WorldWideScience

Sample records for surface diffusion rates

  1. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  2. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  3. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  4. Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

    Science.gov (United States)

    Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

    2015-01-01

    The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

  5. Diffusion rates for elevated releases

    International Nuclear Information System (INIS)

    Ramsdell, J.V.

    1983-11-01

    A search of the literature related to diffusion from elevated sources has determined that an adequate data base exists for use in developing parameterizations for estimating diffusion rates for material released from free standing stacks at nuclear power plants. A review of published data analyses indicates that a new parameterization of horizontal diffusion rates specifically for elevated releases is not likely to significantly change the magnitudes of horizontal diffusion coefficients on the average. However, the uncertainties associated with horizontal diffusion coefficient estimates under any given set of atmospheric conditions could be reduced by a new parameterization. Similarly, a new parameterization of vertical diffusion rates would be unlikely to significantly alter the magnitudes of diffusion coefficients for unstable atmospheric conditons. However, for neutral and stable atmospheric conditions, a new parameterization of vertical diffusion rates might increase vertical diffusion coefficients significantly. The increase would move ground-level time-integrated concentration maxima closer to the plant and would increase the maxima. 55 references, 2 figures, 4 tables

  6. Flow, diffusion, and rate processes

    International Nuclear Information System (INIS)

    Sieniutycz, S.; Salamon, P.

    1992-01-01

    This volume contains recent results obtained for the nonequilibrium thermodynamics of transport and rate processes are reviewed. Kinetic equations, conservation laws, and transport coefficients are obtained for multicomponent mixtures. Thermodynamic principles are used in the design of experiments predicting heat and mass transport coefficients. Highly nonstationary conditions are analyzed in the context of transient heat transfer, nonlocal diffusion in stress fields and thermohydrodynamic oscillatory instabilities. Unification of the dynamics of chemical systems with other sorts of processes (e.g. mechanical) is given. Thermodynamics of reacting surfaces is developed. Admissible reaction paths are studied and a consistency of chemical kinetics with thermodynamics is shown. Oscillatory reactions are analyzed in a unifying approach showing explosive, conservation or damped behavior. A comprehensive review of transport processes in electrolytes and membranes is given. Applications of thermodynamics to thermoelectric systems and ionized gas (plasma) systems are reviewed

  7. Electro-oxidation of methanol diffused through proton exchange membrane on Pt surface: crossover rate of methanol

    International Nuclear Information System (INIS)

    Jung, Inhwa; Kim, Doyeon; Yun, Yongsik; Chung, Suengyoung; Lee, Jaeyoung; Tak, Yongsug

    2004-01-01

    Methanol crossover rate through proton exchange membrane (Nafion 117) was investigated with a newly designed electrochemical stripping cell. Nanosize Pt electrode was prepared by the electroless deposition. Distinct electrocatalytic oxidation behaviors of methanol inside membrane were similar to the methanol oxidation in aqueous electrolyte, except adsorption/desorption of hydrogen. The amount of methanol diffused through membrane was calculated from the charge of methanol oxidation during repetitive cyclic voltammetry (CV) and methanol crossover rate was estimated to be 0.69 nmol/s

  8. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  9. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  10. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  11. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  12. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  13. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  14. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  15. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  16. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  17. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  18. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  19. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  20. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  1. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  2. Rate Theory for Correlated Processes: Double Jumps in Adatom Diffusion

    DEFF Research Database (Denmark)

    Jacobsen, J.; Jacobsen, Karsten Wedel; Sethna, J.

    1997-01-01

    We study the rate of activated motion over multiple barriers, in particular the correlated double jump of an adatom diffusing on a missing-row reconstructed platinum (110) surface. We develop a transition path theory, showing that the activation energy is given by the minimum-energy trajectory...... which succeeds in the double jump. We explicitly calculate this trajectory within an effective-medium molecular dynamics simulation. A cusp in the acceptance region leads to a root T prefactor for the activated rate of double jumps. Theory and numerical results agree....

  3. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  4. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  5. Evaporation rates and surface profiles on heterogeneous surfaces with mass transfer and surface reaction

    Energy Technology Data Exchange (ETDEWEB)

    Flytzani-Stephanopoulos, M; Schmidt, L D

    1979-01-01

    Simple models incorporating surface reaction and diffusion of volatile products through a boundary layer are developed to calculate effective rates of evaporation and local surface profiles on surfaces having active and inactive regions. The coupling between surface heterogeneities with respect to a particular reaction and external mass transfer may provide a mechanism for the surface rearrangement and metal loss encountered in several catalytic systems of practical interest. Calculated transport rates for the volatilization of platinum in oxidizing environments and the rearrangement of this metal during the ammonia oxidation reaction agree well with published experimental data.

  6. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  7. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  8. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  9. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  10. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  11. Diffusion equations and the time evolution of foreign exchange rates

    Energy Technology Data Exchange (ETDEWEB)

    Figueiredo, Annibal; Castro, Marcio T. de [Institute of Physics, Universidade de Brasília, Brasília DF 70910-900 (Brazil); Fonseca, Regina C.B. da [Department of Mathematics, Instituto Federal de Goiás, Goiânia GO 74055-110 (Brazil); Gleria, Iram, E-mail: iram@fis.ufal.br [Institute of Physics, Federal University of Alagoas, Brazil, Maceió AL 57072-900 (Brazil)

    2013-10-01

    We investigate which type of diffusion equation is most appropriate to describe the time evolution of foreign exchange rates. We modify the geometric diffusion model assuming a non-exponential time evolution and the stochastic term is the sum of a Wiener noise and a jump process. We find the resulting diffusion equation to obey the Kramers–Moyal equation. Analytical solutions are obtained using the characteristic function formalism and compared with empirical data. The analysis focus on the first four central moments considering the returns of foreign exchange rate. It is shown that the proposed model offers a good improvement over the classical geometric diffusion model.

  12. Diffusion equations and the time evolution of foreign exchange rates

    Science.gov (United States)

    Figueiredo, Annibal; de Castro, Marcio T.; da Fonseca, Regina C. B.; Gleria, Iram

    2013-10-01

    We investigate which type of diffusion equation is most appropriate to describe the time evolution of foreign exchange rates. We modify the geometric diffusion model assuming a non-exponential time evolution and the stochastic term is the sum of a Wiener noise and a jump process. We find the resulting diffusion equation to obey the Kramers-Moyal equation. Analytical solutions are obtained using the characteristic function formalism and compared with empirical data. The analysis focus on the first four central moments considering the returns of foreign exchange rate. It is shown that the proposed model offers a good improvement over the classical geometric diffusion model.

  13. Diffusion equations and the time evolution of foreign exchange rates

    International Nuclear Information System (INIS)

    Figueiredo, Annibal; Castro, Marcio T. de; Fonseca, Regina C.B. da; Gleria, Iram

    2013-01-01

    We investigate which type of diffusion equation is most appropriate to describe the time evolution of foreign exchange rates. We modify the geometric diffusion model assuming a non-exponential time evolution and the stochastic term is the sum of a Wiener noise and a jump process. We find the resulting diffusion equation to obey the Kramers–Moyal equation. Analytical solutions are obtained using the characteristic function formalism and compared with empirical data. The analysis focus on the first four central moments considering the returns of foreign exchange rate. It is shown that the proposed model offers a good improvement over the classical geometric diffusion model.

  14. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  15. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  16. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  17. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  18. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  19. The Chern-Simons diffusion rate in improved holographic QCD

    NARCIS (Netherlands)

    Gürsoy, U.; Iatrakis, I.; Kiritsis, E.; Nitti, F.; O’Bannon, A.

    2013-01-01

    In (3 + 1)-dimensional SU(N c) Yang-Mills (YM) theory, the Chern-Simons diffusion rate, ΓCS, is determined by the zero-momentum, zero-frequency limit of the retarded two-point function of the CP-odd operator tr [F ∧ F ], with F the YM field strength. The Chern-Simons diffusion rate is a crucial

  20. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  1. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  2. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  3. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  4. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  5. Liquid Film Diffusion on Reaction Rate in Submerged Biofilters

    DEFF Research Database (Denmark)

    Christiansen, Pia; Hollesen, Line; Harremoës, Poul

    1995-01-01

    Experiments were carried out in order to investigate the influence of liquid film diffusion on reaction rate in a submerged biofilter with denitrification and in order to compare with a theoretical study of the mass transfer coefficient. The experiments were carried out with varied flow, identified...... by the empty bed velocity of inflow and recirculation, respectively 1.3, 2.8, 5.6 and 10.9 m/h. The filter material consisted of 3 mm biostyren spheres. The results indicate that the influence of liquid film diffusion on reaction rate can be ignored....

  6. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  7. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  8. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  9. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  10. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  11. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  12. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  13. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  14. II. Inhibited Diffusion Driven Surface Transmutations

    Science.gov (United States)

    Chubb, Talbot A.

    2006-02-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

  15. II. Inhibited diffusion driven surface transmutations

    International Nuclear Information System (INIS)

    Cubb, Talbot A.

    2006-01-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  16. II. Inhibited diffusion driven surface transmutations

    Energy Technology Data Exchange (ETDEWEB)

    Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

    2006-07-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  17. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  18. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  19. Rate of riboflavin diffusion from intrastromal channels before corneal crosslinking.

    Science.gov (United States)

    McQuaid, Rebecca; Mrochen, Michael; Vohnsen, Brian

    2016-03-01

    To determine the diffusion of riboflavin from intrastromal channels through the effective diffusion coefficients compared with traditional axial diffusion with epithelium on or off. Advanced Optical Imaging Laboratory, University College Dublin, and Wellington Eye Clinic, Sandyford, Dublin, Ireland. Experimental study. The rate of diffusion in whole-mounted porcine eyes was monitored for a 30 minutes using an optical setup with a charge-coupled device camera and a bandpass filter (central wavelength 550 nm and 40 nm bandpass) to image the fluorescence under ultraviolet illumination (365 nm wavelength). For comparison, an isotropic corneal stroma with an annular channel was modeled numerically for different diffusion constants and boundary conditions. Numerical and experimental results were compared, allowing determination of the effective diffusion coefficient for each case. Experimental results for 6 different riboflavin solutions were in all cases found to be higher than for the common crosslinking (CXL) riboflavin protocol, where the diffusion constant is D0 = 6.5 × 10(-5) mm(2)/sec. For the intrastromal channel, 2 isotonic solutions containing riboflavin 0.1% correlated with a diffusion constant of 5D0 = 32.5 × 10(-5) mm(2)/sec. Hypotonic solutions and transepithelium had a higher diffusion coefficient approaching 10D0 = 65.0 × 10(-5) mm(2)/sec, which is an order-of-magnitude increase compared with the typical diffusion coefficient found in standard CXL. In this study, riboflavin had a faster stromal diffusion when injected into a corneal channel than when applied as drops to the anterior corneal surface. Further numerical modeling might allow optimization of the channel structure for any specific choice of riboflavin. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  20. Determinants of Inter-Country Internet Diffusion Rates

    OpenAIRE

    Wunnava, Phanindra V.; Leiter, Daniel B.

    2008-01-01

    This paper employs cross-sectional data from 100 countries to analyze the main determinants of inter-country Internet diffusion rates. We set up an empirical model based on strong theoretical foundations, in which we regress Internet usage on variables that capture social, economic and political differences between these countries. Our results support past findings that economic strength, infrastructure and knowledge of the English language positively affect Internet connectivity. In addition...

  1. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  2. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  3. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  4. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  5. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  6. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  7. Backtracking and Mixing Rate of Diffusion on Uncorrelated Temporal Networks

    Directory of Open Access Journals (Sweden)

    Martin Gueuning

    2017-10-01

    Full Text Available We consider the problem of diffusion on temporal networks, where the dynamics of each edge is modelled by an independent renewal process. Despite the apparent simplicity of the model, the trajectories of a random walker exhibit non-trivial properties. Here, we quantify the walker’s tendency to backtrack at each step (return where he/she comes from, as well as the resulting effect on the mixing rate of the process. As we show through empirical data, non-Poisson dynamics may significantly slow down diffusion due to backtracking, by a mechanism intrinsically different from the standard bus paradox and related temporal mechanisms. We conclude by discussing the implications of our work for the interpretation of results generated by null models of temporal networks.

  8. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  9. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  10. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  11. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  12. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  13. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  14. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  15. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  16. Visualization and quantification of heterogeneous diffusion rates in granodiorite samples by X-ray absorption imaging. Diffusion within gouge materials, altered rim and intact rock matrix

    International Nuclear Information System (INIS)

    Altman, S.J.; Tidwell, V.C.; Uchida, M.

    2001-01-01

    Matrix diffusion is one of the most important contaminant migration retardation processes in crystalline rocks. Performance assessment calculations in various countries assume that only the area of the fracture surface where advection is active provides access to the rock matrix. However, accessibility to the matrix could be significantly enhanced with diffusion into stagnant zones, fracture fillings, and through an alteration rim in the matrix. Laboratory visualization experiments were conducted on granodiorite samples to investigate and quantify diffusion rates within different zones of a Cretaceous granodiorite. Samples were collected from the Kamaishi experimental site in the northern part of the main island of Japan. Diffusion of iodine out of the sample is visualized and rates are measured using x-ray absorption imaging. X-ray images allow for measurements of relative iodine concentration and relative iodine mass as a function of time and two-dimensional space at a sub-millimeter spatial resolution. In addition, two-dimensional heterogeneous porosity fields (at the same resolution as the relative concentration fields) are measured. This imaging technique allows for a greater understanding of the spatial variability of diffusion rates than can be accomplished with standard bulk measurements. It was found that diffusion rates were fastest in partially gouge-filled fractures. Diffusion rates in the recrystallized calcite-based fracture-filling material were up to an order of magnitude lower than in gouge-filled fractures. Diffusion in altered matrix around the fractures was over an order of magnitude lower than that in the gouge-filled fractures. Healed fractures did not appear to have different diffusion rates than the unaltered matrix

  17. Visualization and quantification of heterogeneous diffusion rates in granodiorite samples by X-ray absorption imaging. Diffusion within gouge materials, altered rim and intact rock matrix

    Energy Technology Data Exchange (ETDEWEB)

    Altman, S.J.; Tidwell, V.C. [Sandia National Laboratories, Albuquerque, NM (United States); Uchida, M. [Japan Nuclear Cycle Development Inst., Ibaraki (Japan)

    2001-08-01

    Matrix diffusion is one of the most important contaminant migration retardation processes in crystalline rocks. Performance assessment calculations in various countries assume that only the area of the fracture surface where advection is active provides access to the rock matrix. However, accessibility to the matrix could be significantly enhanced with diffusion into stagnant zones, fracture fillings, and through an alteration rim in the matrix. Laboratory visualization experiments were conducted on granodiorite samples to investigate and quantify diffusion rates within different zones of a Cretaceous granodiorite. Samples were collected from the Kamaishi experimental site in the northern part of the main island of Japan. Diffusion of iodine out of the sample is visualized and rates are measured using x-ray absorption imaging. X-ray images allow for measurements of relative iodine concentration and relative iodine mass as a function of time and two-dimensional space at a sub-millimeter spatial resolution. In addition, two-dimensional heterogeneous porosity fields (at the same resolution as the relative concentration fields) are measured. This imaging technique allows for a greater understanding of the spatial variability of diffusion rates than can be accomplished with standard bulk measurements. It was found that diffusion rates were fastest in partially gouge-filled fractures. Diffusion rates in the recrystallized calcite-based fracture-filling material were up to an order of magnitude lower than in gouge-filled fractures. Diffusion in altered matrix around the fractures was over an order of magnitude lower than that in the gouge-filled fractures. Healed fractures did not appear to have different diffusion rates than the unaltered matrix.

  18. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  19. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  20. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  1. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  2. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  3. SEE rate estimation based on diffusion approximation of charge collection

    Science.gov (United States)

    Sogoyan, Armen V.; Chumakov, Alexander I.; Smolin, Anatoly A.

    2018-03-01

    The integral rectangular parallelepiped (IRPP) method remains the main approach to single event rate (SER) prediction for aerospace systems, despite the growing number of issues impairing method's validity when applied to scaled technology nodes. One of such issues is uncertainty in parameters extraction in the IRPP method, which can lead to a spread of several orders of magnitude in the subsequently calculated SER. The paper presents an alternative approach to SER estimation based on diffusion approximation of the charge collection by an IC element and geometrical interpretation of SEE cross-section. In contrast to the IRPP method, the proposed model includes only two parameters which are uniquely determined from the experimental data for normal incidence irradiation at an ion accelerator. This approach eliminates the necessity of arbitrary decisions during parameter extraction and, thus, greatly simplifies calculation procedure and increases the robustness of the forecast.

  4. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  5. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  6. Molecular Dynamics and Monte Carlo simulations resolve apparent diffusion rate differences for proteins confined in nanochannels

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, J.W., E-mail: tringe2@llnl.gov [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Ileri, N. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Levie, H.W. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Stroeve, P.; Ustach, V.; Faller, R. [Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Renaud, P. [Swiss Federal Institute of Technology, Lausanne, (EPFL) (Switzerland)

    2015-08-18

    Highlights: • WGA proteins in nanochannels modeled by Molecular Dynamics and Monte Carlo. • Protein surface coverage characterized by atomic force microscopy. • Models indicate transport characteristics depend strongly on surface coverage. • Results resolve of a four orders of magnitude difference in diffusion coefficient values. - Abstract: We use Molecular Dynamics and Monte Carlo simulations to examine molecular transport phenomena in nanochannels, explaining four orders of magnitude difference in wheat germ agglutinin (WGA) protein diffusion rates observed by fluorescence correlation spectroscopy (FCS) and by direct imaging of fluorescently-labeled proteins. We first use the ESPResSo Molecular Dynamics code to estimate the surface transport distance for neutral and charged proteins. We then employ a Monte Carlo model to calculate the paths of protein molecules on surfaces and in the bulk liquid transport medium. Our results show that the transport characteristics depend strongly on the degree of molecular surface coverage. Atomic force microscope characterization of surfaces exposed to WGA proteins for 1000 s show large protein aggregates consistent with the predicted coverage. These calculations and experiments provide useful insight into the details of molecular motion in confined geometries.

  7. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  8. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  9. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  10. SMART, Radiation Dose Rates on Cask Surface

    International Nuclear Information System (INIS)

    Yamakoshi, Hisao

    1989-01-01

    1 - Description of program or function: SMART calculates radiation dose rate at the center of each cask surface by using characteristic functions for radiation shielding ability and for radiation current back-scattered from cask wall and cask cavity of each cask, once cask-type is specified. 2 - Method of solution: Matrix Calculation

  11. Diffusion-controlled reaction. V. Effect of concentration-dependent diffusion coefficient on reaction rate in graft polymerization

    International Nuclear Information System (INIS)

    Imre, K.; Odian, G.

    1979-01-01

    The effect of diffusion on radiation-initiated graft polymerization has been studied with emphasis on the single- and two-penetrant cases. When the physical properties of the penetrants are similar, the two-penetrant problems can be reduced to the single-penetrant problem by redefining the characteristic parameters of the system. The diffusion-free graft polymerization rate is assumed to be proportional to the upsilon power of the monomer concentration respectively, and, in which the proportionality constant a = k/sub p/R/sub i//sup w//k/sub t//sup z/, where k/sub p/ and k/sub t/ are the propagation and termination rate constants, respectively, and R/sub i/ is the initiation rate. The values of upsilon, w, and z depend on the particular reaction system. The results of earlier work were generalized by allowing a non-Fickian diffusion rate which predicts an essentially exponential dependence on the monomer concentration of the diffusion coefficient, D = D 0 [exp(deltaC/M)], where M is the saturation concentration. A reaction system is characterized by the three dimensionless parameters, upsilon, delta, and A = (L/2)[aM/sup (upsilon--1)//D 0 ]/sup 1/2/, where L is the polymer film thickness. Graft polymerization tends to become diffusion controlled as A increases. Larger values of delta and ν cause a reaction system to behave closer to the diffusion-free regime. Transition from diffusion-free to diffusion-controlled reaction involves changes in the dependence of the reaction rate on film thickness, initiation rate, and monomer concentration. Although the diffusion-free rate is w order in initiation rate, upsilon order in monomer, and independent of film thickness, the diffusion-controlled rate is w/2 order in initiator rate and inverse first-order in film thickness. Dependence of the diffusion-controlled rate on monomer is dependent in a complex manner on the diffusional characteristics of the reaction system. 11 figures, 4 tables

  12. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  13. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  14. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  15. Mathematical modelling of the influenced of diffusion rate on macro nutrient availability in paddy field

    Science.gov (United States)

    Renny; Supriyanto

    2018-04-01

    Nutrition is the chemical compounds that needed by the organism for the growth process. In plants, nutrients are organic or inorganic compounds that are absorbed from the roots of the soil. It consist of macro and micro nutrient. Macro nutrients are nutrition that needed by plants in large quantities, such as, nitrogen, calcium, pottacium, magnesium, and sulfur. The total soil nutrient is the difference between the input nutrient and the output nutrients. Input nutrients are nutrient that derived from the decomposition of organic substances. Meanwhile, the output nutrient consists of the nutrients that absorbed by plant roots (uptake), the evaporated nutrients (volatilized) and leached nutrients. The nutrient transport can be done through diffusion process. The diffusion process is essential in removing the nutrient from one place to the root surface. It will cause the rate of absorption of nutrient by the roots will be greater. Nutrient concept in paddy filed can be represented into a mathematical modelling, by making compartment models. The rate of concentration change in the compartment model forms a system of homogeneous linear differential equations. In this research, we will use Laplaces transformation to solve the compartment model and determined the dynamics of macro nutrition due to diffusion process.

  16. The determination of volatile chlorinated hydrocarbons in air. Sampling rate and efficiency of diffuse samplers

    Energy Technology Data Exchange (ETDEWEB)

    Giese, U.; Stenner, H.; Kettrup, A.

    1989-05-01

    When applicating diffusive sampling-systems to workplace air-monitoring it is necessary to know the behaviour of the diffusive-rate and the efficiency in dependence of concentration, exposition time and the type of pollutant. Especially concerning mixtures of pollutants there are negative influences by competition and mutual displacement possible. Diffusive-rate and discovery for CH/sub 2/Cl/sub 2/ and CHCl/sub 3/ were investigated using two different types of diffuse samplers. For this it was necessary to develop suitable defices for standard gas generation and for the exposition of diffusive-samplers to a standard gas mixture. (orig.).

  17. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  18. Using genetic data to estimate diffusion rates in heterogeneous landscapes.

    Science.gov (United States)

    Roques, L; Walker, E; Franck, P; Soubeyrand, S; Klein, E K

    2016-08-01

    Having a precise knowledge of the dispersal ability of a population in a heterogeneous environment is of critical importance in agroecology and conservation biology as it can provide management tools to limit the effects of pests or to increase the survival of endangered species. In this paper, we propose a mechanistic-statistical method to estimate space-dependent diffusion parameters of spatially-explicit models based on stochastic differential equations, using genetic data. Dividing the total population into subpopulations corresponding to different habitat patches with known allele frequencies, the expected proportions of individuals from each subpopulation at each position is computed by solving a system of reaction-diffusion equations. Modelling the capture and genotyping of the individuals with a statistical approach, we derive a numerically tractable formula for the likelihood function associated with the diffusion parameters. In a simulated environment made of three types of regions, each associated with a different diffusion coefficient, we successfully estimate the diffusion parameters with a maximum-likelihood approach. Although higher genetic differentiation among subpopulations leads to more accurate estimations, once a certain level of differentiation has been reached, the finite size of the genotyped population becomes the limiting factor for accurate estimation.

  19. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  20. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  1. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  2. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  3. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  4. Strain rate effect on sooting characteristics in laminar counterflow diffusion flames

    KAUST Repository

    Wang, Yu

    2016-01-20

    The effects of strain rate, oxygen enrichment and fuel type on the sooting characteristics of counterflow diffusion flames were studied. The sooting structures and relative PAH concentrations were measured with laser diagnostics. Detailed soot modeling using recently developed PAH chemistry and surface reaction mechanism was performed and the results were compared with experimental data for ethylene flames, focusing on the effects of strain rates. The results showed that increase in strain rate reduced soot volume fraction, average size and peak number density. Increase in oxygen mole fraction increased soot loading and decreased its sensitivity on strain rate. The soot volume fractions of ethane, propene and propane flames were also measured as a function of global strain rate. The sensitivity of soot volume fraction to strain rate was observed to be fuel dependent at a fixed oxygen mole fraction, with the sensitivity being higher for more sooting fuels. However, when the soot loadings were matched at a reference strain rate for different fuels by adjusting oxygen mole fraction, the dependence of soot loading on strain rate became comparable among the tested fuels. PAH concentrations were shown to decrease with increase in strain rate and the dependence on strain rate is more pronounced for larger PAHs. Soot modeling was performed using detailed PAH growth chemistry with molecular growth up to coronene. A qualitative agreement was obtained between experimental and simulation results, which was then used to explain the experimentally observed strain rate effect on soot growth. However, quantitatively, the simulation result exhibits higher sensitivity to strain rate, especially for large PAHs and soot volume fractions.

  5. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  6. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  7. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  8. Effective reaction rates in diffusion-limited phosphorylation-dephosphorylation cycles

    Science.gov (United States)

    Szymańska, Paulina; Kochańczyk, Marek; Miekisz, Jacek; Lipniacki, Tomasz

    2015-02-01

    We investigate the kinetics of the ubiquitous phosphorylation-dephosphorylation cycle on biological membranes by means of kinetic Monte Carlo simulations on the triangular lattice. We establish the dependence of effective macroscopic reaction rate coefficients as well as the steady-state phosphorylated substrate fraction on the diffusion coefficient and concentrations of opposing enzymes: kinases and phosphatases. In the limits of zero and infinite diffusion, the numerical results agree with analytical predictions; these two limits give the lower and the upper bound for the macroscopic rate coefficients, respectively. In the zero-diffusion limit, which is important in the analysis of dense systems, phosphorylation and dephosphorylation reactions can convert only these substrates which remain in contact with opposing enzymes. In the most studied regime of nonzero but small diffusion, a contribution linearly proportional to the diffusion coefficient appears in the reaction rate. In this regime, the presence of opposing enzymes creates inhomogeneities in the (de)phosphorylated substrate distributions: The spatial correlation function shows that enzymes are surrounded by clouds of converted substrates. This effect becomes important at low enzyme concentrations, substantially lowering effective reaction rates. Effective reaction rates decrease with decreasing diffusion and this dependence is more pronounced for the less-abundant enzyme. Consequently, the steady-state fraction of phosphorylated substrates can increase or decrease with diffusion, depending on relative concentrations of both enzymes. Additionally, steady states are controlled by molecular crowders which, mostly by lowering the effective diffusion of reactants, favor the more abundant enzyme.

  9. Gaussian and Affine Approximation of Stochastic Diffusion Models for Interest and Mortality Rates

    Directory of Open Access Journals (Sweden)

    Marcus C. Christiansen

    2013-10-01

    Full Text Available In the actuarial literature, it has become common practice to model future capital returns and mortality rates stochastically in order to capture market risk and forecasting risk. Although interest rates often should and mortality rates always have to be non-negative, many authors use stochastic diffusion models with an affine drift term and additive noise. As a result, the diffusion process is Gaussian and, thus, analytically tractable, but negative values occur with positive probability. The argument is that the class of Gaussian diffusions would be a good approximation of the real future development. We challenge that reasoning and study the asymptotics of diffusion processes with affine drift and a general noise term with corresponding diffusion processes with an affine drift term and an affine noise term or additive noise. Our study helps to quantify the error that is made by approximating diffusive interest and mortality rate models with Gaussian diffusions and affine diffusions. In particular, we discuss forward interest and forward mortality rates and the error that approximations cause on the valuation of life insurance claims.

  10. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  11. A calculation of the surface recombination rate constant for hydrogen isotopes on metals

    International Nuclear Information System (INIS)

    Baskes, M.J.

    1980-01-01

    The surface recombination rate constant for hydrogen isotopes on a metal has been calculated using a simple model whose parameters may be determined by direct experimental measurements. Using the experimental values for hydrogen diffusivity, solubility, and sticking coefficient at zero surface coverage a reasonable prediction of the surface recombination constant may be made. The calculated recombination constant is in excellent agreement with experiment for bcc iron. A heuristic argument is developed which, along with the rate constant calculation, shows that surface recombination is important in those metals in which hydrogen has an exothermic heat of solution. (orig.)

  12. A first-passage scheme for determination of overall rate constants for non-diffusion-limited suspensions

    Science.gov (United States)

    Lu, Shih-Yuan; Yen, Yi-Ming

    2002-02-01

    A first-passage scheme is devised to determine the overall rate constant of suspensions under the non-diffusion-limited condition. The original first-passage scheme developed for diffusion-limited processes is modified to account for the finite incorporation rate at the inclusion surface by using a concept of the nonzero survival probability of the diffusing entity at entity-inclusion encounters. This nonzero survival probability is obtained from solving a relevant boundary value problem. The new first-passage scheme is validated by an excellent agreement between overall rate constant results from the present development and from an accurate boundary collocation calculation for the three common spherical arrays [J. Chem. Phys. 109, 4985 (1998)], namely simple cubic, body-centered cubic, and face-centered cubic arrays, for a wide range of P and f. Here, P is a dimensionless quantity characterizing the relative rate of diffusion versus surface incorporation, and f is the volume fraction of the inclusion. The scheme is further applied to random spherical suspensions and to investigate the effect of inclusion coagulation on overall rate constants. It is found that randomness in inclusion arrangement tends to lower the overall rate constant for f up to the near close-packing value of the regular arrays because of the inclusion screening effect. This screening effect turns stronger for regular arrays when f is near and above the close-packing value of the regular arrays, and consequently the overall rate constant of the random array exceeds that of the regular array. Inclusion coagulation too induces the inclusion screening effect, and leads to lower overall rate constants.

