Roughness and phase composition in the surface layer of product were next related to the diffusion coefficient D examined in respective sublayers of the intermetallic phases.

  6. Self-diffusion on (100), (110), and (111) surfaces of Ni and Cu: A detailed study of prefactors and activation energies

    International Nuclear Information System (INIS)

    Ku'rpick, Ulrike

    2001-01-01

    We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values

  7. Surface energy anisotropy of tungsten

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, R; Grenga, H E [Georgia Inst. of Tech., Atlanta (USA). School of Chemical Engineering

    1976-10-01

    Field-ion microscopy was used to study the faceting behavior and/or surface energy anisotropy of tungsten in vacuum and in hydrogen. In vacuum below 1700 K the activation energy for (110) facet growth agreed with values previously reported for surface diffusion on tungsten. The observed anisotropy values at 0.5 Tsub(m), where Tsub(m) is the absolute melting temperature of tungsten (approximately 3680 K), were different from those previously reported at higher temperatures and more nearly agreed with broken bond calculations based on Mie potential using m=5, n=8, and a 1.5% lattice expansion. Hydrogen appeared to have a negligible effect on surface energy anisotropy, but did preferentially increase surface diffusion rates on (310) regions.

  8. Past surface temperatures at the NorthGRIP drill site from the difference in firn diffusion of water isotopes

    DEFF Research Database (Denmark)

    Simonsen, Sebastian Bjerregaard; Johnsen, S. J.; Popp, T. J.

    2011-01-01

    A new ice core paleothermometer is introduced based on the temperature dependent diffusion of the stable water isotopes in the firn. A new parameter called differential diffusion length is defined as the difference between the diffusion length of the two stable water isotopologues 2H1H16O and 1H218......O. A model treatment of the diffusion process of the firn and the ice is presented along with a method of retrieving the diffusion signal from the ice core record of water isotopes using spectral methods. The model shows how the diffusion process is highly dependent on the inter-annual variations...... warmer than observed in other ice core based temperature reconstructions. The mechanisms behind this behaviour are not fully understood. The method shows the need of an expansion of high resolution stable water isotope datasets from ice cores. However, the new ice core paleothermometer presented here...

  9. Impact of the structural anisotropy of La{sub 2}NiO{sub 4+δ} on on high temperature surface modifications and diffusion of oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Gauquelin, Nicolas

    2010-11-29

    La{sub 2}NiO{sub 4+δ} was first studied due to its structural similarities with the High Temperature superconductor La{sub 2}NiO{sub 4+δ} and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K{sub 2}NiF{sub 4} layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La{sub 2}NiO{sub 4+δ} were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new {sup 18}O-{sup 18}O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  10. Impact of the structural anisotropy of La2NiO4+δ on on high temperature surface modifications and diffusion of oxygen

    International Nuclear Information System (INIS)

    Gauquelin, Nicolas

    2010-01-01

    La 2 NiO 4+δ was first studied due to its structural similarities with the High Temperature superconductor La 2 NiO 4+δ and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K 2 NiF 4 layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La 2 NiO 4+δ were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new 18 O- 18 O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  11. Surfaces with Natural Ridges

    DEFF Research Database (Denmark)

    Brander, David; Markvorsen, Steen

    2015-01-01

    We discuss surfaces with singularities, both in mathematics and in the real world. For many types of mathematical surface, singularities are natural and can be regarded as part of the surface. The most emblematic example is that of surfaces of constant negative Gauss curvature, all of which...

  12. Approximation by Cylinder Surfaces

    DEFF Research Database (Denmark)

    Randrup, Thomas

    1997-01-01

    We present a new method for approximation of a given surface by a cylinder surface. It is a constructive geometric method, leading to a monorail representation of the cylinder surface. By use of a weighted Gaussian image of the given surface, we determine a projection plane. In the orthogonal...

  13. Ruled Laguerre minimal surfaces

    KAUST Repository

    Skopenkov, Mikhail; Pottmann, Helmut; Grohs, Philipp

    2011-01-01

    A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ

  14. Probing the surface swelling in ultra-thin supported polystyrene films during case II diffusion of n-hexane

    NARCIS (Netherlands)

    Ogieglo, Wojciech; Wormeester, Herbert; Wessling, Matthias; Benes, Nieck Edwin

    2013-01-01

    In situ time-resolved spectroscopic ellipsometry is used to study the dynamics of n-hexane diffusion into, and the corresponding induced swelling of, ultra-thin polystyrene films. The experimental conditions are carefully selected to facilitate the observation of anomalous Case II diffusion in the

  15. Surface Topography Hinders Bacterial Surface Motility.

    Science.gov (United States)

    Chang, Yow-Ren; Weeks, Eric R; Ducker, William A

    2018-03-21

    We demonstrate that the surface motility of the bacterium, Pseudomonas aeruginosa, is hindered by a crystalline hemispherical topography with wavelength in the range of 2-8 μm. The motility was determined by the analysis of time-lapse microscopy images of cells in a flowing growth medium maintained at 37 °C. The net displacement of bacteria over 5 min is much lower on surfaces containing 2-8 μm hemispheres than on flat topography, but displacement on the 1 μm hemispheres is not lower. That is, there is a threshold between 1 and 2 μm for response to the topography. Cells on the 4 μm hemispheres were more likely to travel parallel to the local crystal axis than in other directions. Cells on the 8 μm topography were less likely to travel across the crowns of the hemispheres and were also more likely to make 30°-50° turns than on flat surfaces. These results show that surface topography can act as a significant barrier to surface motility and may therefore hinder surface exploration by bacteria. Because surface exploration can be a part of the process whereby bacteria form colonies and seek nutrients, these results help to elucidate the mechanism by which surface topography hinders biofilm formation.

  16. SURFACE PHOTOMETRY OF LOW SURFACE BRIGHTNESS GALAXIES

    NARCIS (Netherlands)

    DEBLOK, WJG; VANDERHULST, JM; BOTHUN, GD

    1995-01-01

    Low surface brightness (LSB) galaxies are galaxies dominated by an exponential disc whose central surface brightness is much fainter than the value of mu(B)(0) = 21.65 +/- 0.30 mag arcsec(-2) found by Freeman. In this paper we present broadband photometry of a sample of 21 late-type LSB galaxies.

  17. Surface morphology of laser superheated Pb(100)

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Z.H.; Lin, B.; Elsayed-Ali, H.E.

    1999-11-01

    The change in the surface vacancy density after heating of Pb(100) with {approximately}100 ps laser pulses is investigated using reflection high-energy electron diffraction. The surface vacancy density remains unchanged when the surface is superheated without melting. However, when the laser fluence is high enough to cause surface melting, the surface vacancy density increases. This increase in vacancy density is attributed to fast diffusion of atoms in the liquid film formed on Pb(100) during laser melting.

  18. Iron oxide surfaces

    Science.gov (United States)

    Parkinson, Gareth S.

    2016-03-01

    The current status of knowledge regarding the surfaces of the iron oxides, magnetite (Fe3O4), maghemite (γ-Fe2O3), haematite (α-Fe2O3), and wüstite (Fe1-xO) is reviewed. The paper starts with a summary of applications where iron oxide surfaces play a major role, including corrosion, catalysis, spintronics, magnetic nanoparticles (MNPs), biomedicine, photoelectrochemical water splitting and groundwater remediation. The bulk structure and properties are then briefly presented; each compound is based on a close-packed anion lattice, with a different distribution and oxidation state of the Fe cations in interstitial sites. The bulk defect chemistry is dominated by cation vacancies and interstitials (not oxygen vacancies) and this provides the context to understand iron oxide surfaces, which represent the front line in reduction and oxidation processes. Fe diffuses in and out from the bulk in response to the O2 chemical potential, forming sometimes complex intermediate phases at the surface. For example, α-Fe2O3 adopts Fe3O4-like surfaces in reducing conditions, and Fe3O4 adopts Fe1-xO-like structures in further reducing conditions still. It is argued that known bulk defect structures are an excellent starting point in building models for iron oxide surfaces. The atomic-scale structure of the low-index surfaces of iron oxides is the major focus of this review. Fe3O4 is the most studied iron oxide in surface science, primarily because its stability range corresponds nicely to the ultra-high vacuum environment. It is also an electrical conductor, which makes it straightforward to study with the most commonly used surface science methods such as photoemission spectroscopies (XPS, UPS) and scanning tunneling microscopy (STM). The impact of the surfaces on the measurement of bulk properties such as magnetism, the Verwey transition and the (predicted) half-metallicity is discussed. The best understood iron oxide surface at present is probably Fe3O4(100); the structure is

  19. Surface phonons and elastic surface waves

    Science.gov (United States)

    Büscher, H.; Klein-Heßling, W.; Ludwig, W.

    Theoretical investigations on the dynamics of the (001), (110) and (111) surfaces of some cubic metals (Ag, Cu, Ni) will be reviewed. Both, lattice dynamical and continuum theoretical results are obtained via a Green's function formalism. The main attitude of this paper is the comparison of our results with experiments and with results obtained via slab-calculations. The calculation of elastic surface waves has been performed using a modified surface-green-function-matching method. We have used two different approaches of calculation the bulk Green's function (a) using the spectral representation and (b) a method, what works on residues. The investigations are carried out using shortrange phenomenological potentials. The atomic force constants in the first surface layers are modified to describe surface phonon anomalies, observed by experiments. In the case of Ag (100) and Ag(110) we conclude that the detection of odd symmetry shear modes by Erskine et al. [1 a, b] was not very accurate.

  20. Surface phonons and elastic surface waves

    International Nuclear Information System (INIS)

    Buescher, H.; Klein-Hessling, W.; Ludwig, W.

    1993-01-01

    Theoretical investigations on the dynamics of the (001), (110) and (111) surfaces of some cubic metals (Ag, Cu, Ni) will be reviewed. Both, lattice dynamical and continuum theoretical results are obtained via a Green's function formalism. The main attitude of this paper is the comparison of our results with experiments and with results obtained via slab-calculations. The calculation of elastic surface waves has been performed using a modified surface-green-function-matching method. We have used two different approaches of calculation the bulk Green's function (a) using the spectral representation and (b) a method, what works on residues. The investigations are carried out using shortrange phenomenological potentials. The atomic force constants in the first surface layers are modified to describe surface phonon anomalies, observed by experiments. In the case of Ag(100) and Ag(110) we conclude that the detection of odd symmetry shear modes by Erskine et al. was not very accurate. (orig.)

  1. Adsorption, Desorption, Surface Diffusion, Lattice Defect Formation, and Kink Incorporation Processes of Particles on Growth Interfaces of Colloidal Crystals with Attractive Interactions

    Directory of Open Access Journals (Sweden)

    Yoshihisa Suzuki

    2016-07-01

    Full Text Available Good model systems are required in order to understand crystal growth processes because, in many cases, precise incorporation processes of atoms or molecules cannot be visualized easily at the atomic or molecular level. Using a transmission-type optical microscope, we have successfully observed in situ adsorption, desorption, surface diffusion, lattice defect formation, and kink incorporation of particles on growth interfaces of colloidal crystals of polystyrene particles in aqueous sodium polyacrylate solutions. Precise surface transportation and kink incorporation processes of the particles into the colloidal crystals with attractive interactions were observed in situ at the particle level. In particular, contrary to the conventional expectations, the diffusion of particles along steps around a two-dimensional island of the growth interface was not the main route for kink incorporation. This is probably due to the number of bonds between adsorbed particles and particles in a crystal; the number exceeds the limit at which a particle easily exchanges its position to the adjacent one along the step. We also found novel desorption processes of particles from steps to terraces, attributing them to the assistance of attractive forces from additionally adsorbing particles to the particles on the steps.

  2. Surface sealing using self-assembled monolayers and its effect on metal diffusion in porous low-k dielectrics studied using monoenergetic positron beams

    International Nuclear Information System (INIS)

    Uedono, Akira; Armini, Silvia; Zhang, Yu; Kakizaki, Takeaki; Krause-Rehberg, Reinhard; Anwand, Wolfgang; Wagner, Andreas

    2016-01-01

    Graphical abstract: - Highlights: • Pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the low-k film. • For the sample without the SAM sealing process, metal atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. Almost all pore interiors were covered by those metals. • For the sample damaged by a plasma etch treatment before the SAM sealing process, self-assembled molecules diffused into the OSG film, and they were preferentially trapped by larger pores. - Abstract: Surface sealing effects on the diffusion of metal atoms in porous organosilicate glass (OSG) films were studied by monoenergetic positron beams. For a Cu(5 nm)/MnN(3 nm)/OSG(130 nm) sample fabricated with pore stuffing, C_4F_8 plasma etch, unstuffing, and a self-assembled monolayer (SAM) sealing process, it was found that pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the OSG film. For the sample without the SAM sealing process, metal (Cu and Mn) atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. As a result, almost all pore interiors were covered with those metals. For the sample damaged by an Ar/C_4F_8 plasma etch treatment before the SAM sealing process, SAMs diffused into the OSG film, and they were preferentially trapped by larger pores. The cubic pore side length in these pores containing self-assembled molecules was estimated to be 0.7 nm. Through this work, we have demonstrated that monoenergetic positron beams are a powerful tool for characterizing capped porous films and the trapping of atoms and molecules by pores.

  3. Computer aided surface representation

    Energy Technology Data Exchange (ETDEWEB)

    Barnhill, R E

    1987-11-01

    The aims of this research are the creation of new surface forms and the determination of geometric and physical properties of surfaces. The full sweep from constructive mathematics through the implementation of algorithms and the interactive computer graphics display of surfaces is utilized. Both three-dimensional and multi- dimensional surfaces are considered. Particular emphasis is given to the scientific computing solution of Department of Energy problems. The methods that we have developed and that we are proposing to develop allow applications such as: Producing smooth contour maps from measured data, such as weather maps. Modeling the heat distribution inside a furnace from sample measurements. Terrain modeling based on satellite pictures. The investigation of new surface forms includes the topics of triangular interpolants, multivariate interpolation, surfaces defined on surfaces and monotone and/or convex surfaces. The geometric and physical properties considered include contours, the intersection of surfaces, curvatures as a interrogation tool, and numerical integration.

  4. Mechanics of active surfaces

    Science.gov (United States)

    Salbreux, Guillaume; Jülicher, Frank

    2017-09-01

    We derive a fully covariant theory of the mechanics of active surfaces. This theory provides a framework for the study of active biological or chemical processes at surfaces, such as the cell cortex, the mechanics of epithelial tissues, or reconstituted active systems on surfaces. We introduce forces and torques acting on a surface, and derive the associated force balance conditions. We show that surfaces with in-plane rotational symmetry can have broken up-down, chiral, or planar-chiral symmetry. We discuss the rate of entropy production in the surface and write linear constitutive relations that satisfy the Onsager relations. We show that the bending modulus, the spontaneous curvature, and the surface tension of a passive surface are renormalized by active terms. Finally, we identify active terms which are not found in a passive theory and discuss examples of shape instabilities that are related to active processes in the surface.

  5. Capillary waves with surface viscosity

    Science.gov (United States)

    Shen, Li; Denner, Fabian; Morgan, Neal; van Wachem, Berend; Dini, Daniele

    2017-11-01

    Experiments over the last 50 years have suggested a correlation between the surface (shear) viscosity and the stability of a foam or emulsion. With recent techniques allowing more accurate measurements of the elusive surface viscosity, we examine this link theoretically using small-amplitude capillary waves in the presence of the Marangoni effect and surface viscosity modelled via the Boussinesq-Scriven model. The surface viscosity effect is found to contribute a damping effect on the amplitude of the capillary wave with subtle differences to the effect of the convective-diffusive Marangoni transport. The general wave dispersion is augmented to take into account the Marangoni and surface viscosity effects, and a first-order correction to the critical damping wavelength is derived. The authors acknowledge the financial support of the Shell University Technology Centre for fuels and lubricants.

  6. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Directory of Open Access Journals (Sweden)

    Murat Kuscu

    Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  7. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Science.gov (United States)

    Kuscu, Murat; Akan, Ozgur B

    2018-01-01

    We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  8. Radiation heat transfer of arbitrary axisymmetric bodies with specular and diffuse surfaces; Kyomen ranhanshamen wo motsu nin`i keijo jikutaishobuttai no hosha dennetsu

    Energy Technology Data Exchange (ETDEWEB)

    Maruyama, S.; Aihara, T. [Tohoku University, Sendai (Japan). Institute of Fluid Sceince

    1993-10-25

    A radiation light tracking method was used to derive shape factors of arbitrary axisymmetric bodies consisted of specular and diffuse surfaces or an annular face element as a composite surface of the former surfaces. This paper illustrates the summary of an analytical method to calculate radiation heat transfer amount of these bodies using the shape factors, and describes the following matters: The difference between the shape factor obtained by applying this method to the inner face of a cylindrical body and conventional analytical solution can be reduced by increasing the number of splits in outgoing light. The numerical solution from this method on radiation heat transfer amount in the particular body agrees well with the conventional analytical solution. Radiation heat transfer amount when the specular reflectivity was increased either increases or decreases depending on the face shape, not necessarily changing monotonously. The paper further describes briefly a composite heat transfer analysis applied to a silicon crystal growing equipment using the Czochralski method, the analysis combining a radiation heat transfer analysis that splits the equipment interior into 88 annular elements with a general purpose heat transfer analysis. 13 refs., 11 figs., 1 tab.

  9. Regularity of Minimal Surfaces

    CERN Document Server

    Dierkes, Ulrich; Tromba, Anthony J; Kuster, Albrecht

    2010-01-01

    "Regularity of Minimal Surfaces" begins with a survey of minimal surfaces with free boundaries. Following this, the basic results concerning the boundary behaviour of minimal surfaces and H-surfaces with fixed or free boundaries are studied. In particular, the asymptotic expansions at interior and boundary branch points are derived, leading to general Gauss-Bonnet formulas. Furthermore, gradient estimates and asymptotic expansions for minimal surfaces with only piecewise smooth boundaries are obtained. One of the main features of free boundary value problems for minimal surfaces is t

  10. Advanced Surface Technology

    DEFF Research Database (Denmark)

    Møller, Per; Nielsen, Lars Pleht

    of the components. It covers everything from biocompatible surfaces of IR absorbent or reflective surfaces to surfaces with specific properties within low friction, hardness, corrosion, colors, etc. The book includes more than 400 pages detailing virtually all analysis methods for examining at surfaces.......This new significant book on advanced modern surface technology in all its variations, is aimed at both teaching at engineering schools and practical application in industry. The work covers all the significant aspects of modern surface technology and also describes how new advanced techniques make...

  11. Extremal surface barriers

    International Nuclear Information System (INIS)

    Engelhardt, Netta; Wall, Aron C.

    2014-01-01

    We present a generic condition for Lorentzian manifolds to have a barrier that limits the reach of boundary-anchored extremal surfaces of arbitrary dimension. We show that any surface with nonpositive extrinsic curvature is a barrier, in the sense that extremal surfaces cannot be continuously deformed past it. Furthermore, the outermost barrier surface has nonnegative extrinsic curvature. Under certain conditions, we show that the existence of trapped surfaces implies a barrier, and conversely. In the context of AdS/CFT, these barriers imply that it is impossible to reconstruct the entire bulk using extremal surfaces. We comment on the implications for the firewall controversy

  12. Insights into Surface Interactions between Metal Organic Frameworks and Gases during Transient Adsorption and Diffusion by In-Situ Small Angle X-ray Scattering

    Directory of Open Access Journals (Sweden)

    Ludovic F. Dumée

    2016-09-01

    Full Text Available The fabrication of molecular gas sieving materials with specific affinities for a single gas species and able to store large quantities of materials at a low or atmospheric pressure is desperately required to reduce the adverse effects of coal and oil usage in carbon capture. Fundamental understanding of the dynamic adsorption of gas, the diffusion mechanisms across thin film membranes, and the impact of interfaces play a vital role in developing these materials. In this work, single gas permeation tests across micro-porous membrane materials, based on metal organic framework crystals grown on the surface of carbon nanotubes (ZiF-8@CNT, were performed for the first time in-situ at the Australian Synchrotron on the small angle X-ray scattering beamline in order to reveal molecular sieving mechanisms and gas adsorption within the material. The results show that specific chemi-sorption of CO2 across the ZiF-8 crystal lattices affected the morphology and unit cell parameters, while the sieving of other noble or noble like gases across the ZiF-8@CNT membranes was found to largely follow Knudsen diffusion. This work demonstrates for the first time a novel and effective technique to assess molecular diffusion at the nano-scale across sub-nano-porous materials by probing molecular flexibility across crystal lattice and single cell units.

  13. Surface electrical resistivity of insulators

    International Nuclear Information System (INIS)

    Senn, B. C.; Liesegang, J.

    1996-01-01

    A method is presented here for measuring surface charge decay, and theory has been developed so as to produce determinations of resistivity in the surface region of insulator films or wafers. This method incorporates the use of a coaxial cylindrical capacitor arrangement and an electrometer interfaced to a PC. The charge transport theory given here is based on Mott-Gurney diffusion, and allows easy interpretation of the experimental data, especially for the initial phase of surface charge decay. Resistivity measurements are presented for glass, mica, perspex and polyethylene, covering a range of 10 9 to 10 18 Ωm, as an illustration of the useful range of the instrument for static and antistatic materials, particularly in film or sheet form. Values for the surface charge diffusion constants of the materials are also presented. The charge transport theory has also been extended to allow the experimental and computational theoretical comparison of surface charge decay not only over the initial phase of charge decay, but also over longer times. The theoretical predictions show excellent agreement with experiment using the values for the diffusion constants referred to above

  14. Induced surface stress at crystal surfaces

    International Nuclear Information System (INIS)

    Dahmen, K.

    2002-05-01

    Changes of the surfaces stress Δτ (s) can be studied by observing the bending of thin crystalline plates. With this cantilever method one can gain the induced change of surface stress Δτ (s) from the bending of plates with the help of elasticity theory. For elastic isotropic substrates the relevant relations are known. Here the relations are generalized to elastic anisotropic crystals with a C 2v - Symmetry. The equilibrium shapes of crystalline plates oriented along the (100)-, (110)-, or (111)-direction which are clamped along one edge are calculated with a numeric method under the load of a homogeneous but pure isotropic or anisotropic surface stress. The results can be displayed with the dimensionality, so that the effect of clamping can be described in a systematic way. With these tabulated values one can evaluate cantilever experiments exactly. These results are generalized to cantilever methods for determining magnetoelastic constants. It is shown which magnetoelastic constants are measured in domains of thin films with ordered structures. The eigenshape and the eigenfrequency of plates constraint through a clamping at one side are calculated. These results give a deeper understanding of the elastic anisotropy. The induced surface stress of oxygen on the (110)-surface of molybdenum is measured along the principle directions Δτ [001] and Δτ [ anti 110] . The anisotropy of the surface stress is found for the p(2 x 2)-reconstruction. Lithium induces a tensile surface stress on the Molybdenum (110)-surface up to a coverage of Θ = 0, 3 monolayer. For a higher coverage the induced stress drops and reaches a level of less than -1, 2 N/m at one monolayer. It is shown, that cobalt induces a linear increasing stress with respect to the coverage on the (100)-surface of copper with a value of 2, 4GPa. The copper (100)-surface is bombarded with accelerated ions in the range between 800-2200 eV. The resulting induced compressive stress (Δτ (s) < 0) of the order

  15. Growth morphologies of crystal surfaces

    Science.gov (United States)

    Xiao, Rong-Fu; Alexander, J. Iwan D.; Rosenberger, Franz

    1991-03-01

    We have expanded our earlier Monte Carlo model [Phys. Rev. A 38, 2447 (1988); J. Crystal Growth 100, 313 (1990)] to three dimensions and included reevaporation after accommodation and growth on dislocation-induced steps. We found again that, for a given set of growth parameters, the critical size, beyond which a crystal cannot retain its macroscopically faceted shape, scales linearly with the mean free path in the vapor. However, the three-dimensional (3D) the systems show increased shape stability compared to corresponding 2D cases. Extrapolation of the model results to mean-free-path conditions used in morphological stability experiments leads to order-of-magnitude agreement of the predicted critical size with experimental findings. The stability region for macroscopically smooth (faceted) surfaces in the parameter space of temperature and supersaturation depends on both the surface and bulk diffusion. While surface diffusion is seen to smooth the growth morphology on the scale of the surface diffusion length, bulk diffusion is always destabilizing. The atomic surface roughness increases with increase in growth temperature and supersaturation. That is, the tendency of surface kinetics anisotropies to stabilize the growth shape is reduced through thermal and kinetic roughening. It is also found that the solid-on-solid assumption, which can be advantageously used at low temperatures and supersaturations, is insufficient to describe the growth dynamics of atomically rough interfaces where bulk diffusion governs the process. For surfaces with an emerging screw dislocation, we find that the spiral growth mechanism dominates at low temperatures and supersaturations. The polygonization of a growth spiral decreases with increasing temperature or supersaturation. When the mean free path in the nutrient is comparable to the lattice constant, the combined effect of bulk and surface diffusion reduces the terrace width of a growth spiral in its center region. At elevated

  16. Smooth polyhedral surfaces

    KAUST Repository

    Gü nther, Felix; Jiang, Caigui; Pottmann, Helmut

    2017-01-01

    Polyhedral surfaces are fundamental objects in architectural geometry and industrial design. Whereas closeness of a given mesh to a smooth reference surface and its suitability for numerical simulations were already studied extensively, the aim of our work is to find and to discuss suitable assessments of smoothness of polyhedral surfaces that only take the geometry of the polyhedral surface itself into account. Motivated by analogies to classical differential geometry, we propose a theory of smoothness of polyhedral surfaces including suitable notions of normal vectors, tangent planes, asymptotic directions, and parabolic curves that are invariant under projective transformations. It is remarkable that seemingly mild conditions significantly limit the shapes of faces of a smooth polyhedral surface. Besides being of theoretical interest, we believe that smoothness of polyhedral surfaces is of interest in the architectural context, where vertices and edges of polyhedral surfaces are highly visible.

  17. Surface Prognostic Charts

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Surface Prognostic Charts are historical surface prognostic (forecast) charts created by the United States Weather Bureau. They include fronts, isobars, cloud, and...

  18. Integrated Surface Dataset (Global)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Integrated Surface (ISD) Dataset (ISD) is composed of worldwide surface weather observations from over 35,000 stations, though the best spatial coverage is...

  19. Smooth polyhedral surfaces

    KAUST Repository

    Günther, Felix

    2017-03-15

    Polyhedral surfaces are fundamental objects in architectural geometry and industrial design. Whereas closeness of a given mesh to a smooth reference surface and its suitability for numerical simulations were already studied extensively, the aim of our work is to find and to discuss suitable assessments of smoothness of polyhedral surfaces that only take the geometry of the polyhedral surface itself into account. Motivated by analogies to classical differential geometry, we propose a theory of smoothness of polyhedral surfaces including suitable notions of normal vectors, tangent planes, asymptotic directions, and parabolic curves that are invariant under projective transformations. It is remarkable that seemingly mild conditions significantly limit the shapes of faces of a smooth polyhedral surface. Besides being of theoretical interest, we believe that smoothness of polyhedral surfaces is of interest in the architectural context, where vertices and edges of polyhedral surfaces are highly visible.

  20. Surface freezing of water

    OpenAIRE

    P?rez-D?az, J. L.; ?lvarez-Valenzuela, M. A.; Rodr?guez-Celis, F.

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered?exclusively?by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on ...

  1. Biomaterials surface science

    CERN Document Server

    Taubert, Andreas; Rodriguez-Cabello, José Carlos

    2013-01-01

    The book provides an overview of the highly interdisciplinary field of surface science in the context of biological and biomedical applications. The covered topics range from micro- and nanostructuring for imparting functionality in a top-down manner to the bottom-up fabrication of gradient surfaces by self-assembly, from interfaces between biomaterials and living matter to smart, stimuli-responsive surfaces, and from cell and surface mechanics to the elucidation of cell-chip interactions in biomedical devices.

  2. Decontamination of floor surfaces

    International Nuclear Information System (INIS)

    Smirous, F.

    1983-01-01

    Requirements are presented put on the surfaces of floors of radiochemical workplaces. The mechanism is described of retaining the contaminant in the surface of the flooring, ways of reducing the hazards of floor surface contamination, decontamination techniques and used decontamination agents. (J.P.)

  3. Surface vibrational spectroscopy

    International Nuclear Information System (INIS)

    Erskine, J.L.

    1984-01-01

    A brief review of recent studies which combine measurements of surface vibrational energies with lattice dynamical calculations is presented. These results suggest that surface vibrational spectroscopy offers interesting prospects for use as a molecular-level probe of surface geometry, adsorbate bond distances and molecular orientations

  4. Effect of TiO2 additive on the sintering of nuclear fuel (U,Pu)O2. Contribution of surface diffusion to plutonium distribution

    International Nuclear Information System (INIS)

    Bremier, Stephane

    1997-01-01

    This thesis has as objective the study of the effect of TiO 2 additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO 2 in the presence of TiO 2 has been established and the influence of the PuO 2 distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO 2 and UO 2 -PuO 2 . The results concerning the influence of TiO 2 upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO 2 alone or in the presence of TiO 2 are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO 2 -PuO 2 preparation upon the initial microstructure of the materials and the role played by the PuO 2 grains in sintering. The potentiality of surface diffusion as a means of PuO 2 spreading in the UO 2 is evaluated and correlated with the reduced capacity of sintering the UO 2 ceramics containing PuO 2 . The last chapter deals with the influence of TiO 2 on the development of microstructure in UO 2 -PuO 2 ceramics. While at temperatures below 1500 deg.C the TiO 2 additive affects the surface diffusion and so the plutonium distribution, at values T≥ 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO 2 , PuO 2 and titanium oxide. Thus the objective is the optimizing the temperature conditions, the oxygen potential as sintering gas and the additive

  5. Radioactive Ions for Surface Characterization

    CERN Multimedia

    2002-01-01

    The collaboration has completed a set of pilot experiments with the aim to develop techniques for using radioactive nuclei in surface physics. The first result was a method for thermal deposition of isolated atoms (Cd, In, Rb) on clean metallic surfaces. \\\\ \\\\ Then the diffusion history of deposited Cd and In atoms on two model surfaces, Mo(110) and Pd(111), was followed through the electric field gradients (efg) acting at the probe nuclei as measured with the Perturbed Angular Correlation technique. For Mo(110) a rather simple history of the adatoms was inferred from the experiments: Atoms initially landing at terrace sites diffuse from there to ledges and then to kinks, defects always present at real surfaces. The next stage is desorption from the surface. For Pd a scenario that goes still further was found. Following the kink stage the adatoms get incorporated into ledges and finally into the top surface layer. For all these five sites the efg's could be measured.\\\\ \\\\ In preparation for a further series o...

  6. Sulfide Mineral Surfaces

    International Nuclear Information System (INIS)

    Rosso, Kevin M.; Vaughan, David J.

    2006-01-01

    The past twenty years or so have seen dramatic development of the experimental and theoretical tools available to study the surfaces of solids at the molecular (?atomic resolution?) scale. On the experimental side, two areas of development well illustrate these advances. The first concerns the high intensity photon sources associated with synchrotron radiation; these have both greatly improved the surface sensitivity and spatial resolution of already established surface spectroscopic and diffraction methods, and enabled the development of new methods for studying surfaces. The second centers on the scanning probe microscopy (SPM) techniques initially developed in the 1980's with the first scanning tunneling microscope (STM) and atomic force microscope (AFM) experiments. The direct 'observation' of individual atoms at surfaces made possible with these methods has truly revolutionized surface science. On the theoretical side, the availability of high performance computers coupled with advances in computational modeling has provided powerful new tools to complement the advances in experiment. Particularly important have been the quantum mechanics based computational approaches such as density functional theory (DFT), which can now be easily used to calculate the equilibrium crystal structures of solids and surfaces from first principles, and to provide insights into their electronic structure. In this chapter, we review current knowledge of sulfide mineral surfaces, beginning with an overview of the principles relevant to the study of the surfaces of all crystalline solids. This includes the thermodynamics of surfaces, the atomic structure of surfaces (surface crystallography and structural stability, adjustments of atoms at the surface through relaxation or reconstruction, surface defects) and the electronic structure of surfaces. We then discuss examples where specific crystal surfaces have been studied, with the main sulfide minerals organized by structure type

  7. Sulfide Mineral Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Rosso, Kevin M.; Vaughan, David J.

    2006-08-01

    The past twenty years or so have seen dramatic development of the experimental and theoretical tools available to study the surfaces of solids at the molecular (?atomic resolution?) scale. On the experimental side, two areas of development well illustrate these advances. The first concerns the high intensity photon sources associated with synchrotron radiation; these have both greatly improved the surface sensitivity and spatial resolution of already established surface spectroscopic and diffraction methods, and enabled the development of new methods for studying surfaces. The second centers on the scanning probe microscopy (SPM) techniques initially developed in the 1980's with the first scanning tunneling microscope (STM) and atomic force microscope (AFM) experiments. The direct 'observation' of individual atoms at surfaces made possible with these methods has truly revolutionized surface science. On the theoretical side, the availability of high performance computers coupled with advances in computational modeling has provided powerful new tools to complement the advances in experiment. Particularly important have been the quantum mechanics based computational approaches such as density functional theory (DFT), which can now be easily used to calculate the equilibrium crystal structures of solids and surfaces from first principles, and to provide insights into their electronic structure. In this chapter, we review current knowledge of sulfide mineral surfaces, beginning with an overview of the principles relevant to the study of the surfaces of all crystalline solids. This includes the thermodynamics of surfaces, the atomic structure of surfaces (surface crystallography and structural stability, adjustments of atoms at the surface through relaxation or reconstruction, surface defects) and the electronic structure of surfaces. We then discuss examples where specific crystal surfaces have been studied, with the main sulfide minerals organized by

  8. Surface for dummies

    CERN Document Server

    Rathbone, Andy

    2014-01-01

    Make Microsoft's Surface work-and play-just the way you want it to Microsoft's Surface tablet has the features and personality you're looking for, with a robust environment for business computing that doesn't skimp on fun. Surface for Dummies, 2nd Edition explains how Windows 8.1 Pro and Windows RT differ, and helps you decide which Surface model is best for you. Step by step, this book walks you through both the hardware and software features of the Surface, including the touch cover and type cover, Windows RT and Windows 8.1 Pro operating systems, and the coveted Office Home & Student 2013 s