  13. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  14. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  15. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  16. A photo-tunable membrane based on inter-particle crosslinking for decreasing diffusion rates

    KAUST Repository

    Li, Song; Moosa, Basem; Chen, Ye; Li, Wengang; Khashab, Niveen M.

    2015-01-01

    %. To prove the applicability of the designed system, the composite membrane was coated on a model drug reservoir tablet. Upon irradiating the tablet with UV light, the original permeability decreased by 57%, and consequently the diffusion rate of the cargo

  17. Rates of convergence and asymptotic normality of curve estimators for ergodic diffusion processes

    NARCIS (Netherlands)

    J.H. van Zanten (Harry)

    2000-01-01

    textabstractFor ergodic diffusion processes, we study kernel-type estimators for the invariant density, its derivatives and the drift function. We determine rates of convergence and find the joint asymptotic distribution of the estimators at different points.

  18. Strain rate effect on sooting characteristics in laminar counterflow diffusion flames

    KAUST Repository

    Wang, Yu; Chung, Suk-Ho

    2016-01-01

    The effects of strain rate, oxygen enrichment and fuel type on the sooting characteristics of counterflow diffusion flames were studied. The sooting structures and relative PAH concentrations were measured with laser diagnostics. Detailed soot

  19. Absence of saturation of void growth in rate theory with anisotropic diffusion

    CERN Document Server

    Hudson, T S; Sutton, A P

    2002-01-01

    We present a first attempt at solution the problem of the growth of a single void in the presence of anisotropically diffusing radiation induced self-interstitial atom (SIA) clusters. In order to treat a distribution of voids we perform ensemble averaging over the positions of centres of voids using a mean-field approximation. In this way we are able to model physical situations in between the Standard Rate Theory (SRT) treatment of swelling (isotropic diffusion), and the purely 1-dimensional diffusion of clusters in the Production Bias Model. The background absorption by dislocations is however treated isotropically, with a bias for interstitial cluster absorption assumed similar to that of individual SIAs. We find that for moderate anisotropy, unsaturated void growth is characteristic of this anisotropic diffusion of clusters. In addition we obtain a higher initial void swelling rate than predicted by SRT whenever the diffusion is anisotropic.

  20. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  1. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  2. Magnetoresistance of films and strips with the diffuse surface scattering

    International Nuclear Information System (INIS)

    Aronov, A.G.

    1993-08-01

    Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs

  3. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  4. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  5. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  6. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  7. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  8. Computing Rates of Small Molecule Diffusion Through Protein Channels Using Markovian Milestoning

    Science.gov (United States)

    Abrams, Cameron

    2014-03-01

    Measuring diffusion rates of ligands plays a key role in understanding the kinetic processes inside proteins. For example, although many molecular simulation studies have reported free energy barriers to infer rates for CO diffusion in myoglobin (Mb), they typically do not include direct calculation of diffusion rates because of the long simulation times needed to infer these rates with statistical accuracy. We show in this talk how to apply Markovian milestoning along minimum free-energy pathways to calculate diffusion rates of CO inside Mb. In Markovian milestoning, one partitions a suitable reaction coordinate space into regions and performs restrained molecular dynamics in each region to accumulate kinetic statistics that, when assembled across regions, provides an estimate of the mean first-passage time between states. The mean escape time for CO directly from the so-called distal pocket (DP) through the histidine gate (HG) is estimated at about 24 ns, confirming the importance of this portal for CO. But Mb is known to contain several internal cavities, and cavity-to-cavity diffusion rates are also computed and used to build a complete kinetic network as a Markov state model. Within this framework, the effective mean time of escape to the solvent through HG increases to 30 ns. Our results suggest that carrier protein structure may have evolved under pressure to modulate dissolved gas release rates using a network of ligand-accessible cavities. Support: NIH R01GM100472.

  9. Functional evaluation of hydronephrosis by diffusion-weighted MR imaging: Relationship between apparent diffusion coefficient and split glomerular filtration rate

    International Nuclear Information System (INIS)

    Toyoshima, S.; Noguchi, K.; Seto, H.; Shimizu, M.; Watanabe, N.

    2000-01-01

    To determine the relationship between apparent diffusion coefficient (ADC) values measured by diffusion-weighted MR imaging and split renal function determined by renal scintigraphy in patients with hydronephrosis. Material and Methods: Diffusion-weighted imaging on a 1.5 T MR unit and renal scintigraphy were performed in 36 patients with hydronephrosis (45 hydronephrotic kidneys, 21 non-hydronephrotic kidneys). ADC values of the individual kidneys were measured by diffusion-weighted MR imaging. Split renal function (glomerular filtration rate (GFR)) was determined by renal scintigraphy using 99m Tc-DTPA. The relationship between ADC values and split GFR was examined in 66 kidneys. The hydronephrotic kidneys were further classified into three groups (severe renal dysfunction, GFR 25 ml/min, n=28), and mean values for ADCs were calculated. Results: In hydronephrotic kidneys, there was a moderate positive correlation between ADC values and split GFR (R2=0.56). On the other hand, in non-hydronephrotic kidneys, poor correlation between ADC values and split GFR was observed (R2=0.08). The mean values for ADCs of the dysfunctioning hydronephrotic kidneys (severe renal dysfunction, 1.32x10 -3 ±0.18x10 -3 mm 2 /s; moderate renal dysfunction, 1.38x10 -3 ±0.10x10 -3 mm2/s) were significantly lower than that of the normal functioning hydronephrotic kidneys (1.63x10 -3 ±0.12±10 -3 mm 2 /s). Conclusion: These results indicated that measurement of ADC values by diffusion-weighted MR imaging has a potential value in the evaluation of the functional status of hydronephrotic kidneys

  10. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  11. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  12. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  13. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  14. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  15. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  16. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  17. Effect of macromolecular crowding on the rate of diffusion-limited ...

    Indian Academy of Sciences (India)

    The enzymatic reaction rate has been shown to be affected by the presence of such macromolecules. A simple numerical model is proposed here based on percolation and diffusion in disordered systems to study the effect of macromolecular crowding on the enzymatic reaction rates. The model qualitatively explains some ...

  18. Inverse method for determining radon diffusion coefficient and free radon production rate of fragmented uranium ore

    International Nuclear Information System (INIS)

    Ye, Yong-jun; Wang, Li-heng; Ding, De-xin; Zhao, Ya-li; Fan, Nan-bin

    2014-01-01

    The radon diffusion coefficient and the free radon production rate are important parameters for describing radon migration in the fragmented uranium ore. In order to determine the two parameters, the pure diffusion migration equation for radon was firstly established and its analytic solution with the two parameters to be determined was derived. Then, a self manufactured experimental column was used to simulate the pure diffusion of the radon, the improved scintillation cell method was used to measure the pore radon concentrations at different depths of the column loaded with the fragmented uranium ore, and the nonlinear least square algorithm was used to inversely determine the radon diffusion coefficient and the free radon production rate. Finally, the solution with the two inversely determined parameters was used to predict the pore radon concentrations at some depths of the column, and the predicted results were compared with the measured results. The results show that the predicted results are in good agreement with the measured results and the numerical inverse method is applicable to the determination of the radon diffusion coefficient and the free radon production rate for the fragmented uranium ore. - Highlights: • Inverse method for determining two transport parameters of radon is proposed. • A self-made experimental apparatus is used to simulate radon diffusion process. • Sampling volume and position for measuring radon concentration are optimized. • The inverse results of an experimental sample are verified

  19. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  20. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  1. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  2. INTRODUCTION: Surface Dynamics, Phonons, Adsorbate Vibrations and Diffusion

    Science.gov (United States)

    Bruch, L. W.

    2004-07-01

    -temperature operation, as well as improving the spectral purity, modulation speed and peak power output. Many applications in medicine, environmental sensing and communications can be addressed with the achievement of significant improvements in these parameters. Semiconductor optical amplifiers (SOAs) are also important devices of interest, since it is widely predicted that the market for SOAs in photonic access networks will increase dramatically in the next few years. In addition to EELs and SOAs, vertical cavity surface-emitting lasers (VCSELs), vertical external cavity surface-emitting lasers (VECSELs), vertical cavity semiconductor optical amplifiers (VCSOAs), and semiconductor saturable absorber mirrors (SESAMs) are of increasing importance. The VECSELs can potentially incorporate saturable absorbers for very high repetition rate (~100 GHz) pulsed and potentially MEMS-tuneable sources. VECSEL devices in the 2-3 µm range for applications in e.g. free-space optical (FSO) communications, are possible using InAsN/InGaAs/InP with AlGaAs metamorphic mirror growth. Semiconductor saturable-absorber mirror structures (SESAMs) have demonstrated widespread applicability for self-starting passive mode locking of (diode-pumped) solid-state lasers, to produce high-performance picosecond and femtosecond laser sources for scientific, instrumentation and industrial use. Very recently, these devices have also shown applicability for ultra short pulse generation at >GHz repetition rates, both in DPSS lasers and surface-emitting semiconductor lasers. These devices are undoped monolithic DBR structures incorporating one or more quantum wells for saturable absorption. Low-loss and high-damage threshold requirements demand pseudomorphic growth, and have, until very recently, essentially limited these devices to the 800-1100 nm range, but extension beyond this range is urgently required by a host of mode locking applications. In addition to these devices modulators and photodiodes, including quantum

  3. Diffuse emission and control of copper in urban surface runoff.

    Science.gov (United States)

    Boller, M A; Steiner, M

    2002-01-01

    Copper washed off from roofs and roads is considered to be a major contribution to diffuse copper pollution of urban environments. In order to guarantee sustainable protection of soils and water, the long-term strategy is to avoid or replace copper containing materials on roofs and fagades. Until achievement of this goal, a special adsorber system is suggested to control the diffuse copper fluxes by retention of copper by a mixture of granulated iron-hydroxide (GEH) and calcium carbonate. Since future stormwater runoff concepts are based on decentralised runoff infiltration into the underground, solutions are proposed which provide for copper retention in infiltration sites using GEH adsorption layers. The example of a large copper façade of which the runoff is treated in an adsorption trench reveals the first full-scale data on façade runoff and adsorber performance. During the first year of investigation average façade runoff concentrations in the range of 1-10 mg Cu/l are reduced by 96-99% in the adsorption ditch.

  4. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  5. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  6. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  7. Mechanobiology of LDL mass transport in the arterial wall under the effect of magnetic field, part I: Diffusion rate

    Energy Technology Data Exchange (ETDEWEB)

    Aminfar, Habib, E-mail: hh_aminfar@tabrizu.ac.ir [Faculty of Mechanical Engineering, University of Tabriz, Tabriz (Iran, Islamic Republic of); Mohammadpourfard, Mousa, E-mail: Mohammadpour@tabrizu.ac.ir [Faculty of Chemical and Petroleum Engineering, University of Tabriz, Tabriz 5166616471 (Iran, Islamic Republic of); Khajeh, Kosar, E-mail: k.khajeh.2005@tabrizu.ac.ir [Faculty of Mechanical Engineering, University of Tabriz, Tabriz (Iran, Islamic Republic of)

    2017-03-15

    It is well-known that the Low Density Lipoprotein (LDL) can accumulate and penetrate into the arterial wall. Here, we have investigated the diffusion rate of macromolecules across the porous layer of blood vessel under the effects of magnetic force. By using a finite volume technique, it was found that magnetic field makes alterations in diffusion rate of LDLs, also surface concentration of macromolecules on the walls. As well, the influence of different value of Re and Sc number in the presence of a magnetic field have shown as nondimensional concentration profiles. Magnetic field considered as a body force, porous layer simulated by using Darcy's law and the blood regarded as nano fluid which was examined as a single phase model. - Highlights: • LDLs mass transfer across the arterial wall under magnetic field has simulated numerically. • Arterial wall assumed as a homogeneous porous layer by using Darcy's law. • Blood containing 4% Vol. Fe{sub 3}O{sub 4} regarded as nanofluid and has examined by single phase model. • Magnetic field significantly affects the diffusion rate of LDLs through porous arterial wall.

  8. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  9. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  10. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  11. Are US utility standby rates inhibiting diffusion of customer-owned generating systems?

    International Nuclear Information System (INIS)

    Jackson, Jerry

    2007-01-01

    New, small-scale electric generation technologies permit utility customers to generate some of their own electric power and to utilize waste heat for space heating and other applications at the building site. This combined heat and power (CHP) characteristic can provide significant energy-cost savings. However, most current US utility regulations leave CHP standby rate specification largely to utility discretion resulting in claims by CHP advocates that excessive standby rates are significantly reducing CHP-related savings and inhibiting CHP diffusion. The impacts of standby rates on the adoption of CHP are difficult to determine; however, because of the characteristically slow nature of new technology diffusion. This study develops an agent-based microsimulation model of CHP technology choice using cellular automata to represent new technology information dispersion and knowledge acquisition. Applying the model as an n-factorial experiment quantifies the impacts of standby rates on CHP technologies under alternative diffusion paths. Analysis of a sample utility indicates that, regardless of the likely diffusion process, reducing standby rates to reflect the cost of serving a large number of small, spatially clustered CHP systems significantly increases the adoption of these technologies

  12. Efficient kinetic Monte Carlo method for reaction-diffusion problems with spatially varying annihilation rates

    Science.gov (United States)

    Schwarz, Karsten; Rieger, Heiko

    2013-03-01

    We present an efficient Monte Carlo method to simulate reaction-diffusion processes with spatially varying particle annihilation or transformation rates as it occurs for instance in the context of motor-driven intracellular transport. Like Green's function reaction dynamics and first-passage time methods, our algorithm avoids small diffusive hops by propagating sufficiently distant particles in large hops to the boundaries of protective domains. Since for spatially varying annihilation or transformation rates the single particle diffusion propagator is not known analytically, we present an algorithm that generates efficiently either particle displacements or annihilations with the correct statistics, as we prove rigorously. The numerical efficiency of the algorithm is demonstrated with an illustrative example.

  13. The rate of diffusion into advanced gas cooled reactor moderator bricks: an equivalent cylinder model

    International Nuclear Information System (INIS)

    Kyte, W.S.

    1980-01-01

    The graphite moderator bricks which make up the moderator of an advanced gas-cooled nuclear reactor (AGR) are of many different and complex shapes. Many physico-chemical processes that occur within these porous bricks include a diffusional step and thus to model these processes it is necessary to solve the diffusion equation (with chemical reaction) in a porous medium of complex shape. A finite element technique is applied to calculating the rate at which nitrogen diffuses into and out of the porous moderator graphite during operation of a shutdown procedure for an AGR. However, the finite element method suffers from several disadvantages that undermine its general usefulness for calculating rates of diffusion in AGR moderator cores. A model which overcomes some of these disadvantages is presented (the equivalent cylinder model) and it is shown that this gives good results for a variety of different boundary and initial conditions

  14. Surface modification of polyethylene by diffuse barrier discharge plasma

    Czech Academy of Sciences Publication Activity Database

    Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

    2013-01-01

    Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

  15. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  16. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  17. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  18. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  20. Order of current variance and diffusivity in the rate one totally asymmetric zero range process

    NARCIS (Netherlands)

    Balázs, M.; Komjáthy, J.

    2008-01-01

    We prove that the variance of the current across a characteristic is of order t 2/3 in a stationary constant rate totally asymmetric zero range process, and that the diffusivity has order t 1/3. This is a step towards proving universality of this scaling behavior in the class of one-dimensional

  1. Determination of H2 Diffusion Rates through Various Closures on TRU Waste Bag-Out Bags

    International Nuclear Information System (INIS)

    Noll, Phillip D. Jr.; Callis, E. Larry; Norman, Kirsten M.

    1999-01-01

    The amount of H 2 diffusion through twist and tape (horse-tail), wire tie, plastic tie, and heat sealed closures on transuranic (TRU) waste bag-out bags has been determined. H 2 diffusion through wire and plastic tie closures on TRU waste bag-out bags has not been previously characterized and, as such, TRU waste drums containing bags with these closures cannot be certified and/or shipped to the Waste Isolation Pilot Plant (WIPP). Since wire ties have been used at Los Alamos National Laboratory (LANL) from 1980 to 1991 and the plastic ties from 1991 to the present, there are currently thousands of waste drums that cannot be shipped to the WIPP site. Repackaging the waste would be prohibitively expensive. Diffusion experiments performed on the above mentioned closures show that the diffusion rates of plastic tie and horse-tail closures are greater than the accepted value presented in the TRU-PACT 11 Safety Analysis Report (SAR). Diffusion rates for wire tie closures are not statistically different from the SAR value. Thus, drums containing bags with these closures can now potentially be certified which would allow for their consequent shipment to WIPP

  2. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  3. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  4. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  5. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  6. Scaling and diffusion of oil spills in the Ocean Surface

    Science.gov (United States)

    Tarquis, A. M.; Platonov, A.; Grau, J.; Sekula, E.

    2010-05-01

    The region of the Gulf of Lions at the northwestern Mediterranean Sea has been studied within a ten-year period from December 1996 until November 2006. More than 1000 synthetic aperture radar (SAR) images, which have been acquired by the Second European Remote Sensing Satellite (ERS 1/2) as well as from ENVISAT. We present statistical results of the structure of several features revealed by SAR such as oil spills and tensioactive slicks dynamic. We compare oil splils obtained from the projects Clean Seas,ENVA4/CT/0334, RC2003/005700, ESP2005/07551 and ESA/AO/IP2240. Since natural (caused by plankton, fish, etc.) slicks as well as man-made oil slicks dampen the small-scale surface waves, which are responsible for the radar backscattering from the ocean surface, both types of effects may be confused and give look/alike false oil spill detections. The early SAR images were processed at a resolution of 1 pixel=200m and were provided by the RApid Information Dissemination System (RAIDS) SAR processing facility in West Freugh, UK. Recent ENVISAT images directly from ESA allow a higher resolution of 1 pixel = 26 m, improving the detected turbulent scaling range. The occurrence of marine oil pollution as well as several dynamic features near Barcelona (frames 8-10, 19, 20; 200 SAR images)is itself a random multi-scale process. The use of different multifractal techniques, both using limits to the smallest and largest available scales, show that the scaling laws are very complex and depend strongly on intermittency of the assumed turbulent cascade, the shapes of the multifractal spectra functions are seen to deviate from an homogeneous multifractal and depend both on the initial conditions of the spill or slick, and on the transit time that the spill has been subjected to the local turbulence.

  7. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  8. On diffusion processes with variable drift rates as models for decision making during learning

    International Nuclear Information System (INIS)

    Eckhoff, P; Holmes, P; Law, C; Connolly, P M; Gold, J I

    2008-01-01

    We investigate Ornstein-Uhlenbeck and diffusion processes with variable drift rates as models of evidence accumulation in a visual discrimination task. We derive power-law and exponential drift-rate models and characterize how parameters of these models affect the psychometric function describing performance accuracy as a function of stimulus strength and viewing time. We fit the models to psychophysical data from monkeys learning the task to identify parameters that best capture performance as it improves with training. The most informative parameter was the overall drift rate describing the signal-to-noise ratio of the sensory evidence used to form the decision, which increased steadily with training. In contrast, secondary parameters describing the time course of the drift during motion viewing did not exhibit steady trends. The results indicate that relatively simple versions of the diffusion model can fit behavior over the course of training, thereby giving a quantitative account of learning effects on the underlying decision process

  9. Determination of surface dose rate for cloisonne using thermoluminescent dosimeters

    Energy Technology Data Exchange (ETDEWEB)

    Hengyuan, Zhao; Yulian, Zhang

    1985-07-01

    In this paper, the measuring method and results of surface dose rate of cloisonne using CaSO/sub 4/ Dy-Teflon foil dosimeter are described. The surface dose rate of all products are below 0.015 mrad/h. These products contain 42 sorts of jewelery and 20 sets of wares (such as vases, plates, ash-trays, etc.). Most of the data fall within the range of natural background. For comparison, some jewelery from Taiwan and 3 vases from Japan are measured. The highest surface dose rate of 0.78 mrad/h is due to the necklace jewelery from Taiwan.

  10. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  11. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  12. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  13. Cooling Rates of Mantle Peridotites Estimated from Lithophile Trace Element Diffusion in Orthopyroxene

    Science.gov (United States)

    von der Handt, A.; Hellebrand, E.; Snow, J. E.

    2007-12-01

    Cooling rates of ocean floor mantle rocks from mid-ocean ridges can potentially provide important information about ridge dynamics, emplacement mechanisms and mantle uplift. There are a growing number of geospeedometric methods to retrieve such cooling rates in various settings. However, few exist for typical four- phase mantle peridotites and they only cover temperatures below 800° C. The down-temperature lithophile trace element exchange between clinopyroxene (cpx) and orthopyroxene (opx) can provide such a high- temperature spinel peridotite geospeedometer. Orthopyroxenes studied by SIMS from two fresh Gakkel Ridge peridotites are zoned in all trace elements while clinopyroxenes are homogeneous. This allows the calculation of equilibrium temperatures [1]. Several profiles in opx cover a range of 1250° C (opx core) to 800° C (opx rim) and are in agreement with straightforward diffusion and closure temperature models. The systematics of REE diffusion in opx deviate from the results of a recent experimental study [2]. The data allow us to estimate diffusion systematics of 16 elements (REE and TE) and their cation distributions in orthopyroxene. The data set is internally coherent as all elements were subjected to the same extrinsic parameters. 1. Decreasing ionic radius increases REE diffusion in opx (as it does in cpx). 2. M2-site diffusion is controlled more by ionic radius than by cationic charge. 3. M1-site diffusion is controlled by both ionic radius and cationic charge. 4. M1-site diffusion is generally slower than M2-site diffusion for isovalent cations, most likely because of higher M1- site energies compared to M2-site. The advantages of this geospeedometer should be its relatively good precision, use of standard analytical methods and its coverage of the important range between solidus temperatures and 800° C. In combination with other geospeedometers it will be possible to retrieve the continuous cooling history of a mantle rock from its solidus down

  14. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  15. Application of the multi-rate diffusion approach in tracer test studies at Aespoe HRL. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Haggerty, R. [Oregon State Univ., Corvallis, OR (United States). Dept. of Geosciences

    1999-11-01

    This report summarizes an investigation into heterogeneous diffusivity and associated parameters within granitic rocks at the Aespoe Hard Rock Laboratory (HRL). Our tasks for this investigation were: (1) to assess the potential for either anomalous or multi-rate diffusion within Aespoe rocks; (2) to evaluate existing data relating to anomalous and multi-rate diffusion within Aespoe rocks; (3) to perform scoping calculations in support of a Long Term Diffusion Experiment (LTDE) design; and (4) to begin developing a mathematical and computer model for solute advection in the presence of anomalous matrix diffusion. In addition to carrying out these tasks, we also report on (5) the late-time behavior of breakthrough curves. First, in regard to the potential for anomalous and multi-rate diffusion and analyses of existing data, we find that (1) in a literature review of 100 column experiments in various types of rock and sediment, rate coefficients decrease with experimental observation time. This is precisely what would be expected of both multi-rate and anomalous diffusion. (2) Three sets of through-diffusion experiments in Fenno-Scandian granitic rock found decreasing effective diffusivity, D{sub e}, with sample length, while one set did not. (3) Based on diffusivity and sorption data, and speculation on matrix block size variability, the total variability of D{sub a}/a{sup 2} may reasonably be expected to exceed 4 orders of magnitude. (4) Analyses of two-well tracer data completed to date are ambiguous with respect to multi-rate diffusion. Analyses of TRUE data are currently underway and may support multi-rate diffusion. Second, in regard to the potential consequences of multi-rate and anomalous diffusion on nuclear waste disposal, we found the following key points: (1) No single value of diffusivity can represent the diffusion process at all time- or length-scales if diffusion is truly anomalous, while a single value of diffusivity will represent diffusion

  16. Application of the multi-rate diffusion approach in tracer test studies at Aespoe HRL. Final report

    International Nuclear Information System (INIS)

    Haggerty, R.

    1999-11-01

    This report summarizes an investigation into heterogeneous diffusivity and associated parameters within granitic rocks at the Aespoe Hard Rock Laboratory (HRL). Our tasks for this investigation were: (1) to assess the potential for either anomalous or multi-rate diffusion within Aespoe rocks; (2) to evaluate existing data relating to anomalous and multi-rate diffusion within Aespoe rocks; (3) to perform scoping calculations in support of a Long Term Diffusion Experiment (LTDE) design; and (4) to begin developing a mathematical and computer model for solute advection in the presence of anomalous matrix diffusion. In addition to carrying out these tasks, we also report on (5) the late-time behavior of breakthrough curves. First, in regard to the potential for anomalous and multi-rate diffusion and analyses of existing data, we find that (1) in a literature review of 100 column experiments in various types of rock and sediment, rate coefficients decrease with experimental observation time. This is precisely what would be expected of both multi-rate and anomalous diffusion. (2) Three sets of through-diffusion experiments in Fenno-Scandian granitic rock found decreasing effective diffusivity, D e , with sample length, while one set did not. (3) Based on diffusivity and sorption data, and speculation on matrix block size variability, the total variability of D a /a 2 may reasonably be expected to exceed 4 orders of magnitude. (4) Analyses of two-well tracer data completed to date are ambiguous with respect to multi-rate diffusion. Analyses of TRUE data are currently underway and may support multi-rate diffusion. Second, in regard to the potential consequences of multi-rate and anomalous diffusion on nuclear waste disposal, we found the following key points: (1) No single value of diffusivity can represent the diffusion process at all time- or length-scales if diffusion is truly anomalous, while a single value of diffusivity will represent diffusion adequately for some

  17. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  18. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  19. Properties of water surface discharge at different pulse repetition rates

    International Nuclear Information System (INIS)

    Ruma,; Yoshihara, K.; Hosseini, S. H. R.; Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-01-01

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H 2 O 2 ) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H 2 O 2 and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  20. Durability predictions from rate of diffusion testing of normal portland cement, fly ash, and slag concrete

    International Nuclear Information System (INIS)

    Philipose, K.E.

    1991-09-01

    A waste repository for the belowground disposal of low-level radioactive waste, labelled IRUS (Intrusion Resistant Underground Structure), is planned at the Chalk River Laboratories. It relies greatly on the durability of concrete for a minimum of 500 years of service life. A research program based on laboratory testing to design a durable concrete and predict its useful engineered service life is in progress. The durability of concrete depends on its resistance to deterioration from both internal and external causes. Since the rate of degradation depends to a major extent on the rate of ingress of aggressive ions into concrete, laboratory testing is in progress to establish the diffusion rates of chlorides and sulphate ions. A total of 1000 concrete specimens and 500 paste specimens are being exposed at 22 degrees and 45 degrees C to twenty-five different combinations of corrosive agents, including CO 2 . Procedures to measure the ionic penetration profile and to determine the factors controlling diffusion of ions in the various concretes have been developed. The paper presents the initial results from the research program and the longevity predictions to qualify concretes for the IRUS waste repository, based on 16 months of diffusion testing on laboratory specimens

  1. Quantitation of chemical exchange rates using pulsed-field-gradient diffusion measurements

    International Nuclear Information System (INIS)

    Andrec, Michael; Prestegard, James H.

    1997-01-01

    A new approach to the quantitation of chemical exchange rates is presented, and its utility is illustrated with application to the exchange of protein amide protons with bulk water. The approach consists of a selective-inversion exchange HMQC experiment in which a short spin echo diffusion filter has been inserted into the exchange period. In this way, the kinetics of exchange are encoded directly in an apparent diffusion coefficient which is a function of the position of the diffusion filter in the pulse sequence. A detailed theoretical analysis of this experiment indicates that, in addition to the measurement of simple exchange rates, the experiment is capable of measuring the effect of mediated exchange, e.g. the transfer of magnetization from bulk water to an amide site mediated by an internal bound water molecule or a labile protein side-chain proton in fast exchange with bulk water. Experimental results for rapid water/amide exchange in acyl carrier protein are shown to be quantitatively consistent with the exchange rates measured using a selective-inversion exchange experiment

  2. Rate-Dependent Slip of Newtonian Liquid at Smooth Surfaces

    International Nuclear Information System (INIS)

    Zhu, Yingxi; Granick, Steve

    2001-01-01

    Newtonian fluids were placed between molecularly smooth surfaces whose spacing was vibrated at spacings where the fluid responded as a continuum. Hydrodynamic forces agreed with predictions from the no-slip boundary condition only provided that flow rate (peak velocity normalized by spacing) was low, but implied partial slip when it exceeded a critical level, different in different systems, correlated with contact angle (surface wettability). With increasing flow rate and partially wetted surfaces, hydrodynamic forces became up to 2--4 orders of magnitude less than expected by assuming the no-slip boundary condition that is commonly stated in textbooks

  3. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  4. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  5. Jump locations of jump-diffusion processes with state-dependent rates

    International Nuclear Information System (INIS)

    Miles, Christopher E; Keener, James P

    2017-01-01

    We propose a general framework for studying statistics of jump-diffusion systems driven by both Brownian noise (diffusion) and a jump process with state-dependent intensity. Of particular natural interest in many physical systems are the jump locations: the system evaluated at the jump times. As an example, this could be the voltage at which a neuron fires, or the so-called ‘threshold voltage’. However, the state-dependence of the jump rate provides direct coupling between the diffusion and jump components, making it difficult to disentangle the two to study individually. In this work, we provide an iterative map formulation of the sequence of distributions of jump locations. The distributions computed by this map can be used to elucidate other interesting quantities about the process, including statistics of the interjump times. Ultimately, the limit of the map reveals that knowledge of the stationary distribution of the full process is sufficient to recover (but not necessarily equal to) the distribution of jump locations. We propose two biophysical examples to illustrate the use of this framework to provide insight about a system. We find that a sharp threshold voltage emerges robustly in a simple stochastic integrate-and-fire neuronal model. The interplay between the two sources of noise is also investigated in a stepping model of molecular motor in intracellular transport pulling a diffusive cargo. (paper)

  6. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  7. THE IMPLICATIONS OF A HIGH COSMIC-RAY IONIZATION RATE IN DIFFUSE INTERSTELLAR CLOUDS

    International Nuclear Information System (INIS)

    Indriolo, Nick; Fields, Brian D.; McCall, Benjamin J.