  9. Radioactive surface contamination monitors

    International Nuclear Information System (INIS)

    Aoyama, Kei; Minagoshi, Atsushi; Hasegawa, Toru

    1994-01-01

    To reduce radiation exposure and prevent contamination from spreading, each nuclear power plant has established a radiation controlled area. People and articles out of the controlled area are checked for the surface contamination of radioactive materials with surface contamination monitors. Fuji Electric has repeatedly improved these monitors on the basis of user's needs. This paper outlines typical of a surface contamination monitor, a personal surface contamination monitor, an article surface contamination monitor and a laundry monitor, and the whole-body counter of an internal contamination monitor. (author)

  10. Radionuclide transfer onto ground surface in surface water flow, 1

    International Nuclear Information System (INIS)

    Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

    1991-07-01

    Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

  11. Surface modification of gas diffusion layers by inorganic nanomaterials for performance enhancement of proton exchange membrane fuel cells at low RH conditions

    Energy Technology Data Exchange (ETDEWEB)

    Cindrella, L. [Fuel Cell Research Lab, Engineering Technology Department, Arizona State University, 7001 E Williams Field Rd., Mesa, AZ 85212 (United States); Department of Chemistry, National Institute of Technology, Tiruchirappalli, Tamil Nadu 620015 (India); Kannan, A.M. [Fuel Cell Research Lab, Engineering Technology Department, Arizona State University, 7001 E Williams Field Rd., Mesa, AZ 85212 (United States); Ahmad, R.; Thommes, M. [Quantachrome Instruments, 1900 Corporate Drive, Boynton Beach, FL 33426 (United States)

    2009-08-15

    Prompted by our earlier study that fumed silica on gas diffusion layer (GDL) favored a performance improvement of the single fuel cell at lower RH conditions, the present study has been carried out with inorganic oxides in the nanoscale such as TiO{sub 2}, Al{sub 2}O{sub 3}, commercially available mixed oxides, hydrophilic silica and aerosil silica. The structure of each of the oxide coating on the GDL surface has resulted in refinement with graded pore dimension as seen from the Hg porosimetry data. The fuel cell evaluation at various RH conditions (50-100%) revealed that the performance of all the inorganic oxides loaded GDL is very high compared to that of pristine GDL. The results confirm our earlier observation that inorganic oxides on GDL bring about structural refinement favorable for the transport of gases, and their water retaining capacity enable a high performance of the fuel cell even at low RH conditions. (author)

  12. Depth Distribution Studies of Carbon in Steel Surfaces by Means of Charged Particle Activation Analysis with an Account of Heat and Diffusion Effects in the Sample

    International Nuclear Information System (INIS)

    Brune, D.; Lorenzen, J.; Witalis, E.

    1972-05-01

    Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: 12 C(p,γ) 13 N and 12 C(d,n) 13 N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, 13 N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described

  13. Surface freezing of water.

    Science.gov (United States)

    Pérez-Díaz, J L; Álvarez-Valenzuela, M A; Rodríguez-Celis, F

    2016-01-01

    Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered-exclusively-by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on humidity, presenting at least three different types of surface crystals. Humidity triggers surface freezing as soon as it overpasses a defined value for a given temperature, generating a plurality of nucleation nodes. An evidence of simultaneous nucleation of surface ice crystals is also provided.

  14. On rationally supported surfaces

    DEFF Research Database (Denmark)

    Gravesen, Jens; Juttler, B.; Sir, Z.

    2008-01-01

    We analyze the class of surfaces which are equipped with rational support functions. Any rational support function can be decomposed into a symmetric (even) and an antisymmetric (odd) part. We analyze certain geometric properties of surfaces with odd and even rational support functions....... In particular it is shown that odd rational support functions correspond to those rational surfaces which can be equipped with a linear field of normal vectors, which were discussed by Sampoli et al. (Sampoli, M.L., Peternell, M., Juttler, B., 2006. Rational surfaces with linear normals and their convolutions...... with rational surfaces. Comput. Aided Geom. Design 23, 179-192). As shown recently, this class of surfaces includes non-developable quadratic triangular Bezier surface patches (Lavicka, M., Bastl, B., 2007. Rational hypersurfaces with rational convolutions. Comput. Aided Geom. Design 24, 410426; Peternell, M...

  15. Computer aided surface representation

    Energy Technology Data Exchange (ETDEWEB)

    Barnhill, R.E.

    1990-02-19

    The central research problem of this project is the effective representation, computation, and display of surfaces interpolating to information in three or more dimensions. If the given information is located on another surface, then the problem is to construct a surface defined on a surface''. Sometimes properties of an already defined surface are desired, which is geometry processing''. Visualization of multivariate surfaces is possible by means of contouring higher dimensional surfaces. These problems and more are discussed below. The broad sweep from constructive mathematics through computational algorithms to computer graphics illustrations is utilized in this research. The breadth and depth of this research activity makes this research project unique.

  16. MHD heat and mass diffusion flow by natural convection past a surface embedded in a porous medium

    Directory of Open Access Journals (Sweden)

    Chaudhary R.C.

    2009-01-01

    Full Text Available This paper presents an analytical study of the transient hydromagnetic natural convection flow past a vertical plate embedded in a porous medium, taking account of the presence of mass diffusion and fluctuating temperature about time at the plate. The governing equations are solved in closed form by the Laplace-transform technique. The results are obtained for temperature, velocity, penetration distance, Nusselt number and skin-friction. The effects of various parameters are discussed on the flow variables and presented by graphs.

  17. Electro-oxidation of methanol diffused through proton exchange membrane on Pt surface: crossover rate of methanol

    International Nuclear Information System (INIS)

    Jung, Inhwa; Kim, Doyeon; Yun, Yongsik; Chung, Suengyoung; Lee, Jaeyoung; Tak, Yongsug

    2004-01-01

    Methanol crossover rate through proton exchange membrane (Nafion 117) was investigated with a newly designed electrochemical stripping cell. Nanosize Pt electrode was prepared by the electroless deposition. Distinct electrocatalytic oxidation behaviors of methanol inside membrane were similar to the methanol oxidation in aqueous electrolyte, except adsorption/desorption of hydrogen. The amount of methanol diffused through membrane was calculated from the charge of methanol oxidation during repetitive cyclic voltammetry (CV) and methanol crossover rate was estimated to be 0.69 nmol/s

  18. Interface doping of conjugated organic films by means of diffusion of atomic components from the surfaces of semiconductors and of metal oxides.

    Science.gov (United States)

    Komolov, A S; Akhremtchik, S N; Lazneva, E F

    2011-08-15

    The paper reports the results on the interface formation of 5-10 nm thick conjugated layers of Cu-phthalocyanine (CuPc) with a number of solid surfaces: polycrystalline Au, (SiO(2))n-Si, ZnO(0 0 0 1), Si(1 0 0), Ge(1 1 1), CdS(0 0 0 1) and GaAs(1 0 0). The results were obtained using Auger electron spectroscopy (AES) and low-energy target current electron spectroscopy (TCS). The organic overlayers were thermally deposited in situ in UHV onto substrate surfaces. The island-like organic deposits were excluded from the analysis so that only uniform organic deposits were considered. In the cases of polycrystalline Au, Si(1 0 0) and Ge(1 1 1) substrates the AES peaks of the substrate material attenuated down to the zero noise level upon the increase of the CuPc film thickness of 8-10 nm. The peaks corresponding to oxygen atoms in the case of SiO(2) substrate, and to atoms from the ZnO, GaAs and CdS substrates were clearly registered in the AES spectra of the 8-10 nm thick CuPc deposits. The relative concentration of the substrate atomic components diffused into the film was different from their relative concentration at the pure substrate surface. The concentration of the substrate dopant atoms in the CuPc film was estimated as one atom per one CuPc molecule. Using the target current electron spectroscopy, it was shown that the substrate atoms admixed in the CuPc film account for the appearance of a new peak in the density of unoccupied electronic states. Formation of intermediate TCS spectra until the CuPc deposit reaches 2-3 nm was observed in the cases of GaAs(1 0 0), ZnO(0 0 0 1), Ge(1 1 1) surfaces. The intermediate spectra show a less pronounced peak structure different from the one typical for the CuPc films. It was suggested that the intermediate layer was formed by the CuPc molecules fully or partially decomposed due to the interaction with the relatively reactive semiconductor surfaces. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Lagrangian and Eulerian diffusion study in the coastal surface layers. Progress report, July 1, 1979-June 30, 1980

    International Nuclear Information System (INIS)

    Carter, H.H.; Okubo, A.; Wilson, R.E.; Sanderson, B.; Pritchard, D.W.

    1980-07-01

    This research project addresses a fundamental problem in turbulence theory, the relation between Lagrangian and Eulerian statistics, by carrying out, analyzing, and interpreting a set of field experiments in the coastal waters off the south shore of Long Island. The study will not only provide information on the relation between the Lagrangian and Eulerian autocorrelations but also between the various experimental methods for quantitatively estimating turbulent diffusion. Two experiments, one in summer and one in winter, consisting of simultaneous measurements of dye diffusion, drogue dispersion, and Eulerian current velocities in a typical coastal locale were planned. In order to ensure a match between the Lagrangian (drogues, dye) scales of motion and the Eulerian (current meters) scales, however, a preliminary experiment, consisting of a 6 mooring current meter array and a short (approx. 3 hours) drogue experiment, was conducted during March 1980. Results of this preliminary experiment and their implications to the experimental program are discussed. The principal results were an improved design of our current meter array, and a wider variety of drogue experiments, i.e., multi-level, multi-scale, and continuous source simulation

  20. Surface-Based fMRI-Driven Diffusion Tractography in the Presence of Significant Brain Pathology: A Study Linking Structure and Function in Cerebral Palsy

    Science.gov (United States)

    Cunnington, Ross; Boyd, Roslyn N.; Rose, Stephen E.

    2016-01-01

    Diffusion MRI (dMRI) tractography analyses are difficult to perform in the presence of brain pathology. Automated methods that rely on cortical parcellation for structural connectivity studies often fail, while manually defining regions is extremely time consuming and can introduce human error. Both methods also make assumptions about structure-function relationships that may not hold after cortical reorganisation. Seeding tractography with functional-MRI (fMRI) activation is an emerging method that reduces these confounds, but inherent smoothing of fMRI signal may result in the inclusion of irrelevant pathways. This paper describes a novel fMRI-seeded dMRI-analysis pipeline based on surface-meshes that reduces these issues and utilises machine-learning to generate task specific white matter pathways, minimising the requirement for manually-drawn ROIs. We directly compared this new strategy to a standard voxelwise fMRI-dMRI approach, by investigating correlations between clinical scores and dMRI metrics of thalamocortical and corticomotor tracts in 31 children with unilateral cerebral palsy. The surface-based approach successfully processed more participants (87%) than the voxel-based approach (65%), and provided significantly more-coherent tractography. Significant correlations between dMRI metrics and five clinical scores of function were found for the more superior regions of these tracts. These significant correlations were stronger and more frequently found with the surface-based method (15/20 investigated were significant; R2 = 0.43–0.73) than the voxelwise analysis (2 sig. correlations; 0.38 & 0.49). More restricted fMRI signal, better-constrained tractography, and the novel track-classification method all appeared to contribute toward these differences. PMID:27487011

  1. Communication: A new ab initio potential energy surface for HCl-H2O, diffusion Monte Carlo calculations of D0 and a delocalized zero-point wavefunction.

    Science.gov (United States)

    Mancini, John S; Bowman, Joel M

    2013-03-28

    We report a global, full-dimensional, ab initio potential energy surface describing the HCl-H2O dimer. The potential is constructed from a permutationally invariant fit, using Morse-like variables, to over 44,000 CCSD(T)-F12b∕aug-cc-pVTZ energies. The surface describes the complex and dissociated monomers with a total RMS fitting error of 24 cm(-1). The normal modes of the minima, low-energy saddle point and separated monomers, the double minimum isomerization pathway and electronic dissociation energy are accurately described by the surface. Rigorous quantum mechanical diffusion Monte Carlo (DMC) calculations are performed to determine the zero-point energy and wavefunction of the complex and the separated fragments. The calculated zero-point energies together with a De value calculated from CCSD(T) with a complete basis set extrapolation gives a D0 value of 1348 ± 3 cm(-1), in good agreement with the recent experimentally reported value of 1334 ± 10 cm(-1) [B. E. Casterline, A. K. Mollner, L. C. Ch'ng, and H. Reisler, J. Phys. Chem. A 114, 9774 (2010)]. Examination of the DMC wavefunction allows for confident characterization of the zero-point geometry to be dominant at the C(2v) double-well saddle point and not the C(s) global minimum. Additional support for the delocalized zero-point geometry is given by numerical solutions to the 1D Schrödinger equation along the imaginary-frequency out-of-plane bending mode, where the zero-point energy is calculated to be 52 cm(-1) above the isomerization barrier. The D0 of the fully deuterated isotopologue is calculated to be 1476 ± 3 cm(-1), which we hope will stand as a benchmark for future experimental work.

  2. Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations

    Science.gov (United States)

    Zhang, Wei; Gan, Jie; Li, Qian; Gao, Kun; Sun, Jian; Xu, Ning; Ying, Zhifeng; Wu, Jiada

    2011-06-01

    The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

  3. Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations

    International Nuclear Information System (INIS)

    Zhang Wei; Gan Jie; Li Qian; Gao Kun; Sun Jian; Xu Ning; Ying Zhifeng; Wu Jiada

    2011-01-01

    The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

  4. Surface diffusion and coverage effect of Li atom on graphene as studied by several density functional theory methods

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Zhi [Instituto de Ciencias Físicas, Universidad Nacional Autónoma de México, Av. Universidad 2001, Col. Chamilpa, 62210 Cuernavaca, Morelos (Mexico); Contreras-Torres, Flavio F., E-mail: flavioc@nucleares.unam.mx [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, Circuito Exterior, Ciudad Universitaria, 04510 México, DF (Mexico); Jalbout, Abraham F.; Ramírez-Treviño, Alberto [Instituto Tecnológico de Estudios Superiores de Cajeme, Ciudad Obregon, Sonora (Mexico)

    2013-11-15

    The adsorption of Li atom on graphene is examined using density functional theory methods. Three different adsorption sites are considered, including the on top of a carbon atom (OT), on top of a C-C bond (Bri), and on top of a hexagon (Hol), as well as Li adsorbed at different coverage. The Hol site is found to be the most stable, followed by the Bri and OT sites. The order of stabilization is independent of coverage. The localization of Li–graphene interaction at all sites has reverse order with stabilization. The localization will cause different repulsive interaction between Li atoms which is believed to take responsibility for the difference between the charge transfer order and adsorption energy order of Li adsorption at all possible sites. Repulsive interaction also causes the decreasing of adsorption energies of Li at Hol site with increasing coverage, but the corresponding influence is bigger at low coverage range (0.020–0.056 monolayers) than that at high coverage range (0.056–0.250 monolayers). The trend of charge transfer and dipole moment with increasing coverage is also in agreement with that of adsorption energy. It is also found that the distance of Li above graphene will increase with increasing coverage, but a so-called “zigzag” curve appears, which exhibits an oscillatory behavior as a function of increasing coverage. The diffusion of Li atom on graphene is also studied. Li atom migrates from a Hol site to a neighboring Hol site through the Bri site between them is found to be the minimum energy path. Within the studied coverage range, the diffusion barrier decreases with increasing coverage which can be ascribed to the phenomenon of different repulsion interactions when Li atom adsorbs at different sites. The increasing coverage amplified the phenomenon.

  5. A new top boundary condition for modeling surface diffusive exchange of a generic volatile tracer: theoretical analysis and application to soil evaporation

    Directory of Open Access Journals (Sweden)

    J. Y. Tang

    2013-02-01

    Full Text Available We describe a new top boundary condition (TBC for representing the air–soil diffusive exchange of a generic volatile tracer. This new TBC (1 accounts for the multi-phase flow of a generic tracer; (2 accounts for effects of soil temperature, pH, solubility, sorption, and desorption processes; (3 enables a smooth transition between wet and dry soil conditions; (4 is compatible with the conductance formulation for modeling air–water volatile tracer exchange; and (5 is applicable to site, regional, and global land models.

    Based on the new TBC, we developed new formulations for bare-soil resistance and corresponding soil evaporation efficiency. The new soil resistance is predicted as the reciprocal of the harmonic sum of two resistances: (1 gaseous and aqueous molecular diffusion and (2 liquid mass flow resulting from the hydraulic pressure gradient between the soil surface and center of the topsoil control volume. We compared the predicted soil evaporation efficiency with those from several field and laboratory soil evaporation measurements and found good agreement with the typically observed two-stage soil evaporation curves. Comparison with the soil evaporation efficiency equation of Lee and Pielke (1992; hereafter LP92 indicates that their equation can overestimate soil evaporation when the atmospheric resistance is low and underestimate soil evaporation when the soil is dry. Using a synthetic inversion experiment, we demonstrated that using inverted soil resistance data from field measurements to derive empirical soil resistance formulations resulted in large uncertainty because (1 the inverted soil resistance data are always severely impacted by measurement error and (2 the derived empirical equation is very sensitive to the number of data points and the assumed functional form of the resistance.

    We expect the application of our new TBC in land models will provide a consistent representation for the diffusive tracer

  6. Ruled Laguerre minimal surfaces

    KAUST Repository

    Skopenkov, Mikhail

    2011-10-30

    A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ) + λ(sin φ, cos φ, 0), where A,B,C,D ε ℝ are fixed. To achieve invariance under Laguerre transformations, we also derive all Laguerre minimal surfaces that are enveloped by a family of cones. The methodology is based on the isotropic model of Laguerre geometry. In this model a Laguerre minimal surface enveloped by a family of cones corresponds to a graph of a biharmonic function carrying a family of isotropic circles. We classify such functions by showing that the top view of the family of circles is a pencil. © 2011 Springer-Verlag.

  7. Water at surfaces with tunable surface chemistries

    Science.gov (United States)

    Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

    2018-03-01

    Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

  8. Make your Boy surface

    OpenAIRE

    Ogasa, Eiji

    2013-01-01

    This is an introductory article on the Boy surface. Boy found that RP2 can be immersed into R3 and published it 1901. (The image of) the immersion is called the Boy surface after Boy's discovery. We have created a way to construct the Boy surface by using a pair of scissors, a piece of paper, and a strip of scotch tape. In this article we introduce the way.

  9. Encyclopedia of analytical surfaces

    CERN Document Server

    Krivoshapko, S N

    2015-01-01

    This encyclopedia presents an all-embracing collection of analytical surface classes. It provides concise definitions  and description for more than 500 surfaces and categorizes them in 38 classes of analytical surfaces. All classes are cross references to the original literature in an excellent bibliography. The encyclopedia is of particular interest to structural and civil engineers and serves as valuable reference for mathematicians.

  10. Hot Surface Ignition

    OpenAIRE

    Tursyn, Yerbatyr; Goyal, Vikrant; Benhidjeb-Carayon, Alicia; Simmons, Richard; Meyer, Scott; Gore, Jay P.

    2015-01-01

    Undesirable hot surface ignition of flammable liquids is one of the hazards in ground and air transportation vehicles, which primarily occurs in the engine compartment. In order to evaluate the safety and sustainability of candidate replacement fuels with respect to hot surface ignition, a baseline low lead fuel (Avgas 100 LL) and four experimental unleaded aviation fuels recommended for reciprocating aviation engines were considered. In addition, hot surface ignition properties of the gas tu...

  11. Surface science and catalysis

    International Nuclear Information System (INIS)

    Somorjai, G.A.

    1985-02-01

    Modern surface science studies have explored a large number of metal catalyst systems. Three classes of catalytic reactions can be identified: (1) those that occur over the metal surface; (2) reactions that take place on top of a strongly adsorbed overlayer and (3) reactions that occur on co-adsorbate modified surfaces. Case histories for each class are presented. 44 refs., 13 figs., 3 tabs

  12. Anodized dental implant surface

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Mishra

    2017-01-01

    Full Text Available Purpose: Anodized implants with moderately rough surface were introduced around 2000. Whether these implants enhanced biologic effect to improve the environment for better osseointegration was unclear. The purpose of this article was to review the literature available on anodized surface in terms of their clinical success rate and bone response in patients till now. Materials and Methods: A broad electronic search of MEDLINE and PubMed databases was performed. A focus was made on peer-reviewed dental journals. Only articles related to anodized implants were included. Both animal and human studies were included. Results: The initial search of articles resulted in 581 articles on anodized implants. The initial screening of titles and abstracts resulted in 112 full-text papers; 40 animal studies, 16 studies on cell adhesion and bacterial adhesion onto anodized surfaced implants, and 47 human studies were included. Nine studies, which do not fulfill the inclusion criteria, were excluded. Conclusions: The long-term studies on anodized surface implants do favor the surface, but in most of the studies, anodized surface is compared with that of machined surface, but not with other surfaces commercially available. Anodized surface in terms of clinical success rate in cases of compromised bone and immediately extracted sockets has shown favorable success.

  13. Surface science an introduction

    CERN Document Server

    Hudson, John

    1991-01-01

    The whole field of surface science is covered in this work. Starting with a description of the structure and thermodynamics of clean surfaces, the book goes on to discuss kinetic theory of gases and molecular beam formation. This is followed by a largesection on gas-surface interactions, and another major section on energetic particle-surface interactions. The final chapter provides the background to crystal nucleation and growth. The approach adopted is interdisciplinary and slanted towards theexperimental side, with practical analytical techniques being used to illustrate general princi

  14. Surface chemistry essentials

    CERN Document Server

    Birdi, K S

    2013-01-01

    Surface chemistry plays an important role in everyday life, as the basis for many phenomena as well as technological applications. Common examples range from soap bubbles, foam, and raindrops to cosmetics, paint, adhesives, and pharmaceuticals. Additional areas that rely on surface chemistry include modern nanotechnology, medical diagnostics, and drug delivery. There is extensive literature on this subject, but most chemistry books only devote one or two chapters to it. Surface Chemistry Essentials fills a need for a reference that brings together the fundamental aspects of surface chemistry w

  15. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients: Validated and tested for the adsorption of 1-Octanol at a microscopic air-water interface and its dissolution into water.

    Science.gov (United States)

    Kinoshita, Koji; Parra, Elisa; Needham, David

    2017-02-15

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain "dead time" at initial measurement. These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the "micropipette interfacial area-expansion method" was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion controlled molecular adsorption at the air-water interfaces. To validate the new technique, the diffusion coefficient of 1-Octanol in water was investigated with existing models: the Ward Tordai model for the long time adsorption regime (1-100s), and the Langmuir and Frumkin adsorption isotherm models for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2±0.8×10 -6 cm 2 /s, showed excellent agreement with the result from an alternative method, "single microdroplet catching method", to measure the diffusion coefficient from diffusion-controlled microdroplet dissolution, 7.3±0.1×10 -6 cm 2 /s. These new techniques for determining adsorption and diffusion coefficients can apply for a range of surface active molecules, especially the less-characterized ionic surfactants, and biological compounds such as lipids, peptides, and proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. [Ocular surface system integrity].

    Science.gov (United States)

    Safonova, T N; Pateyuk, L S

    2015-01-01

    The interplay of different structures belonging to either the anterior segment of the eye or its accessory visual apparatus, which all share common embryological, anatomical, functional, and physiological features, is discussed. Explanation of such terms, as ocular surface, lacrimal functional unit, and ocular surface system, is provided.

  17. Pseudospherical surfaces with singularities

    DEFF Research Database (Denmark)

    Brander, David

    2017-01-01

    We study a generalization of constant Gauss curvature −1 surfaces in Euclidean 3-space, based on Lorentzian harmonic maps, that we call pseudospherical frontals. We analyse the singularities of these surfaces, dividing them into those of characteristic and non-characteristic type. We give methods...

  18. Solar absorption surface panel

    Science.gov (United States)

    Santala, Teuvo J.

    1978-01-01

    A composite metal of aluminum and nickel is used to form an economical solar absorption surface for a collector plate wherein an intermetallic compound of the aluminum and nickel provides a surface morphology with high absorptance and relatively low infrared emittance along with good durability.

  19. Random surfaces and strings

    International Nuclear Information System (INIS)

    Ambjoern, J.

    1987-08-01

    The theory of strings is the theory of random surfaces. I review the present attempts to regularize the world sheet of the string by triangulation. The corresponding statistical theory of triangulated random surfaces has a surprising rich structure, but the connection to conventional string theory seems non-trivial. (orig.)

  20. Stiction in surface micromachining

    NARCIS (Netherlands)

    Tas, Niels Roelof; Sonnenberg, A.H.; Jansen, Henricus V.; Legtenberg, R.; Legtenberg, Rob; Elwenspoek, Michael Curt

    1996-01-01

    Due to the smoothness of the surfaces in surface micromachining, large adhesion forces between fabricated structures and the substrate are encountered. Four major adhesion mechanisms have been analysed: capillary forces, hydrogen bridging, electrostatic forces and van der Waals forces. Once contact

  1. Surface Acoustic Wave Devices

    DEFF Research Database (Denmark)

    Dühring, Maria Bayard

    The work of this project is concerned with the simulation of surface acoustic waves (SAW) and topology optimization of SAW devices. SAWs are elastic vibrations that propagate along a material surface and are extensively used in electromechanical filters and resonators in telecommunication. A new...

  2. Bacteria-surface interactions.

    Science.gov (United States)

    Tuson, Hannah H; Weibel, Douglas B

    2013-05-14

    The interaction of bacteria with surfaces has important implications in a range of areas, including bioenergy, biofouling, biofilm formation, and the infection of plants and animals. Many of the interactions of bacteria with surfaces produce changes in the expression of genes that influence cell morphology and behavior, including genes essential for motility and surface attachment. Despite the attention that these phenotypes have garnered, the bacterial systems used for sensing and responding to surfaces are still not well understood. An understanding of these mechanisms will guide the development of new classes of materials that inhibit and promote cell growth, and complement studies of the physiology of bacteria in contact with surfaces. Recent studies from a range of fields in science and engineering are poised to guide future investigations in this area. This review summarizes recent studies on bacteria-surface interactions, discusses mechanisms of surface sensing and consequences of cell attachment, provides an overview of surfaces that have been used in bacterial studies, and highlights unanswered questions in this field.

  3. Protective Surfacing for Playgrounds.

    Science.gov (United States)

    Frost, Joe L.

    Noting that 90 percent of serious playground injuries result from falls to hard surfaces, this paper reviews the advantages and disadvantages of various playground surfacing materials in terms of cost, climate, durability, aesthetics, and play value. Findings are based on the personal experience of the author, government documents, laboratory…

  4. Chapter 8:Surface Characterization

    Science.gov (United States)

    Mandla A. Tshabalala; Joseph Jakes; Mark R. VanLandingham; Shaoxia Wang; Jouko. Peltonen

    2013-01-01

    Surface properties of wood play an important role when wood is used or processed into different commodities such as siding, joinery, textiles, paper, sorption media, or wood composites. Thus, for example, the quality and durability of a wood coating are determined by the surface properties of the wood and the coating. The same is true for wood composites where the...

  5. Response Surface Methodology

    NARCIS (Netherlands)

    Kleijnen, Jack P.C.

    2014-01-01

    Abstract: This chapter first summarizes Response Surface Methodology (RSM), which started with Box and Wilson’s article in 1951 on RSM for real, non-simulated systems. RSM is a stepwise heuristic that uses first-order polynomials to approximate the response surface locally. An estimated polynomial

  6. Surface Loving and Surface Avoiding modes

    OpenAIRE

    Combe, Nicolas; Huntzinger, Jean Roch; Morillo, Joseph

    2008-01-01

    International audience; We theoretically study the propagation of sound waves in GaAs/AlAs superlattices focussing on periodic modes in the vicinity of the band gaps. Based on analytical and numerical calculations, we show that these modes are the product of a quickly oscillating function times a slowly varying envelope function. We carefully study the phase of the envelope function compared to the surface of a semi-infinite superlattice. Especially, the dephasing of the superlattice compared...

  7. Workbench surface editor of brain cortical surface

    Science.gov (United States)

    Dow, Douglas E.; Nowinski, Wieslaw L.; Serra, Luis

    1996-04-01

    We have developed a 3D reach-in tool to manually reconstruct 3D cortical surface patches from 2D brain atlas images. The first application of our cortex editor is building 3D functional maps, specifically Brodmann's areas. This tool may also be useful in clinical practice to adjust incorrectly mapped atlas regions due to the deforming effect of lesions. The cortex editor allows a domain expert to control the correlation of control points across slices. Correct correlation has been difficult for 3D reconstruction algorithms because the atlas slices are far apart and because of the complex topology of the cortex which differs so much from slice to slice. Also, higher precision of the resulting surfaces is demanded since these define 3D brain atlas features upon which future stereotactic surgery may be based. The cortex editor described in this paper provides a tool suitable for a domain expert to use in defining the 3D surface of a Brodmann's area.

  8. Antibacterial Au nanostructured surfaces

    Science.gov (United States)

    Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun

    2016-01-01

    We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all

  9. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry; von Glehn, Ingrid; Macdonald, Colin B.; Marz, Thomas

    2013-01-01

    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  10. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry

    2013-09-01

    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  11. Rough Surface Contact

    Directory of Open Access Journals (Sweden)

    T Nguyen

    2017-06-01

    Full Text Available This paper studies the contact of general rough curved surfaces having nearly identical geometries, assuming the contact at each differential area obeys the model proposed by Greenwood and Williamson. In order to account for the most general gross geometry, principles of differential geometry of surface are applied. This method while requires more rigorous mathematical manipulations, the fact that it preserves the original surface geometries thus makes the modeling procedure much more intuitive. For subsequent use, differential geometry of axis-symmetric surface is considered instead of general surface (although this “general case” can be done as well in Chapter 3.1. The final formulas for contact area, load, and frictional torque are derived in Chapter 3.2.

  12. Super Riemann surfaces

    International Nuclear Information System (INIS)

    Rogers, Alice

    1990-01-01

    A super Riemann surface is a particular kind of (1,1)-dimensional complex analytic supermanifold. From the point of view of super-manifold theory, super Riemann surfaces are interesting because they furnish the simplest examples of what have become known as non-split supermanifolds, that is, supermanifolds where the odd and even parts are genuinely intertwined, as opposed to split supermanifolds which are essentially the exterior bundles of a vector bundle over a conventional manifold. However undoubtedly the main motivation for the study of super Riemann surfaces has been their relevance to the Polyakov quantisation of the spinning string. Some of the papers on super Riemann surfaces are reviewed. Although recent work has shown all super Riemann surfaces are algebraic, some areas of difficulty remain. (author)

  13. Defects at oxide surfaces

    CERN Document Server

    Thornton, Geoff

    2015-01-01

    This book presents the basics and characterization of defects at oxide surfaces. It provides a state-of-the-art review of the field, containing information to the various types of surface defects, describes analytical methods to study defects, their chemical activity and the catalytic reactivity of oxides. Numerical simulations of defective structures complete the picture developed. Defects on planar surfaces form the focus of much of the book, although the investigation of powder samples also form an important part. The experimental study of planar surfaces opens the possibility of applying the large armoury of techniques that have been developed over the last half-century to study surfaces in ultra-high vacuum. This enables the acquisition of atomic level data under well-controlled conditions, providing a stringent test of theoretical methods. The latter can then be more reliably applied to systems such as nanoparticles for which accurate methods of characterization of structure and electronic properties ha...

  14. Surface preparation of niobium

    International Nuclear Information System (INIS)

    Kneisel, P.

    1980-01-01

    Any discussion of surface preparation for superconducting rf-surfaces is certainly connected with the question what is the best recipe for achieving high Q-values and high break-down fields. Since the break-down in a cavity is not understood so far and because several mechanisms play a role, it also is not possible to give one recipe which always works. Nevertheless in the past certain preparation techniques for niobium surfaces have been developed and certain rules for preparation can be applied. In the following the to-days state of the art will be described and it is attempted to give a short description of the surface in conjunction with the methods of surface treatments, which generally can be applied to niobium cavities. (orig./WTR)

  15. Surface enhanced Raman scattering

    CERN Document Server

    Furtak, Thomas

    1982-01-01

    In the course of the development of surface science, advances have been identified with the introduction of new diagnostic probes for analytical characterization of the adsorbates and microscopic structure of surfaces and interfaces. Among the most recently de­ veloped techniques, and one around which a storm of controversy has developed, is what has now been earmarked as surface enhanced Raman scattering (SERS). Within this phenomenon, molecules adsorbed onto metal surfaces under certain conditions exhibit an anomalously large interaction cross section for the Raman effect. This makes it possible to observe the detailed vibrational signature of the adsorbate in the ambient phase with an energy resolution much higher than that which is presently available in electron energy loss spectroscopy and when the surface is in contact with a much larger amount of material than that which can be tolerated in infrared absorption experiments. The ability to perform vibrational spectroscopy under these conditions would l...

  16. Land Surface Data Assimilation

    Science.gov (United States)

    Houser, P. R.

    2012-12-01

    Information about land surface water, energy and carbon conditions is of critical importance to real-world applications such as agricultural production, water resource management, flood prediction, water supply, weather and climate forecasting, and environmental preservation. While ground-based observational networks are improving, the only practical way to observe these land surface states on continental to global scales is via satellites. Remote sensing can make spatially comprehensive measurements of various components of the terrestrial system, but it cannot provide information on the entire system (e.g. evaporation), and the observations represent only an instant in time. Land surface process models may be used to predict temporal and spatial terrestrial dynamics, but these predictions are often poor, due to model initialization, parameter and forcing, and physics errors. Therefore, an attractive prospect is to combine the strengths of land surface models and observations (and minimize the weaknesses) to provide a superior terrestrial state estimate. This is the goal of land surface data assimilation. Data Assimilation combines observations into a dynamical model, using the model's equations to provide time continuity and coupling between the estimated fields. Land surface data assimilation aims to utilize both our land surface process knowledge, as embodied in a land surface model, and information that can be gained from observations. Both model predictions and observations are imperfect and we wish to use both synergistically to obtain a more accurate result. Moreover, both contain different kinds of information, that when used together, provide an accuracy level that cannot be obtained individually. Model biases can be mitigated using a complementary calibration and parameterization process. Limited point measurements are often used to calibrate the model(s) and validate the assimilation results. This presentation will provide a brief background on land

  17. PREFACE: Nanostructured surfaces

    Science.gov (United States)

    Palmer, Richard E.