    2009-01-01

    Diffuse interstellar clouds show large abundances of H + 3 which can only be maintained by a high ionization rate of H 2 . Cosmic rays are the dominant ionization mechanism in this environment, so the large ionization rate implies a high cosmic-ray flux, and a large amount of energy residing in cosmic rays. In this paper, we find that the standard propagated cosmic-ray spectrum predicts an ionization rate much lower than that inferred from H + 3 . Low-energy (∼10 MeV) cosmic rays are the most efficient at ionizing hydrogen, but cannot be directly detected; consequently, an otherwise unobservable enhancement of the low-energy cosmic-ray flux offers a plausible explanation for the H + 3 results. Beyond ionization, cosmic rays also interact with the interstellar medium by spalling atomic nuclei and exciting atomic nuclear states. These processes produce the light elements Li, Be, and B, as well as gamma-ray lines. To test the consequences of an enhanced low-energy cosmic-ray flux, we adopt two physically motivated cosmic-ray spectra which by construction reproduce the ionization rate inferred in diffuse clouds, and investigate the implications of these spectra on dense cloud ionization rates, light-element abundances, gamma-ray fluxes, and energetics. One spectrum proposed here provides an explanation for the high ionization rate seen in diffuse clouds while still appearing to be broadly consistent with other observables, but the shape of this spectrum suggests that supernovae remnants may not be the predominant accelerators of low-energy cosmic rays.

  8. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  9. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  10. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  11. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  12. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  13. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  14. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  15. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  16. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  18. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  19. An approximate stationary solution for multi-allele neutral diffusion with low mutation rates.

    Science.gov (United States)

    Burden, Conrad J; Tang, Yurong

    2016-12-01

    We address the problem of determining the stationary distribution of the multi-allelic, neutral-evolution Wright-Fisher model in the diffusion limit. A full solution to this problem for an arbitrary K×K mutation rate matrix involves solving for the stationary solution of a forward Kolmogorov equation over a (K-1)-dimensional simplex, and remains intractable. In most practical situations mutations rates are slow on the scale of the diffusion limit and the solution is heavily concentrated on the corners and edges of the simplex. In this paper we present a practical approximate solution for slow mutation rates in the form of a set of line densities along the edges of the simplex. The method of solution relies on parameterising the general non-reversible rate matrix as the sum of a reversible part and a set of (K-1)(K-2)/2 independent terms corresponding to fluxes of probability along closed paths around faces of the simplex. The solution is potentially a first step in estimating non-reversible evolutionary rate matrices from observed allele frequency spectra. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  1. Experimental Methodology for Estimation of Local Heat Fluxes and Burning Rates in Steady Laminar Boundary Layer Diffusion Flames.

    Science.gov (United States)

    Singh, Ajay V; Gollner, Michael J

    2016-06-01

    Modeling the realistic burning behavior of condensed-phase fuels has remained out of reach, in part because of an inability to resolve the complex interactions occurring at the interface between gas-phase flames and condensed-phase fuels. The current research provides a technique to explore the dynamic relationship between a combustible condensed fuel surface and gas-phase flames in laminar boundary layers. Experiments have previously been conducted in both forced and free convective environments over both solid and liquid fuels. A unique methodology, based on the Reynolds Analogy, was used to estimate local mass burning rates and flame heat fluxes for these laminar boundary layer diffusion flames utilizing local temperature gradients at the fuel surface. Local mass burning rates and convective and radiative heat feedback from the flames were measured in both the pyrolysis and plume regions by using temperature gradients mapped near the wall by a two-axis traverse system. These experiments are time-consuming and can be challenging to design as the condensed fuel surface burns steadily for only a limited period of time following ignition. The temperature profiles near the fuel surface need to be mapped during steady burning of a condensed fuel surface at a very high spatial resolution in order to capture reasonable estimates of local temperature gradients. Careful corrections for radiative heat losses from the thermocouples are also essential for accurate measurements. For these reasons, the whole experimental setup needs to be automated with a computer-controlled traverse mechanism, eliminating most errors due to positioning of a micro-thermocouple. An outline of steps to reproducibly capture near-wall temperature gradients and use them to assess local burning rates and heat fluxes is provided.

  2. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  3. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  4. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  5. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  6. A Method for Medical Diagnosis Based on Optical Fluence Rate Distribution at Tissue Surface.

    Science.gov (United States)

    Hamdy, Omnia; El-Azab, Jala; Al-Saeed, Tarek A; Hassan, Mahmoud F; Solouma, Nahed H

    2017-09-20

    Optical differentiation is a promising tool in biomedical diagnosis mainly because of its safety. The optical parameters' values of biological tissues differ according to the histopathology of the tissue and hence could be used for differentiation. The optical fluence rate distribution on tissue boundaries depends on the optical parameters. So, providing image displays of such distributions can provide a visual means of biomedical diagnosis. In this work, an experimental setup was implemented to measure the spatially-resolved steady state diffuse reflectance and transmittance of native and coagulated chicken liver and native and boiled breast chicken skin at 635 and 808 nm wavelengths laser irradiation. With the measured values, the optical parameters of the samples were calculated in vitro using a combination of modified Kubelka-Munk model and Bouguer-Beer-Lambert law. The estimated optical parameters values were substituted in the diffusion equation to simulate the fluence rate at the tissue surface using the finite element method. Results were verified with Monte-Carlo simulation. The results obtained showed that the diffuse reflectance curves and fluence rate distribution images can provide discrimination tools between different tissue types and hence can be used for biomedical diagnosis.

  7. A Method for Medical Diagnosis Based on Optical Fluence Rate Distribution at Tissue Surface

    Directory of Open Access Journals (Sweden)

    Omnia Hamdy

    2017-09-01

    Full Text Available Optical differentiation is a promising tool in biomedical diagnosis mainly because of its safety. The optical parameters’ values of biological tissues differ according to the histopathology of the tissue and hence could be used for differentiation. The optical fluence rate distribution on tissue boundaries depends on the optical parameters. So, providing image displays of such distributions can provide a visual means of biomedical diagnosis. In this work, an experimental setup was implemented to measure the spatially-resolved steady state diffuse reflectance and transmittance of native and coagulated chicken liver and native and boiled breast chicken skin at 635 and 808 nm wavelengths laser irradiation. With the measured values, the optical parameters of the samples were calculated in vitro using a combination of modified Kubelka-Munk model and Bouguer-Beer-Lambert law. The estimated optical parameters values were substituted in the diffusion equation to simulate the fluence rate at the tissue surface using the finite element method. Results were verified with Monte-Carlo simulation. The results obtained showed that the diffuse reflectance curves and fluence rate distribution images can provide discrimination tools between different tissue types and hence can be used for biomedical diagnosis.

  8. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  9. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  10. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  11. A Reaction-Diffusion-Based Coding Rate Control Mechanism for Camera Sensor Networks

    Directory of Open Access Journals (Sweden)

    Naoki Wakamiya

    2010-08-01

    Full Text Available A wireless camera sensor network is useful for surveillance and monitoring for its visibility and easy deployment. However, it suffers from the limited capacity of wireless communication and a network is easily overflown with a considerable amount of video traffic. In this paper, we propose an autonomous video coding rate control mechanism where each camera sensor node can autonomously determine its coding rate in accordance with the location and velocity of target objects. For this purpose, we adopted a biological model, i.e., reaction-diffusion model, inspired by the similarity of biological spatial patterns and the spatial distribution of video coding rate. Through simulation and practical experiments, we verify the effectiveness of our proposal.

  12. A reaction-diffusion-based coding rate control mechanism for camera sensor networks.

    Science.gov (United States)

    Yamamoto, Hiroshi; Hyodo, Katsuya; Wakamiya, Naoki; Murata, Masayuki

    2010-01-01

    A wireless camera sensor network is useful for surveillance and monitoring for its visibility and easy deployment. However, it suffers from the limited capacity of wireless communication and a network is easily overflown with a considerable amount of video traffic. In this paper, we propose an autonomous video coding rate control mechanism where each camera sensor node can autonomously determine its coding rate in accordance with the location and velocity of target objects. For this purpose, we adopted a biological model, i.e., reaction-diffusion model, inspired by the similarity of biological spatial patterns and the spatial distribution of video coding rate. Through simulation and practical experiments, we verify the effectiveness of our proposal.

  13. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  14. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  15. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  16. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  17. First-order dissolution rate law and the role of surface layers in glass performance assessment

    Science.gov (United States)

    Grambow, B.; Müller, R.

    2001-09-01

    potential mechanical destruction it will be reformed instantaneously. The same is true for radiation damage. The dissolution of silica from the surface in this concept is considered as rate limiting for the release of soluble elements from the glass. After surface stabilization by local solid/solution equilibrium the release of soluble radionuclides continues with lower rates, but this is considered as resulting from parallel leaching mechanism. In fact, the deconvolutions of the overall leach mechanism into individual parallel and sequential rate limiting steps (not necessarily elementary reactions) is fundamental to this concept. In concept (2) surface stability as well as surface morphology are fundamental. A fracture in the protective surface would increase glass corrosion. The protective effect is based on the low diffusivities of radionuclides and other glass constituents in this layer. However, a true relation between layer thickness and rates is seldom observed. Diffusion coefficients are considered to vary with time as well as with the surface area to solution volume S/ V ratio. Sometimes, extremely low diffusivities in extremely thin layers are invoked to explain experimental data. The two concepts are not so different from each other and one is tempted to think of a problem of semantics. In fact, there are two alternative ways by which the protective layer concept can be coupled to the saturation concept: (a) the layer may be formed by solubility effects as proposed in [loc.cit] and/or (b) the layer plays the role of a silica diffusion barrier limiting glass dissolution rates according to the first-order rate law at the interface between the pristine glass and the surface layer. However, the mathematical models based on these conceptual models yield quite different long-term predictions, even though the models may equally well fit a given set of experimental data. The models are also different with respect to the number of interrelated parameters. In the case of

  18. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  19. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  20. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  1. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  2. Microcanonical rates, gap times, and phase space dividing surfaces

    NARCIS (Netherlands)

    Ezra, Gregory S.; Waalkens, Holger; Wiggins, Stephen

    2009-01-01

    The general approach to classical unimolecular reaction rates due to Thiele is revisited in light of recent advances in the phase space formulation of transition state theory for multidimensional systems. Key concepts, such as the phase space dividing surface separating reactants from products, the

  3. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  4. Combined Diffusion Tensor Imaging and Apparent Transverse Relaxation Rate Differentiate Parkinson Disease and Atypical Parkinsonism.

    Science.gov (United States)

    Du, G; Lewis, M M; Kanekar, S; Sterling, N W; He, L; Kong, L; Li, R; Huang, X

    2017-05-01

    Both diffusion tensor imaging and the apparent transverse relaxation rate have shown promise in differentiating Parkinson disease from atypical parkinsonism (particularly multiple system atrophy and progressive supranuclear palsy). The objective of the study was to assess the ability of DTI, the apparent transverse relaxation rate, and their combination for differentiating Parkinson disease, multiple system atrophy, progressive supranuclear palsy, and controls. A total of 106 subjects (36 controls, 35 patients with Parkinson disease, 16 with multiple system atrophy, and 19 with progressive supranuclear palsy) were included. DTI and the apparent transverse relaxation rate measures from the striatal, midbrain, limbic, and cerebellar regions were obtained and compared among groups. The discrimination performance of DTI and the apparent transverse relaxation rate among groups was assessed by using Elastic-Net machine learning and receiver operating characteristic curve analysis. Compared with controls, patients with Parkinson disease showed significant apparent transverse relaxation rate differences in the red nucleus. Compared to those with Parkinson disease, patients with both multiple system atrophy and progressive supranuclear palsy showed more widespread changes, extending from the midbrain to striatal and cerebellar structures. The pattern of changes, however, was different between the 2 groups. For instance, patients with multiple system atrophy showed decreased fractional anisotropy and an increased apparent transverse relaxation rate in the subthalamic nucleus, whereas patients with progressive supranuclear palsy showed an increased mean diffusivity in the hippocampus. Combined, DTI and the apparent transverse relaxation rate were significantly better than DTI or the apparent transverse relaxation rate alone in separating controls from those with Parkinson disease/multiple system atrophy/progressive supranuclear palsy; controls from those with Parkinson

  5. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  6. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  7. Edge flame instability in low-strain-rate counterflow diffusion flames

    Energy Technology Data Exchange (ETDEWEB)

    Park, June Sung; Hwang, Dong Jin; Park, Jeong; Kim, Jeong Soo; Kim, Sungcho [School of Mechanical and Aerospace Engineering, Sunchon National University, 315 Maegok-dong, Suncheon, Jeonnam 540-742 (Korea, Republic of); Keel, Sang In [Environment & amp; Energy Research Division, Korea Institute of Machinery and Materials, P.O. Box 101, Yusung-gu, Taejon 305-343 (Korea, Republic of); Kim, Tae Kwon [School of Mechanical & amp; Automotive Engineering, Keimyung University, 1000 Sindang-dong, Dalseo-gu, Daegu 704-701 (Korea, Republic of); Noh, Dong Soon [Energy System Research Department, Korea Institute of Energy Research, 71-2 Jang-dong, Yusung-gu, Taejon 305-343 (Korea, Republic of)

    2006-09-15

    Experiments in low-strain-rate methane-air counterflow diffusion flames diluted with nitrogen have been conducted to study flame extinction behavior and edge flame oscillation in which flame length is less than the burner diameter and thus lateral conductive heat loss, in addition to radiative loss, could be high at low global strain rates. The critical mole fraction at flame extinction is examined in terms of velocity ratio and global strain rate. Onset conditions of the edge flame oscillation and the relevant modes are also provided with global strain rate and nitrogen mole fraction in the fuel stream or in terms of fuel Lewis number. It is observed that flame length is intimately relevant to lateral heat loss, and this affects flame extinction and edge flame oscillation considerably. Lateral heat loss causes flame oscillation even at fuel Lewis number less than unity. Edge flame oscillations, which result from the advancing and retreating edge flame motion of the outer flame edge of low-strain-rate flames, are categorized into three modes: a growing, a decaying, and a harmonic-oscillation mode. A flame stability map based on the flame oscillation modes is also provided for low-strain-rate flames. The important contribution of lateral heat loss even to edge flame oscillation is clarified finally. (author)

  8. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  9. Dynamics and profiles of a diffusive host-pathogen system with distinct dispersal rates

    Science.gov (United States)

    Wu, Yixiang; Zou, Xingfu

    2018-04-01

    In this paper, we investigate a diffusive host-pathogen model with heterogeneous parameters and distinct dispersal rates for the susceptible and infected hosts. We first prove that the solution of the model exists globally and the model system possesses a global attractor. We then identify the basic reproduction number R0 for the model and prove its threshold role: if R0 ≤ 1, the disease free equilibrium is globally asymptotically stable; if R0 > 1, the solution of the model is uniformly persistent and there exists a positive (pathogen persistent) steady state. Finally, we study the asymptotic profiles of the positive steady state as the dispersal rate of the susceptible or infected hosts approaches zero. Our result suggests that the infected hosts concentrate at certain points which can be characterized as the pathogen's most favoured sites when the mobility of the infected host is limited.

  10. Increasing inhibitory input increases neuronal firing rate: why and when? Diffusion process cases

    Energy Technology Data Exchange (ETDEWEB)

    Feng Jianfeng [COGS, Sussex University (United Kingdom)]. E-mail: jf218@cam.ac.uk; Wei Gang [Department of Mathematics, Hong Kong Baptist University, Hong Kong (China)]. E-mail gwei@math.hkbu.edu.hk

    2001-09-21

    Increasing inhibitory input to single neuronal models, such as the FitzHugh-Nagumo model and the Hodgkin-Huxley model, can sometimes increase their firing rates, a phenomenon which we term inhibition-boosted firing (IBF). Here we consider neuronal models with diffusion approximation inputs, i.e. they share the identical first- and second-order statistics of the corresponding Poisson process inputs. Using the integrate-and-fire model and the IF-FHN model, we explore theoretically how and when IBF can happen. For both models, it is shown that there is a critical input frequency at which the efferent firing rate is identical when the neuron receives purely excitatory inputs or exactly balanced inhibitory and excitatory inputs. When the input frequency is lower than the critical frequency, IBF occurs. (author)

  11. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  12. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  13. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  14. Determining Surface Infiltration Rate of Permeable Pavements with Digital Imaging

    Directory of Open Access Journals (Sweden)

    Caterina Valeo

    2018-01-01

    Full Text Available Cell phone images of pervious pavement surfaces were used to explore relationships between surface infiltration rates (SIR measured using the ASTM C1701 standard test and using a simple falling head test. A fiber-reinforced porous asphalt surface and a highly permeable material comprised of stone, rubber and a polymer binder (Porous Pave were tested. Images taken with a high-resolution cellphone camera were acquired as JPEG files and converted to gray scale images in Matlab® for analysis. The distribution of gray levels was compared to the surface infiltration rates obtained for both pavements with attention given to the mean of the distribution. Investigation into the relationships between mean SIR and parameters determined from the gray level distribution produced in the image analysis revealed that mean SIR measured in both pavements were proportional to the inverse of the mean of the distribution. The relationships produced a coefficient of determination over 85% using both the ASTM and the falling head test in the porous asphalt surface. SIR measurements determined with the ASTM method were highly correlated with the inverse mean of the distribution of gray levels in the Porous Pave material as well, producing coefficients of determination of over 90% and Kendall’s tau-b of roughly 70% for nonparametric data.

  15. Rate and extent of aqueous perchlorate removal by iron surfaces.

    Science.gov (United States)

    Moore, Angela M; De Leon, Corinne H; Young, Thomas M

    2003-07-15

    The rate and extent of perchlorate reduction on several types of iron metal was studied in batch and column reactors. Mass balances performed on the batch experiments indicate that perchlorate is initially sorbed to the iron surface, followed by a reduction to chloride. Perchlorate removal was proportional to the iron dosage in the batch reactors, with up to 66% removal in 336 h in the highest dosage system (1.25 g mL(-1)). Surface-normalized reaction rates among three commercial sources of iron filings were similar for acid-washed samples. The most significant perchlorate removal occurred in solutions with slightly acidic or near-neutral initial pH values. Surface mediation of the reaction is supported by the absence of reduction in batch experiments with soluble Fe2+ and also by the similarity in specific reaction rate constants (kSA) determined for three different iron types. Elevated soluble chloride concentrations significantly inhibited perchlorate reduction, and lower removal rates were observed for iron samples with higher amounts of background chloride contamination. Perchlorate reduction was not observed on electrolytic sources of iron or on a mixed-phase oxide (Fe3O4), suggesting that the reactive iron phase is neither pure zerovalent iron nor the mixed oxide alone. A mixed valence iron hydr(oxide) coating or a sorbed Fe2+ surface complex represent the most likely sites for the reaction. The observed reaction rates are too slow for immediate use in remediation system design, but the findings may provide a basis for future development of cost-effective abiotic perchlorate removal techniques.

  16. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  17. Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

    Science.gov (United States)

    Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

    2017-12-01

    This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

  18. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  19. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  20. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  1. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  2. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  3. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  4. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  5. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  6. A photo-tunable membrane based on inter-particle crosslinking for decreasing diffusion rates

    KAUST Repository

    Li, Song

    2015-01-01

    Functional polymeric membranes are widely used to adjust and control the diffusion of molecules. Herein, photosensitive poly(hydroxycinnamic acid) (PHCA) microspheres, which were fabricated by an emulsification solvent-evaporation method, were embedded into an ethyl cellulose matrix to fabricate composite membranes with a photo-tunable property. The photoreaction of PHCA is based on the [2 + 2] cycloaddition of cinnamic moieties upon irradiation with 365 nm light. Intra-particle crosslinking in PHCA microspheres was confirmed in the solution phase, while inter-particle crosslinking between adjacent PHCA microspheres dominated the solid membrane phase. The inter-particle crosslinking turned down the permeability of the composite membranes by 74%. To prove the applicability of the designed system, the composite membrane was coated on a model drug reservoir tablet. Upon irradiating the tablet with UV light, the original permeability decreased by 57%, and consequently the diffusion rate of the cargo (Rhodamine B) from the tablet slowed down. Most importantly, the tablet showed sustained release for over 10 days. This controllability can be further tuned by adjusting the membrane thickness. Composite membranes showed excellent processing reproducibility together with consistent mechanical properties. These results demonstrate that the incorporation of photosensitive PHCA microspheres in polymeric membranes provides a promising photo-tunable material for different applications including coating and separation. This journal is © The Royal Society of Chemistry 2015.

  7. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  8. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  9. Competing quantum effects in the free energy profiles and diffusion rates of hydrogen and deuterium molecules through clathrate hydrates.

    Science.gov (United States)

    Cendagorta, Joseph R; Powers, Anna; Hele, Timothy J H; Marsalek, Ondrej; Bačić, Zlatko; Tuckerman, Mark E

    2016-11-30

    Clathrate hydrates hold considerable promise as safe and economical materials for hydrogen storage. Here we present a quantum mechanical study of H 2 and D 2 diffusion through a hexagonal face shared by two large cages of clathrate hydrates over a wide range of temperatures. Path integral molecular dynamics simulations are used to compute the free-energy profiles for the diffusion of H 2 and D 2 as a function of temperature. Ring polymer molecular dynamics rate theory, incorporating both exact quantum statistics and approximate quantum dynamical effects, is utilized in the calculations of the H 2 and D 2 diffusion rates in a broad temperature interval. We find that the shape of the quantum free-energy profiles and their height relative to the classical free energy barriers at a given temperature, as well as the rate of diffusion, are strongly affected by competing quantum effects: above 25 K, zero-point energy (ZPE) perpendicular to the reaction path for diffusion between cavities decreases the quantum rate compared to the classical rate, whereas at lower temperatures tunneling outcompetes the ZPE and as a result the quantum rate is greater than the classical rate.

  10. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  11. Rate equation analysis of hydrogen uptake on Si (100) surfaces

    International Nuclear Information System (INIS)

    Inanaga, S.; Rahman, F.; Khanom, F.; Namiki, A.

    2005-01-01

    We have studied the uptake process of H on Si (100) surfaces by means of rate equation analysis. Flowers' quasiequilibrium model for adsorption and desorption of H [M. C. Flowers, N. B. H. Jonathan, A. Morris, and S. Wright, Surf. Sci. 396, 227 (1998)] is extended so that in addition to the H abstraction (ABS) and β 2 -channel thermal desorption (TD) the proposed rate equation further includes the adsorption-induced desorption (AID) and β 1 -TD. The validity of the model is tested by the experiments of ABS and AID rates in the reaction system H+D/Si (100). Consequently, we find it can well reproduce the experimental results, validating the proposed model. We find the AID rate curve as a function of surface temperature T s exhibits a clear anti-correlation with the bulk dangling bond density versus T s curve reported in the plasma-enhanced chemical vapor deposition (CVD) for amorphous Si films. The significance of the H chemistry in plasma-enhanced CVD is discussed

  12. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  13. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  14. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  15. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  16. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  17. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  18. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  19. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  20. Isopleths of surface concentration and surface exposure rate due to a radioactive cloud released from a stack

    International Nuclear Information System (INIS)

    Kobayashi, Hideo; Yabuta, Hajimu; Katagiri, Hiroshi; Obata, Kazuichi; Kokubu, Morinobu

    1982-03-01

    Various calculations are made to estimate the distributions of concentration and γ-exposure rate due to a radioactive cloud released from a point source to the atmosphere. In this report, the isopleths of concentration and γ-exposure rate which were calculated are given in graphs to enable rapid prediction of the influence of released radioactive material in the emergency situation. Recently there are facilities which are equipped with a system to display the calculation results on CRT; but such practice is rather rare. By placing the calculated isopleths of reduction scale 1/25000 or 1/50000 on the usual map, any facilities without the CRT system can readily estimate the influence of an accidental release. The graphs of isopleths are given with the release height (11 values of 0 to 200 m at about 20 m intervals) and the atmospheric stability (6 classes) as parameters. Calculations of γ-exposure rates were made using the computer code GAMPUL developed by T. Hayashi and T. Shiraishi. In the calculation of radioactive concentrations and γ-exposure rates, the vertical diffusion depths, σsub(z), exceeding 1000 m are taken to be 1000 m according to the Meteorological Guide for the Safety Analysis of Power Reactor (J.AEC). The comparison between with and without this limitation in σsub(z) is made in the case of downwind axial surface distributions. (author)

  1. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  2. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  3. Surface Potential and Particle Size Effect on the Rate of Perikinetic Coagulation

    International Nuclear Information System (INIS)

    Molina-Bolivar, J. A.; Galisteo-Gonzalez, F.; Cabrerizo-Vilchez, M.; Hidalgo-alvarez, R.

    1998-01-01

    The diffusion-controlled rapid coagulation rate of monodisperse polystyrene particles in aqueous solutions has been measured with a low angle scattering apparatus (nephelometer). We have refined this technique by using a narrow scattering flow cell and a pneumatic addicting-mixing device to introduce the salt solution and the latex sample in the cell. Coagulation rate constants were determined from analysis of the scattered light intensity dependence with time at an angle of 4.5 degree centigrade ± 1 degree centigrade. Experiments were designed to check the effects of particle size, surface potential and counterion valency on rapid coagulation constant. The particle ranged in diameter from 151 nm to 530 nm. The results are compared with the predictions of Smoluchowski's theory. Experiments to obtain the stability diagrams and the critical coagulation concentration of latexes have been performed. (Author) 31 refs

  4. Electrochemical evidences and consequences of significant differences in ions diffusion rate in polyacrylate-based ion-selective membranes.

    Science.gov (United States)

    Woźnica, Emilia; Mieczkowski, Józef; Michalska, Agata

    2011-11-21

    The origin and effect of surface accumulation of primary ions within the ion-selective poly(n-butyl acrylate)-based membrane, obtained by thermal polymerization, is discussed. Using a new method, based on the relation between the shape of a potentiometric plot and preconditioning time, the diffusion of copper ions in the membrane was found to be slow (the diffusion coefficient estimated to be close to 10(-11) cm(2) s(-1)), especially when compared to ion-exchanger counter ions--sodium cations diffusion (a diffusion coefficient above 10(-9) cm(2) s(-1)). The higher mobility of sodium ions than those of the copper-ionophore complex results in exposed ion-exchanger role leading to undesirably exposed sensitivity to sodium or potassium ions.

  5. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  6. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  7. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  8. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  9. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  10. Indexing Glomerular Filtration Rate to Body Surface Area

    DEFF Research Database (Denmark)

    Redal-Baigorri, Belén; Rasmussen, Knud; Heaf, James Goya

    2014-01-01

    BACKGROUND: Kidney function is mostly expressed in terms of glomerular filtration rate (GFR). A common feature is the expression as ml/min per 1.73 m(2) , which represents the adjustment of the individual kidney function to a standard body surface area (BSA) to allow comparison between individuals....... We investigated the impact of indexing GFR to BSA in cancer patients, as this BSA indexation might affect the reported individual kidney function. METHODS: Cross-sectional study of 895 adults who had their kidney function measured with (51) chrome ethylene diamine tetraacetic acid. Mean values of BSA...

  11. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  12. Leveraging tagging and rating for recommendation: RMF meets weighted diffusion on tripartite graphs

    Science.gov (United States)

    Li, Jianguo; Tang, Yong; Chen, Jiemin

    2017-10-01

    Recommender systems (RSs) have been a widely exploited approach to solving the information overload problem. However, the performance is still limited due to the extreme sparsity of the rating data. With the popularity of Web 2.0, the social tagging system provides more external information to improve recommendation accuracy. Although some existing approaches combine the matrix factorization models with the tag co-occurrence and context of tags, they neglect the issue of tag sparsity that would also result in inaccurate recommendations. Consequently, in this paper, we propose a novel hybrid collaborative filtering model named WUDiff_RMF, which improves regularized matrix factorization (RMF) model by integrating Weighted User-Diffusion-based CF algorithm(WUDiff) that obtains the information of similar users from the weighted tripartite user-item-tag graph. This model aims to capture the degree correlation of the user-item-tag tripartite network to enhance the performance of recommendation. Experiments conducted on four real-world datasets demonstrate that our approach significantly performs better than already widely used methods in the accuracy of recommendation. Moreover, results show that WUDiff_RMF can alleviate the data sparsity, especially in the circumstance that users have made few ratings and few tags.