    2003-10-01

    We can define nanostructured surfaces as well-defined surfaces which contain lateral features of size 1-100 nm. This length range lies well below the micron regime but equally above the Ångstrom regime, which corresponds to the interatomic distances on single-crystal surfaces. This special issue of Journal of Physics: Condensed Matter presents a collection of twelve papers which together address the fabrication, characterization, properties and applications of such nanostructured surfaces. Taken together they represent, in effect, a status report on the rapid progress taking place in this burgeoning area. The first four papers in this special issue have been contributed by members of the European Research Training Network ‘NanoCluster’, which is concerned with the deposition, growth and characterization of nanometre-scale clusters on solid surfaces—prototypical examples of nanoscale surface features. The paper by Vandamme is concerned with the fundamentals of the cluster-surface interaction; the papers by Gonzalo and Moisala address, respectively, the optical and catalytic properties of deposited clusters; and the paper by van Tendeloo reports the application of transmission electron microscopy (TEM) to elucidate the surface structure of spherical particles in a catalyst support. The fifth paper, by Mendes, is also the fruit of a European Research Training Network (‘Micro-Nano’) and is jointly contributed by three research groups; it reviews the creation of nanostructured surface architectures from chemically-synthesized nanoparticles. The next five papers in this special issue are all concerned with the characterization of nanostructured surfaces with scanning tunnelling microscopy (STM) and atomic force microscopy (AFM). The papers by Bolotov, Hamilton and Dunstan demonstrate that the STM can be employed for local electrical measurements as well as imaging, as illustrated by the examples of deposited clusters, model semiconductor structures and real

  18. A multi-level surface rebalancing approach for efficient convergence acceleration of 3D full core multi-group fine grid nodal diffusion iterations

    International Nuclear Information System (INIS)

    Geemert, René van

    2014-01-01

    Highlights: • New type of multi-level rebalancing approach for nodal transport. • Generally improved and more mesh-independent convergence behavior. • Importance for intended regime of 3D pin-by-pin core computations. - Abstract: A new multi-level surface rebalancing (MLSR) approach has been developed, aimed at enabling an improved non-linear acceleration of nodal flux iteration convergence in 3D steady-state and transient reactor simulation. This development is meant specifically for anticipating computational needs for solving envisaged multi-group diffusion-like SP N calculations with enhanced mesh resolution (i.e. 3D multi-box up to 3D pin-by-pin grid). For the latter grid refinement regime, the previously available multi-level coarse mesh rebalancing (MLCMR) strategy has been observed to become increasingly inefficient with increasing 3D mesh resolution. Furthermore, for very fine 3D grids that feature a very fine axial mesh as well, non-convergence phenomena have been observed to emerge. In the verifications pursued up to now, these problems have been resolved by the new approach. The novelty arises from taking the interface current balance equations defined over all Cartesian box edges, instead of the nodal volume-integrated process-rate balance equation, as an appropriate restriction basis for setting up multi-level acceleration of fine grid interface current iterations. The new restriction strategy calls for the use of a newly derived set of adjoint spectral equations that are needed for computing a limited set of spectral response vectors per node. This enables a straightforward determination of group-condensed interface current spectral coupling operators that are of crucial relevance in the new rebalancing setup. Another novelty in the approach is a new variational method for computing the neutronic eigenvalue. Within this context, the latter is treated as a control parameter for driving another, newly defined and numerically more fundamental

  19. Surface structure of MgO underlayer with Ti diffusion for (002 oriented L10 FePt-based heat assisted magnetic recording media

    Directory of Open Access Journals (Sweden)

    Sintaro Hinata

    2018-05-01

    Full Text Available Surface morphology of the MgO layer and magnetic properties of FePt-C layer deposited on the MgO were investigated for the FePt-based heat assisted magnetic recording media. Stacking structure of the underlayer for the FePt-C layer was MgO (0-5 nm/Cr80Mn20 (0-30 nm/Cr50Ti50 (0-50 nm/glass sub.. Surface observation result for the MgO film by using an atomic force microscope revealed the existence of nodules with a height of about 2 nm and a network-like convex structure with a height difference of about sub nm (boundary wall, BW on the MgO crystal grain boundary. Density of the nodules largely depends on the surface roughness of the CrTi layer, RaCrTi and it is suppressed from 10 to 2/0.5 μm2 by reducing RaCrTi from 420 to 260 pm. Height of the BW depends on thickness of the MgO layer, tMgO and it can be suppressed by reducing tMgO to less than 4 nm. From the cross-sectional energy dispersive x-ray mapping, it is clarified that the BW is formed by atomic diffusion of Ti atoms from CrTi layer due to the substrate heating process, and a compound consists of Mg, Ti and O atoms. This BW can be used as a template to magnetically isolate the FePt column in the FePt-based granular film, such as FePt-SiO2, if the size of the BW is reduced to less than 10 nm. M-H loop of the FePt-C granular film deposited on the underlayer showed that the nodule and BW induce oxidation of the FePt grains, and reduction of intergranular exchange coupling.

  20. Surface structure of MgO underlayer with Ti diffusion for (002) oriented L10 FePt-based heat assisted magnetic recording media

    Science.gov (United States)

    Hinata, Sintaro; Jo, Shin; Saito, Shin

    2018-05-01

    Surface morphology of the MgO layer and magnetic properties of FePt-C layer deposited on the MgO were investigated for the FePt-based heat assisted magnetic recording media. Stacking structure of the underlayer for the FePt-C layer was MgO (0-5 nm)/Cr80Mn20 (0-30 nm)/Cr50Ti50 (0-50 nm)/glass sub.. Surface observation result for the MgO film by using an atomic force microscope revealed the existence of nodules with a height of about 2 nm and a network-like convex structure with a height difference of about sub nm (boundary wall, BW) on the MgO crystal grain boundary. Density of the nodules largely depends on the surface roughness of the CrTi layer, RaCrTi and it is suppressed from 10 to 2/0.5 μm2 by reducing RaCrTi from 420 to 260 pm. Height of the BW depends on thickness of the MgO layer, tMgO and it can be suppressed by reducing tMgO to less than 4 nm. From the cross-sectional energy dispersive x-ray mapping, it is clarified that the BW is formed by atomic diffusion of Ti atoms from CrTi layer due to the substrate heating process, and a compound consists of Mg, Ti and O atoms. This BW can be used as a template to magnetically isolate the FePt column in the FePt-based granular film, such as FePt-SiO2, if the size of the BW is reduced to less than 10 nm. M-H loop of the FePt-C granular film deposited on the underlayer showed that the nodule and BW induce oxidation of the FePt grains, and reduction of intergranular exchange coupling.

  1. Surface Habitat Systems

    Science.gov (United States)

    Kennedy, Kriss J.

    2009-01-01

    The Surface Habitat Systems (SHS) Focused Investment Group (FIG) is part of the National Aeronautics and Space Administration (NASA) Johnson Space Center (JSC) effort to provide a focused direction and funding to the various projects that are working on human surface habitat designs and technologies for the planetary exploration missions. The overall SHS-FIG effort focuses on directing and guiding those projects that: 1) develop and demonstrate new surface habitat system concepts, innovations, and technologies to support human exploration missions, 2) improve environmental systems that interact with human habitats, 3) handle and emplace human surface habitats, and 4) focus on supporting humans living and working in habitats on planetary surfaces. The activity areas of the SHS FIG described herein are focused on the surface habitat project near-term objectives as described in this document. The SHS-FIG effort focuses on mitigating surface habitat risks (as identified by the Lunar Surface Systems Project Office (LSSPO) Surface Habitat Element Team; and concentrates on developing surface habitat technologies as identified in the FY08 gap analysis. The surface habitat gap assessment will be updated annually as the surface architecture and surface habitat definition continues to mature. These technologies are mapped to the SHS-FIG Strategic Development Roadmap. The Roadmap will bring to light the areas where additional innovative efforts are needed to support the development of habitat concepts and designs and the development of new technologies to support of the LSSPO Habitation Element development plan. Three specific areas of development that address Lunar Architecture Team (LAT)-2 and Constellation Architecture Team (CxAT) Lunar habitat design issues or risks will be focused on by the SHS-FIG. The SHS-FIG will establish four areas of development that will help the projects prepare in their planning for surface habitat systems development. Those development areas are

  2. Antibacterial Au nanostructured surfaces.

    Science.gov (United States)

    Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun

    2016-02-07

    We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.

  3. Electrokinetics on superhydrophobic surfaces

    International Nuclear Information System (INIS)

    Papadopoulos, Periklis; Deng Xu; Vollmer, Doris; Butt, Hans-Jürgen

    2012-01-01

    On a superhydrophobic surface a liquid is exposed to a large air-water interface. The reduced wall friction is expected to cause a higher electro-osmotic mobility. On the other hand, the low charge density of a superhydrophobic surface reduces the electro-osmotic mobility. Due to a lack of experimental data it has not been clear so far whether the reduced wall friction or the reduced charge density dominate the electrokinetic mobilities. To separate the relative contributions of electrophoresis and electro-osmosis, the mobilities of colloids on a negatively charged hydrophilic, a superhydrophobic (Cassie) and a partially hydrophilized superhydrophobic (Cassie composite) coating were measured. To vary the charge density as well as its sign with respect to those of the colloids the partially hydrophilized surfaces were coated with polyelectrolytes. We analyzed the electrokinetic mobilities of negatively charged polystyrene colloids dispersed in aqueous medium on porous hydrophilic and superhydrophobic surfaces by confocal laser scanning electron microscopy. In all cases, the external electric field was parallel to the surface. The total electrokinetic mobilities on the superhydrophobic (Cassie) and negatively charged partially hydrophilized (Cassie composite) surfaces were similar, showing that electro-osmosis is small compared to electrophoresis. The positively charged Cassie composite surfaces tend to ‘trap’ the colloids due to attracting electrostatic interactions and rough morphology, reducing the mobility. Thus, either the charge density of the coatings in the Cassie composite state or its slip length is too low to enhance electro-osmosis.

  4. Plasma-surface interactions

    International Nuclear Information System (INIS)

    Goeckner, M J; Nelson, C T; Sant, S P; Jindal, A K; Joseph, E A; Zhou, B S; Padron-Wells, G; Jarvis, B; Pierce, R; Overzet, L J

    2008-01-01

    Materials processing is at a crossroads. Currently a large fraction of industrially viable materials processing is via plasmas. Until recently it has been economical to just examine the influence the plasma properties on the desired surface processes and through this ultimately optimize manufacturing. For example, it is well known that the surface processes (etch or deposition), occur in the top few mono-layers of the surface. Thus, in film growth one requires that molecules from the gas-phase land and bond on the surface. However as processing has reached the nano-scale, development of viable processes has become more and more difficult. In part, this is because of all of the free parameters that exist in plasmas. To overcome this economic issue, tool vendors and semiconductor companies have turned to complex computational models of processing plasmas. For those models to work, one requires a through understanding of all of the gas-phase and surface-phase processes that are exhibited in plasmas. Unfortunately, these processes, particularly those at the surface, are not well understood. In this article we describe a viable model of the surface-phase based on cross sections for processes that occur. While originally developed of fluorocarbon systems, the model also appears to be applicable to hydrocarbon systems.

  5. Plasma-surface interactions

    Energy Technology Data Exchange (ETDEWEB)

    Goeckner, M J; Nelson, C T; Sant, S P; Jindal, A K; Joseph, E A; Zhou, B S; Padron-Wells, G; Jarvis, B; Pierce, R; Overzet, L J [Department of Electrical Engineering, University of Texas at Dallas (United States)], E-mail: goeckner@utdallas.edu

    2008-10-01

    Materials processing is at a crossroads. Currently a large fraction of industrially viable materials processing is via plasmas. Until recently it has been economical to just examine the influence the plasma properties on the desired surface processes and through this ultimately optimize manufacturing. For example, it is well known that the surface processes (etch or deposition), occur in the top few mono-layers of the surface. Thus, in film growth one requires that molecules from the gas-phase land and bond on the surface. However as processing has reached the nano-scale, development of viable processes has become more and more difficult. In part, this is because of all of the free parameters that exist in plasmas. To overcome this economic issue, tool vendors and semiconductor companies have turned to complex computational models of processing plasmas. For those models to work, one requires a through understanding of all of the gas-phase and surface-phase processes that are exhibited in plasmas. Unfortunately, these processes, particularly those at the surface, are not well understood. In this article we describe a viable model of the surface-phase based on cross sections for processes that occur. While originally developed of fluorocarbon systems, the model also appears to be applicable to hydrocarbon systems.

  6. The effect of radiation-thermal treatment on the physicochemical properties of the Ni-Mo/Al2O3 hydrotreatment catalyst. II. UV-Vis diffuse reflectance spectra of surface compounds after irradiation

    International Nuclear Information System (INIS)

    Solovetskii, Yu.I.; Miroshinichenko, I.I.; Lunin, V.V.

    1993-01-01

    Radiation-thermal damage of the surface and the active metal phases of hydrodesulfurization Ni-Mo/Al 2 O 3 catalysts by a fast electron beam of up to 2.0 MeV energy was studied. UV-Vis diffuse reflectance spectra of the industrial and model coked systems after radiation-thermal treatment were measured. 14 refs., 2 figs

  7. Adsorption and diffusion of H and NH{sub x} as key steps of the NH{sub x} dehydrogenation reaction at the V{sub 2}O{sub 5} (010) surface

    Energy Technology Data Exchange (ETDEWEB)

    Gruber, Mathis; Hermann, Klaus [Fritz-Haber-Institut der MPG, und Sfb 546, Berlin (Germany)

    2009-07-01

    Various selective oxidation reactions as the selective catalytic reduction (SCR) of NO{sub x} or the ammoxidation of propane/propene to acrylonitrile are processed on vanadium based metal-oxide catalysts in the presence of ammonia. In the reactions the intermediates NH{sub 2}, NH{sub 3}, and NH{sub 4} are involved indicating that the adsorption and dehydrogenation of NH{sub x}, x < 4, are important steps. We have performed theoretical studies of corresponding reaction steps where the catalyst is simulated by a finite section of the V{sub 2}O{sub 5} (010) surface. The calculations apply density-functional theory combined with clusters modeling the adsorbate system. The substrate lowers corresponding dehydrogenation energies considerably compared with values for the gas phase reaction. However, the lowering is too small to make dehydrogenation of NH{sub 3} likely to happen. Our results on the role of oxygen vacancies for the dehydrogenation indicate that such surface defects become important for the reaction. Besides the energetics also the diffusion at the surface influences the reaction. A nudged elastic band (NEB) routine has been implemented to evaluate diffusion paths and barriers. Hydrogen diffusion on the surface will be discussed and additional examples for NH{sub x} diffusion will be shown. Based on these results possible reaction scenarios for the dehydrogenation reaction will be presented.

  8. Surface science techniques

    CERN Document Server

    Walls, JM

    2013-01-01

    This volume provides a comprehensive and up to the minute review of the techniques used to determine the nature and composition of surfaces. Originally published as a special issue of the Pergamon journal Vacuum, it comprises a carefully edited collection of chapters written by specialists in each of the techniques and includes coverage of the electron and ion spectroscopies, as well as the atom-imaging methods such as the atom probe field ion microscope and the scanning tunnelling microscope. Surface science is an important area of study since the outermost surface layers play a crucial role

  9. Surface modes in physics

    CERN Document Server

    Sernelius, Bo E

    2011-01-01

    Electromagnetic surface modes are present at all surfaces and interfaces between material of different dielectric properties. These modes have very important effects on numerous physical quantities: adhesion, capillary force, step formation and crystal growth, the Casimir effect etc. They cause surface tension and wetting and they give rise to forces which are important e.g. for the stability of colloids.This book is a useful and elegant approach to the topic, showing how the concept of electromagnetic modes can be developed as a unifying theme for a range of condensed matter physics. The

  10. Localized Acoustic Surface Modes

    KAUST Repository

    Farhat, Mohamed

    2015-08-04

    We introduce the concept of localized acoustic surface modes (ASMs). We demonstrate that they are induced on a two-dimensional cylindrical rigid surface with subwavelength corrugations under excitation by an incident acoustic plane wave. Our results show that the corrugated rigid surface is acoustically equivalent to a cylindrical scatterer with uniform mass density that can be represented using a Drude-like model. This, indeed, suggests that plasmonic-like acoustic materials can be engineered with potential applications in various areas including sensing, imaging, and cloaking.

  11. Surface physics : experimental

    International Nuclear Information System (INIS)

    Padalia, B.D.

    1978-01-01

    In this report, discussion is confined to some important ultra high vacuum surface techniques such as ultra-violet photoelectron spectroscopy (UPS), X-ray photoelectron spectroscopy (XPS), Auger electron spectroscopy (AES) and the low energy electron diffraction (LEED). An attempt is made to cover the basic principles and the experimental details of XPS and AES. Selected examples illustrating the potentialities of the above techniques to solve the important basic as well as applied problems relating to surfaces are presented. Salient features of the available commercial machines in which UPS, AES and LEED are combined to facilitate surface examination sequentially or simultaneously under identical experimental conditions are indicated. (auth.)