  13. Density profile evolution and nonequilibrium effects in partial and full spreading measurements of surface diffusion

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2001-01-01

    in D-C(theta) depend on the initial density gradient and the initial state from which the spreading starts. To this end, we carry out extensive Monte Carlo simulations for a lattice-gas model of the O/W(110) system. Studies of submonolayer spreading from an initially ordered p(2x1) phase at theta = 1....../2 reveal that the spreading and diffusion rates in directions parallel and perpendicular to rows of oxygen atoms are significantly different within the ordered phase. Aside from this effect, we find that the degree of ordering in the initial phase has a relatively small impact on the overall behavior of D...

  14. Surface controlled dissolution rates of gypsum in aqueous solutions exhibit nonlinear dissolution kinetics

    Science.gov (United States)

    Jeschke, Alexander A.; Vosbeck, Katrin; Dreybrodt, Wolfgang

    2001-01-01

    The effective dissolution rates of gypsum are determined by mixed kinetics, where the rate constants of dissolution at the surface and the transport constant of molecular diffusion of dissolved material are similar. To obtain the surface reaction rate law it is necessary to know the transport constant. We have determined the surface rate law for monocrystalline selenite by using a rotating disc set-up, where the transport coefficients are well known. As a result, up to a calcium concentration of 0.6 · ceq, we find a nearly linear rate law Rs = ksl (1- cs/ ceq) n1, where cs is the total calcium concentration at the surface and ceq the equilibrium concentration with respect to gypsum, n1 = 1.2 ± 0.2, and ksl = 1.1 · 10 -4 mmol cm -2 s -1 ± 15%. We also employed batch-experiments for selenite, alabaster and gypsum rock samples. The result of these experiments were interpreted by using a transport constant determined by NaCl dissolution experiments under similar physical conditions. The batch experiments reveal a dissolution rate law Rs = ksl (1- cs/ ceq) n1, ksl = 1.3 · 10 -4 mmol · cm -2 s -1, n1 = 1.2 ± 0.2 for c ≤ 0.94 · ceq. Close to equilibrium a nonlinear rate law, Rs = ks2 (1- cs/ ceq) n2, is observed, where ks2 is in the order of 10 mmol · cm -2 s -1 and n2 ≈ 4.5. The experimentally observed gypsum dissolution rates from the batch experiments could be accurately fitted, with only minor variations of the surface reaction constant obtained from the rotating disk experiment and the transport coefficient from the NaCl dissolution batch experiment. Batch experiments on pure synthetic gypsum, reveal a linear rate law up to equilibrium. This indicates inhibition of dissolution in natural samples close to equilibrium, as is known also for calcite minerals.

  15. The surface-forming energy release rate versus the local energy release rate

    OpenAIRE

    Xiao, Si; Wang, He-ling; Landis, Chad M; Hwang, Keh-Chih; Liu, Bin

    2016-01-01

    This paper identifies two ways to extract the energy (or power) flowing into a crack tip during propagation based on the power balance of areas enclosed by a stationary contour and a comoving contour. It is very interesting to find a contradiction that two corresponding energy release rates (ERRs), a surface-forming ERR and a local ERR, are different when stress singularity exists at a crack tip. Besides a rigorous mathematical interpretation, we deduce that the stress singularity leads to an...

  16. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  17. Detectability and detection rate of acute cerebral hemisphere infarcts on CT and diffusion-weighted MRI

    International Nuclear Information System (INIS)

    Urbach, H.; Flacke, S.; Keller, E.; Textor, J.; Berlis, A.; Reul, J.; Schild, H.H.; Hartmann, A.; Solymosi, L.

    2000-01-01

    Our purpose was to compare the detectability and detection rate of acute ischaemic cerebral hemisphere infarcts on CT and diffusion-weighted MRI (DWI). We investigated 32 consecutive patients with acute hemisphere stroke with unenhanced CT and DWI within 6 h of stroke onset. The interval between CT and DWI ranged from 15 to 180 min (mean 60 min). Infarct detectability on CT and DWI was determined by comparing the initial CT, DWI and later reference images in a consensus reading of five independent examiners. The ''true'' detection rate was assessed by analysing all single readings. Two patients had intracerebral haematomas on DWI and CT and were excluded. There were 27 patients with ischaemic infarcts; all were visible on DWI and proven by follow-up. DWI was negative in three patients without a final diagnosis of infarct (100 % sensitivity, 100 % specificity, χ 2 = 30, P 2 = 1.48, P = 0.224). With regard to the single readings (30 examinations x 5 examiners = 150 readings), 63 CT readings were true positive and 72 false negative (sensitivity 47 %, specificity 86 %, χ 2 = 2.88, P = 0.089). Of the DWI readings 128 were true positive and 7 false negative (sensitivity 95 %, specificity 87 %, χ 2 = 70.67, P < 0.0001). Interobserver agreement was substantial for CT (χ= 0.72, 95 % confidence interval, 0.6-0.84) and DWI (χ= 0.82, 95 % confidence interval, 0.46-1). Taken together, detectability and detection rate of acute (< 6 h) hemisphere infarcts are significantly higher with DWI than with CT. (orig.)

  18. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  19. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  20. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  1. Nonlinear estimation of weathering rate parameters for uranium in surface soil near a nuclear facility

    International Nuclear Information System (INIS)

    Killough, G.G.; Rope, S.K.; Shleien, B.; Voilleque, P.G.

    1999-01-01

    A dynamic mass-balance model has been calibrated by a nonlinear parameter estimation method, using time-series measurements of uranium in surface soil near the former Feed Materials Production Center (FMPC) near Fernald, Ohio, USA. The time-series data, taken at six locations near the site boundary since 1971, show a statistically significant downtrend of above-background uranium concentration in surface soil for all six locations. The dynamic model is based on first-order kinetics in a surface-soil compartment 10 cm in depth. Median estimates of weathering rate coefficients for insoluble uranium in this soil compartment range from about 0.065-0.14 year -1 , corresponding to mean transit times of about 7-15 years, depending on the location sampled. The model, calibrated by methods similar to those discussed in this paper, has been used to simulate surface soil kinetics of uranium for a dose reconstruction study. It was also applied, along with other data, to make confirmatory estimates of airborne releases of uranium from the FMPC between 1951 and 1988. Two soil-column models (one diffusive and one advective, the latter similar to a catenary first-order kinetic box model) were calibrated to profile data taken at one of the six locations in 1976. The temporal predictions of the advective model approximate the trend of the time series data for that location. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  2. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  3. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    International Nuclear Information System (INIS)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S.; Jarašiūnas, K.; Vengris, M.; Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D.

    2014-01-01

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10 18  cm −3 , a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses

  4. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    Energy Technology Data Exchange (ETDEWEB)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S., E-mail: saulius.nargelas@ff.vu.lt; Jarašiūnas, K. [Department of Semiconductor Optoelectronics, Institute of Applied Research, Vilnius University, Saulėtekio 9–III, 10222 Vilnius (Lithuania); Vengris, M. [Laser Research Center, Vilnius University, Saulėtekio 10, 10223 Vilnius (Lithuania); Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D. [Veeco Instruments, Turbodisc Operations, 394 Elizabeth Avenue, Somerset, New Jersey 08873 (United States)

    2014-01-13

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10{sup 18} cm{sup −3}, a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses.

  5. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  6. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  7. The production rate of cosmogenic deuterium at the Moon's surface

    Science.gov (United States)

    Füri, Evelyn; Deloule, Etienne; Trappitsch, Reto

    2017-09-01

    The hydrogen (D/H) isotope ratio is a key tracer for the source of planetary water. However, secondary processes such as solar wind implantation and cosmic ray induced spallation reactions have modified the primordial D/H signature of 'water' in all rocks and soils recovered on the Moon. Here, we re-evaluate the production rate of cosmogenic deuterium (D) at the Moon's surface through ion microprobe analyses of hydrogen isotopes in olivines from eight Apollo 12 and 15 mare basalts. These in situ measurements are complemented by CO2 laser extraction-static mass spectrometry analyses of cosmogenic noble gas nuclides (3He, 21Ne, 38Ar). Cosmic ray exposure (CRE) ages of the mare basalts, derived from their cosmogenic 21Ne content, range from 60 to 422 Ma. These CRE ages are 35% higher, on average, than the published values for the same samples. The amount of D detected in the olivines increases linearly with increasing CRE ages, consistent with a production rate of (2.17 ± 0.11) ×10-12 mol(g rock)-1 Ma-1. This value is more than twice as high as previous estimates for the production of D by galactic cosmic rays, indicating that for water-poor lunar samples, i.e., samples with water concentrations ≤50 ppm, corrected D/H ratios have been severely overestimated.

  8. Diffusion of Innovation Theory and Xbox Live: Examining Minority Gamers' Responses and Rate of Adoption to Changes in Xbox Live

    Science.gov (United States)

    Gray, Kishonna L.

    2012-01-01

    This article examines the response of minority gamers as they adopt new innovations in Xbox Live. Using diffusion of innovation theory, specific attention is given to gamers' rate of adoption of the new Xbox Live environment, which was a recent update to the Xbox Live interface. By employing virtual ethnography, observations, and interviews reveal…

  9. Functional imaging and assessment of the glucose diffusion rate in epithelial tissues in optical coherence tomography

    International Nuclear Information System (INIS)

    Larin, K V; Tuchin, V V

    2008-01-01

    Functional imaging, monitoring and quantitative description of glucose diffusion in epithelial and underlying stromal tissues in vivo and controlling of the optical properties of tissues are extremely important for many biomedical applications including the development of noninvasive or minimally invasive glucose sensors as well as for therapy and diagnostics of various diseases, such as cancer, diabetic retinopathy, and glaucoma. Recent progress in the development of a noninvasive molecular diffusion biosensor based on optical coherence tomography (OCT) is described. The diffusion of glucose was studied in several epithelial tissues both in vitro and in vivo. Because OCT provides depth-resolved imaging of tissues with high in-depth resolution, the glucose diffusion is described not only as a function of time but also as a function of depth. (special issue devoted to application of laser technologies in biophotonics and biomedical studies)

  10. Effect of macromolecular crowding on the rate of diffusion-limited ...

    Indian Academy of Sciences (India)

    Enzyme kinetics; Monte Carlo; percolation; random walk; obstacle. .... enzyme E, P remains on the same site but S is converted to P with unit probability. ..... is then qualitatively understood with the help of diffusion and percolation theory.

  11. Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

    Science.gov (United States)

    Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

    2006-12-01

    Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

  12. Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

    International Nuclear Information System (INIS)

    Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

    2014-01-01

    Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

  13. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  14. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  15. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  16. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  17. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    Energy Technology Data Exchange (ETDEWEB)

    Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

    2015-12-28

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

  18. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    International Nuclear Information System (INIS)

    Mirigian, Stephen; Schweizer, Kenneth S.

    2015-01-01

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

  19. Using OSL dating to quantify rates of Earth surface processes

    Science.gov (United States)

    Rhodes, E. J.; Rittenour, T. M.

    2010-12-01

    In Optically Stimulated Luminescence (OSL), the dating signal is reset when mineral grains are exposed to light or heat, and gradually rebuilds during subsequent burial by interaction with ionising radiation. Quartz and feldspar provide useful OSL signals demonstrating rapid signal reduction in only seconds of light exposure. Age estimates ranging from under 1 year to around 200,000 years can be determined for a wide range of sedimentary contexts, including dunes, marine deposits, fluvial and glacial environments, and recent developments provide the framework for low temperature thermochronometric applications on timescales comparable with rapid climate fluctuations. In this presentation, we explore the range of applications for determining rates of Earth surface processes using OSL. We examine technical limitations, and provide a framework for overcoming current difficulties experienced in several specific regions and contexts. We will focus on OSL dating applications to glacigenic and fluvial records, along with use of the technique in tectonic and paleoseismic contexts. In many ways, these represent the most challenging environments for OSL; rapid high energy deposition is associated with incomplete signal zeroing, and the characteristics of quartz in many of these environments make it difficult to derive precise age estimates using this mineral. We will introduce innovative methods to overcome these limitations, both existing and those under development.

  20. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  1. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  2. Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

    International Nuclear Information System (INIS)

    Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

    1976-01-01

    Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

  3. Mass transfer rate through liquid membranes: interfacial chemical reactions and diffusion as simultaneous permeability controlling factors

    International Nuclear Information System (INIS)

    Danesi, P.R.; Horwitz, E.P.; Vandegrift, G.F.; Chiarizia, R.

    1981-01-01

    Equations describing the permeability of a liquid membrane to metal cations have been derived taking into account aqueous diffusion, membrane diffusion, and interfacial chemical reactions as simultaneous permeability controlling factors. Diffusion and chemical reactions have been coupled by a simple model analogous to the one previously described by us to represent liquid-liquid extraction kinetics. The derived equations, which make use of experimentally determined interfacial reaction mechanisms, qualitatively fit unexplained literature data regarding Cu 2+ transfer through liquid membranes. Their use to predict and optimize membrane permeability in practical separation processes by setting the appropriate concentration of the membrane carrier [LIX 64 (General Mills), a commercial β-hydroxy-oxime] and the pH of the aqueous copper feed solution is briefly discussed. 4 figures

  4. Variation in diffusion-induced solidification rate of liquated Ni-Cr-B insert during TLP bonding of Waspaloy superalloy

    International Nuclear Information System (INIS)

    Tokoro, K.; Wikstrom, N.P.; Ojo, O.A.; Chaturvedi, M.C.

    2008-01-01

    A microstructural study was performed on transient liquid phase (TLP) bonded Waspaloy superalloy with a Ni-Cr-B filler. The applicability of a diffusion model based on Fick's second law of diffusion to determine the time required for complete isothermal solidification (t f ) was investigated. Over the temperature range of 1065-1110 deg. C, experimental observations of t f were in reasonable agreement with t f values predicted by the diffusion model. However, a notable deviation was observed in joints prepared between 1175 and 1225 deg. C in that the rate of isothermal solidification was reduced at these temperatures resulting in the formation of a centerline eutectic-type microconstituent, which in contrast, was prevented from forming after holding the brazing assembly for an equivalent bonding time at a lower temperature of 1145 deg. C. Boride particles were observed as part of the eutectic product, which suggested that diffusion of boron out of the liquated insert was also reduced at these higher temperatures. A decrease in solubility of the melting point depressing solute, boron, with increase in temperature is suggested to be an important factor contributing to the reduction in isothermal solidification rate observed at the higher bonding temperatures

  5. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  6. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  7. Diffusion Modeling of Cooling Rates of Relict Olivine in Semarkona Chondrules

    Science.gov (United States)

    Hewins, R. H.; Ganguly, J.; Mariani, E.

    2009-03-01

    Diffusive exchange profiles between relict olivine and melt-grown olivine in Semarkona Type IIA chondrules were oriented by EBSD to correct D. Results for Fe-Mg (D from Dohmen) and Cr (Ito and Ganguly) are concordant at 300°-400°C/hr.

  8. Isopleths of surface air concentration and surface air kerma rate due to a radioactive cloud released from a stack (3)

    International Nuclear Information System (INIS)

    Tachibana, Haruo; Kikuchi, Masamitsu; Sekita, Tsutomu; Yamaguchi, Takenori

    2004-06-01

    This report is a revised edition of 'Isopleths of Surface Air Concentration and Surface Air Absorbed Dose Rate due to a Radioactive Cloud Released from a Stack(II) '(JAERI-M 90-206) and based on the revised Nuclear Safety Guidelines reflected the ICRP1990 Recommendation. Characteristics of this report are the use of Air Karma Rate (Gy/h) instead of Air Absorbed Dose Rate (Gy/h), and the record of isopleths of surface air concentration and surface air karma rate on CD-ROM. These recorded data on CD-ROM can be printed out on paper and/or pasted on digital map by personal computer. (author)

  9. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, Rizwan M; Oral, Ebru; Muratoglu, Orhun K

    2014-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E

  10. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, R. M.; Oral, E.; Muratoglu, O. K.

    2013-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E. (author)

  11. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  12. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)

    International Nuclear Information System (INIS)

    Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.

    2013-01-01

    In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)

  13. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  14. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  15. Method for the determination of oxygen consumption rates and diffusion coefficients in multicellular spheroids

    OpenAIRE

    Mueller-Klieser, W.

    1984-01-01

    A method has been developed for the quantitative evaluation of oxygen tension (PO2) distributions in multicellular spheroids measured with O2-sensitive microelectrodes. The experimental data showed that multicellular tumor spheroids in stirred growth media were characterized by a diffusion-depleted zone surrounding the spheroids. This zone was elicited by an unstirred layer of medium next to the spheroid leading to a continuous decrease in the PO2 values from the bulk medium towards the spher...

  16. Electrochemistry of cations in diopsidic melt - Determining diffusion rates and redox potentials from voltammetric curves

    Science.gov (United States)

    Colson, Russell O.; Haskin, Larry A.; Crane, Daniel

    1990-01-01

    Results are presented on determinations of reduction potentials and their temperature dependence of selected ions in diopsidic melt, by using linear sweep voltammetry. Diffusion coefficients were measured for cations of Eu, Mn, Cr, and In. Enthalpies and entropies of reduction were determined for the cations V(V), Cr(3+), Mn(2+), Mn(3+), Fe(2+), Cu(2+), Mo(VI), Sn(IV), and Eu(3+). Reduction potentials were used to study the structural state of cations in the melt.

  17. Melatonin increases anagen hair rate in women with androgenetic alopecia or diffuse alopecia: results of a pilot randomized controlled trial.

    Science.gov (United States)

    Fischer, T W; Burmeister, G; Schmidt, H W; Elsner, P

    2004-02-01

    In addition to the well-known hormonal influences of testosterone and dihydrotestosterone on the hair cycle, melatonin has been reported to have a beneficial effect on hair growth in animals. The effect of melatonin on hair growth in humans has not been investigated so far. To examine whether topically applied melatonin influences anagen and telogen hair rate in women with androgenetic or diffuse hair loss. A double-blind, randomized, placebo-controlled study was conducted in 40 women suffering from diffuse alopecia or androgenetic alopecia. A 0.1% melatonin or a placebo solution was applied on the scalp once daily for 6 months and trichograms were performed to assess anagen and telogen hair rate. To monitor effects of treatment on physiological melatonin levels, blood samples were taken over the whole study period. Melatonin led to a significantly increased anagen hair rate in occipital hair in women with androgenetic hair loss compared with placebo (n=12; P=0.012). For frontal hair, melatonin gave a significant increase in the group with diffuse alopecia (n=28; P=0.046). The occipital hair samples of patients with diffuse alopecia and the frontal hair counts of those with androgenetic alopecia also showed an increase of anagen hair, but differences were not significant. Plasma melatonin levels increased under treatment with melatonin, but did not exceed the physiological night peak. To the authors' knowledge, this pilot study is the first to show that topically applied melatonin might influence hair growth in humans in vivo. The mode of action is not known, but the effect might result from an induction of anagen phase.

  18. Flamelet Surface Density and Burning Rate Integral in Premixed Combustion

    National Research Council Canada - National Science Library

    Gouldin, F

    1999-01-01

    We have developed, tested and applied in V-flames and a spark ignition engine a new experimental method, crossed-plane laser imaging, for measuring flamelet surface normals in premixed turbulent flames...

  19. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  20. THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

    Energy Technology Data Exchange (ETDEWEB)

    Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

    2012-10-01

    To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

  1. Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-09-15

    Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

  2. Microscale anechoic architecture: acoustic diffusers for ultra low power microparticle separation via traveling surface acoustic waves.

    Science.gov (United States)

    Behrens, Jan; Langelier, Sean; Rezk, Amgad R; Lindner, Gerhard; Yeo, Leslie Y; Friend, James R

    2015-01-07

    We present a versatile and very low-power traveling SAW microfluidic sorting device able to displace and separate particles of different diameter in aqueous suspension; the travelling wave propagates through the fluid bulk and diffuses via a Schröder diffuser, adapted from its typical use in concert hall acoustics to be the smallest such diffuser to be suitable for microfluidics. The effective operating power range is two to three orders of magnitude less than current SAW devices, uniquely eliminating the need for amplifiers, and by using traveling waves to impart forces directly upon suspended microparticles, they can be separated by size.

  3. Geometry- and rate-dependent adhesive failure of micropatterned surfaces

    NARCIS (Netherlands)

    Bakker, H.; Lindstrom, S.B.; Sprakel, J.H.B.

    2012-01-01

    The dynamic nature of adhesive interface failure remains poorly understood, especially when the contact between the two surfaces is localized in microscopic points of adhesion. Here, we explore the dynamic failure of adhesive interfaces composed of a large number of micron-sized pillars against

  4. Poisson-Nernst-Planck Equations for Simulating Biomolecular Diffusion-Reaction Processes II: Size Effects on Ionic Distributions and Diffusion-Reaction Rates

    Science.gov (United States)

    Lu, Benzhuo; Zhou, Y.C.

    2011-01-01

    The effects of finite particle size on electrostatics, density profiles, and diffusion have been a long existing topic in the study of ionic solution. The previous size-modified Poisson-Boltzmann and Poisson-Nernst-Planck models are revisited in this article. In contrast to many previous works that can only treat particle species with a single uniform size or two sizes, we generalize the Borukhov model to obtain a size-modified Poisson-Nernst-Planck (SMPNP) model that is able to treat nonuniform particle sizes. The numerical tractability of the model is demonstrated as well. The main contributions of this study are as follows. 1), We show that an (arbitrarily) size-modified PB model is indeed implied by the SMPNP equations under certain boundary/interface conditions, and can be reproduced through numerical solutions of the SMPNP. 2), The size effects in the SMPNP effectively reduce the densities of highly concentrated counterions around the biomolecule. 3), The SMPNP is applied to the diffusion-reaction process for the first time, to our knowledge. In the case of low substrate density near the enzyme reactive site, it is observed that the rate coefficients predicted by SMPNP model are considerably larger than those by the PNP model, suggesting both ions and substrates are subject to finite size effects. 4), An accurate finite element method and a convergent Gummel iteration are developed for the numerical solution of the completely coupled nonlinear system of SMPNP equations. PMID:21575582

  5. An investigation of multi-rate sound decay under strongly non-diffuse conditions: The crypt of the Cathedral of Cadiz

    Science.gov (United States)

    Martellotta, Francesco; Álvarez-Morales, Lidia; Girón, Sara; Zamarreño, Teófilo

    2018-05-01

    Multi-rate sound decays are often found and studied in complex systems of coupled volumes where diffuse field conditions generally apply, although the openings connecting different sub-spaces are by themselves potential causes of non-diffuse behaviour. However, in presence of spaces in which curved surfaces clearly prevent diffuse field behaviour from being established, things become more complex and require more sophisticated tools (or, better, combinations of them) to be fully understood. As an example of such complexity, the crypt of the Cathedral of Cadiz is a relatively small space characterised by a central vaulted rotunda, with five radial galleries with flat and low ceiling. In addition, the crypt is connected to the main cathedral volume by means of several small openings. Acoustic measurements carried out in the crypt pointed out the existence of at least two decay processes combined, in some points, with flutter echoes. Application of conventional methods of analysis pointed out the existence of significant differences between early decay time and reverberation time, but was inconclusive in explaining the origin of the observed phenomena. The use of more robust Bayesian analysis permitted the conclusion that the late decay appearing in the crypt had a different rate than that observed in the cathedral, thus excluding the explanation based on acoustic coupling of different volumes. Finally, processing impulse responses collected by means of a B-format microphone to obtain directional intensity maps demonstrated that the late decay was originated from the rotunda where a repetitive reflection pattern appeared between the floor and the dome causing both flutter echoes and a longer reverberation time.

  6. Flowing afterglow: construction of an apparatus, measurement of rate constants, and consideration of the diffusive behavior of charges

    International Nuclear Information System (INIS)

    Matsuoka, Shingo; Nakamura, Hirone; Tamura, Takaaki; Fujii, Toshihiro.

    1984-01-01

    A flowing afterglow apparatus was constructed and the operation of the afterglow system including data analysis was tested by measuring the rate constants for the reactions N + + NO, N 2 + + NO, He + + N 2 , and SF 6 + e; the results were 5.8 x 10 -10 , 3.9 x 10 -10 , 1.20 x 10 -9 , and 2.1 x 10 -7 cm 3 s -1 respectively. In the measurements an extraction voltage for ion sampling was not applied to the nose cone in order not to introduce an electric field into the reaction region. A ''non-ambipolar'' model developed by us was used for the data analysis of the ion/molecule reactions. For the data analysis of the electron attachment, a typical curve fit mehtod to the product ion signal was used. However, no theoretical curves fit the experimental points. This disagreement is attributed to a change of the ion-sampling efficiency through the nose-cone aperture arising from a change of the electron-dominated plasma to a negative-ion-dominated plasma with an increasing flow rate of SF 6 . Nevertheless, the attachment rate could be determined by fitting the theoretical and experimantal curves in the limited region of the SF 6 flow rate where the negative-ion-dominated plasma is established at the sampling aperture. All the rate constants obtained here agree reasonably well with literature values. Next, errors in the positive ion/molecule reaction rate constants, which would occur if the diffusion coefficients of the ions and neutrals each have a + 10 % error were calculated for the flow model to be -0.4 and +1.2 % respectively, demonstrating that these parameters are not important in the analysis of data. This insensitivity explains why the nose-cone voltage applied in a typical flowing afterglow operation has not caused a significant error in the published rate constants although it disturbs the ion diffusive behavior. (author)

  7. Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

    Science.gov (United States)

    Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

    2015-06-03

    Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Chemically-induced liquid film migration with low lattice diffusivity relative to the migration rate in Mo-Ni-(W)

    International Nuclear Information System (INIS)

    Lee, K.R.

    1992-01-01

    This paper reports that when a 90Mo-10Ni alloy (by wt) liquid phase sintered at 1400 degrees C is heat-treated at 1400 degrees C after replacing the matrix with a melt of 44Ni-34Mo-22W (by wt), the liquid films between the grains migrate, leaving behind an Mo alloy enriched with W. The ratio of the lattice diffusivity of W in Mo, D, to the initial migration velocity, v. (D/v) is estimated to be between 0.03 and 0.18 angstrom. Hence it appears that there is no lattice diffusion of W ahead of the migrating liquid film, and is such a case the driving force has been suggested to be the chemical free energy. But the observed v is approximately same as that to be expected if the driving force is assumed to be diffusional coherency strain energy. Likewise, a previous study of den Broeder and Nakahara shows that the rate of chemically-induced grain boundary migration in Cu-Ni shows a smooth variation with temperature as D/v decreases from values much larger than the interatomic spacing to values much smaller with decreasing temperature. The coherency strain energy thus appears to be a general driving force for the migration even when the apparent diffusion length indicated by D/v is smaller than the interatomic spacing

  9. Modelling of a 400 kW natural gas diffusion flame using finite-rate chemistry schemes

    International Nuclear Information System (INIS)

    Mueller, Christian; Kremer, Hans; Brink, Anders; Kilpinen, Pia; Hupa, Mikko

    1999-01-01

    The Eddy-Dissipation Combustion Model combined with three different reaction mechanisms is applied to simulate a fuel-rich 400 kW natural gas diffusion flame. The chemical schemes include a global 2-step and a global 4-step approach as well as a reduced 4-step mechanism systematically derived from an elementary scheme. The species and temperature distributions resulting from the different schemes are studied in detail and compared to each other and to experiments. Furthermore the method of implementing finite-rate chemistry to the Eddy-Dissipation Combustion Model is discussed. (author)

  10. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  11. Properties of water surface discharge at different pulse repetition rates

    Czech Academy of Sciences Publication Activity Database

    Ruma, R.; Hosseini, S.H.R.; Yoshihara, K.; Akiyama, M.; Sakugawa, T.; Lukeš, Petr; Akiyama, H.

    2014-01-01

    Roč. 116, č. 12 (2014), s. 123304-123304 ISSN 0021-8979 Grant - others:Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR(CZ) M100431203 Program:M Institutional support: RVO:61389021 Keywords : plasma in air * water surface discharge * pulse frequency * hydrogen peroxide * organic dye Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 2.183, year: 2014 http://dx.doi.org/ 10.1063/1.4896266

  12. EFFECT OF RATIO OF SURFACE AREA ON THE CORROSION RATE

    OpenAIRE

    Dody Prayitno; M. Irsyad

    2018-01-01

    Aluminum and steel are used to be a construction for a building outdoor panel. Aluminum and steel are connected by bolt and nut. An atmosphere due to a corrosion of the aluminum. The corrosion possibly to cause the hole diameter of bolt and nut to become larger. Thus the bolt and nut can not enough strong to hold the panel. The panel may collapse. The aim of the research is first to answer a question where does the corrosion starts. The second is to know the effect of ratio surface area of st...

  13. An Econometric Diffusion Model of Exchange Rate Movements within a Band - Implications for Interest Rate Differential and Credibility of Exchange Rate Policy

    OpenAIRE

    Rantala, Olavi

    1992-01-01

    The paper presents a model ofexchange rate movements within a specified exchange rate band enforced by central bank interventions. The model is based on the empirical observation that the exchange rate has usually been strictly inside the band, at least in Finland. In this model the distribution of the exchange rate is truncated lognormal from the edges towards the center of the band and hence quite different from the bimodal distribution of the standard target zone model. The model is estima...