  12. Architectural Knitted Surfaces

    DEFF Research Database (Denmark)

    Mossé, Aurélie

    2010-01-01

    WGSN reports from the Architectural Knitted Surfaces workshop recently held at ShenkarCollege of Engineering and Design, Tel Aviv, which offered a cutting-edge insight into interactive knitted surfaces. With the increasing role of smart textiles in architecture, the Architectural Knitted Surfaces...... workshop brought together architects and interior and textile designers to highlight recent developments in intelligent knitting. The five-day workshop was led by architects Ayelet Karmon and Mette Ramsgaard Thomsen, together with Amir Cang and Eyal Sheffer from the Knitting Laboratory, in collaboration...

  13. Nonlinear surface electromagnetic phenomena

    CERN Document Server

    Ponath, H-E

    1991-01-01

    In recent years the physics of electromagnetic surface phenomena has developed rapidly, evolving into technologies for communications and industry, such as fiber and integrated optics. The variety of phenomena based on electromagnetism at surfaces is rich and this book was written with the aim of summarizing the available knowledge in selected areas of the field. The book contains reviews written by solid state and optical physicists on the nonlinear interaction of electromagnetic waves at and with surfaces and films. Both the physical phenomena and some potential applications are

  14. Depth Distribution Studies of Carbon in Steel Surfaces by Means of Charged Particle Activation Analysis with an Account of Heat and Diffusion Effects in the Sample

    Energy Technology Data Exchange (ETDEWEB)

    Brune, D; Lorenzen, J [AB Atomenergi, Nykoeping (Sweden); Witalis, E [Swedish National Defence Research Inst., Stockholm (Sweden)

    1972-05-15

    Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: {sup 12}C(p,{gamma}){sup 13}N and {sup 12}C(d,n){sup 13}N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, {sup 13}N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described.

  15. Surface- vs Diffusion-Limited Mechanisms of Anion Exchange in CsPbBr3 Nanocrystal Cubes Revealed through Kinetic Studies.

    Science.gov (United States)

    Koscher, Brent A; Bronstein, Noah D; Olshansky, Jacob H; Bekenstein, Yehonadav; Alivisatos, A Paul

    2016-09-21

    Ion-exchange transformations allow access to nanocrystalline materials with compositions that are inaccessible via direct synthetic routes. However, additional mechanistic insight into the processes that govern these reactions is needed. We present evidence for the presence of two distinct mechanisms of exchange during anion exchange in CsPbX3 nanocrystals (NCs), ranging in size from 6.5 to 11.5 nm, for transformations from CsPbBr3 to CsPbCl3 or CsPbI3. These NCs exhibit bright luminescence throughout the exchange, allowing their optical properties to be observed in real time, in situ. The iodine exchange presents surface-reaction-limited exchanges allowing all anionic sites within the NC to appear chemically identical, whereas the chlorine exchange presents diffusion-limited exchanges proceeding through a more complicated exchange mechanism. Our results represent the first steps toward developing a microkinetic description of the anion exchange, with implications not only for understanding the lead halide perovskites but also for nanoscale ion exchange in general.

  16. Bag model with diffuse surface

    International Nuclear Information System (INIS)

    Phatak, S.C.

    1986-01-01

    The constraint of a sharp bag boundary in the bag model is relaxed in the present work. This has been achieved by replacing the square-well potential of the bag model by a smooth scalar potential and introducing a term similar to the bag pressure term. The constraint of the conservation of the energy-momentum tensor is used to obtain an expression for the added bag pressure term. The model is then used to determine the static properties of the nucleon. The calculation shows that the rms charge radius and the nucleon magnetic moment are larger than the corresponding bag model values. Also, the axial vector coupling constant and the πNN coupling constant are in better agreement with the experimental values

  17. Ti, Al and N adatom adsorption and diffusion on rocksalt cubic AlN (001) and (011) surfaces: Ab initio calculations

    Science.gov (United States)

    Mastail, C.; David, M.; Nita, F.; Michel, A.; Abadias, G.

    2017-11-01

    We use ab initio calculations to determine the preferred nucleation sites and migration pathways of Ti, Al and N adatoms on cubic NaCl-structure (B1) AlN surfaces, primary inputs towards a further thin film growth modelling of the TiAlN alloy system. The potential energy landscape is mapped out for both metallic species and nitrogen adatoms for two different AlN surface orientations, (001) and (110), using density functional theory. For all species, the adsorption energies on AlN(011) surface are larger than on AlN(001) surface. Ti and Al adatom adsorption energy landscapes determined at 0 K by ab initio show similar features, with stable binding sites being located in, or near, epitaxial surface positions, with Ti showing a stronger binding compared to Al. In direct contrast, N adatoms (Nad) adsorb preferentially close to N surface atoms (Nsurf), thus forming strong N2-molecule-like bonds on both AlN(001) and (011). Similar to N2 desorption mechanisms reported for other cubic transition metal nitride surfaces, in the present work we investigate Nad/Nsurf desorption on AlN(011) using a drag calculation method. We show that this process leaves a Nsurf vacancy accompanied with a spontaneous surface reconstruction, highlighting faceting formation during growth.

  18. Surface Weather Observations

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Surface Weather Observation Collection consists primarily of hourly, synoptic, daily, and monthly forms submitted to the archive by the National Weather Service...

  19. Uruguay - Surface Weather Observations

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Surface weather observation forms for 26 stations in Uruguay. Period of record 1896-2005, with two to eight observations per day. Files created through a...

  20. Iowa Bedrock Surface Elevation

    Data.gov (United States)

    Iowa State University GIS Support and Research Facility — This Digital Elevation Model (DEM) of the bedrock surface elevation in Iowa was compiled using all available data, principally information from GEOSAM, supplemented...

  1. Paneling architectural freeform surfaces

    KAUST Repository

    Eigensatz, Michael; Kilian, Martin; Schiftner, Alexander; Mitra, Niloy J.; Pottmann, Helmut; Pauly, Mark

    2010-01-01

    with a selected technology at reasonable cost, while meeting the design intent and achieving the desired aesthetic quality of panel layout and surface smoothness. The production of curved panels is mostly based on molds. Since the cost of mold fabrication

  2. Vortices on hyperbolic surfaces

    International Nuclear Information System (INIS)

    Manton, Nicholas S; Rink, Norman A

    2010-01-01

    It is shown that Abelian Higgs vortices on a hyperbolic surface M can be constructed geometrically from holomorphic maps f: M → N, where N is also a hyperbolic surface. The fields depend on f and on the metrics of M and N. The vortex centres are the ramification points, where the derivative of f vanishes. The magnitude of the Higgs field measures the extent to which f is locally an isometry. Witten's construction of vortices on the hyperbolic plane is rederived, and new examples of vortices on compact surfaces and on hyperbolic surfaces of revolution are obtained. The interpretation of these solutions as SO(3)-invariant, self-dual SU(2) Yang-Mills fields on R 4 is also given.

  3. Land Surface Weather Observations

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is the international standard code format for hourly surface weather observations. The acronym roughly translates from French as Aviation Routine Weather...

  4. Average nuclear surface properties

    International Nuclear Information System (INIS)

    Groote, H. von.

    1979-01-01

    The definition of the nuclear surface energy is discussed for semi-infinite matter. This definition is extended also for the case that there is a neutron gas instead of vacuum on the one side of the plane surface. The calculations were performed with the Thomas-Fermi Model of Syler and Blanchard. The parameters of the interaction of this model were determined by a least squares fit to experimental masses. The quality of this fit is discussed with respect to nuclear masses and density distributions. The average surface properties were calculated for different particle asymmetry of the nucleon-matter ranging from symmetry beyond the neutron-drip line until the system no longer can maintain the surface boundary and becomes homogeneous. The results of the calculations are incorporated in the nuclear Droplet Model which then was fitted to experimental masses. (orig.)

  5. Mexico - Surface Weather Observations

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Mexican Surface Daily Observations taken at 94 observatories located throughout Mexico, beginning in 1872 and going up through 1981. The data resided on paper...

  6. Switching between pitch surfaces

    DEFF Research Database (Denmark)

    Rago, Vincenzo; Silva, João R; Brito, João

    2018-01-01

    Soccer training and completion is conventionally practiced on natural grass (NG) or artificial turf (AT). Recently, AT pitches for training / competition, and of unstable surfaces for injury prevention training has increased. Therefore, soccer players are frequently exposed to variations in pitch...... surface during either training or competition. These ground changes may impact physical and physiological responses, adaptations as well as the injury. The aim of this review was to summarize the acute physical and physiological responses, chronic adaptations, and injury risk associated with exercising...... on different pitch surfaces in soccer. Eligible studies were published in English, had pitch surface as an independent variable, and had physical, physiological or epidemiological information as outcome variables. Specific data extracted from the articles included the training response, training adaptations...

  7. Surface vibrational spectroscopy (EELS)

    International Nuclear Information System (INIS)

    Okuyama, Hiroshi

    2006-01-01

    Adsorbed states of hydrogen on metal surfaces have been studied by means of electron energy loss spectroscopy (EELS). In this article, typical spectra and analysis as well as recent development are introduced. (author)

  8. Surface Weather Observations Monthly

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Surface Weather Observation 1001 Forms is a set of historical manuscript records for the period 1893-1948. The collection includes two very similar form types: Form...

  9. Electron microscopy of surfaces

    International Nuclear Information System (INIS)

    Venables, J.A.

    1981-01-01

    Electron beam techniques used to study clean surfaces and surface processes on a microscopic scale are reviewed. Recent experimental examples and possible future developments are discussed. Special emphasis is given to (i) transmission diffraction and microscopy techniques, including atomic imaging; (ii) Auger microscopy on bulk and thin film samples; (iii) secondary electron microscopy, especially low energy secondaries for work-function imaging and photoelectron imaging; and (iv) reflection electron microscopy and diffraction. (orig.)

  10. Dyakonov surface waves

    DEFF Research Database (Denmark)

    Takayama, Osamu; Crasovan, Lucian Cornel; Johansen, Steffen Kjær

    2008-01-01

    The interface of two semi-infinite media, where at least one of them is a birefringent crystal, supports a special type of surface wave that was predicted theoretically by D'yakonov in 1988. Since then, the properties of such waves, which exist in transparent media only under very special......, the existence of these surface waves in specific material examples is analyzed, discussing the challenge posed by their experimental observation....

  11. Automated galaxy surface photometry

    International Nuclear Information System (INIS)

    Cawson, M.G.M.; Kibblewhite, E.J.; Disney, M.J.; Phillipps, S.

    1987-01-01

    Two-dimensional surface photometry of a very large number of galaxies on a deep Schmidt plate has been obtained using the Automatic Plate Measuring System (APM). A method of photometric calibration, suitable for APM measurements, via pixel-by-pixel comparison with CCD frames of a number of the brighter galaxies is described and its advantages are discussed. The same method is used to demonstrate the consistency of measurement of the APM machine when used for surface photometry. (author)

  12. Effect of TiO{sub 2} additive on the sintering of nuclear fuel (U,Pu)O{sub 2}. Contribution of surface diffusion to plutonium distribution; Influence de l`ajout de TiO{sub 2} sur l`aptitude au frittage du combustible nucleaire (U,Pu)O{sub 2}. Contribution de la diffusion de surface a la repartition du plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Bremier, Stephane [CEA Centre d`Etudes de Cadarache, 13 - Saint-Paul-lez-Durance (France)

    1997-12-19

    This thesis has as objective the study of the effect of TiO{sub 2} additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO{sub 2} in the presence of TiO{sub 2} has been established and the influence of the PuO{sub 2} distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO{sub 2} and UO{sub 2}-PuO{sub 2}. The results concerning the influence of TiO{sub 2} upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO{sub 2} alone or in the presence of TiO{sub 2} are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO{sub 2}-PuO{sub 2} preparation upon the initial microstructure of the materials and the role played by the PuO{sub 2} grains in sintering. The potentiality of surface diffusion as a means of PuO{sub 2} spreading in the UO{sub 2} is evaluated and correlated with the reduced capacity of sintering the UO{sub 2} ceramics containing PuO{sub 2}. The last chapter deals with the influence of TiO{sub 2} on the development of microstructure in UO{sub 2}-PuO{sub 2} ceramics. While at temperatures below 1500 deg.C the TiO{sub 2} additive affects the surface diffusion and so the plutonium distribution, at values T{>=} 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO{sub 2}, PuO{sub 2} and titanium oxide. Thus the objective is

  13. Surface Relief of Mapping

    Science.gov (United States)

    Costa, Manuel F.; Almeida, Jose B.

    1989-02-01

    We will describe in this communication a noncont act method of measuring surface profile, it does not require any surface preparation, and it can be used with a very large range of surfaces from highly reflecting to non reflecting ones and as complex as textile surfaces. This method is reasonably immune to dispersion and diffraction, which usually make very difficult the application of non contact profilometry methods to a wide range of materials and situations, namely on quality control systems in industrial production lines. The method is based on the horizontal shift of the bright spot on a horizontal surface when this is illuminated with an oblique beam and moved vertically. in order to make the profilometry the sample is swept by an oblique light beam and the bright spot position is compared with a reference position. The bright spot must be as small as possible, particularly in very irregular surfaces; so the light beam diameter must be as small as possible and the incidence angle must not be too small. The sensivity of a system based on this method will be given, mostly, by the reception optical system.

  14. Modification of rubber surface by UV surface grafting

    International Nuclear Information System (INIS)

    Shanmugharaj, A.M.; Kim, Jin Kuk; Ryu, Sung Hun

    2006-01-01

    Rubber surface is subjected to ultraviolet radiation (UV) in the presence of allylamine and radiation sensitizer benzophenone (BP). Fourier transform infrared spectral studies reveal the presence of allylamine on the surface. The presence of irregular needle shapes on the surface as observed in scanning electron micrographs also confirms the polymerized allylamine on the surface. Allylamine coatings have been further confirmed from atomic force microscopy (AFM) analysis. Thermogravimetric analysis (TGA) reveals that allylamine coating on the rubber surface lowers the thermal degradation rate. The contact angle between the water and rubber surface decreases for the modified rubber surface confirming the surface modification due to UV surface grafting

  15. Glycoprotein on cell surfaces

    International Nuclear Information System (INIS)

    Muramatsu, T.

    1975-01-01

    There are conjugated polysaccharides in cell membranes and outside of animal cells, and they play important role in the control of cell behavior. In this paper, the studies on the glycoprotein on cell surfaces are reported. It was found that the glycoprotein on cell surfaces have both N-glycoside type and O-glycoside type saccharic chains. Therefore it can be concluded that the basic structure of the saccharic chains in the glycoprotein on cell surfaces is similar to that of blood serum and body fluid. The main glycoprotein in the membranes of red blood corpuscles has been studied most in detail, and it also has both types of saccharic chains. The glycoprotein in liver cell membranes was found to have only the saccharic chains of acid type and to be in different pattern from that in endoplasmic reticula and nuclear membranes, which also has the saccharic chains of neutral type. The structure of the saccharic chains of H-2 antigen, i.e. the peculiar glycoprotein on the surfaces of lymph system cells, has been studied, and it is similar to the saccharic chains of glycoprotein in blood serum. The saccharic chain structures of H-2 antigen and TL antigen are different. TL, H-2 (D), Lna and H-2 (K) are the glycoprotein on cell surfaces, and are independent molecules. The analysis of the saccharic chain patterns on cell surfaces was carried out, and it was shown that the acid type saccharic chains were similar to those of ordinary glycoprotein, because the enzyme of pneumococci hydrolyzed most of the acid type saccharic chains. The change of the saccharic chain patterns of glycoprotein on cell surfaces owing to canceration and multiplication is complex matter. (Kako, I.)

  16. Mars Surface Environmental Issues

    Science.gov (United States)

    Charles, John

    2002-01-01

    Planetary exploration by astronauts will require extended periods of habitation on a planet's surface, under the influence of environmental factors that are different from those of Earth and the spacecraft that delivered the crew to the planet. Human exploration of Mars, a possible near-term planetary objective, can be considered a challenging scenario. Mission scenarios currently under consideration call for surface habitation periods of from 1 to 18 months on even the earliest expeditions. Methods: Environmental issues associated with Mars exploration have been investigated by NASA and the National Space Biomedical Research Institute (NSBRI) as part of the Bioastronautics Critical Path Roadmap Project (see http ://criticalpath.jsc.nasa.gov). Results: Arrival on Mars will immediately expose the crew to gravity only 38% of that at Earth's surface in possibly the first prolonged exposure to gravity other than the 1G of Earth's surface and the zero G of weightless space flight, with yet unknown effects on crew physiology. The radiation at Mars' surface is not well documented, although the planet's bulk and even its thin atmosphere may moderate the influx of galactic cosmic radiation and energetic protons from solar flares. Secondary radiation from activated components of the soil must also be considered. Ultrafine and larger respirable and nonrespirable particles in Martian dust introduced into the habitat after surface excursions may induce pulmonary inflammation exacerbated by the additive reactive and oxidizing nature of the dust. Stringent decontamination cannot eliminate mechanical and corrosive effects of the dust on pressure suits and exposed machinery. The biohazard potential of putative indigenous Martian microorganisms may be assessed by comparison with analog environments on Earth. Even in their absence, human microorganisms, if not properly controlled, can be a threat to the crew's health. Conclusions: Mars' surface offers a substantial challenge to the

  17. Surface chemistry theory and applications

    CERN Document Server

    Bikerman, J J

    2013-01-01

    Surface Chemistry Theory and Applications focuses on liquid-gas, liquid-liquid, solid-gas, solid-liquid, and solid-solid surfaces. The book first offers information on liquid-gas surfaces, including surface tension, measurement of surface tension, rate of capillarity rise, capillary attraction, bubble pressure and pore size, and surface tension and temperature. The text then ponders on liquid-liquid and solid-gas surfaces. Discussions focus on surface energy of solids, surface roughness and cleanness, adsorption of gases and vapors, adsorption hysteresis, interfacial tension, and interfacial t

  18. Smooth surfaces from bilinear patches: Discrete affine minimal surfaces

    KAUST Repository

    Kä ferbö ck, Florian; Pottmann, Helmut

    2013-01-01

    Motivated by applications in freeform architecture, we study surfaces which are composed of smoothly joined bilinear patches. These surfaces turn out to be discrete versions of negatively curved affine minimal surfaces and share many properties

  19. Viscoelastic Surface Waves

    Science.gov (United States)

    Borcherdt, R. D.

    2007-12-01

    General theoretical solutions for Rayleigh- and Love-Type surface waves in viscoelastic media describe physical characteristics of the surface waves in elastic as well as anelastic media with arbitrary amounts of intrinsic absorption. In contrast to corresponding physical characteristics for Rayleigh waves in elastic media, Rayleigh- Type surface waves in anelastic media demonstrate; 1) tilt of the particle motion orbit that varies with depth, and 2) amplitude and volumetric strain distributions with superimposed sinusoidal variations that decay exponentially with depth. Each characteristic is dependent on the amount of intrinsic absorption and the chosen model of viscoelasticity. Distinguishing characteristics of anelastic Love-Type surface waves include: 1) dependencies of the wave speed and absorption coefficient on the chosen model and amount of intrinsic absorption and frequency, and 2) superimposed sinusoidal amplitude variations with an exponential decay with depth. Numerical results valid for a variety of viscoelastic models provide quantitative estimates of the physical characteristics of both types of viscoelastic surface waves appropriate for interpretations pertinent to models of earth materials ranging from low-loss in the crust to moderate- and high-loss in water-saturated soils.

  20. Surface rheology and interface stability.

    Energy Technology Data Exchange (ETDEWEB)

    Yaklin, Melissa A.; Cote, Raymond O.; Moffat, Harry K.; Grillet, Anne Mary; Walker, Lynn; Koehler, Timothy P.; Reichert, Matthew D. (Carnegie Mellon University, Pittsburgh, PA); Castaneda, Jaime N.; Mondy, Lisa Ann; Brooks, Carlton, F.

    2010-11-01

    We have developed a mature laboratory at Sandia to measure interfacial rheology, using a combination of home-built, commercially available, and customized commercial tools. An Interfacial Shear Rheometer (KSV ISR-400) was modified and the software improved to increase sensitivity and reliability. Another shear rheometer, a TA Instruments AR-G2, was equipped with a du Nouey ring, bicone geometry, and a double wall ring. These interfacial attachments were compared to each other and to the ISR. The best results with the AR-G2 were obtained with the du Nouey ring. A Micro-Interfacial Rheometer (MIR) was developed in house to obtain the much higher sensitivity given by a smaller probe. However, it was found to be difficult to apply this technique for highly elastic surfaces. Interfaces also exhibit dilatational rheology when the interface changes area, such as occurs when bubbles grow or shrink. To measure this rheological response we developed a Surface Dilatational Rheometer (SDR), in which changes in surface tension with surface area are measured during the oscillation of the volume of a pendant drop or bubble. All instruments were tested with various surfactant solutions to determine the limitations of each. In addition, foaming capability and foam stability were tested and compared with the rheology data. It was found that there was no clear correlation of surface rheology with foaming/defoaming with different types of surfactants, but, within a family of surfactants, rheology could predict the foam stability. Diffusion of surfactants to the interface and the behavior of polyelectrolytes were two subjects studied with the new equipment. Finally, surface rheological terms were added to a finite element Navier-Stokes solver and preliminary testing of the code completed. Recommendations for improved implementation were given. When completed we plan to use the computations to better interpret the experimental data and account for the effects of the underlying bulk

  1. Surface engineering for enhanced performance against wear

    CERN Document Server

    2013-01-01

    Surface Engineering constitutes a variety of processes and sub processes. Each chapter of this work covers specific processes by experts working in the area. Included for each topic are tribological performances for each process as well as results of recent research. The reader also will benefit from in-depth studies of diffusion coatings, nanocomposite films for wear resistance, surfaces for biotribological applications, thin-film wear, tribology of thermal sprayed coatings, hardfacing, plating for tribology and high energy beam surface modifications. Material scientists as well as engineers working with surface engineering for tribology will be particularly interested in this work.

  2. Surface-water surveillance

    Energy Technology Data Exchange (ETDEWEB)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995).

  3. Surface states and spectra

    International Nuclear Information System (INIS)

    Jaksic, V.; Last, Y.; California Inst. of Tech., Pasadena, CA

    2001-01-01

    Let Z + d+1 =Z d x Z + , let H 0 be the discrete Laplacian on the Hilbert space l 2 (Z + d+1 ) with a Dirichlet boundary condition, and let V be a potential supported on the boundary ∂Z + d+1 . We introduce the notions of surface states and surface spectrum of the operator H=H 0 +V and explore their properties. Our main result is that if the potential V is random and if the disorder is either large or small enough, then in dimension two H has no surface spectrum on σ(H 0 ) with probability one. To prove this result we combine Aizenman-Molchanov theory with techniques of scattering theory. (orig.)

  4. Cryogenic surface ion traps

    International Nuclear Information System (INIS)

    Niedermayr, M.

    2015-01-01

    Microfabricated surface traps are a promising architecture to realize a scalable quantum computer based on trapped ions. In principle, hundreds or thousands of surface traps can be located on a single substrate in order to provide large arrays of interacting ions. To this end, trap designs and fabrication methods are required that provide scalable, stable and reproducible ion traps. This work presents a novel surface-trap design developed for cryogenic applications. Intrinsic silicon is used as the substrate material of the traps. The well-developed microfabrication and structuring methods of silicon are utilized to create simple and reproducible traps. The traps were tested and characterized in a cryogenic setup. Ions could be trapped and their life time and motional heating were investigated. Long ion lifetimes of several hours were observed and the measured heating rates were reproducibly low at around 1 phonon per second at a trap frequency of 1 MHz. (author) [de

  5. Responsive acoustic surfaces

    DEFF Research Database (Denmark)

    Peters, Brady; Tamke, Martin; Nielsen, Stig Anton

    2011-01-01

    Acoustic performance is defined by the parameter of reverberation time; however, this does not capture the acoustic experience in some types of open plan spaces. As many working and learning activities now take place in open plan spaces, it is important to be able to understand and design...... for the acoustic conditions of these spaces. This paper describes an experimental research project that studied the design processes necessary to design for sound. A responsive acoustic surface was designed, fabricated and tested. This acoustic surface was designed to create specific sonic effects. The design...... was simulated using custom integrated acoustic software and also using Odeon acoustic analysis software. The research demonstrates a method for designing space- and sound-defining surfaces, defines the concept of acoustic subspace, and suggests some new parameters for defining acoustic subspaces....

  6. From analysis to surface

    DEFF Research Database (Denmark)

    Bemman, Brian; Meredith, David

    it with a “ground truth” analysis of the same music pro- duced by a human expert (see, in particular, [5]). In this paper, we explore the problem of generating an encoding of the musical surface of a work automatically from a systematic encoding of an analysis. The ability to do this depends on one having...... an effective (i.e., comput- able), correct and complete description of some aspect of the structure of the music. Generating the surface struc- ture of a piece from an analysis in this manner serves as a proof of the analysis' correctness, effectiveness and com- pleteness. We present a reductive analysis......In recent years, a significant body of research has focused on developing algorithms for computing analyses of mu- sical works automatically from encodings of these works' surfaces [3,4,7,10,11]. The quality of the output of such analysis algorithms is typically evaluated by comparing...

  7. Surface-water surveillance

    International Nuclear Information System (INIS)

    Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995)

  8. Photochemistry on solid surfaces

    CERN Document Server

    Matsuura, T

    1989-01-01

    The latest developments in photochemistry on solid surfaces, i.e. photochemistry in heterogeneous systems, including liquid crystallines, are brought together for the first time in a single volume. Distinguished photochemists from various fields have contributed to the book which covers a number of important applications: molecular photo-devices for super-memory, photochemical vapor deposition to produce thin-layered electronic semiconducting materials, sensitive optical media, the control of photochemical reactions pathways, etc. Photochemistry on solid surfaces is now a major field and this

  9. Surface and nanomolecular catalysis

    CERN Document Server

    Richards, Ryan

    2006-01-01

    Using new instrumentation and experimental techniques that allow scientists to observe chemical reactions and molecular properties at the nanoscale, the authors of Surface and Nanomolecular Catalysis reveal new insights into the surface chemistry of catalysts and the reaction mechanisms that actually occur at a molecular level during catalysis. While each chapter contains the necessary background and explanations to stand alone, the diverse collection of chapters shows how developments from various fields each contributed to our current understanding of nanomolecular catalysis as a whole. The

  10. Solid lubricants and surfaces

    CERN Document Server

    Braithwaite, E R

    1964-01-01

    Solid Lubricants and Surfaces deals with the theory and use of solid lubricants, particularly in colloidal form. Portions of this book are devoted to graphite and molybdenum disulfides, which are widely used solid lubricants in colloidal form. An extensive literature on the laboratory examination of hundreds of solids as potential lubricants is also provided in this text. Other topics discussed include the metals and solid lubricants; techniques for examining surfaces; other solid lubricants; metal shaping; and industrial uses of solid-lubricant dispersions. This publication is beneficial to e

  11. Surface science techniques

    CERN Document Server

    Bracco, Gianangelo

    2013-01-01

    The book describes the experimental techniques employed to study surfaces and interfaces. The emphasis is on the experimental method. Therefore all chapters start with an introduction of the scientific problem, the theory necessary to understand how the technique works and how to understand the results. Descriptions of real experimental setups, experimental results at different systems are given to show both the strength and the limits of the technique. In a final part the new developments and possible extensions of the techniques are presented. The included techniques provide microscopic as well as macroscopic information. They cover most of the techniques used in surface science.

  12. Photometric Lunar Surface Reconstruction

    Science.gov (United States)

    Nefian, Ara V.; Alexandrov, Oleg; Morattlo, Zachary; Kim, Taemin; Beyer, Ross A.

    2013-01-01

    Accurate photometric reconstruction of the Lunar surface is important in the context of upcoming NASA robotic missions to the Moon and in giving a more accurate understanding of the Lunar soil composition. This paper describes a novel approach for joint estimation of Lunar albedo, camera exposure time, and photometric parameters that utilizes an accurate Lunar-Lambertian reflectance model and previously derived Lunar topography of the area visualized during the Apollo missions. The method introduced here is used in creating the largest Lunar albedo map (16% of the Lunar surface) at the resolution of 10 meters/pixel.

  13. Surfing surface gravity waves

    Science.gov (United States)

    Pizzo, Nick

    2017-11-01

    A simple criterion for water particles to surf an underlying surface gravity wave is presented. It is found that particles travelling near the phase speed of the wave, in a geometrically confined region on the forward face of the crest, increase in speed. The criterion is derived using the equation of John (Commun. Pure Appl. Maths, vol. 6, 1953, pp. 497-503) for the motion of a zero-stress free surface under the action of gravity. As an example, a breaking water wave is theoretically and numerically examined. Implications for upper-ocean processes, for both shallow- and deep-water waves, are discussed.

  14. Hyperpolarized Nanodiamond Surfaces.

    Science.gov (United States)

    Rej, Ewa; Gaebel, Torsten; Waddington, David E J; Reilly, David J

    2017-01-11

    The widespread use of nanodiamond as a biomedical platform for drug-delivery, imaging, and subcellular tracking applications stems from its nontoxicity and unique quantum mechanical properties. Here, we extend this functionality to the domain of magnetic resonance, by demonstrating that the intrinsic electron spins on the nanodiamond surface can be used to hyperpolarize adsorbed liquid compounds at low fields and room temperature. By combining relaxation measurements with hyperpolarization, spins on the surface of the nanodiamond can be distinguished from those in the bulk liquid. These results are likely of use in signaling the controlled release of pharmaceutical payloads.

  15. Organometallic chemistry of metal surfaces

    International Nuclear Information System (INIS)

    Muetterties, E.L.

    1981-06-01

    The organometallic chemistry of metal surfaces is defined as a function of surface crystallography and of surface composition for a set of cyclic hydrocarbons that include benzene, toluene, cyclohexadienes, cyclohexene, cyclohexane, cyclooctatetraene, cyclooctadienes, cyclooctadiene, cycloheptatriene and cyclobutane. 12 figures

  16. Concentration polarization, surface currents, and bulk advection in a microchannel

    DEFF Research Database (Denmark)

    Nielsen, Christoffer Peder; Bruus, Henrik

    2014-01-01

    . A remarkable outcome of the investigations is the discovery of strong couplings between bulk advection and the surface current; without a surface current, bulk advection is strongly suppressed. The numerical simulations are supplemented by analytical models valid in the long channel limit as well...... as in the limit of negligible surface charge. By including the effects of diffusion and advection in the diffuse part of the electric double layers, we extend a recently published analytical model of overlimiting current due to surface conduction....

  17. Wetting of real surfaces

    CERN Document Server

    Bormashenko, Edward Yu

    2013-01-01

    The problem of wetting and drop dynamics on various surfaces is very interesting from both the scientificas well as thepractical viewpoint, and subject of intense research.The results are scattered across papers in journals, sothis workwill meet the need for a unifying, comprehensive work.

  18. Optimization of surface maintenance

    International Nuclear Information System (INIS)

    Oeverland, E.

    1990-01-01

    The present conference paper deals with methods of optimizing the surface maintenance of steel-made offshore installations. The paper aims at identifying important approaches to the problems regarding the long-range planning of an economical and cost effective maintenance program. The methods of optimization are based on the obtained experiences from the maintenance of installations on the Norwegian continental shelf. 3 figs

  19. Paneling architectural freeform surfaces

    KAUST Repository

    Eigensatz, Michael

    2010-07-26

    The emergence of large-scale freeform shapes in architecture poses big challenges to the fabrication of such structures. A key problem is the approximation of the design surface by a union of patches, socalled panels, that can be manufactured with a selected technology at reasonable cost, while meeting the design intent and achieving the desired aesthetic quality of panel layout and surface smoothness. The production of curved panels is mostly based on molds. Since the cost of mold fabrication often dominates the panel cost, there is strong incentive to use the same mold for multiple panels. We cast the major practical requirements for architectural surface paneling, including mold reuse, into a global optimization framework that interleaves discrete and continuous optimization steps to minimize production cost while meeting user-specified quality constraints. The search space for optimization is mainly generated through controlled deviation from the design surface and tolerances on positional and normal continuity between neighboring panels. A novel 6-dimensional metric space allows us to quickly compute approximate inter-panel distances, which dramatically improves the performance of the optimization and enables the handling of complex arrangements with thousands of panels. The practical relevance of our system is demonstrated by paneling solutions for real, cutting-edge architectural freeform design projects. © 2010 ACM.

  20. Dynamical triangulated fermionic surfaces

    International Nuclear Information System (INIS)

    Ambjoern, J.; Varsted, S.

    1990-12-01

    We perform Monte Carlo simulations of randomly triangulated random surfaces which have fermionic world-sheet scalars θ i associated with each vertex i in addition to the usual bosonic world-sheet scalar χ i μ . The fermionic degrees of freedom force the internal metrics of the string to be less singular than the internal metric of the pure bosonic string. (orig.)

  1. Paneling architectural freeform surfaces

    KAUST Repository

    Eigensatz, Michael

    2010-07-25

    The emergence of large-scale freeform shapes in architecture poses big challenges to the fabrication of such structures. A key problem is the approximation of the design surface by a union of patches, so-called panels, that can be manufactured with a selected technology at reasonable cost, while meeting the design intent and achieving the desired aesthetic quality of panel layout and surface smoothness. The production of curved panels is mostly based on molds. Since the cost of mold fabrication often dominates the panel cost, there is strong incentive to use the same mold for multiple panels. We cast the major practical requirements for architectural surface paneling, including mold reuse, into a global optimization framework that interleaves discrete and continuous optimization steps to minimize production cost while meeting user-specified quality constraints. The search space for optimization is mainly generated through controlled deviation from the design surface and tolerances on positional and normal continuity between neighboring panels. A novel 6-dimensional metric space allows us to quickly compute approximate inter-panel distances, which dramatically improves the performance of the optimization and enables the handling of complex arrangements with thousands of panels. The practical relevance of our system is demonstrated by paneling solutions for real, cutting-edge architectural freeform design projects.

  2. Music Mixing Surface

    DEFF Research Database (Denmark)

    Gelineck, Steven; Büchert, Morten; Andersen, Jesper

    2013-01-01

    This paper presents a multi-touch based interface for mixing music. The goal of the interface is to provide users with a more intuitive control of the music mix by implementing the so-called stage metaphor control scheme, which is especially suitable for multi-touch surfaces. Specifically, we...