  14. A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

    Science.gov (United States)

    Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

    2016-01-01

    Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

  15. Empirical recurrence rates for ground motion signals on planetary surfaces

    Science.gov (United States)

    Lorenz, Ralph D.; Panning, Mark

    2018-03-01

    We determine the recurrence rates of ground motion events as a function of sensed velocity amplitude at several terrestrial locations, and make a first interplanetary comparison with measurements on the Moon, Mars, Venus and Titan. This empirical approach gives an intuitive order-of-magnitude guide to the observed ground motion (including both tectonic and ocean- and atmosphere-forced signals) of these locations as a guide to instrument expectations on future missions, without invoking interior models and specific sources: for example a Venera-14 observation of possible ground motion indicates a microseismic environment mid-way between noisy and quiet terrestrial locations. Quiet terrestrial regions see a peak velocity amplitude in mm/s roughly equal to 0.3*N(-0.7), where N is the number of "events" (half-hour intervals in which a given peak ground motion is exceeded) observed per year. The Apollo data show endogenous seismic signals for a given recurrence rate that are typically about 10,000 times smaller in amplitude than a quiet site on Earth, although local thermally-induced moonquakes are much more common. Viking data masked for low-wind periods appear comparable with a quiet terrestrial site, whereas a Venera observation of microseisms suggests ground motion more similar to a more active terrestrial location. Recurrence rate plots from in-situ measurements provide a context for seismic instrumentation on future planetary missions, e.g. to guide formulation of data compression schemes. While even small geophones can discriminate terrestrial activity rates, observations with guidance accelerometers are typically too insensitive to provide meaningful constraints (i.e. a non-zero number of "events") on actual ground motion observations unless operated for very long periods.

  16. Below the Surface: Solving the Hidden Graduation Rate Crisis. Updated

    Science.gov (United States)

    Cardichon, Jessica; Lovell, Phillip

    2015-01-01

    The U.S. national high school graduation rate recently reached a record high with 81 percent of the Class of 2013 graduating within four years. While this accomplishment is laudable, it should not obscure the fact that more than 1,200 high schools, serving more than 1.1 million students, still fail to graduate one-third or more of their students…

  17. Continuous Rating for Diggability Assessment in Surface Mines

    Science.gov (United States)

    IPHAR, Melih

    2016-10-01

    The rocks can be loosened either by drilling-blasting or direct excavation using powerful machines in opencast mining operations. The economics of rock excavation is considered for each method to be applied. If blasting operation is not preferred and also the geological structures and rock mass properties in site are convenient (favourable ground conditions) for ripping or direct excavation method by mining machines, the next step is to determine which machine or excavator should be selected for the excavation purposes. Many researchers have proposed several diggability or excavatability assessment methods for deciding on excavator type to be used in the field. Most of these systems are generally based on assigning a rating for the parameters having importance in rock excavation process. However, the sharp transitions between the two adjacent classes for a given parameter can lead to some uncertainties. In this paper, it has been proposed that varying rating should be assigned for a given parameter called as “continuous rating” instead of giving constant rating for a given class.

  18. Experimental study of the inverse diffusion flame using high repetition rate OH/acetone PLIF and PIV

    KAUST Repository

    Elbaz, Ayman M.; Roberts, William L.

    2015-01-01

    Most previous work on inverse diffusion flames (IDFs) has focused on laminar IDF emissions and the soot formation characteristics. Here, we investigate the characteristics and structure of methane IDFs using high speed planar laser-induced fluorescence (PLIF) images of OH, particle image velocimetry (PIV), and acetone PLIF imaging for non-reacting cases. First, the flame appearance was investigated with fixed methane loading (mass flux) but with varying airflow rates, yielding a central air jet Reynolds number (Re) of 1,000 to 6,000 (when blow-off occurs). Next, it was investigated a fixed central air jet Re of 4500, but with varied methane mass flux such that the global equivalence ratio spanned 0.5 to 4. It was observed that at Re smaller than 2000, the inner air jet promotes the establishment of an inverse diffusion flame surrounded by a normal diffusion flame. However, when the Re was increased to 2500, two distinct zones became apparent in the flame, a lower entrainment zone and an upper mixing and combustion zone. 10 kHz OH-PLIF images, and 2D PIV allow the identification of the fate and spatial flame structure. Many flame features were identified and further analyzed using simple but effective image processing methods, where three types of structure in all the flames investigated here: flame holes or breaks; closures; and growing kernels. Insights about the rate of evolution of these features, the dynamics of local extinction, and the sequence of events that lead to re-ignition are reported here. In the lower entrainment zone, the occurrence of the flame break events is counterbalanced by closure events, and the edge propagation appears to control the rate at which the flame holes and closures propagate. The rate of propagation of holes was found to be statistically faster than the rate of closure. As the flames approach blow-off, flame kernels become the main mechanism for flame re-ignition further downstream. The simultaneous OH-PLIF/Stereo PIV

  19. Experimental study of the inverse diffusion flame using high repetition rate OH/acetone PLIF and PIV

    KAUST Repository

    Elbaz, Ayman M.

    2015-10-29

    Most previous work on inverse diffusion flames (IDFs) has focused on laminar IDF emissions and the soot formation characteristics. Here, we investigate the characteristics and structure of methane IDFs using high speed planar laser-induced fluorescence (PLIF) images of OH, particle image velocimetry (PIV), and acetone PLIF imaging for non-reacting cases. First, the flame appearance was investigated with fixed methane loading (mass flux) but with varying airflow rates, yielding a central air jet Reynolds number (Re) of 1,000 to 6,000 (when blow-off occurs). Next, it was investigated a fixed central air jet Re of 4500, but with varied methane mass flux such that the global equivalence ratio spanned 0.5 to 4. It was observed that at Re smaller than 2000, the inner air jet promotes the establishment of an inverse diffusion flame surrounded by a normal diffusion flame. However, when the Re was increased to 2500, two distinct zones became apparent in the flame, a lower entrainment zone and an upper mixing and combustion zone. 10 kHz OH-PLIF images, and 2D PIV allow the identification of the fate and spatial flame structure. Many flame features were identified and further analyzed using simple but effective image processing methods, where three types of structure in all the flames investigated here: flame holes or breaks; closures; and growing kernels. Insights about the rate of evolution of these features, the dynamics of local extinction, and the sequence of events that lead to re-ignition are reported here. In the lower entrainment zone, the occurrence of the flame break events is counterbalanced by closure events, and the edge propagation appears to control the rate at which the flame holes and closures propagate. The rate of propagation of holes was found to be statistically faster than the rate of closure. As the flames approach blow-off, flame kernels become the main mechanism for flame re-ignition further downstream. The simultaneous OH-PLIF/Stereo PIV

  20. The American Foreign Exchange Option in Time-Dependent One-Dimensional Diffusion Model for Exchange Rate

    International Nuclear Information System (INIS)

    Rehman, Nasir; Shashiashvili, Malkhaz

    2009-01-01

    The classical Garman-Kohlhagen model for the currency exchange assumes that the domestic and foreign currency risk-free interest rates are constant and the exchange rate follows a log-normal diffusion process.In this paper we consider the general case, when exchange rate evolves according to arbitrary one-dimensional diffusion process with local volatility that is the function of time and the current exchange rate and where the domestic and foreign currency risk-free interest rates may be arbitrary continuous functions of time. First non-trivial problem we encounter in time-dependent case is the continuity in time argument of the value function of the American put option and the regularity properties of the optimal exercise boundary. We establish these properties based on systematic use of the monotonicity in volatility for the value functions of the American as well as European options with convex payoffs together with the Dynamic Programming Principle and we obtain certain type of comparison result for the value functions and corresponding exercise boundaries for the American puts with different strikes, maturities and volatilities.Starting from the latter fact that the optimal exercise boundary curve is left continuous with right-hand limits we give a mathematically rigorous and transparent derivation of the significant early exercise premium representation for the value function of the American foreign exchange put option as the sum of the European put option value function and the early exercise premium.The proof essentially relies on the particular property of the stochastic integral with respect to arbitrary continuous semimartingale over the predictable subsets of its zeros. We derive from the latter the nonlinear integral equation for the optimal exercise boundary which can be studied by numerical methods

  1. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  2. Exciton diffusion length in some thermocleavable polythiophenes by the surface photovoltage method

    DEFF Research Database (Denmark)

    Tousek, J.; Touskova, J.; Remes, Z.

    2012-01-01

    property is that P3MHOCT can serve as a precursor which, after thermal annealing, converts into more rigid and insoluble P3CT and further thermal treatment produces native unsubstituted PT. Ellipsometric measurement yielded data on the thickness of the spin coated layers; absorption coefficients were...... be ascribed to the increase of the crystalline fraction. The highest diffusion length was found in P3CT polymer but its large resistivity represents a disadvantage in application in solar cells. Taking into account just these parameters, relatively low resistivity together with quite high diffusion length (13...

  3. Effect of surface roughness on the heating rates of large-angled hypersonic blunt cones

    Science.gov (United States)

    Irimpan, Kiran Joy; Menezes, Viren

    2018-03-01

    Surface-roughness caused by the residue of an ablative Thermal Protection System (TPS) can alter the turbulence level and surface heating rates on a hypersonic re-entry capsule. Large-scale surface-roughness that could represent an ablated TPS, was introduced over the forebody of a 120° apex angle blunt cone, in order to test for its influence on surface heating rates in a hypersonic freestream of Mach 8.8. The surface heat transfer rates measured on smooth and roughened models under the same freestream conditions were compared. The hypersonic flow-fields of the smooth and rough-surfaced models were visualized to analyse the flow physics. Qualitative numerical simulations and pressure measurements were carried out to have an insight into the high-speed flow physics. Experimental observations under moderate Reynolds numbers indicated a delayed transition and an overall reduction of 17-46% in surface heating rates on the roughened model.

  4. Simple scaling laws for the evaporation of droplets pinned on pillars: Transfer-rate- and diffusion-limited regimes.

    Science.gov (United States)

    Hernandez-Perez, Ruth; García-Cordero, José L; Escobar, Juan V

    2017-12-01

    The evaporation of droplets can give rise to a wide range of interesting phenomena in which the dynamics of the evaporation are crucial. In this work, we find simple scaling laws for the evaporation dynamics of axisymmetric droplets pinned on millimeter-sized pillars. Different laws are found depending on whether evaporation is limited by the diffusion of vapor molecules or by the transfer rate across the liquid-vapor interface. For the diffusion-limited regime, we find that a mass-loss rate equal to 3/7 of that of a free-standing evaporating droplet brings a good balance between simplicity and physical correctness. We also find a scaling law for the evaporation of multicomponent solutions. The scaling laws found are validated against experiments of the evaporation of droplets of (1) water, (2) blood plasma, and (3) a mixture of water and polyethylene glycol, pinned on acrylic pillars of different diameters. These results shed light on the macroscopic dynamics of evaporation on pillars as a first step towards the understanding of other complex phenomena that may be taking place during the evaporation process, such as particle transport and chemical reactions.

  5. Simple scaling laws for the evaporation of droplets pinned on pillars: Transfer-rate- and diffusion-limited regimes

    Science.gov (United States)

    Hernandez-Perez, Ruth; García-Cordero, José L.; Escobar, Juan V.

    2017-12-01

    The evaporation of droplets can give rise to a wide range of interesting phenomena in which the dynamics of the evaporation are crucial. In this work, we find simple scaling laws for the evaporation dynamics of axisymmetric droplets pinned on millimeter-sized pillars. Different laws are found depending on whether evaporation is limited by the diffusion of vapor molecules or by the transfer rate across the liquid-vapor interface. For the diffusion-limited regime, we find that a mass-loss rate equal to 3/7 of that of a free-standing evaporating droplet brings a good balance between simplicity and physical correctness. We also find a scaling law for the evaporation of multicomponent solutions. The scaling laws found are validated against experiments of the evaporation of droplets of (1) water, (2) blood plasma, and (3) a mixture of water and polyethylene glycol, pinned on acrylic pillars of different diameters. These results shed light on the macroscopic dynamics of evaporation on pillars as a first step towards the understanding of other complex phenomena that may be taking place during the evaporation process, such as particle transport and chemical reactions.

  6. Rate of Contamination Removal of Two Phyto-remediation Sites at the DOE Portsmouth Gaseous Diffusion Plant

    International Nuclear Information System (INIS)

    Lewis, A.C.; Baird, D.R.

    2006-01-01

    This paper describes applications of phyto-remediation at the Portsmouth Gaseous Diffusion Plant (PORTS), a Department of Energy (DOE) Facility that enriched uranium from the early 1950's until 2000. Phyto-remediation has been implemented to assist in the removal of TCE (trichloroethylene) in the groundwater at two locations at the PORTS facility: the X-740 area and the X-749/X-120 area. Phyto-remediation technology is based on the ability of certain plants species (in this case hybrid poplar trees) and their associated rhizo-spheric microorganisms to remove, degrade, or contain chemical contaminants located in the soil, sediment, surface water, groundwater, and possibly even the atmosphere. Phyto-remediation technology is a promising clean-up solution for a wide variety of pollutants and sites. Mature trees, such as the hybrid poplar, can consume up to 3,000 gallons of groundwater per acre per day. Organic compounds are captured in the trees' root systems. These organic compounds are degraded by ultraviolet light as they are transpired along with the water vapor through the leaves of the trees. The phyto-remediation system at the X-740 area encompasses 766 one-year old hybrid poplar trees (Populus nigra x nigra, Populus nigra x maximowiczii, and Populus deltoides x nigra) that were planted 10 feet apart in rows 10 feet to 20 feet apart, over an area of 2.6 acres. The system was installed to manage the VOC contaminant plume. At the X749/X-120 area, a phyto-remediation system of 2,640 hybrid poplar trees (Populus nigra x maximowiczii) was planted in seven areas/zones to manage the VOC contaminant plume. The objectives of these systems are to remove contamination from the groundwater and to prevent further migration of contaminants. The goal of these remediation procedures is to achieve completely mature and functional phyto-remediation systems within two years of the initial planting of the hybrid poplar trees at each planting location. There is a direct

  7. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  8. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  9. Numerical modeling of turbulent jet diffusion flames in the atmospheric surface layer

    NARCIS (Netherlands)

    Hernández, J.; Crespo, A.; Duijm, N.J.

    1995-01-01

    The evolution of turbulent jet diffusion flames of natural gas in air is predicted using a finite-volume procedure for solving the flow equations. The model is three dimensional, elliptic and based on the conserved-scalar approach and the laminar flamelet concept. A laminar flamelet prescription for

  10. Diffusion Coefficient in the Zinc Coating Shaped on the Surface of Cast Iron and Steel Alloys

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2015-06-01

    Full Text Available The article presents the method to assess the diffusion coefficient D in the sub-layer of intermetallic phases formed during hot-dip galvanizing “Armco” iron and ductile cast iron EN-GJS-500-7. Hot-dip galvanizing is one of the most popular forms of long-term protection of Fe-C alloys against corrosion. The process for producing a protective layer of sufficient quality is closely related to diffusion of atoms of zinc and iron. The simulation consist in performed a hot-dip galvanizing in laboratory condition above Fe-C alloys, in the Department of Engineering of Cast Alloys and Composites. Galvanizing time ranged from 15 to 300 seconds. Then metallographic specimens were prepared, intermetallic layers were measured and diffusion coefficient (D were calculated. It was found that the diffusion coefficient obtained during hot-dip galvanizing “Armco” iron and zinc is about two orders of magnitude less than the coefficient obtained on ductile cast iron EN-GJS-500-7.

  11. Modelling and analysis of material removal rate and surface roughness in wire-cut EDM of armour materials

    Directory of Open Access Journals (Sweden)

    Ravindranadh Bobbili

    2015-12-01

    Full Text Available The current work presents a comparative study of wire electrical discharge machining (WEDM of armour materials such as aluminium alloy 7017 and rolled homogeneous armour (RHA steel using buckingham pi theorem to model the input variables and thermo-physical characteristics of WEDM on material removal rate (MRR and surface roughness (Ra of Al 7017 and RHA steel. The parameters of the model such as pulse-on time, flushing pressure, input power, thermal diffusivity and latent heat of vaporization have been determined through design of experiment methodology. Wear rate of brass wire increases with rise in input energy in machining Al 7017. The dependence of thermo-physical properties and machining variables on mechanism of MRR and Ra has been described by performing scanning electron microscope (SEM study. The rise in pulse-on time from 0.85μs to 1.25μs causes improvement in MRR and deterioration of surface finish. The machined surface has revealed that craters are found on the machined surface. The propensity of formation of craters increases during WEDM with a higher current and larger pulse-on time.

  12. Rating of roofs’ surfaces regarding their solar potential and suitability for PV systems, based on LiDAR data

    International Nuclear Information System (INIS)

    Lukač, Niko; Žlaus, Danijel; Seme, Sebastijan; Žalik, Borut; Štumberger, Gorazd

    2013-01-01

    Highlights: ► A new method for estimating and rating buildings roofs’ solar potential is presented. ► Considering LiDAR geospatial data together with pyranometer measurements. ► Use of multi-resolution shadowing model with new heuristic vegetation shadowing. ► High correlation between estimated solar potential and onsite measurements. -- Abstract: The roof surfaces within urban areas are constantly attracting interest regarding the installation of photovoltaic systems. These systems can improve self-sufficiency of electricity supply, and can help to decrease the emissions of greenhouse gases throughout urban areas. Unfortunately, some roof surfaces are unsuitable for installing photovoltaic systems. This presented work deals with the rating of roof surfaces within urban areas regarding their solar potential and suitability for the installation of photovoltaic systems. The solar potential of a roof’s surface is determined by a new method that combines extracted urban topography from LiDAR data with the pyranometer measurements of global and diffuse solar irradiances. Heuristic annual vegetation shadowing and a multi-resolution shadowing model, complete the proposed method. The significance of different influential factors (e.g. shadowing) was analysed extensively. A comparison between the results obtained by the proposed method and measurements performed on an actual PV power plant showed a correlation agreement of 97.4%.

  13. Role of hydraulic diffusivity in the decrease of weathering rates over time

    NARCIS (Netherlands)

    Pacheco, F.A.L.; van der Weijden, C.H.

    2014-01-01

    Springs emerging within massifs of crystalline rocks were monitored for discharge rate (Q), and the Q values combined with geomorphic and hydrographic parameters in a hydrologic model to calculate hydraulic conductivity (K) and effective porosity (ne) of the spring watersheds. The spring waters,

  14. On the rate of triplet excitation transfer in the diffuse limit

    International Nuclear Information System (INIS)

    Davidovich, M.A.; Knox, R.S.

    1979-11-01

    The usefulness of spectral data in estimating intermolecular triplet excitation transfer rates in found to be rather limited and to depend explicitly on the mechaisms which allow the optical transitions. Necessary conditions for the validity of such use of spectra are given, and the otherwise required correction factors are discussed and estimated. (Author) [pt

  15. Optical coherent tomography measurements of the diffusion rate of water and drugs in an isolated and whole cornea

    International Nuclear Information System (INIS)

    Larin, Kirill V; Ghosn, M G

    2006-01-01

    The passive diffusion of drugs through the epithelial surfaces of an eye (the most widespread method for medical treatment of various diseases) is considered. The permeability of water and drugs through rabbit cornea was measured in the isolated cornea (separate from an eye) and in the whole cornea. The permeability coefficients of water and dexamethasone were estimated by the method of optical coherence tomography (OCT). Because multiple photon scattering introduces noise and distortions to the OCT signal, measurements were performed at depths up to 500 μm where most likely single scattering of light occurs in cornea. It is shown that the permeability coefficients in the isolated and whole cornea strongly differ from each other. For example, the water permeability in the isolated and whole cornea is (7.09±0.12)x10 -5 and (1.71±0.51)x10 -5 cm s -1 , respectively. (special issue devoted to multiple radiation scattering in random media)

  16. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas

    2012-01-01

    in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices

  17. Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

    Science.gov (United States)

    Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

    2018-04-01

    The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

  18. COMPARISON OF GKS CALCULATED CRITICAL ION TEMPERATURE GRADIENTS AND ITG GROWTH RATES TO DIII-D MEASURED GRADIENTS AND DIFFUSIVITIES

    International Nuclear Information System (INIS)

    BAKER, DR; STAEBLER, GM; PETTY, CC; GREENFIELD, CM; LUCE, TC

    2003-01-01

    OAK-B135 The gyrokinetic equations predict that various drift type waves or modes can be unstable in a tokamak. For some of these modes, such as the ion temperature gradient (ITG) mode and the electron temperature gradient mode, there exists a critical gradient, above which the mode is unstable. Since the existence of unstable modes can cause increased transport, plasmas which are centrally heated tend to increase in temperature gradient until the modes become unstable. Under some conditions the increased transport can fix the gradient at the critical value. here they present a comparison between the measured ion temperature gradients and the critical gradient as calculated by a gyrokinetic linear stability (GKS) code. They also present the maximum linear growth rate as calculated by this code for comparison to experimentally derived transport coefficients. The results show that for low confinement mode (L-mode) discharges, the measured ion temperature gradient is significantly greater than the GKS calculated critical gradient over a large region of the plasma. This is the same region of the plasma where the ion thermal diffusivity is large. For high confinement mode (H-mode) discharges the ion temperature gradient is closer to the critical gradient, but often still greater than the critical gradient over some region. For the best H-mode discharges, the ion temperature is less than or equal to the critical gradient over the whole plasma. In general they find that the position in the plasma where the ion thermal diffusivity starts to increase rapidly is where the maximum linear growth rate is greater than the E x B shearing rate

  19. Diffusion coefficients-surface and interfacial tensions - Particular study of some lauryl compounds

    International Nuclear Information System (INIS)

    Morel, Jean-Emile

    1969-01-01

    Two important results of the double lipophilic and hydrophilic character of some heavy organic compounds with a polar group at the end of the chain, were studied: - In a first part, molecular diffusion coefficients were measured in order to prove the micellar aggregation of tri-laurylammonium nitrate in some organic solutions; - In a second part, the tensioactivity of some lauryl compounds (lauric acid, lauric alcohol, mono-laurylamine, etc.), was studied. (author) [fr

  20. Reflection Matrix Method for Controlling Light After Reflection From a Diffuse Scattering Surface

    Science.gov (United States)

    2016-12-22

    of Philosophy Kenneth W. Burgi, BS, MS Major, USAF 22 December 2016 DISTRIBUTION STATEMENT A APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT...refocusing light through thin films of a turbid medium. When coherent light is trans- mitted through a stationary diffuser (i.e. a turbid medium), a fine...resultant light scatter [14, 15, 21, 23]. Transmission matrices were measured with microscopic objectives and thin films of turbid media, resulting in

  1. Modeling the Influence of Diffusion-Controlled Reactions and Residual Termination and Deactivation on the Rate and Control of Bulk ATRP at High Conversions

    Directory of Open Access Journals (Sweden)

    Ali Mohammad Rabea

    2015-04-01

    Full Text Available In high-conversion atom transfer radical polymerization (ATRP, all the reactions, such as radical termination, radical deactivation, dormant chain activation, monomer propagation, etc. could become diffusion controlled sooner or later, depending on relative diffusivities of the involved reacting species. These diffusion-controlled reactions directly affect the rate of polymerization and the control of polymer molecular weight. A model is developed to investigate the influence of diffusion-controlled reactions on the high conversion ATRP kinetics. Model simulation reveals that diffusion-controlled termination slightly increases the rate, but it is the diffusion-controlled deactivation that causes auto-acceleration in the rate (“gel effect” and loss of control. At high conversions, radical chains are “trapped” because of high molecular weight. However, radical centers can still migrate through (1 radical deactivation–activation cycles and (2 monomer propagation, which introduce “residual termination” reactions. It is found that the “residual termination” does not have much influence on the polymerization kinetics. The migration of radical centers through propagation can however facilitate catalytic deactivation of radicals, which improves the control of polymer molecular weight to some extent. Dormant chain activation and monomer propagation also become diffusion controlled and finally stop the polymerization when the system approaches its glass state.

  2. Kalman Filtering and Smoothing of the Van Allen Probes Observations to Estimate the Radial, Energy and Pitch Angle Diffusion Rates

    Science.gov (United States)

    Podladchikova, T.; Shprits, Y.; Kellerman, A. C.

    2015-12-01

    The Kalman filter technique combines the strengths of new physical models of the Earth's radiation belts with long-term spacecraft observations of electron fluxes and therefore provide an extremely useful method for the analysis of the state and evolution of the electron radiation belts. However, to get the reliable data assimilation output, the Kalman filter application is confronted with a set of fundamental problems. E.g., satellite measurements are usually limited to a single location in space, which confines the reconstruction of the global evolution of the radiation environment. The uncertainties arise from the imperfect description of the process dynamics and the presence of observation errors, which may cause the failure of data assimilation solution. The development of adaptive Kalman filter that combines the Van Allen Probes data and 3-D VERB code, its accurate customizations in the reconstruction of model describing the phase space density (PSD) evolution, extension of the possibilities to use measurement information, and the model adjustment by developing the identification techniques of model and measurement errors allowed us to reveal hidden and implicit regularities of the PSD dynamics and obtain quantitative and qualitative estimates of radial, energy and pitch angle diffusion characteristics from satellite observations. In this study we propose an approach to estimate radial, energy and pitch angle diffusion rates, as well as the direction of their propagation.

  3. Diffusively cooled thin-sheath high-repetition-rate TEA and TEMA lasers

    Science.gov (United States)

    Yatsiv, Shaul; Gabay, Amnon; Sintov, Yoav

    1993-05-01

    Transverse electric atmospheric (TEA), or multi atmospheric (TEMA) lasers deliver intense short laser pulses of considerable energies. Recurrent high repetition rate pulse trains afford substantial average power levels. In a high rep-rate operation the gas flows across the cavity and is externally cooled to maintain a reasonably low temperature. The gas flow gear and heat exchanger are bulky and costly. In this work we present a repetitively pulsed TEA or TEMA laser that combines energy and peak power features in an individual pulse with the substantial average power levels of a pulse train in a thin layer of gas. Excess heat is disposed of, by conduction through the gas, to cooled enclosing walls. The gas does not flow. The method applies to vibrational transition molecular lasers in the infrared, where elevated temperatures are deleterious to the laser operation. The gist of the method draws on the law that heat conductivity in gases does not depend on their pressure. The fact lends unique operational flexibility and compactness, desirable for industrial and research purposes.

  4. Influence of Ni Catalyst Layer and TiN Diffusion Barrier on Carbon Nanotube Growth Rate

    Directory of Open Access Journals (Sweden)

    Mérel Philippe

    2010-01-01

    Full Text Available Abstract Dense, vertically aligned multiwall carbon nanotubes were synthesized on TiN electrode layers for infrared sensing applications. Microwave plasma-enhanced chemical vapor deposition and Ni catalyst were used for the nanotubes synthesis. The resultant nanotubes were characterized by SEM, AFM, and TEM. Since the length of the nanotubes influences sensor characteristics, we study in details the effects of changing Ni and TiN thickness on the physical properties of the nanotubes. In this paper, we report the observation of a threshold Ni thickness of about 4 nm, when the average CNT growth rate switches from an increasing to a decreasing function of increasing Ni thickness, for a process temperature of 700°C. This behavior is likely related to a transition in the growth mode from a predominantly “base growth” to that of a “tip growth.” For Ni layer greater than 9 nm the growth rate, as well as the CNT diameter, variations become insignificant. We have also observed that a TiN barrier layer appears to favor the growth of thinner CNTs compared to a SiO2 layer.

  5. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  6. Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

    Science.gov (United States)

    Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

    2014-03-01

    Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

  7. Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

    Science.gov (United States)

    1979-01-01

    A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

  8. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  9. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  10. Off-lattice self-learning kinetic Monte Carlo: application to 2D cluster diffusion on the fcc(111) surface

    International Nuclear Information System (INIS)

    Kara, Abdelkader; Yildirim, Handan; Rahman, Talat S; Trushin, Oleg

    2009-01-01

    We report developments of the kinetic Monte Carlo (KMC) method with improved accuracy and increased versatility for the description of atomic diffusivity on metal surfaces. The on-lattice constraint built into our recently proposed self-learning KMC (SLKMC) (Trushin et al 2005 Phys. Rev. B 72 115401) is released, leaving atoms free to occupy 'off-lattice' positions to accommodate several processes responsible for small-cluster diffusion, periphery atom motion and heteroepitaxial growth. This technique combines the ideas embedded in the SLKMC method with a new pattern-recognition scheme fitted to an off-lattice model in which relative atomic positions are used to characterize and store configurations. Application of a combination of the 'drag' and the repulsive bias potential (RBP) methods for saddle point searches allows the treatment of concerted cluster, and multiple- and single-atom, motions on an equal footing. This tandem approach has helped reveal several new atomic mechanisms which contribute to cluster migration. We present applications of this off-lattice SLKMC to the diffusion of 2D islands of Cu (containing 2-30 atoms) on Cu and Ag(111), using the interatomic potential from the embedded-atom method. For the hetero-system Cu/Ag(111), this technique has uncovered mechanisms involving concerted motions such as shear, breathing and commensurate-incommensurate occupancies. Although the technique introduces complexities in storage and retrieval, it does not introduce noticeable extra computational cost.

  11. Fem Simulation of Triple Diffusive Natural Convection Along Inclined Plate in Porous Medium: Prescribed Surface Heat, Solute and Nanoparticles Flux

    Directory of Open Access Journals (Sweden)

    Goyal M.

    2017-12-01

    Full Text Available In this paper, triple diffusive natural convection under Darcy flow over an inclined plate embedded in a porous medium saturated with a binary base fluid containing nanoparticles and two salts is studied. The model used for the nanofluid is the one which incorporates the effects of Brownian motion and thermophoresis. In addition, the thermal energy equations include regular diffusion and cross-diffusion terms. The vertical surface has the heat, mass and nanoparticle fluxes each prescribed as a power law function of the distance along the wall. The boundary layer equations are transformed into a set of ordinary differential equations with the help of group theory transformations. A wide range of parameter values are chosen to bring out the effect of buoyancy ratio, regular Lewis number and modified Dufour parameters of both salts and nanofluid parameters with varying angle of inclinations. The effects of parameters on the velocity, temperature, solutal and nanoparticles volume fraction profiles, as well as on the important parameters of heat and mass transfer, i.e., the reduced Nusselt, regular and nanofluid Sherwood numbers, are discussed. Such problems find application in extrusion of metals, polymers and ceramics, production of plastic films, insulation of wires and liquid packaging.