  3. Predictive Surface Complexation Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Sverjensky, Dimitri A. [Johns Hopkins Univ., Baltimore, MD (United States). Dept. of Earth and Planetary Sciences

    2016-11-29

    Surface complexation plays an important role in the equilibria and kinetics of processes controlling the compositions of soilwaters and groundwaters, the fate of contaminants in groundwaters, and the subsurface storage of CO2 and nuclear waste. Over the last several decades, many dozens of individual experimental studies have addressed aspects of surface complexation that have contributed to an increased understanding of its role in natural systems. However, there has been no previous attempt to develop a model of surface complexation that can be used to link all the experimental studies in order to place them on a predictive basis. Overall, my research has successfully integrated the results of the work of many experimentalists published over several decades. For the first time in studies of the geochemistry of the mineral-water interface, a practical predictive capability for modeling has become available. The predictive correlations developed in my research now enable extrapolations of experimental studies to provide estimates of surface chemistry for systems not yet studied experimentally and for natural and anthropogenically perturbed systems.

  4. Surface soil contamination standards

    International Nuclear Information System (INIS)

    Boothe, G.F.

    1979-01-01

    The purpose of this document is to define surface soil contamination limits for radioactive materials below which posting, restrictions and environmental controls are not necessary in order to protect personnel and the environment. The standards can also be used to determine if solid waste or other material is contaminated relative to disposal requirements. The derivation of the standards is given

  5. Paneling architectural freeform surfaces

    KAUST Repository

    Eigensatz, Michael; Kilian, Martin; Schiftner, Alexander; Mitra, Niloy J.; Pottmann, Helmut; Pauly, Mark

    2010-01-01

    The emergence of large-scale freeform shapes in architecture poses big challenges to the fabrication of such structures. A key problem is the approximation of the design surface by a union of patches, socalled panels, that can be manufactured with a

  6. Laser surface cleaning

    International Nuclear Information System (INIS)

    Freiwald, J.G.; Freiwald, D.A.

    1994-01-01

    The objective of this work is a laboratory demonstration that red-lead primer and two-part epoxy paints can be stripped from concrete and metal surfaces using surface cleaning systems based on pulsed-repetition CO 2 lasers. The three goals are to: (1) demonstrate coatings removal, including surface pore cleaning; (2) demonstrate that there is negligible release of ablated contaminants to the environment; and (3) demonstrate that the process will generate negligible amounts of additional waste compared to competing technologies. Phase 1 involved site visits to RMI and Fernald to assess the cleaning issues for buildings and parts. In addition, Phase 1 included detailed designs of a more powerful system for industrial cleaning rates, including laser, articulating optics, ablated-material capture suction nozzle attached to a horizontal raster scanner for floor cleaning, and filtration system. Some concept development is also being done for using robots, and for parts cleaning. In Phase 2 a transportable 6 kW system will be built and tested, with a horizontal surface scanner for cleaning paint from floors. The laboratory tests will again be instrumented. Some concept development will continue for using robots, and for parts cleaning. This report describes Phase 1 results

  7. Tritium-surface interactions

    International Nuclear Information System (INIS)

    Kirkaldy, J.S.

    1983-06-01

    The report deals broadly with tritium-surface interactions as they relate to a fusion power reactor enterprise, viz., the vacuum chamber, first wall, peripherals, pumping, fuel recycling, isotope separation, repair and maintenance, decontamination and safety. The main emphasis is on plasma-surface interactions and the selection of materials for fusion chamber duty. A comprehensive review of the international (particularly U.S.) research and development is presented based upon a literature review (about 1 000 reports and papers) and upon visits to key laboratories, Sandia, Albuquerque, Sandia, Livermore and EGβG Idaho. An inventory of Canadian expertise and facilities for RβD on tritium-surface interactions is also presented. A number of proposals are made for the direction of an optimal Canadian RβD program, emphasizing the importance of building on strength in both the technological and fundamental areas. A compendium of specific projects and project areas is presented dealing primarily with plasma-wall interactions and permeation, anti-permeation materials and surfaces and health, safety and environmental considerations. Potential areas of industrial spinoff are identified

  8. Surface Water in Hawaii

    Science.gov (United States)

    Oki, Delwyn S.

    2003-01-01

    Surface water in Hawaii is a valued resource as well as a potential threat to human lives and property. The surface-water resources of Hawaii are of significant economic, ecologic, cultural, and aesthetic importance. Streams supply more than 50 percent of the irrigation water in Hawaii, and although streams supply only a few percent of the drinking water statewide, surface water is the main source of drinking water in some places. Streams also are a source of hydroelectric power, provide important riparian and instream habitats for many unique native species, support traditional and customary Hawaiian gathering rights and the practice of taro cultivation, and possess valued aesthetic qualities. Streams affect the physical, chemical, and aesthetic quality of receiving waters, such as estuaries, bays, and nearshore waters, which are critical to the tourism-based economy of the islands. Streams in Hawaii pose a danger because of their flashy nature; a stream's stage, or water level, can rise several feet in less than an hour during periods of intense rainfall. Streams in Hawaii are flashy because rainfall is intense, drainage basins are small, basins and streams are steep, and channel storage is limited. Streamflow generated during periods of heavy rainfall has led to loss of property and human lives in Hawaii. Most Hawaiian streams originate in the mountainous interiors of the islands and terminate at the coast. Streams are significant sculptors of the Hawaiian landscape because of the erosive power of the water they convey. In geologically young areas, such as much of the southern part of the island of Hawaii, well-defined stream channels have not developed because the permeability of the surface rocks generally is so high that rainfall infiltrates before flowing for significant distances on the surface. In geologically older areas that have received significant rainfall, streams and mass wasting have carved out large valleys.

  9. Transversal Surfaces of Timelike Ruled Surfaces in Minkowski 3-Space

    OpenAIRE

    Önder, Mehmet

    2012-01-01

    In this study we give definitions and characterizations of transversal surfaces of timelike ruled surfaces. We study some special cases such as the striction curve is a geodesic, an asymptotic line or a line of curvature. Moreover, we obtain developable conditions for transversal surfaces of a timelike ruled surface.

  10. General aspects of surface alloy formation

    Energy Technology Data Exchange (ETDEWEB)

    Bergbreiter, Andreas; Engstfeld, Albert K.; Roetter, Ralf T.; Hoster, Harry E.; Behm, R. Juergen [Institute of Surface Chemistry and Catalysis, Ulm University, D-89069 Ulm (Germany); Berko, Andras

    2010-07-01

    Surface confined alloys are excellent model systems for studies of structure-property relationships of bimetallic surfaces. They are formed by deposition of a guest metal B onto a substrate A, followed by annealing to a temperature, where place exchange between adatoms and atoms from the underlying surface layer becomes possible and diffusion into the bulk is sufficiently slow. We exemplarily confirmed by scanning tunneling microscopy and Auger electron spectroscopy for PtRu/Ru(0001), PdRu/Ru(0001), AuPt/Pt(111), AgPt/Pt(111), and AgPd/Pd(111), surface alloys are obtained for systems where metal B has a negative surface segregation energy within metal A. By exchanging A and B, however, AB surface alloys are most likely overgrown by metal B, which we demonstrate for RuPt/Pt(111) in comparison to PtRu/Ru(0001).

  11. In-surface confinement of topological insulator nanowire surface states

    International Nuclear Information System (INIS)

    Chen, Fan W.; Jauregui, Luis A.; Tan, Yaohua; Manfra, Michael; Klimeck, Gerhard; Chen, Yong P.; Kubis, Tillmann

    2015-01-01

    The bandstructures of [110] and [001] Bi 2 Te 3 nanowires are solved with the atomistic 20 band tight binding functionality of NEMO5. The theoretical results reveal: The popular assumption that all topological insulator (TI) wire surfaces are equivalent is inappropriate. The Fermi velocity of chemically distinct wire surfaces differs significantly which creates an effective in-surface confinement potential. As a result, topological insulator surface states prefer specific surfaces. Therefore, experiments have to be designed carefully not to probe surfaces unfavorable to the surface states (low density of states) and thereby be insensitive to the TI-effects

  12. In-surface confinement of topological insulator nanowire surface states

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Fan W., E-mail: fanchen@purdue.edu [Department of Physics and Astronomy, Purdue, West Lafayette, Indiana 47907 (United States); Network for Computational Nanotechnology, Purdue, West Lafayette, Indiana 47907 (United States); Jauregui, Luis A. [School of Electrical and Computer Engineering, Purdue University, West Lafayette, Indiana 47907 (United States); Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47907 (United States); Tan, Yaohua [Network for Computational Nanotechnology, Purdue, West Lafayette, Indiana 47907 (United States); School of Electrical and Computer Engineering, Purdue University, West Lafayette, Indiana 47907 (United States); Manfra, Michael [Department of Physics and Astronomy, Purdue, West Lafayette, Indiana 47907 (United States); School of Electrical and Computer Engineering, Purdue University, West Lafayette, Indiana 47907 (United States); Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47907 (United States); School of Materials Engineering, Purdue University, West Lafayette, Indiana 47907 (United States); Klimeck, Gerhard [Network for Computational Nanotechnology, Purdue, West Lafayette, Indiana 47907 (United States); School of Electrical and Computer Engineering, Purdue University, West Lafayette, Indiana 47907 (United States); Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47907 (United States); Chen, Yong P. [Department of Physics and Astronomy, Purdue, West Lafayette, Indiana 47907 (United States); School of Electrical and Computer Engineering, Purdue University, West Lafayette, Indiana 47907 (United States); Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47907 (United States); Kubis, Tillmann [Network for Computational Nanotechnology, Purdue, West Lafayette, Indiana 47907 (United States)

    2015-09-21

    The bandstructures of [110] and [001] Bi{sub 2}Te{sub 3} nanowires are solved with the atomistic 20 band tight binding functionality of NEMO5. The theoretical results reveal: The popular assumption that all topological insulator (TI) wire surfaces are equivalent is inappropriate. The Fermi velocity of chemically distinct wire surfaces differs significantly which creates an effective in-surface confinement potential. As a result, topological insulator surface states prefer specific surfaces. Therefore, experiments have to be designed carefully not to probe surfaces unfavorable to the surface states (low density of states) and thereby be insensitive to the TI-effects.

  13. In-surface confinement of topological insulator nanowire surface states

    Science.gov (United States)

    Chen, Fan W.; Jauregui, Luis A.; Tan, Yaohua; Manfra, Michael; Klimeck, Gerhard; Chen, Yong P.; Kubis, Tillmann

    2015-09-01

    The bandstructures of [110] and [001] Bi2Te3 nanowires are solved with the atomistic 20 band tight binding functionality of NEMO5. The theoretical results reveal: The popular assumption that all topological insulator (TI) wire surfaces are equivalent is inappropriate. The Fermi velocity of chemically distinct wire surfaces differs significantly which creates an effective in-surface confinement potential. As a result, topological insulator surface states prefer specific surfaces. Therefore, experiments have to be designed carefully not to probe surfaces unfavorable to the surface states (low density of states) and thereby be insensitive to the TI-effects.

  14. Characterisation of surface roughness for ultra-precision freeform surfaces

    International Nuclear Information System (INIS)

    Li Huifen; Cheung, C F; Lee, W B; To, S; Jiang, X Q

    2005-01-01

    Ultra-precision freeform surfaces are widely used in many advanced optics applications which demand for having surface roughness down to nanometer range. Although a lot of research work has been reported on the study of surface generation, reconstruction and surface characterization such as MOTIF and fractal analysis, most of them are focused on axial symmetric surfaces such as aspheric surfaces. Relative little research work has been found in the characterization of surface roughness in ultra-precision freeform surfaces. In this paper, a novel Robust Gaussian Filtering (RGF) method is proposed for the characterisation of surface roughness for ultra-precision freeform surfaces with known mathematic model or a cloud of discrete points. A series of computer simulation and measurement experiments were conducted to verify the capability of the proposed method. The experimental results were found to agree well with the theoretical results

  15. Evaluation of Surface Fatigue Strength Based on Surface Temperature

    Science.gov (United States)

    Deng, Gang; Nakanishi, Tsutomu

    Surface temperature is considered to be an integrated index that is dependent on not only the load and the dimensions at the contact point but also the sliding velocity, rolling velocity, surface roughness, and lubrication conditions. Therefore, the surface durability of rollers and gears can be evaluated more exactly and simply by the use of surface temperature rather than Hertzian stress. In this research, surface temperatures of rollers under different rolling and sliding conditions are measured using a thermocouple. The effects of load P, mean velocity Vm and sliding velocity Vs on surface temperature are clarified. An experimental formula, which expresses the linear relationship between surface temperature and the P0.86Vs1.31Vm-0.83 value, is used to determine surface temperature. By comparing calculated and measured temperature on the tooth surface of a gear, this formula is confirmed to be applicable for gear tooth surface temperature calculation.

  16. Surface desorption and bulk diffusion models of tritium release from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles

    Energy Technology Data Exchange (ETDEWEB)

    Avila, R.E., E-mail: ravila@cchen.c [Departamento de Materiales Nucleares, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile); Pena, L.A.; Jimenez, J.C. [Departamento de Produccion y Servicios, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile)

    2010-10-30

    The release of tritium from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles, in batch experiments, is studied by means of temperature programmed desorption. Data reduction focuses on the analysis of the non-oxidized and oxidized tritium components in terms of release limited by diffusion from the bulk of ceramic grains, or by first or second order surface desorption. By analytical and numerical methods the in-furnace tritium release is deconvoluted from the ionization chamber transfer functions, for which a semi-empirical form is established. The release from Li{sub 2}TiO{sub 3} follows second order desorption kinetics, requiring a temperature for a residence time of 1 day (T{sub 1dRes}) of 620 K, and 603 K, of the non-oxidized, and the oxidized components, respectively. The release from Li{sub 2}ZrO{sub 3} appears as limited by either diffusion from the bulk of the ceramic grains, or by first order surface desorption, the first possibility being the more probable. The respective values of T{sub 1dRes} for the non-oxidized component are 661 K, according to the first order surface desorption model, and 735 K within the bulk diffusion limited model.

  17. Modeling of hydrogen desorption from tungsten surface

    Energy Technology Data Exchange (ETDEWEB)

    Guterl, J., E-mail: jguterl@ucsd.edu [University of California, San Diego, La Jolla, CA 92093 (United States); Smirnov, R.D. [University of California, San Diego, La Jolla, CA 92093 (United States); Krasheninnikov, S.I. [University of California, San Diego, La Jolla, CA 92093 (United States); Nuclear Research National University MEPhI, Moscow 115409 (Russian Federation); Uberuaga, B.; Voter, A.F.; Perez, D. [Los Alamos National Laboratory, Los Alamos, NM 8754 (United States)

    2015-08-15

    Hydrogen retention in metallic plasma-facing components is among key-issues for future fusion devices. For tungsten, which has been chosen as divertor material in ITER, hydrogen desorption parameters experimentally measured for fusion-related conditions show large discrepancies. In this paper, we therefore investigate hydrogen recombination and desorption on tungsten surfaces using molecular dynamics simulations and accelerated molecular dynamics simulations to analyze adsorption states, diffusion, hydrogen recombination into molecules, and clustering of hydrogen on tungsten surfaces. The quality of tungsten hydrogen interatomic potential is discussed in the light of MD simulations results, showing that three body interactions in current interatomic potential do not allow to reproduce hydrogen molecular recombination and desorption. Effects of surface hydrogen clustering on hydrogen desorption are analyzed by introducing a kinetic model describing the competition between surface diffusion, clustering and recombination. Different desorption regimes are identified and reproduce some aspects of desorption regimes experimentally observed.

  18. Radon transport processes below the earth's surface

    International Nuclear Information System (INIS)

    Wilkening, M.

    1980-01-01

    Processes by which 222 Rn is transported from the soil to the earth's surface are reviewed. The mechanisms effective in transporting 222 Rn to the surface are related to the size and configuration of the spaces occupied by the soil gas which may vary from molecular interstices to large underground caverns. The near-surface transport processes are divided into two categories: (1) a microscopic process that includes molecular diffusion and viscous flow in fine capillaries and (2) macroscopic flow in fissures and channels. Underground air rich in 222 Rn can also reach the surface through cracks, fissures, and underground channels. This type of transport is shown for (1) a horizontal tunnel penetrating a fractured hillside, (2) a large underground cave, and (3) volcanic activity. Pressure differentials having various natural origins and thermal gradients are responsible for the transport in these examples. 222 Rn transport by ordinary molecular diffusion appears to be the dominant process

  19. Approximation of Surfaces by Cylinders

    DEFF Research Database (Denmark)

    Randrup, Thomas

    1998-01-01

    We present a new method for approximation of a given surface by a cylinder surface. It is a constructive geometric method, leading to a monorail representation of the cylinder surface. By use of a weighted Gaussian image of the given surface, we determine a projection plane. In the orthogonal...

  20. Drop Impact on Superheated Surfaces

    NARCIS (Netherlands)

    Tran, Tuan; Staat, Erik-Jan; Prosperetti, Andrea; Sun, Chao; Lohse, Detlef

    2012-01-01

    At the impact of a liquid droplet on a smooth surface heated above the liquid’s boiling point, the droplet either immediately boils when it contacts the surface (“contact boiling”), or without any surface contact forms a Leidenfrost vapor layer towards the hot surface and bounces back (“gentle film