  12. Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

    International Nuclear Information System (INIS)

    Singh, Gyanendra; Mehta, Dalip Singh

    2013-01-01

    We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

  13. Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

    International Nuclear Information System (INIS)

    Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

    2010-01-01

    This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

  14. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  15. Dominant rate process of silicon surface etching by hydrogen chloride gas

    International Nuclear Information System (INIS)

    Habuka, Hitoshi; Suzuki, Takahiro; Yamamoto, Sunao; Nakamura, Akio; Takeuchi, Takashi; Aihara, Masahiko

    2005-01-01

    Silicon surface etching and its dominant rate process are studied using hydrogen chloride gas in a wide concentration range of 1-100% in ambient hydrogen at atmospheric pressure in a temperature range of 1023-1423 K, linked with the numerical calculation accounting for the transport phenomena and the surface chemical reaction in the entire reactor. The etch rate, the gaseous products and the surface morphology are experimentally evaluated. The dominant rate equation accounting for the first-order successive reactions at silicon surface by hydrogen chloride gas is shown to be valid. The activation energy of the dominant surface process is evaluated to be 1.5 x 10 5 J mol - 1 . The silicon deposition by the gaseous by-product, trichlorosilane, is shown to have a negligible influence on the silicon etch rate

  16. Influence of atmospheric rainfall to γ radiation Kerma rate in surface air

    International Nuclear Information System (INIS)

    Xu Zhe; Wan Jun; Yu Rongsheng

    2009-01-01

    Objective: To investigate the influence rule of the atmospheric Rainfall to the γ radiation Kerma rate in surface air in order to revise the result of its measurement during rainfall. Methods: The influence factors of rainfall to the measurement of the γ radiation Kerma rate in air were analyzed and then the differential equation of the correlation factors was established theoretically, and by resolving the equation, the mathematical model Was obtained. The model was discussed through several practical examples. Results: The mathematical model was coincided with the tendency of curve about the measured data on the influence rule of rainfall to the γ radiation Kerma rate in surface air. Conclusion: By using the theoretical formula in this article which is established to explain the relationship between the rainfall and the γ radiation Kerma rate in surface air, the influence of rainfall to the γ radiation Kerma rate in surface air could be correctly revised. (authors)

  17. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

    2006-01-01

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  18. Surface reaction rate and probability of ozone and alpha-terpineol on glass, polyvinyl chloride, and latex paint surfaces.

    Science.gov (United States)

    Shu, Shi; Morrison, Glenn C

    2011-05-15

    Ozone can react homogeneously with unsaturated organic compounds in buildings to generate undesirable products. However, these reactions can also occur on indoor surfaces, especially for low-volatility organics. Conversion rates of ozone with α-terpineol, a representative low-volatility compound, were quantified on surfaces that mimic indoor substrates. Rates were measured for α-terpineol adsorbed to beads of glass, polyvinylchloride (PVC), and dry latex paint, in a plug flow reactor. A newly defined second-order surface reaction rate coefficient, k(2), was derived from the flow reactor model. The value of k(2) ranged from 0.68 × 10(-14) cm(4)s(-1)molecule(-1) for α-terpineol adsorbed to PVC to 3.17 × 10(-14) cm(4)s(-1)molecule(-1) for glass, but was insensitive to relative humidity. Further, k(2) is only weakly influenced by the adsorbed mass but instead appears to be more strongly related to the interfacial activity α-terpineol. The minimum reaction probability ranged from 3.79 × 10(-6) for glass at 20% RH to 6.75 × 10(-5) for PVC at 50% RH. The combination of high equilibrium surface coverage and high reactivity for α-terpineol suggests that surface conversion rates are fast enough to compete with or even overwhelm other removal mechanisms in buildings such as gas-phase conversion and air exchange.

  19. Surface diffusivity of cleaved NaCl crystals as a function of humidity: Impedance spectroscopy measurements and implications for crack healing in rock salt

    NARCIS (Netherlands)

    Koelemeijer, P.J.; Peach, C.J.; Spiers, C.J.

    2012-01-01

    Rock salt offers an attractive host rock for geological storage applications, because of its naturally low permeability and the ability of excavation-induced cracks to heal by fluid-assisted diffusive mass transfer. However, while diffusive transport rates in bulk NaCl solution are rapid and well

  20. High speed surface cleaning by a high repetition rated TEA-CO2 laser

    International Nuclear Information System (INIS)

    Tsunemi, Akira; Hirai, Ryo; Hagiwara, Kouji; Nagasaka, Keigo; Tashiro, Hideo

    1994-01-01

    We demonstrated the feasibility of high speed cleaning of solid surfaces by the laser ablation technique using a TEA-CO 2 laser. The laser pulses with the repetition rate of 1 kHz were applied to paint, rust, moss and dirt attached on the surfaces. The attachments were effectively removed without the damage of bulk surfaces by the irradiation of line-focused sequential pulses with an energy of 300 mJ/pulse. A cleaning rate reached to 17 m 2 /hour for the case of paint removal from iron surfaces. (author)

  1. Simultaneous Retrieval of Aerosol and Surface Optical Properties from Combined Airborne- and Ground-Based Direct and Diffuse Radiometric Measurements

    Science.gov (United States)

    Gatebe, C. K.; Dubovik, O.; King, M. D.; Sinyuk, A.

    2010-01-01

    This paper presents a new method for simultaneously retrieving aerosol and surface reflectance properties from combined airborne and ground-based direct and diffuse radiometric measurements. The method is based on the standard Aerosol Robotic Network (AERONET) method for retrieving aerosol size distribution, complex index of refraction, and single scattering albedo, but modified to retrieve aerosol properties in two layers, below and above the aircraft, and parameters on surface optical properties from combined datasets (Cloud Absorption Radiometer (CAR) and AERONET data). A key advantage of this method is the inversion of all available spectral and angular data at the same time, while accounting for the influence of noise in the inversion procedure using statistical optimization. The wide spectral (0.34-2.30 m) and angular range (180 ) of the CAR instrument, combined with observations from an AERONET sunphotometer, provide sufficient measurement constraints for characterizing aerosol and surface properties with minimal assumptions. The robustness of the method was tested on observations made during four different field campaigns: (a) the Southern African Regional Science Initiative 2000 over Mongu, Zambia, (b) the Intercontinental Transport Experiment-Phase B over Mexico City, Mexico (c) Cloud and Land Surface Interaction Campaign over the Atmospheric Radiation Measurement (ARM) Central Facility, Oklahoma, USA, and (d) the Arctic Research of the Composition of the Troposphere from Aircraft and Satellites (ARCTAS) over Elson Lagoon in Barrow, Alaska, USA. The four areas are dominated by different surface characteristics and aerosol types, and therefore provide good test cases for the new inversion method.

  2. Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

    Directory of Open Access Journals (Sweden)

    Xi Shao

    2016-03-01

    Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

  3. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Measurements of dry-deposition rates on various earth surfaces by 212Pb

    International Nuclear Information System (INIS)

    Osaki, S.; Sugihara, S.; Maeda, Y.

    2004-01-01

    Dry deposition rates of 212 Pb on a coniferous forest (Japanese cedar) and a broad-leaf forest (Pasania edulis) have been measured. Those on various kinds of grass fields, various states on artificial surface such as water, paper, and standing paper have been also measured. The dry deposition rates depend on the characteristics of depositing particles and the conditions of deposited surfaces. Dry deposition rates on the forest of Japanese cedar are highest because of the complex and adhesive surface of the leaves. Those on various grass fields are roughly depend on the logarithm of the height of their grasses. The total deposition rates of 7 Be do not depend on the densities or heights of the grasses. 7 Be may be not kept on their leaves or surface soil for a long time. The dry deposition rates of on artificial surface, e.g. paper and water surfaces make clear the mechanism on dry deposition, and suggest that more chances of collision and more adhesive of the surface are important for the dry deposition. About 90% of all deposition on the artificial paper grass was attached on the standing paper. On water surface, 60% of the rate of paper grass was attached, but only about 20% were attached on a dry paper plate. The aerosol particles are deposited by collision with the surface, therefore the deposition velocity depends on the chance of collision and the characteristics of the surface. Therefore the dry deposition rates on forests are larger and those of coniferous forest are largest. (author)

  5. Dilution rate and microstructure of TIG arc Ni-Al powder surfacing layer

    Institute of Scientific and Technical Information of China (English)

    SHAN Jiguo; DONG Wei; TAN Wenda; ZHANG Di; PEN Jialie

    2007-01-01

    Surfacing beads are prepared by a direct current tungsten inert gas arc nickel-aluminum (Ni-Al) powder surfacing process. With the aim of controlling the dilution rate and obtaining surfacing beads rich in intermetallic compounds, the effects of surfacing parameters on geometric parameters, dilution rate, composition, and microstructure of the bead are investigated. An assistant cooler, which can potentially reduce the temperature of the base metal, is used in the surfacing process and its effect on dilution rate and microstructure is studied. The result indicates that with the surfacing parameter combination of low current and speed, the width and penetration of the bead decrease, reinforcement increases, and dilution rate drops markedly. With the reduc- tion of the parameter combination, the intergranular phase T-(Fe, Ni) is formed in the grain boundaries of Ni-Al interme- tallic matrix instead of the intergranular phase α-Fe, and large amount of intermetallics are obtained. With the use of an assistant cooler on a selected operation condition during the surfacing process, the reinforcement of the bead increases, penetration decreases, and dilution rate declines. The use of an assistant cooler helps obtain a surfacing bead composed of only intermetallics.

  6. Radon exhalation rates corrected for leakage and back diffusion – Evaluation of radon chambers and radon sources with application to ceramic tile

    Directory of Open Access Journals (Sweden)

    M. Abo-Elmagd

    2014-10-01

    Full Text Available The natural radon decay, leakage and back diffusion are the main removal processes of radon from its container. Ignoring these processes leads to underestimate the measured value of radon related parameters like exhalation rate and radium content. This work is aimed to evaluate two different radon chambers through determining their leakage rate λv and evaluation of radon source by determine its back diffusion rate λb inside the evaluated radon chambers as well as a small sealed cup. Two different methods are adapted for measuring both the leakage rate and the back diffusion rate. The leakage rate can be determined from the initial slope of the radon decay curve or from the exponential fitting of the whole decay curve. This can be achieved if a continuous monitoring of radon concentration inside the chamber is available. Also, the back diffusion rate is measured by sealing the radon source in the chamber and used the initial slope of the buildup curve to determine λb and therefore the exhalation rate of the source. This method was compared with simple equation for λb based on the ratio of the source to the chamber volume. The obtained results are applied to ceramic tile as an important radon source in homes. The measurement is targeted the ceramic glaze before and after firing as well as the obtained tile after adhere the glaze on the tile main body. Also, six different tile brands from Egyptian market are subjected to the study for comparison.

  7. Controls on surface soil drying rates observed by SMAP and simulated by the Noah land surface model

    Science.gov (United States)

    Shellito, Peter J.; Small, Eric E.; Livneh, Ben

    2018-03-01

    Drydown periods that follow precipitation events provide an opportunity to assess controls on soil evaporation on a continental scale. We use SMAP (Soil Moisture Active Passive) observations and Noah simulations from drydown periods to quantify the role of soil moisture, potential evaporation, vegetation cover, and soil texture on soil drying rates. Rates are determined using finite differences over intervals of 1 to 3 days. In the Noah model, the drying rates are a good approximation of direct soil evaporation rates, and our work suggests that SMAP-observed drying is also predominantly affected by direct soil evaporation. Data cover the domain of the North American Land Data Assimilation System Phase 2 and span the first 1.8 years of SMAP's operation. Drying of surface soil moisture observed by SMAP is faster than that simulated by Noah. SMAP drying is fastest when surface soil moisture levels are high, potential evaporation is high, and when vegetation cover is low. Soil texture plays a minor role in SMAP drying rates. Noah simulations show similar responses to soil moisture and potential evaporation, but vegetation has a minimal effect and soil texture has a much larger effect compared to SMAP. When drying rates are normalized by potential evaporation, SMAP observations and Noah simulations both show that increases in vegetation cover lead to decreases in evaporative efficiency from the surface soil. However, the magnitude of this effect simulated by Noah is much weaker than that determined from SMAP observations.

  8. Deduction of the rates of radial diffusion of protons from the structure of the Earth's radiation belts

    Science.gov (United States)

    Kovtyukh, Alexander S.

    2016-11-01

    From the data on the fluxes and energy spectra of protons with an equatorial pitch angle of α0 ≈ 90° during quiet and slightly disturbed (Kp ≤ 2) periods, I directly calculated the value DLL, which is a measure of the rate of radial transport (diffusion) of trapped particles. This is done by successively solving the systems (chains) of integrodifferential equations which describe the balance of radial transport/acceleration and ionization losses of low-energy protons of the stationary belt. This was done for the first time. For these calculations, I used data of International Sun-Earth Explorer 1 (ISEE-1) for protons with an energy of 24 to 2081 keV at L = 2-10 and data of Explorer-45 for protons with an energy of 78.6 to 872 keV at L = 2-5. Ionization losses of protons (Coulomb losses and charge exchange) were calculated on the basis of modern models of the plasmasphere and the exosphere. It is shown that for protons with μ from ˜ 0.7 to ˜ 7 keV nT-1 at L ≈ 4.5-10, the functions of DLL can be approximated by the following equivalent expressions: DLL ≈ 4.9 × 10-14μ-4.1L8.2 or DLL ≈ 1.3 × 105(EL)-4.1 or DLL ≈ 1.2 × 10-9fd-4.1, where fd is the drift frequency of the protons (in mHz), DLL is measured in s-1, E is measured in kiloelectronvolt and μ is measured in kiloelectronvolt per nanotesla. These results are consistent with the radial diffusion of particles under the action of the electric field fluctuations (pulsations) in the range of Pc6 and contradict the mechanism of the radial diffusion of particles under the action of sudden impulses (SIs) of the magnetic field and also under the action of substorm impulses of the electric field. During magnetic storms DLL increases, and the expressions for DLL obtained here can change completely.

  9. Deduction of the rates of radial diffusion of protons from the structure of the Earth's radiation belts

    Directory of Open Access Journals (Sweden)

    A. S. Kovtyukh

    2016-11-01

    Full Text Available From the data on the fluxes and energy spectra of protons with an equatorial pitch angle of α0 ≈ 90° during quiet and slightly disturbed (Kp ≤ 2 periods, I directly calculated the value DLL, which is a measure of the rate of radial transport (diffusion of trapped particles. This is done by successively solving the systems (chains of integrodifferential equations which describe the balance of radial transport/acceleration and ionization losses of low-energy protons of the stationary belt. This was done for the first time. For these calculations, I used data of International Sun–Earth Explorer 1 (ISEE-1 for protons with an energy of 24 to 2081 keV at L = 2–10 and data of Explorer-45 for protons with an energy of 78.6 to 872 keV at L = 2–5. Ionization losses of protons (Coulomb losses and charge exchange were calculated on the basis of modern models of the plasmasphere and the exosphere. It is shown that for protons with μ from  ∼ 0.7 to ∼ 7 keV nT−1 at L ≈ 4.5–10, the functions of DLL can be approximated by the following equivalent expressions: DLL ≈ 4.9 × 10−14μ−4.1L8.2 or DLL ≈ 1.3 × 105(EL−4.1 or DLL ≈ 1.2 × 10−9fd−4.1, where fd is the drift frequency of the protons (in mHz, DLL is measured in s−1, E is measured in kiloelectronvolt and μ is measured in kiloelectronvolt per nanotesla. These results are consistent with the radial diffusion of particles under the action of the electric field fluctuations (pulsations in the range of Pc6 and contradict the mechanism of the radial diffusion of particles under the action of sudden impulses (SIs of the magnetic field and also under the action of substorm impulses of the electric field. During magnetic storms DLL increases, and the expressions for DLL obtained here can change completely.

  10. Deduction of the rates of radial diffusion of protons from the structure of the Earth's radiation belts

    Energy Technology Data Exchange (ETDEWEB)

    Kovtyukh, Alexander S. [Moscow State Univ. (Russian Federation). Skobeltsyn Inst. of Nuclear Physics

    2016-07-01

    From the data on the fluxes and energy spectra of protons with an equatorial pitch angle of α{sub 0} ∼ 90 during quiet and slightly disturbed (Kp≤2) periods, I directly calculated the value D{sub LL}, which is a measure of the rate of radial transport (diffusion) of trapped particles. This is done by successively solving the systems (chains) of integrodifferential equations which describe the balance of radial transport/acceleration and ionization losses of low-energy protons of the stationary belt. This was done for the first time. For these calculations, I used data of International Sun-Earth Explorer 1 (ISEE-1) for protons with an energy of 24 to 2081 keV at L = 2-10 and data of Explorer-45 for protons with an energy of 78.6 to 872 keV at L = 2-5. Ionization losses of protons (Coulomb losses and charge exchange) were calculated on the basis of modern models of the plasmasphere and the exosphere. It is shown that for protons with μ from ∝0.7 to ∝7 keV nT{sup -1} at L ∼ 4.5-10, the functions of D{sub LL} can be approximated by the following equivalent expressions: D{sub LL} ∼ 4.9 x 10{sup -14}μ{sup -4.1}L{sup 8.2} or D{sub LL} ∼ 1.3 x 10{sup 5}(EL){sup -4.1} or D{sub LL} ∼ 1.2 x 10{sup -9}f{sub d}{sup -4.1}, where f{sub d} is the drift frequency of the protons (in mHz), D{sub LL} is measured in s{sup -1}, E is measured in kiloelectronvolt and μ is measured in kiloelectronvolt per nanotesla. These results are consistent with the radial diffusion of particles under the action of the electric field fluctuations (pulsations) in the range of Pc6 and contradict the mechanism of the radial diffusion of particles under the action of sudden impulses (SIs) of the magnetic field and also under the action of substorm impulses of the electric field. During magnetic storms D{sub LL} increases, and the expressions for D{sub LL} obtained here can change completely.

  11. Towards Stable Lithium-Sulfur Batteries with a Low Self-Discharge Rate: Ion Diffusion Modulation and Anode Protection.

    Science.gov (United States)

    Xu, Wen-Tao; Peng, Hong-Jie; Huang, Jia-Qi; Zhao, Chen-Zi; Cheng, Xin-Bing; Zhang, Qiang

    2015-09-07

    The self-discharge of a lithium-sulfur cell decreases the shelf-life of the battery and is one of the bottlenecks that hinders its practical applications. New insights into both the internal chemical reactions in a lithium-sulfur system and effective routes to retard self-discharge for highly stable batteries are crucial for the design of lithium-sulfur cells. Herein, a lithium-sulfur cell with a carbon nanotube/sulfur cathode and lithium-metal anode in lithium bis(trifluoromethanesulfonyl)imide/1,3-dioxolane/dimethyl ether electrolyte was selected as the model system to investigate the self-discharge behavior. Both lithium anode passivation and polysulfide anion diffusion suppression strategies are applied to reduce self-discharge of the lithium-sulfur cell. When the lithium-metal anode is protected by a high density passivation layer induced by LiNO3 , a very low shuttle constant of 0.017 h(-1) is achieved. The diffusion of the polysulfides is retarded by an ion-selective separator, and the shuttle constants decreased. The cell with LiNO3 additive maintained a discharge capacity of 97 % (961 mAh g(-1) ) of the initial capacity after 120 days at open circuit, which was around three times higher than the routine cell (32 % of initial capacity, corresponding to 320 mAh g(-1) ). It is expected that lithium-sulfur batteries with ultralow self-discharge rates may be fabricated through a combination of anode passivation and polysulfide shuttle control, as well as optimization of the lithium-sulfur cell configuration. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Atmospheric Surface Layer Characterization: Preliminary Desert Lapse Rate Study 22-25 August 2000

    National Research Council Canada - National Science Library

    Elliott, Doyle

    2003-01-01

    Results of the August 2000 Desert Lapse Rate (DLR) Experiment are presented. The DLR Experiment was performed to document the night-to-day transition effects on the desert Atmospheric Surface Layer (ASL...

  13. Surface morphology and molecular bonding of CaCO3 nanocrystallites by gas diffusion method

    Science.gov (United States)

    Sulimai, N. H.; Rani, Rozina Abdul; Khusaimi, Z.; Abdullah, S.; Salifairus, M. J.; Alrokayan, Salman; Khan, Haseeb; Rusop, M.

    2018-05-01

    Calcium carbonate with the chemical formula of (CaCO3) is the most abundant element in the world. Its usage on certain applications is largely affected by its properties. The best means to control its properties is through controlled preparation of CaCO3. This study uses diffusion method between the precursors Calcium Chloride and Ammonium Carbonate. Instead of using water, ethanol was used to prepare the salt. Reaction was done in room temperature (RT) for 6h-24h. Smallest average crystallite size measured by FESEM micrograph is 500nm produced by synthesis of CaCO3 reacted for 168 hours. From energy-dispersive X-ray spectrum also indicated the smallest particle size is by CaCO3 reacted for 168 hours. Changes was seen for element Ca at 3.7keV.

  14. Dependence of Rn adsorption rate and effective half-life time on diffusion barrier type and moving air environment

    International Nuclear Information System (INIS)

    Arafa, Wafaa; Badran, Heba

    2005-01-01

    The variation of the adsorbed radon rate during the exposure time using charcoal canister was studied applying moving air environment inside the radon chamber and compared to the static air measurements. The air movement increases the accumulation time leading to more accurate results. Different types of membrane have been tested as diffusion barrier for activated charcoal canisters. The Makrofol and aluminized polycarbonate improve the adsorption/desorption rate more than the polyehylene membrane. The measured effective half-life time showed a remarkable correlation with the previously measured permeability constant for corresponding membranes. Different types of commercially available charcoal were investigated to develop a local version of charcoal canister for radon measurements. Applying static and moving air environments, the break point and radon collection efficiency were determined at different temperatures. Both of the temperature and air movement accelerate the appearance of the break point. Th efficiency of the locally developed charcoal is 87% and 84.5% of that Calgon PCB charcoal used by EPA. (author)

  15. Rate kernel theory for pseudo-first-order kinetics of diffusion-influenced reactions and application to fluorescence quenching kinetics.

    Science.gov (United States)

    Yang, Mino

    2007-06-07

    Theoretical foundation of rate kernel equation approaches for diffusion-influenced chemical reactions is presented and applied to explain the kinetics of fluorescence quenching reactions. A many-body master equation is constructed by introducing stochastic terms, which characterize the rates of chemical reactions, into the many-body Smoluchowski equation. A Langevin-type of memory equation for the density fields of reactants evolving under the influence of time-independent perturbation is derived. This equation should be useful in predicting the time evolution of reactant concentrations approaching the steady state attained by the perturbation as well as the steady-state concentrations. The dynamics of fluctuation occurring in equilibrium state can be predicted by the memory equation by turning the perturbation off and consequently may be useful in obtaining the linear response to a time-dependent perturbation. It is found that unimolecular decay processes including the time-independent perturbation can be incorporated into bimolecular reaction kinetics as a Laplace transform variable. As a result, a theory for bimolecular reactions along with the unimolecular process turned off is sufficient to predict overall reaction kinetics including the effects of unimolecular reactions and perturbation. As the present formulation is applied to steady-state kinetics of fluorescence quenching reactions, the exact relation between fluorophore concentrations and the intensity of excitation light is derived.

  16. The effect of heating rate on the surface chemistry of NiTi.

    Science.gov (United States)

    Undisz, Andreas; Hanke, Robert; Freiberg, Katharina E; Hoffmann, Volker; Rettenmayr, Markus

    2014-11-01

    The impact of the heating rate on the Ni content at the surface of the oxide layer of biomedical NiTi is explored. Heat treatment emulating common shape-setting procedures was performed by means of conventional and inductive heating for similar annealing time and temperature, applying various heating rates from ~0.25 K s(-1) to 250 K s(-1). A glow discharge optical emission spectroscopy method was established and employed to evaluate concentration profiles of Ni, Ti and O in the near-surface region at high resolution. The Ni content at the surface of the differently treated samples varies significantly, with maximum surface Ni concentrations of ~20 at.% at the lowest and ~1.5 at.% at the highest heating rate, i.e. the total amount of Ni contained in the surface region of the oxide layer decreases by >15 times. Consequently, the heating rate is a determinant for the biomedical characteristics of NiTi, especially since Ni available at the surface of the oxide layer may affect the hemocompatibility and be released promptly after surgical application of a respective implant. Furthermore, apparently contradictory results presented in the literature reporting surface Ni concentrations of ~3 at.% to >20 at.% after heat treatment are consistently explained considering the ascertained effect of the heating rate. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  17. Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

    Czech Academy of Sciences Publication Activity Database

    Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

    2016-01-01

    Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

  18. Predictions of homogeneous nucleation rates for n-alkanes accounting for the diffuse phase interface and capillary waves.

    Science.gov (United States)

    Planková, Barbora; Vinš, Václav; Hrubý, Jan

    2017-10-28

    Homogeneous droplet nucleation has been studied for almost a century but has not yet been fully understood. In this work, we used the density gradient theory (DGT) and considered the influence of capillary waves (CWs) on the predicted size-dependent surface tensions and nucleation rates for selected n-alkanes. The DGT model was completed by an equation of state (EoS) based on the perturbed-chain statistical associating fluid theory and compared to the classical nucleation theory and the Peng-Robinson EoS. It was found that the critical clusters are practically free of CWs because they are so small that even the smallest wavelengths of CWs do not fit into their finite dimensions. The CWs contribute to the entropy of the system and thus decrease the surface tension. A correction for the effect of CWs on the surface tension is presented. The effect of the different EoSs is relatively small because by a fortuitous coincidence their predictions are similar in the relevant range of critical cluster sizes. The difference of the DGT predictions to the classical nucleation theory computations is important but not decisive. Of the effects investigated, the most pronounced is the suppression of CWs which causes a sizable decrease of the predicted nucleation rates. The major difference between experimental nucleation rate data and theoretical predictions remains in the temperature dependence. For normal alkanes, this discrepancy is much stronger than observed, e.g., for water. Theoretical corrections developed here have a minor influence on the temperature dependency. We provide empirical equations correcting the predicted nucleation rates to values comparable with experiments.

  19. Predictions of homogeneous nucleation rates for n-alkanes accounting for the diffuse phase interface and capillary waves

    Science.gov (United States)

    Planková, Barbora; Vinš, Václav; Hrubý, Jan

    2017-10-01

    Homogeneous droplet nucleation has been studied for almost a century but has not yet been fully understood. In this work, we used the density gradient theory (DGT) and considered the influence of capillary waves (CWs) on the predicted size-dependent surface tensions and nucleation rates for selected n-alkanes. The DGT model was completed by an equation of state (EoS) based on the perturbed-chain statistical associating fluid theory and compared to the classical nucleation theory and the Peng-Robinson EoS. It was found that the critical clusters are practically free of CWs because they are so small that even the smallest wavelengths of CWs do not fit into their finite dimensions. The CWs contribute to the entropy of the system and thus decrease the surface tension. A correction for the effect of CWs on the surface tension is presented. The effect of the different EoSs is relatively small because by a fortuitous coincidence their predictions are similar in the relevant range of critical cluster sizes. The difference of the DGT predictions to the classical nucleation theory computations is important but not decisive. Of the effects investigated, the most pronounced is the suppression of CWs which causes a sizable decrease of the predicted nucleation rates. The major difference between experimental nucleation rate data and theoretical predictions remains in the temperature dependence. For normal alkanes, this discrepancy is much stronger than observed, e.g., for water. Theoretical corrections developed here have a minor influence on the temperature dependency. We provide empirical equations correcting the predicted nucleation rates to values comparable with experiments.

  20. Oxygen-induced high diffusion rate of magnesium dopants in GaN/AlGaN based UV LED heterostructures.

    Science.gov (United States)

    Michałowski, Paweł Piotr; Złotnik, Sebastian; Sitek, Jakub; Rosiński, Krzysztof; Rudziński, Mariusz

    2018-05-23

    Further development of GaN/AlGaN based optoelectronic devices requires optimization of the p-type material growth process. In particular, uncontrolled diffusion of Mg dopants may decrease the performance of a device. Thus it is meaningful to study the behavior of Mg and the origins of its diffusion in detail. In this work we have employed secondary ion mass spectrometry to study the diffusion of magnesium in GaN/AlGaN structures. We show that magnesium has a strong tendency to form Mg-H complexes which immobilize Mg atoms and restrain their diffusion. However, these complexes are not present in samples post-growth annealed in an oxygen atmosphere or Al-rich AlGaN structures which naturally have a high oxygen concentration. In these samples, more Mg atoms are free to diffuse and thus the average diffusion length is considerably larger than for a sample annealed in an inert atmosphere.

  1. Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Sun Jianzhong; Wang Zhikang; Gong Xiangyang

    2006-01-01

    Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

  2. Enough positive rate of paraspinal mapping and diffusion tensor imaging with levels which should be decompressed in lumbar spinal stenosis.

    Science.gov (United States)

    Chen, Hua-Biao; Zhong, Zhi-Wei; Li, Chun-Sheng; Bai, Bo

    2016-07-01

    In lumbar spinal stenosis, correlating symptoms and physical examination findings with decompression levels based on common imaging is not reliable. Paraspinal mapping (PM) and diffusion tensor imaging (DTI) may be possible to prevent the false positive occurrences with MRI and show clear benefits to reduce the decompression levels of lumbar spinal stenosis than conventional magnetic resonance imaging (MRI) + neurogenic examination (NE). However, they must have enough positive rate with levels which should be decompressed at first. The study aimed to confirm that the positive of DTI and PM is enough in levels which should be decompressed in lumbar spinal stenosis. The study analyzed the positive of DTI and PM as well as compared the preoperation scores to the postoperation scores, which were assessed preoperatively and at 2 weeks, 3 months 6 months, and 12 months postoperatively. 96 patients underwent the single level decompression surgery. The positive rate among PM, DTI, and (PM or DTI) was 76%, 98%, 100%, respectively. All post-operative Oswestry Disability Index (ODI), visual analog scale for back pain (VAS-BP) and visual analog scale for leg pain (VAS-LP) scores at 2 weeks postoperatively were measured improvement than the preoperative ODI, VAS-BP and VAS-LP scores with statistically significance (p-value = 0.000, p-value = 0.000, p-value = 0.000, respectively). In degenetive lumbar spinal stenosis, the positive rate of (DTI or PM) is enough in levels which should be decompressed, thence using the PM and DTI to determine decompression levels will not miss the level which should be operated. Copyright © 2016 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.

  3. Surface tension phenomena in the xylem sap of three diffuse porous temperate tree species

    Science.gov (United States)

    K. K. Christensen-Dalsgaard; M. T. Tyree; P. G. Mussone

    2011-01-01

    In plant physiology models involving bubble nucleation, expansion or elimination, it is typically assumed that the surface tension of xylem sap is equal to that of pure water, though this has never been tested. In this study we collected xylem sap from branches of the tree species Populus tremuloides, Betula papyrifera and Sorbus...

  4. Modification of the glass surface induced by redox reactions and internal diffusion processes

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    In this paper we report a novel way to modify the glass surface in favor of some physical performances. The main step is to perform iso-thermal treatments on the selected silicate glasses containing transition metal at temperatures near the glass transition temperature for various durations under...

  5. Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

    Directory of Open Access Journals (Sweden)

    H. Hammami

    2017-08-01

    Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

  6. Statistical validation of the model of diffusion-convection (MDC) of 137Cs for the assessment of recent sedimentation rates in coastal systems

    International Nuclear Information System (INIS)

    Paulo Alves de Lima Ferreira; Eduardo Siegle; Michel Michaelovitch de Mahiques; Rubens Cesar Lopes Figueira; Carlos Augusto Franca Schettini

    2015-01-01

    This study aimed the validation of the model of diffusion-convection (MDC) of 137 Cs for the calculation of recent sedimentation rates in 13 sedimentary cores of two Brazilian coastal systems, the Cananeia-Iguape and Santos-Sao Vicente estuarine systems. The MDC covers key factors responsible for 137 Cs vertical migration in sediments: its diffusion to the interstitial water and the vertical convection of this water through the sediments. This study successfully validated the MDC use to determine sedimentation rates, which was statistically validated not only with 210 Pb xs (unsupported 210 Pb) models, widely used in oceanographic studies, but also by literature values for those regions. (author)

  7. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  8. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-04-05

    Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

  9. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-01-01

    Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

  10. Lead-210 analyses of sediment accumulation rates in five Southern Illinois surface mine lakes

    International Nuclear Information System (INIS)

    Brugam, R.B.; Carlson, M.A.

    1981-01-01

    210 Pb is a naturally occurring radionuclide with a short half-life (22 yrs) which can be used to determine sedimentation rates in lakes. The technique was applied in 5 Southern Illinois surface mine lakes where it revealed past sedimentation rates to have been extremely variable. In some of the lakes there was evidence for extensive slumping immediately after mining ceased followed by a more regular sedimentary regime that continued until the present. In others there have been one or more changes in sediment accumulation rates since lacustrine sedimentation began. These results suggest that simply measuring the amount of sediment that has accumulated in a surface mine lake since mining ceased is inadequate to determine filling rates. Sedimentation rates in the 5 lakes varied from .60 +- .19 to 1.46 +- .19 cm/y. These rates are similar to natural lakes with moderately disturbed watersheds

  11. Mean field diffusion models for precipitation in crystalline GaAs including surface tension and bulk stresses

    Energy Technology Data Exchange (ETDEWEB)

    Dreyer, Wolfgang [Weierstrass-Institut fuer Angewandte Analysis und Stochastik (WIAS) im Forschungsverbund Berlin e.V. (Germany); Kimmerle, Sven-Joachim [Humboldt-Univ. Berlin (Germany). Dept. of Mathematics

    2009-07-01

    Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first class of models treats the diffusion-controlled regime of interface motion, while the second class is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. We consider homogenised models, where different length scales of the experimental situation have been exploited in order to simplify the equations. These homogenised models generalise the well-known Lifshitz-Slyozov-Wagner model for Ostwald ripening. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

  12. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  13. Electrolyte diffusion in compacted montmorillonite engineered barriers

    International Nuclear Information System (INIS)

    Jahnke, F.M.; Radke, C.J.

    1985-09-01

    The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab

  14. Measurement of the ferric diffusion coefficient in agarose and gelatine gels by utilization of the evolution of a radiation induced edge as reflected in relaxation rate images

    International Nuclear Information System (INIS)

    Pedersen, Torje V.; Olsen, Dag R.; Skretting, Arne

    1997-01-01

    A method has been developed to determine the diffusion coefficients of ferric ions in ferrous sulphate doped gels. A radiation induced edge was created in the gel, and two spin-echo sequences were used to acquire a pair of images of the gel at different points of time. For each of these image pairs, a longitudinal relaxation rate image was derived. From profiles through these images, the standard deviations of the Gaussian functions that characterize diffusion were determined. These data provided the basis for the determination of the ferric diffusion coefficients by two different methods. Simulations indicate that the use of single spin-echo images in this procedure may in some cases lead to a significant underestimation of the diffusion coefficient. The technique was applied to different agarose and gelatine gels that were prepared, irradiated and imaged simultaneously. The results indicate that the diffusion coefficient is lower in a gelatine gel than in an agarose gel. Addition of xylenol orange to a gelatine gel lowers the diffusion coefficient from 1.45 to 0.81 mm 2 h -1 , at the cost of significantly lower R 1 sensitivity. The addition of benzoic acid to the latter gel did not increase the R 1 sensitivity. (author) OK

  15. Direct Measurement of Surface Dissolution Rates in Potential Nuclear Waste Forms: The Example of Pyrochlore.

    Science.gov (United States)

    Fischer, Cornelius; Finkeldei, Sarah; Brandt, Felix; Bosbach, Dirk; Luttge, Andreas

    2015-08-19

    The long-term stability of ceramic materials that are considered as potential nuclear waste forms is governed by heterogeneous surface reactivity. Thus, instead of a mean rate, the identification of one or more dominant contributors to the overall dissolution rate is the key to predict the stability of waste forms quantitatively. Direct surface measurements by vertical scanning interferometry (VSI) and their analysis via material flux maps and resulting dissolution rate spectra provide data about dominant rate contributors and their variability over time. Using pyrochlore (Nd2Zr2O7) pellet dissolution under acidic conditions as an example, we demonstrate the identification and quantification of dissolution rate contributors, based on VSI data and rate spectrum analysis. Heterogeneous surface alteration of pyrochlore varies by a factor of about 5 and additional material loss by chemo-mechanical grain pull-out within the uppermost grain layer. We identified four different rate contributors that are responsible for the observed dissolution rate range of single grains. Our new concept offers the opportunity to increase our mechanistic understanding and to predict quantitatively the alteration of ceramic waste forms.

  16. Self-diffusion dynamics processes relevant to 2D homoepitaxy growth of Ni adatom on Ni(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Fusheng [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Chen, Yifeng, E-mail: yefengc63@sina.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Wang, Yufei, E-mail: yejin802@126.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Liu, Zhulin; Hu, Zhongliang [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Yang, Xiyuan [Department of Physics, Hunan University of Arts and Science, Changde 415000 (China); Luo, Wenhua [Department of Physics and Electronic Information Science, Hunan Institute of Science and Technology, Yueyang 414006 (China)

    2014-07-01

    Using molecular dynamics and modified analytic embedded atom methods, the atomic self-diffusion dynamics behaviors relevant to 2D crystal growth on Ni(111) surface have been studied between 150 and 600 K. On perfect Ni(111) surface, the activation energy and prefactor are 0.058±0.001 eV and 4.2×10{sup −4} cm{sup 2}/s between 150 and 350 K, and 0.082±0.003 eV and 7.8×10{sup −4} cm{sup 2}/s from 400 to 600 K. Ni adatom just hops along the directions of close-packed steps on stepped Ni(111) surface, the corresponding activation energies and prefactors are 0.188±0.002 eV and (3.8–4.4)×10{sup −3} cm{sup 2}/s along the direction of A-type step, 0.140±0.001 eV and (1.1–1.2)×10{sup −3} cm{sup 2}/s along the direction of B-type step, and both fitting lines of Arrhenius law intersect at T{sub c}=420–440 K. Our results show that the atomic growth dynamics under nonequilibrium conditions is gradually dominated by the prefactor with increasing temperature. In addition, the shape-change of the 2D nanometer-size island has been discussed on stepped Ni(111) surface in different temperature range.

  17. Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

    Science.gov (United States)

    Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

    2005-09-01

    We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

  18. Moisture diffusivity in structure of random fractal fiber bed

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Fanglong, E-mail: zhufanglong_168@163.com [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); The Chinese People' s Armed Police Forces Academy, Langfan City (China); Zhou, Yu; Feng, Qianqian [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); Xia, Dehong [School of Mechanical Engineering, University of Science and Technology, Beijing (China)

    2013-11-08

    A theoretical expression related to effective moisture diffusivity to random fiber bed is derived by using fractal theory and considering both parallel and perpendicular channels to diffusion flow direction. In this Letter, macroporous structure of hydrophobic nonwoven material is investigated, and Knudsen diffusion and surface diffusion are neglected. The effective moisture diffusivity predicted by the present fractal model are compared with water vapor transfer rate (WVTR) experiment data and calculated values obtained from other theoretical models. This verifies the validity of the present fractal diffusivity of fibrous structural beds.

  19. Failure rate and reliability of the KOMATSU hydraulic excavator in surface limestone mine

    Science.gov (United States)

    Harish Kumar N., S.; Choudhary, R. P.; Murthy, Ch. S. N.

    2018-04-01

    The model with failure rate function of bathtub-shaped is helpful in reliability analysis of any system and particularly in reliability associated privative maintenance. The usual Weibull distribution is, however, not capable to model the complete lifecycle of the any with a bathtub-shaped failure rate function. In this paper, failure rate and reliability analysis of the KOMATSU hydraulic excavator/shovel in surface mine is presented and also to improve the reliability and decrease the failure rate of each subsystem of the shovel based on the preventive maintenance. The model of the bathtub-shaped for shovel can also be seen as a simplification of the Weibull distribution.

  20. Surface applicators for high dose rate brachytherapy in AIDS-related kaposi's sarcoma

    International Nuclear Information System (INIS)

    Evans, Michael D.C.; Yassa, Mariam; Podgorsak, Ervin B.; Roman, Ted N.; Schreiner, L. John; Souhami, Luis

    1997-01-01

    Purpose: The development of commercially available surface applicators using high dose rate remote afterloading devices has enabled radiotherapy centers to treat selected superficial lesions using a remote afterloading brachytherapy unit. The dosimetric parameters of these applicators, the clinical implementation of this technique, and a review of the initial patient treatment regimes are presented. Methods and Materials: A set of six fixed-diameter (1, 2, and 3 cm), tungsten/steel surface applicators is available for use with a single stepping-source (Ir-192, 370 GBq) high dose rate afterloader. The source can be positioned either in a parallel or perpendicular orientation to the treatment plane at the center of a conical aperture that sits at an SSD of approximately 15 mm and is used with a 1-mm thick removable plastic cap. The surface dose rates, percent depth dose, and off-axis ratios were measured. A custom-built, ceiling-mounted immobilization device secures the applicator on the surface of the patient's lesion during treatment. Results: Between November 1994, and September 1996, 16 AIDS-related Kaposi's sarcoma patients having a total of 120 lesions have been treated with palliative intent. Treatment sites were distributed between the head and neck, extremity, and torso. Doses ranged from 8 to 20 Gy, with a median dose of 10 Gy delivered in a single fraction. Treatments were well tolerated with minimal skin reaction, except for patients with lesions treated to 20 Gy who developed moderate/severe desquamation. Conclusion: Radiotherapy centers equipped with a high dose rate remote afterloading unit may treat small selected surface lesions with commercially available surface applicators. These surface applicators must be used with a protective cap to eliminate electron contamination. The optimal surface dose appears to be either 10 or 15 Gy depending upon the height of the lesion

  1. A versatile optical profilometer based on conoscopic holography sensors for acquisition of specular and diffusive surfaces in artworks

    Science.gov (United States)

    Gaburro, Nicola; Marchioro, Giacomo; Daffara, Claudia

    2017-07-01

    Surface metrology of artworks requires the design of suitable devices for in-situ non-destructive measurement together with reliable procedures for an effective analysis of such non-engineered variegate objects. To advance the state-of-the-art it has been implemented a versatile optical micro-profilometry taking advantage of the adapt- ability of conoscopic holography sensors, able to operate with irregular shapes and composite materials (diffusive, specular, and polychrome) of artworks. The scanning technique is used to obtain wide field and high spatially resolved areal profilometry. The prototype has a modular scheme based on a set of conoscopic sensors, extending the typical design based on a scanning stage and a single probe with a limited bandwidth, thus allowing the collection of heights data from surface with different scales and materials with variegate optical response. The system was optimized by characterizing the quality of the measurement with the probes triggered in continuous scanning modality. The results obtained on examples of cultural heritage objects (2D paintings, 3D height-relief) and materials (pictorial, metallic) demonstrate the versatility of the implemented device.

  2. Constraints on Friction, Dilatancy, Diffusivity, and Effective Stress From Low-Frequency Earthquake Rates on the Deep San Andreas Fault

    Science.gov (United States)

    Beeler, N. M.; Thomas, Amanda; Bürgmann, Roland; Shelly, David

    2018-01-01

    Families of recurring low-frequency earthquakes (LFEs) within nonvolcanic tremor on the San Andreas Fault in central California are sensitive to tidal stresses. LFEs occur at all levels of the tides, are strongly correlated and in phase with the 200 Pa shear stresses, and weakly and not systematically correlated with the 2 kPa tidal normal stresses. We assume that LFEs are small sources that repeatedly fail during shear within a much larger scale, aseismically slipping fault zone and consider two different models of the fault slip: (1) modulation of the fault slip rate by the tidal stresses or (2) episodic slip, triggered by the tides. LFEs are strongly clustered with duration much shorter than the semidiurnal tide; they cannot be significantly modulated on that time scale. The recurrence times of clusters, however, are many times longer than the semidiurnal, leading to an appearance of tidal triggering. In this context we examine the predictions of laboratory-observed triggered frictional (dilatant) fault slip. The undrained end-member model produces no sensitivity to the tidal normal stress, and slip onsets are in phase with the tidal shear stress. The tidal correlation constrains the diffusivity to be less than 1 × 10-6/s and the product of the friction and dilatancy coefficients to be at most 5 × 10-7, orders of magnitude smaller than observed at room temperature. In the absence of dilatancy the effective normal stress at failure would be about 55 kPa. For this model the observations require intrinsic weakness, low dilatancy, and lithostatic pore fluid.

  3. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

    Energy Technology Data Exchange (ETDEWEB)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  4. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

    Science.gov (United States)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  5. Estimating spatially distributed monthly evapotranspiration rates by linear transformations of MODIS daytime land surface temperature data

    Directory of Open Access Journals (Sweden)

    J. Szilagyi

    2009-05-01

    Full Text Available Under simplifying conditions catchment-scale vapor pressure at the drying land surface can be calculated as a function of its watershed-representative temperature (<Ts> by the wet-surface equation (WSE, similar to the wet-bulb equation in meteorology for calculating the dry-bulb thermometer vapor pressure of the Complementary Relationship of evaporation. The corresponding watershed ET rate, , is obtained from the Bowen ratio with the help of air temperature, humidity and percent possible sunshine data. The resulting (<Ts>, pair together with the wet-environment surface temperature (<Tws> and ET rate (ETw, obtained by the Priestley-Taylor equation, define a linear transformation on a monthly basis by which spatially distributed ET rates can be estimated as a sole function of MODIS daytime land surface temperature, Ts, values within the watershed. The linear transformation preserves the mean which is highly desirable. <Tws>, in the lack of significant open water surfaces within the study watershed (Elkhorn, Nebraska, was obtained as the mean of the smallest MODIS Ts values each month. The resulting period-averaged (2000–2007 catchment-scale ET rate of 624 mm/yr is very close to the water-balance derived ET rate of about 617 mm/yr. The latter is a somewhat uncertain value due to the effects of (a observed groundwater depletion of about 1m over the study period caused by extensive irrigation, and; (b the uncertain rate of net regional groundwater supply toward the watershed. The spatially distributed ET rates correspond well with soil/aquifer properties and the resulting land use type (i.e. rangeland versus center-pivot irrigated crops.

  6. Prediction of material removal rate and surface roughness for wire electrical discharge machining of nickel using response surface methodology

    Directory of Open Access Journals (Sweden)

    Thangam Chinnadurai

    2016-12-01

    Full Text Available This study focuses on investigating the effects of process parameters, namely, Peak current (Ip, Pulse on time (Ton, Pulse off time (Toff, Water pressure (Wp, Wire feed rate (Wf, Wire tension (Wt, Servo voltage (Sv and Servo feed setting (Sfs, on the Material Removal Rate (MRR and Surface Roughness (SR for Wire electrical discharge machining (Wire-EDM of nickel using Taguchi method. Response Surface Methodology (RSM is adopted to evolve mathematical relationships between the wire cutting process parameters and the output variables of the weld joint to determine the welding input parameters that lead to the desired optimal wire cutting quality. Besides, using response surface plots, the interaction effects of process parameters on the responses are analyzed and discussed. The statistical software Mini-tab is used to establish the design and to obtain the regression equations. The developed mathematical models are tested by analysis-of-variance (ANOVA method to check their appropriateness and suitability. Finally, a comparison is made between measured and calculated results, which are in good agreement. This indicates that the developed models can predict the responses accurately and precisely within the limits of cutting parameter being used.

  7. Prediction of material removal rate and surface roughness for wire electrical discharge machining of nickel using response surface methodology

    International Nuclear Information System (INIS)

    Chinnadurai, T.; Vendan, S.A.

    2016-01-01

    This study focuses on investigating the effects of process parameters, namely, Peak current (Ip), Pulse on time (Ton), Pulse off time (Toff), Water pressure (Wp), Wire feed rate (Wf), Wire tension (Wt), Servo voltage (Sv) and Servo feed setting (Sfs), on the Material Removal Rate (MRR) and Surface Roughness (SR) for Wire electrical discharge machining (Wire-EDM) of nickel using Taguchi method. Response Surface Methodology (RSM) is adopted to evolve mathematical relationships between the wire cutting process parameters and the output variables of the weld joint to determine the welding input parameters that lead to the desired optimal wire cutting quality. Besides, using response surface plots, the interaction effects of process parameters on the responses are analyzed and discussed. The statistical software Mini-tab is used to establish the design and to obtain the regression equations. The developed mathematical models are tested by analysis-of-variance (ANOVA) method to check their appropriateness and suitability. Finally, a comparison is made between measured and calculated results, which are in good agreement. This indicates that the developed models can predict the responses accurately and precisely within the limits of cutting parameter being used. (Author)

  8. Prediction of material removal rate and surface roughness for wire electrical discharge machining of nickel using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Chinnadurai, T.; Vendan, S.A.

    2016-07-01

    This study focuses on investigating the effects of process parameters, namely, Peak current (Ip), Pulse on time (Ton), Pulse off time (Toff), Water pressure (Wp), Wire feed rate (Wf), Wire tension (Wt), Servo voltage (Sv) and Servo feed setting (Sfs), on the Material Removal Rate (MRR) and Surface Roughness (SR) for Wire electrical discharge machining (Wire-EDM) of nickel using Taguchi method. Response Surface Methodology (RSM) is adopted to evolve mathematical relationships between the wire cutting process parameters and the output variables of the weld joint to determine the welding input parameters that lead to the desired optimal wire cutting quality. Besides, using response surface plots, the interaction effects of process parameters on the responses are analyzed and discussed. The statistical software Mini-tab is used to establish the design and to obtain the regression equations. The developed mathematical models are tested by analysis-of-variance (ANOVA) method to check their appropriateness and suitability. Finally, a comparison is made between measured and calculated results, which are in good agreement. This indicates that the developed models can predict the responses accurately and precisely within the limits of cutting parameter being used. (Author)

  9. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  10. [Diagnostic efficiency of decline rate of signal intensity and apparent diffusion coefficient with different b values for differentiating benign and malignant breast lesions on diffusion-weighted 3.0T magnetic resonance imaging].

    Science.gov (United States)

    Jiang, Jing; Liu, Wanhua; Ye, Yuanyuan; Wang, Rui; Li, Fengfang; Peng, Chengyu

    2014-06-17

    To investigate the diagnostic efficiency of decline rate of signal intensity and apparent diffusion coefficient with different b values for differentiating benign and malignant breast lesions on diffusion-weighted 3.0 T magnetic resonance imaging. A total of 152 patients with 162 confirmed histopathologically breast lesions (85 malignant and 77 benign) underwent 3.0 T diffusion-weighted magnetic resonance imaging. Four b values (0, 400, 800 and 1 000 s/mm²) were used. The signal intensity and ADC values of breast lesions were measured respectively. The signal intensity decline rate (SIDR) and apparent diffusion coefficient decline rate (ADCDR) were calculated respectively. SIDR = (signal intensity of lesions with low b value-signal intensity of lesions with high b value)/signal intensity of lesions with low b value, ADCDR = (ADC value of lesions with low b value-ADC value of lesions with high b value) /ADC value of lesions with low b value. The independent sample t-test was employed for statistical analyses and the receiver operating characteristic (ROC) curve for evaluating the diagnosis efficiency of SIDR and ADCDR values. Significant differences were observed in SIDR between benign and malignant breast lesions with b values of 0-400, 400-800 and 800-1 000 s/mm². The sensitivities of SIDR for differentiating benign and malignant breast lesions were 61.2%, 68.2% and 67.1%, the specificities 74.0%, 85.7% and 67.5%, the diagnosis accordance rates 67.3%, 76.5% and 67.3%, the positive predictive values 72.2%, 84.1% and 69.5% and the negative predictive values 63.3%, 71.0% and 65.0% respectively. Significant differences were observed in ADCDR between benign and malignant breast lesions with b values of 400-800 s/mm² and 800-1 000 s/mm². The sensitivities of SDR for differentiating benign and malignant breast lesions were 80.0% and 65.9%, the specificities 72.7% and 65.0%, the diagnostic accordance rates 76.5% and 65.4%, the positive predictive values 76.4% and 67

  11. Dynamic weakening of serpentinite gouges and bare surfaces at seismic slip rates

    Science.gov (United States)

    Proctor, B. P.; Mitchell, T. M.; Hirth, G.; Goldsby, D.; Zorzi, F.; Platt, J. D.; Di Toro, G.

    2014-11-01

    To investigate differences in the frictional behavior between initially bare rock surfaces of serpentinite and powdered serpentinite ("gouge") at subseismic to seismic slip rates, we conducted single-velocity step and multiple-velocity step friction experiments on an antigorite-rich and lizardite-rich serpentinite at slip rates (V) from 0.003 m/s to 6.5 m/s, sliding displacements up to 1.6 m, and normal stresses (σn) up to 22 MPa for gouge and 97 MPa for bare surfaces. Nominal steady state friction values (μnss) in gouge at V = 1 m/s are larger than in bare surfaces for all σn tested and demonstrate a strong σn dependence; μnss decreased from 0.51 at 4.0 MPa to 0.39 at 22.4 MPa. Conversely, μnss values for bare surfaces remained ~0.1 with increasing σn and V. Additionally, the velocity at the onset of frictional weakening and the amount of slip prior to weakening were orders of magnitude larger in gouge than in bare surfaces. Extrapolation of the normal stress dependence for μnss suggests that the behavior of antigorite gouge approaches that of bare surfaces at σn ≥ 60 MPa. X-ray diffraction revealed dehydration reaction products in samples that frictionally weakened. Microstructural analysis revealed highly localized slip zones with melt-like textures in some cases gouge experiments and in all bare surfaces experiments for V ≥ 1 m/s. One-dimensional thermal modeling indicates that flash heating causes frictional weakening in both bare surfaces and gouge. Friction values for gouge decrease at higher velocities and after longer displacements than bare surfaces because strain is more distributed.

  12. Is there a link between blastomere contact surfaces of day 3 embryos and live birth rate?

    Directory of Open Access Journals (Sweden)

    Paternot Goedele

    2012-09-01

    Full Text Available Abstract Background Cell-cell communication and adhesion are essential for the compaction process of early stage embryos. The aim of this study was to develop a non-invasive objective calculation system of embryo compaction in order to test the hypothesis that embryos with a larger mean contact surface result in a higher live birth rate compared to embryos with a lower mean contact surface. Methods Multilevel images of 474 embryos transferred on day 3 were evaluated by the Cellify software. This software calculates the contact surfaces between the blastomeres. The primary outcome of this study was live birth. An ideal range of contact surface was determined and the positive and negative predictive value, the sensitivity, the specificity and the area under the curve for this new characteristic were calculated. Results In total, 115 (24% transferred embryos resulted in a live birth. Selection of an embryo for transfer on its mean contact surface could predict live birth with a high sensitivity (80% and high negative predicting value (83% but with a low positive predictive value (27%, a low specificity (31% and low area under the ROC curve (0.56. The mean contact surface of embryos cultured in a single medium was significantly higher compared to the mean contact surface of embryos cultured in a sequential medium (p = 0.0003. Conclusions Neither the mean contact surface nor the number of contact surfaces of a day 3 embryo had an additional value in the prediction of live birth. The type of culture medium, however, had an impact on the contact surface of an embryo. Embryos cultured in a single medium had a significant larger contact surface compared to embryos cultured in the sequential medium.

  13. The effect of loading rate on ductile fracture toughness and fracture surface roughness

    DEFF Research Database (Denmark)

    Osovski, S.; Srivastava, Akhilesh Kumar; Ponson, L.

    2015-01-01

    The variation of ductile crack growth resistance and fracture surface roughness with loading rate is modeled under mode I plane strain, small scale yielding conditions. Three-dimensional calculations are carried out using an elastic-viscoplastic constitutive relation for a progressively cavitatin...

  14. Measurements of dry deposition rates of 212Pb from aerosols on various natural and artificial surfaces

    International Nuclear Information System (INIS)

    Osaki, S.; Sugihara, S.; Maeda, Y.; Osaki, T.

    2007-01-01

    The dry deposition rates on various grass fields and two forests have been measured by the use of 212 Pb (T 1/2 = 10.6 hours). The deposition rate on grass fields (average: 7 mm x s -1 ) roughly depends on the logarithms of the heights or densities of the grasses. The dry deposition rates on a broadleaved forest (Lithocarpus edulis) and a coniferous forest (Cryptomeria Japonica) were also measured. The highest (ave. 26 mm x s -1 ) was on the forest of C. Japonica because of the dense and adhesive surfaces of the leaves. (author)

  15. Does disinfection of environmental surfaces influence nosocomial infection rates? A systematic review.

    Science.gov (United States)

    Dettenkofer, Markus; Wenzler, Sibylle; Amthor, Susanne; Antes, Gerd; Motschall, Edith; Daschner, Franz D

    2004-04-01

    To review the evidence on the effects of disinfection of environmental surfaces in hospitals (as compared with cleaning without use of disinfectants) on the occurrence of nosocomial infections. Systematic review of experimental and nonexperimental intervention studies dealing with environmental disinfection or cleaning in different health care settings. A total of 236 scientific articles were identified. None described a meta-analysis, systematic review, or randomized controlled trial. Only 4 articles described completed cohort studies matching the inclusion criteria. None of these studies showed lower infection rates associated with routine disinfection of surfaces (mainly floors) versus cleaning with detergent only. Disinfectants may pose a danger to staff, patients, and the environment and require special safety precautions. However, targeted disinfection of certain environmental surfaces is in certain instances an established component of hospital infection control. Given the complex, multifactorial nature of nosocomial infections, well-designed studies that systematically investigate the role of surface disinfection are required.

  16. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  17. Open charcoal chamber method for mass measurements of radon exhalation rate from soil surface

    International Nuclear Information System (INIS)

    Tsapalov, Andrey; Kovler, Konstantin; Miklyaev, Peter

    2016-01-01

    Radon exhalation rate from the soil surface can serve as an important criterion in the evaluation of radon hazard of the land. Recently published international standard ISO 11665-7 (2012) is based on the accumulation of radon gas in a closed container. At the same time since 1998 in Russia, as a part of engineering and environmental studies for the construction, radon flux measurements are made using an open charcoal chamber for a sampling duration of 3–5 h. This method has a well-defined metrological justification and was tested in both favorable and unfavorable conditions. The article describes the characteristics of the method, as well as the means of sampling and measurement of the activity of radon absorbed. The results of the metrological study suggest that regardless of the sampling conditions (weather, the mechanism and rate of radon transport in the soil, soil properties and conditions), uncertainty of method does not exceed 20%, while the combined standard uncertainty of radon exhalation rate measured from the soil surface does not exceed 30%. The results of the daily measurements of radon exhalation rate from the soil surface at the experimental site during one year are reported. - Highlights: • Radon exhalation rate from the soil surface area of 32 cm"2 can be measured at level of 10 mBq/(m"2s) at the uncertainty ≤30%. • The method has a metrological justification. • No need to consider climate conditions, soil properties and conditions, mechanism and rate of radon transport in the soil.

  18. Past surface temperatures at the NorthGRIP drill site from the difference in firn diffusion of water isotopes

    DEFF Research Database (Denmark)

    Simonsen, Sebastian Bjerregaard; Johnsen, S. J.; Popp, T. J.

    2011-01-01

    A new ice core paleothermometer is introduced based on the temperature dependent diffusion of the stable water isotopes in the firn. A new parameter called differential diffusion length is defined as the difference between the diffusion length of the two stable water isotopologues 2H1H16O and 1H218......O. A model treatment of the diffusion process of the firn and the ice is presented along with a method of retrieving the diffusion signal from the ice core record of water isotopes using spectral methods. The model shows how the diffusion process is highly dependent on the inter-annual variations...... warmer than observed in other ice core based temperature reconstructions. The mechanisms behind this behaviour are not fully understood. The method shows the need of an expansion of high resolution stable water isotope datasets from ice cores. However, the new ice core paleothermometer presented here...

  19. Coverage dependent desorption dynamics of deuterium on Si(100) surfaces: interpretation with a diffusion-promoted desorption model.

    Science.gov (United States)

    Matsuno, T; Niida, T; Tsurumaki, H; Namiki, A

    2005-01-08

    We studied coverage dependence of time-of-flight (TOF) spectra of D2 molecules thermally desorbed from the D/Si(100) surface. The mean translational energies Et of desorbed D2 molecules were found to increase from 0.20+/-0.05 eV to 0.40+/-0.04 eV as the desorption coverage window was decreased from 1.0 ML> or =thetaD> or =0.9 ML to 0.2 ML> or =thetaD> or =0 ML, being consistent with the kinetics switch predicted in the interdimer mechanism. The measured TOF spectra were deconvoluted into 2H, 3H, and 4H components by a curve fitting method along the principle of detailed balance. As a result, it turned out that the desorption kinetics changes from the 4H to the 3H situation at high coverage above thetaD=0.9 ML, while the 2H desorption is dominant for a quite wide coverage region up to thetaD=0.8 ML. A dynamic desorption mechanism by which the desorption is promoted by D-atom diffusion to dangling bonds was proposed. 2005 American Institute of Physics.

  20. Rates of surface lowering and landscape development in southern South Africa: a cosmogenic view

    Science.gov (United States)

    Richardson, Janet; Vanacker, Veerle; Lang, Andreas; Hodgson, David

    2016-04-01

    The landscape of southern South Africa is characterised by large-scale erosion surfaces, including extensive pediments and multiple strath terraces, which document discordant river evolution through resistant quarzitic lithologies of the Cape Fold Belt (CFB). The timing and rate of erosion is poorly constrained. New cosmogenic ages from surfaces in South Africa are presented using in situ produced 10Be. Strath terraces in deeply incised rivers at two sites within the CFB indicate slow rates of erosion (1.54 - 11.79 m/Ma), which are some of the lowest rates recorded globally. Four pediment surfaces and a depth profile of the thickest pediment were also dated, and the results indicate that there are low rates of surface lowering on the pediments (0.44 - 1.24 m/Ma). The pediments are long-lived features (minimum exposure ages of 0.47 - 1.09 Ma), and are now deeply dissected. Given the minimum exposure ages, calculated river incision rates (42- 203 m/Ma) suggest that after a long period of geomorphic stability during pediment formation there was a discrete phase of increased geomorphic activity. The calculated minimum exposure ages are considered dubious because: 1) known rates of surrounding river incision (published and ours); 2) the climate conditions and time necessary for ferricrete formation on the pediment surfaces and; 3) the deeply incised catchments in the CFB on which the pediments sit, which all point to the pediments being much older. The pediments are fossilised remnants of a much larger geomorphic surface that formed after the main phase of exhumation in southern Africa. They form a store of sediment that currently sit above the surrounding rivers that have some of the lowest erosion rates in the world. These results indicate that steep topography can prevail even in areas of low erosion and tectonic quiescence, and that whilst cosmogenic dating of landscapes is an exciting development in earth sciences, care is needed especially in ancient settings. We

  1. Evaluation of surface tension and Tolman length as a function of droplet radius from experimental nucleation rate and supersaturation ratio: metal vapor homogeneous nucleation.

    Science.gov (United States)

    Onischuk, A A; Purtov, P A; Baklanov, A M; Karasev, V V; Vosel, S V

    2006-01-07

    Zinc and silver vapor homogeneous nucleations are studied experimentally at the temperature from 600 to 725 and 870 K, respectively, in a laminar flow diffusion chamber with Ar as a carrier gas at atmospheric pressure. The size, shape, and concentration of aerosol particles outcoming the diffusion chamber are analyzed by a transmission electron microscope and an automatic diffusion battery. The wall deposit is studied by a scanning electron microscope (SEM). Using SEM data the nucleation rate for both Zn and Ag is estimated as 10(10) cm(-3) s(-1). The dependence of critical supersaturation on temperature for Zn and Ag measured in this paper as well as Li, Na, Cs, Ag, Mg, and Hg measured elsewhere is analyzed. To this aim the classical nucleation theory is extended by the dependence of surface tension on the nucleus radius. The preexponent in the formula for the vapor nucleation rate is derived using the formula for the work of formation of noncritical embryo [obtained by Nishioka and Kusaka [J. Chem. Phys. 96, 5370 (1992)] and later by Debenedetti and Reiss [J. Chem. Phys. 108, 5498 (1998)

  2. Lesion dehydration rate changes with the surface layer thickness during enamel remineralization

    Science.gov (United States)

    Chang, Nai-Yuan N.; Jew, Jamison M.; Fried, Daniel

    2018-02-01

    A transparent highly mineralized outer surface zone is formed on caries lesions during remineralization that reduces the permeability to water and plaque generated acids. However, it has not been established how thick the surface zone should be to inhibit the penetration of these fluids. Near-IR (NIR) reflectance coupled with dehydration can be used to measure changes in the fluid permeability of lesions in enamel and dentin. Based on our previous studies, we postulate that there is a strong correlation between the surface layer thickness and the rate of dehydration. In this study, the rates of dehydration for simulated lesions in enamel with varying remineralization durations were measured. Reflectance imaging at NIR wavelengths from 1400-2300 nm, which coincides with higher water absorption and manifests the greatest sensitivity to contrast changes during dehydration measurements, was used to image simulated enamel lesions. The results suggest that the relationship between surface zone thickness and lesion permeability is highly non-linear, and that a small increase in the surface layer thickness may lead to a significant decrease in permeability.

  3. Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

    International Nuclear Information System (INIS)

    Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

    1985-06-01

    A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

  4. Evaluation of surface dose rate on C-14 scrubber and gas bag

    International Nuclear Information System (INIS)

    Gang, D. W.; Lee, H. S.; Lee, D. H.

    2003-01-01

    In CANDU(Canadian Deuterium Uranium) reactors, purge and discharge of moderator cover gas has been performed via vapor recovery system. The methods employed in C-14 removal are mainly based on reactions of CO 2 with absorber of adsorbent. In order to choose an optimum process, we should consider the characteristics of the process, such as, temperature, pressure, humidity etc. and surface dose rate on C-14 scrubber and gas bag to estimate job-related personnel doses. Assuming that the whole C-14 scrubber was completely replaced after one-cycle operation, and that its C-14 activity for one-cycle operation was 40 mCi, we calculated the surface dose rate at the six points of the C-14 scrubber. This calculation showed that the dose rate on the surface of cartridge was only 1.25μSυ/hγ because of low energy of β ray. It is concluded, therefore, that the cartridge change-out is safe because the operation of C-14 removal system causes only a small increase in dose rate

  5. Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

    2016-09-15

    Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

  6. The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

    Directory of Open Access Journals (Sweden)

    K.A. Widi

    2016-09-01

    Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

  7. Probing the surface swelling in ultra-thin supported polystyrene films during case II diffusion of n-hexane

    NARCIS (Netherlands)

    Ogieglo, Wojciech; Wormeester, Herbert; Wessling, Matthias; Benes, Nieck Edwin

    2013-01-01

    In situ time-resolved spectroscopic ellipsometry is used to study the dynamics of n-hexane diffusion into, and the corresponding induced swelling of, ultra-thin polystyrene films. The experimental conditions are carefully selected to facilitate the observation of anomalous Case II diffusion in the

  8. Determination of sedimentation, diffusion, and mixing rates in coastal sediments of the eastern Red Sea via natural and anthropogenic fallout radionuclides.

    Science.gov (United States)

    Al-Mur, Bandar A; Quicksall, Andrew N; Kaste, James M

    2017-09-15

    The Red Sea is a unique ecosystem with high biodiversity in one of the warmest regions of the world. In the last five decades, Red Sea coastal development has rapidly increased. Sediments from continental margins are delivered to depths by advection and diffusion-like processes which are difficult to quantify yet provide invaluable data to researchers. Beryllium-7, lead-210 and ceseium-137 were analyzed from sediment cores from the near-coast Red Sea near Jeddah, Saudi Arabia. The results of this work are the first estimates of diffusion, mixing, and sedimentation rates of the Red Sea coastal sediments. Maximum chemical diffusion and particle mixing rates range from 69.1 to 380cm -2 y -1 and 2.54 to 6.80cm -2 y -1 , respectively. Sedimentation rate is constrained to approximately 0.6cm/yr via multiple methods. These data provide baselines for tracking changes in various environmental problems including erosion, marine benthic ecosystem silting, and particle-bound contaminant delivery to the seafloor. Copyright © 2017. Published by Elsevier Ltd.

  9. Measurements of the deposition rates of radon daughters on indoor surfaces

    International Nuclear Information System (INIS)

    Wang, H.; Essling, M.A.; Toohey, R.E.; Rundo, J.

    1982-01-01

    The deposition rates of radon daughters on indoor surfaces have been measured by exposing the window of a proportional counter to the air of a house with high concentrations of radon and its daughters. Deposition velocities for unattached 218 Po (RaA) and 214 Pb (RaB) of approximately 4 mm sec - 1 were obtained by dividing the deposition rates by the concentrations of unattached daughters in the air. These results agree with those obtained by other workers but are dependent on the assumptions made about the fractions of the daughters which are attached to the atmospheric aerosol

  10. The influence of various cooling rates during laser alloying on nodular iron surface layer

    Science.gov (United States)

    Paczkowska, Marta; Makuch, Natalia; Kulka, Michał

    2018-06-01

    The results of research referring to modification of the nodular iron surface layer by laser alloying with cobalt were presented. The aim of this study was to analyze the possibilities of cobalt implementation into the surface layer of nodular iron in various laser heat treatment conditions (by generating different cooling rates of melted surface layer). The modified surface layer of nodular iron was analyzed with OM, SEM, TEM, XRD, EDS and Vickers microhardness tester. The modified surface layer of nodular iron after laser alloying consisted of: the alloyed zone (melted with cobalt), the transition zone and the hardened zone from solid state. The alloyed zone was characterized by higher microstructure homogeneity - in contrast to the transition and the hardened zones. All the alloyed zones contained a dendritic microstructure. Dendrites consisted of martensite needles and retained austenite. Cementite was also detected. It was stated, that due to similar dimension of iron and cobalt atoms, their mutual replacement in the crystal lattice could occur. Thus, formation of phases based on α solution: Co-Fe (44-1433) could not be excluded. Although cobalt should be mostly diluted in solid solutions (because of its content in the alloyed zone), the other newly formed phases as Co (ε-hex.), FeC and cobalt carbides: Co3C, CoC0.25 could be present in the alloyed zones as a result of unique microstructure creation during laser treatment. Pearlite grains were observed in the zone, formed using lower power density of the laser beam and its longer exposition time. Simply, such conditions resulted in the cooling rate which was lower than critical cooling rate. The alloyed zones, produced at a higher cooling rate, were characterized by better microstructure homogeneity. Dendrites were finer in this case. This could result from a greater amount of crystal nuclei appearing at higher cooling rate. Simultaneously, the increased amount of γ-Fe and Fe3C precipitates was expected in

  11. Measurement of the radon exhalation rate from the medium surface by tracing the radon concentration

    International Nuclear Information System (INIS)

    Yanliang Tan; Detao Xiao

    2013-01-01

    The paper will present a method based on the accumulation chamber technique for measuring of radon exhalation from the medium surface. A radon monitor traces the change of radon concentration in the accumulation chamber, and then the radon exhalation can be obtained accurately through linear fit. Based on our recent experiments, the radon exhalation rate from the medium surface obtained from this method is in good agreement with the actual exhalation rate of our simulation facility. This method is superior to the competition method which obtains the radon exhalation through the exponential fit by an external PC-system. The calculation for the exponential fit is very easy by computer and related software. However, for portable instruments, the single chip microcomputer can't calculate the exponential fit rapidly. Thus, this method is usable for developing the new portable instrument to classify building materials, etc. (author)

  12. Control of the graphene growth rate on capped SiC surface under strong Si confinement

    International Nuclear Information System (INIS)

    Çelebi, C.; Yanık, C.; Demirkol, A.G.; Kaya, İsmet İ.

    2013-01-01

    Highlights: ► Graphene is grown on capped SiC surface with well defined cavity size. ► Graphene growth rate linearly increases with the cavity height. ► Graphene uniformity is reduced with thickness. - Abstract: The effect of the degree of Si confinement on the thickness and morphology of UHV grown epitaxial graphene on (0 0 0 −1) SiC is investigated by using atomic force microscopy and Raman spectroscopy measurements. Prior to the graphene growth process, the C-face surface of a SiC substrate is capped by another SiC comprising three cavities on its Si-rich surface with depths varying from 0.5 to 2 microns. The Si atoms, thermally decomposed from the sample surface during high temperature annealing of the SiC cap /SiC sample stack, are separately trapped inside these individual cavities at the sample/cap interface. Our analyses show that the growth rate linearly increases with the cavity height. It was also found that stronger Si confinement yields more uniform graphene layers.

  13. Effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stresses in cylindrical Li-ion batteries

    International Nuclear Information System (INIS)

    Zhang, Tao; Guo, Zhansheng

    2014-01-01

    The effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stress in a cylindrical Li-ion battery are studied. It is found that hydrostatic pressure or elastic modulus variation in the active layer have little effect on the distribution of Li ions for a higher diffusivity coefficient, but both can facilitate Li ion diffusion for a lower diffusivity coefficient. The elastic modulus variation has a significant effect on the distribution of stress and hydrostatic pressure can reduce the surface stress for the lower diffusivity coefficient. A higher charging rate causes a more transient response in the stress history, but a linear charging history is observed for slow charging rates. A higher charging rate would not inflict extra damage on the electrode for the higher diffusivity coefficient and the stress history becomes highly transient and charging rate dependent for the lower diffusivity coefficient. The effect of fabricated pressure can be neglected. (paper)

  14. Transition Process from Diffuser Stall to Stage Stall in a Centrifugal Compressor with a Vaned Diffuser

    Directory of Open Access Journals (Sweden)

    Nobumichi Fujisawa

    2017-01-01

    Full Text Available The transition process from a diffuser rotating stall to a stage stall in a centrifugal compressor with a vaned diffuser was investigated by experimental and numerical analyses. From the velocity measurements, it was found that the rotating stall existed on the shroud side of the diffuser passage in the off-design flow condition. The numerical results revealed the typical vortical structure of the diffuser stall. The diffuser stall cell was caused by the systematic vortical structure which consisted of the tornado-type vortex, the longitudinal vortex at the shroud/suction surface corner (i.e., leading edge vortex (LEV, and the vortex in the throat area of the diffuser passages. Furthermore, the stage stall, which rotated within both the impeller and diffuser passages, occurred instead of the diffuser stall as the mass flow rate was decreased. According to the velocity measurements at the diffuser inlet, the diffuser stall which rotated on the shroud side was shifted to the hub side. Then, the diffuser stall moved into the impeller passages and formed the stage stall. Therefore, the stage stall was caused by the development of the diffuser stall, which transferred from the shroud side to the hub side in the vaneless space and expanded to the impeller passages.

  15. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    International Nuclear Information System (INIS)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-01-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.

  16. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    Science.gov (United States)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-12-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.

  17. The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

    2016-04-15

    We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

  18. Surface treatments for controlling corrosion rate of biodegradable Mg and Mg-based alloy implants

    International Nuclear Information System (INIS)

    Uddin, M S; Hall, Colin; Murphy, Peter

    2015-01-01

    Due to their excellent biodegradability characteristics, Mg and Mg-based alloys have become an emerging material in biomedical implants, notably for repair of bone as well as coronary arterial stents. However, the main problem with Mg-based alloys is their rapid corrosion in aggressive environments such as human bodily fluids. Previously, many approaches such as control of alloying materials, composition and surface treatments, have been attempted to regulate the corrosion rate. This article presents a comprehensive review of recent research focusing on surface treatment techniques utilised to control the corrosion rate and surface integrity of Mg-based alloys in both in vitro and in vivo environments. Surface treatments generally involve the controlled deposition of thin film coatings using various coating processes, and mechanical surfacing such as machining, deep rolling or low plasticity burnishing. The aim is to either make a protective thin layer of a material or to change the micro-structure and mechanical properties at the surface and sub-surface levels, which will prevent rapid corrosion and thus delay the degradation of the alloys. We have organised the review of past works on coatings by categorising the coatings into two classes—conversion and deposition coatings—while works on mechanical treatments are reviewed based on the tool-based processes which affect the sub-surface microstructure and mechanical properties of the material. Various types of coatings and their processing techniques under two classes of coating and mechanical treatment approaches have been analysed and discussed to investigate their impact on the corrosion performance, biomechanical integrity, biocompatibility and cell viability. Potential challenges and future directions in designing and developing the improved biodegradable Mg/Mg-based alloy implants were addressed and discussed. The literature reveals that no solutions are yet complete and hence new and innovative approaches

  19. Surface treatments for controlling corrosion rate of biodegradable Mg and Mg-based alloy implants

    Science.gov (United States)

    Uddin, M S; Hall, Colin; Murphy, Peter

    2015-01-01

    Due to their excellent biodegradability characteristics, Mg and Mg-based alloys have become an emerging material in biomedical implants, notably for repair of bone as well as coronary arterial stents. However, the main problem with Mg-based alloys is their rapid corrosion in aggressive environments such as human bodily fluids. Previously, many approaches such as control of alloying materials, composition and surface treatments, have been attempted to regulate the corrosion rate. This article presents a comprehensive review of recent research focusing on surface treatment techniques utilised to control the corrosion rate and surface integrity of Mg-based alloys in both in vitro and in vivo environments. Surface treatments generally involve the controlled deposition of thin film coatings using various coating processes, and mechanical surfacing such as machining, deep rolling or low plasticity burnishing. The aim is to either make a protective thin layer of a material or to change the micro-structure and mechanical properties at the surface and sub-surface levels, which will prevent rapid corrosion and thus delay the degradation of the alloys. We have organised the review of past works on coatings by categorising the coatings into two classes—conversion and deposition coatings—while works on mechanical treatments are reviewed based on the tool-based processes which affect the sub-surface microstructure and mechanical properties of the material. Various types of coatings and their processing techniques under two classes of coating and mechanical treatment approaches have been analysed and discussed to investigate their impact on the corrosion performance, biomechanical integrity, biocompatibility and cell viability. Potential challenges and future directions in designing and developing the improved biodegradable Mg/Mg-based alloy implants were addressed and discussed. The literature reveals that no solutions are yet complete and hence new and innovative approaches

  20. Mathematical modeling of synthesis gas fueled electrochemistry and transport including H2/CO co-oxidation and surface diffusion in solid oxide fuel cell

    Science.gov (United States)

    Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin

    2015-10-01

    Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.

  1. Radon and Thoron Exhalation Rates from Surface Soil of Bangka - Belitung Islands, Indonesia

    Directory of Open Access Journals (Sweden)

    Syarbaini Syarbaini

    2015-03-01

    Full Text Available DOI:10.17014/ijog.2.1.35-42Radon and thoron exhalation rate from soil is one of the most important factors that can influence the radioactivity level in the environment. Radon and thoron gases are produced by the decay of the radioactive elements those are radium and thorium in the soil, where its concentration depends on the soil conditions and the local geological background. In this paper, the results of radon and thoron exhalation rate measurements from surface soil of Bangka Belitung Islands at thirty six measurement sites are presented. Exhalation rates of radon and thoron were measured by using an accumulation chamber equipped with a solid-state alpha particle detector. Furthermore, the correlations between radon and thoron exhalation rates with their parent nuclide (226Ra and 232Th concentrations in collected soil samples from the same locations were also evaluated. The result of the measurement shows that mostly the distribution of radon and thoron is similar to 226Ra and 232Th, eventhough it was not a good correlation between radon and thoron exhalation rate with their parent activity concentrations (226Ra and 232Th due to the environmental factors that can influence the radon and thoron mobilities in the soil. In comparison to a world average, Bangka Belitung Islands have the 222Rn and 220Rn exhalation rates higher than the world average value for the regions with normal background radiation.

  2. Near-surface air temperature lapse rates in Xinjiang, northwestern China

    Science.gov (United States)

    Du, Mingxia; Zhang, Mingjun; Wang, Shengjie; Zhu, Xiaofan; Che, Yanjun

    2018-02-01

    Lapse rates of near-surface (2 m) air temperature are important parameters in hydrologic and climate simulations, especially for the mountainous areas without enough in-situ observations. In Xinjiang, northwestern China, the elevations range from higher than 7000 m to lower than sea level, but the existing long-term meteorological measurements are limited and distributed unevenly. To calculate lapse rates in Xinjiang, the daily data of near-surface air temperature ( T min, T ave, and T max) were measured by automatic weather stations from 2012 to 2014. All the in situ observation stations were gridded into a network of 1.5° (latitude) by 1.5° (longitude), and the spatial distribution and the daily, monthly, seasonal variations of lapse rates for T min, T ave, and T max in Xinjiang are analyzed. The Urumqi River Basin has been considered as a case to study the influence of elevation, aspect, and the wet and dry air conditions to the T min, T ave, and T max lapse rates. Results show that (1) the lapse rates for T min, T ave, and T max vary spatially during the observation period. The spatial diversity of T min lapse rates is larger than that of T ave, and that of T max is the smallest. For each season, T max lapse rates have more negative values than T ave lapse rates which are steeper than T min lapse rates. The weakest spatial diversity usually appears in July throughout a year. (2) The comparison for the three subregions (North, Middle, and South region) exhibits that lapse rates have similar day-to-day and month-to-month characteristics which present shallower values in winter months and steeper values in summer months. The T ave lapse rates in North region are shallower than those in Middle and South region, and the steepest T ave lapse rates of the three regions all appear in April. T min lapse rates are shallower than T max lapse rates. The maximum medians of T min and T max lapse rates for each grid in the three regions all appear in January, whereas the

  3. Diffusion and supply rates of /sup 10/Be and /sup 230/Th radioisotopes in two manganese encrustations from the South China Sea

    Energy Technology Data Exchange (ETDEWEB)

    Mangini, A; Segl, M; Kudrass, H

    1986-01-01

    Ages of two Mn encrustations estimated by their /sup 230/Th and /sup 10/Be distributions are compared with K-Ar ages and micropaleontological datings of their nuclei to discuss possible diffusion and supply effects of the radioisotope distribution and their influence on the reliability of age determinations. Based on comparable results obtained by the different methods the effective diffusion coefficient of /sup 10/Be can be calculated as D* <= 1.0 x 10/sup -8/ cm/sup 2//y. This coefficient is 3 to 8 times smaller than the best estimates available at present. In both nodules we observe lower /sup 10/Be concentrations in the uppermost 2 to 3 mm (1.3 m.y.), which suggests that /sup 10/Be uptake has been reduced since the middle Pleistocene. The 2.7-fold increase of the growth rate starting 3.2 m.y. ago coincides with the initiation of the northern hemisphere glaciation.

  4. Temperature dependent electron transport and rate coefficient studies for e-beam-sustained diffuse gas discharge switching

    International Nuclear Information System (INIS)

    Carter, J.G.; Hunter, S.R.; Christophorou, L.G.

    1987-01-01

    Measurements of the electron drift velocity, w, attachment coefficient, eta/N/sub a/, and ionization coefficient, α/N, have been made in C 2 F 6 /Ar and C 2 F 6 /CH 4 gas mixtures at gas temperatures, T, of 300 and 500 0 K over the concentration range of 0.1 to 100% of the C 2 F 6 . These measurements are useful for modeling the expected behavior of repetitively operated electron-beam sustained diffuse gas discharge opening switches where gas temperatures within the switch are anticipated to rise several hundred degrees during switch operation

  5. Road-surface properties affecting rates of energy dissipation from vehicles

    Energy Technology Data Exchange (ETDEWEB)

    Igwe, E.A. [Department of Civil Engineering, Rivers State University of Science and Technology, Port Harcourt, P.M.B 5080, Rivers State (Nigeria); Ayotamuno, M.J.; Okparanma, R.N. [Department of Agricultural and Environmental Engineering, Rivers State University of Science and Technology, Port Harcourt, P.M.B 5080, Rivers State (Nigeria); Ogaji, S.O.T.; Probert, S.D. [School of Engineering, Cranfield University, Bedfordshire Mk43 OAL (United Kingdom)

    2009-09-15

    The rates of energy that moving vehicles dissipate to road surfaces as well as noise emissions and their propensities for pitting (and hence their repair costs per year) all depend upon the structural properties of these surfaces. Thus, to increase the strength of bituminous concrete (i.e. a typical flexible road-surface) has been one of the major recent aims in highway engineering. The present study explored techniques that will increase these strength properties by modifying the material, using rubber latex, through rubberization and hence, improve the strength of the flexible trafficked surface when in contact with vehicles. At the optimal design asphalt (i.e. bitumen) content of 4.68%, the successive addition of various percentages of the rubber latex produced a design value of 1.65% rubber content, which increased the stability of the roadway from 1595 to 2639 N (i.e. an 65.5% increase) and the density from 2447 to 2520.8 kg/m{sup 3} (i.e. a 3.02% increase). This shows that the addition of rubber latex to bituminous concrete (a flexible road-surface) increased sustainability and the strength (in terms of stability and density). Similarly, the air voids and voids in the mineral aggregate (VMA) were reduced by introducing latex from 4.22% to 3.45% (i.e. a 17.06% reduction) and 16.25% to 13.43% (i.e. an 17.4% reduction), respectively. Whereas, the reduction in voidage volume added strength to the bituminous concrete by increasing its stability and density, the reduction in VMA had no positive impact on the strength properties of the flexible road-surface. (author)

  6. Oxygen tracer diffusion and surface exchange kinetics in Ba0.5Sr0.5Co0.8Fe0.2O3-δ

    NARCIS (Netherlands)

    Berenov, A.; Atkinson, A.; Kilner, J.; Ananyev, M.; Eremin, V.; Porotnikova, N.; Farlenkov, A.; Kurumchin, E.; Bouwmeester, Henricus J.M.; Bucher, E.; Sitte, W.

    2014-01-01

    The oxygen tracer diffusion coefficient, Db⁎, and the oxygen tracer surface exchange coefficient, k, were measured in Ba0.5Sr0.5Co0.8Fe0.2O3 − δ (BSCF5582) over the temperature range of 310–800 °C and the oxygen partial pressure range of 1.3 × 10−3–0.21 bar. Several measurement techniques were used:

  7. Effects of surface cracks and strain rate on the tensile behavior of Balmoral Red granite

    Directory of Open Access Journals (Sweden)

    Mardoukhi Ahmad

    2015-01-01

    Full Text Available This paper presents an experimental procedure for studying the effects of surface cracks on the mechanical behavior of Balmoral Red granite under dynamic and quasi-static loading. Three different thermal shocks were applied on the surface of the Brazilian Disc test samples by keeping a flame torch at a fixed distance from the sample surface for 10, 30, and 60 seconds. Microscopy clearly shows that the number of the surface cracks increases with the duration of the thermal shock. After the thermal shock, the Brazilian Disc tests were performed using a servohydraulic materials testing machine and a compression Split Hopkinson Pressure Bar (SHPB device. The results show that the tensile strength of the rock decreases and the rate sensitivity of the rock increases as more cracks are introduced to the structure. The DIC analysis of the Brazilian disc tests shows that the fracture of the sample initiates at the center of the samples or slightly closer to the incident bar contact point. This is followed by crushing of the samples at both contact points with the stress bars.

  8. Dosimetric perturbations of a lead shield for surface and interstitial high-dose-rate brachytherapy

    International Nuclear Information System (INIS)

    Candela-Juan, Cristian; Granero, Domingo; Vijande, Javier; Ballester, Facundo; Perez-Calatayud, Jose; Rivard, Mark J

    2014-01-01

    In surface and interstitial high-dose-rate brachytherapy with either 60 Co, 192 Ir, or 169 Yb sources, some radiosensitive organs near the surface may be exposed to high absorbed doses. This may be reduced by covering the implants with a lead shield on the body surface, which results in dosimetric perturbations. Monte Carlo simulations in Geant4 were performed for the three radionuclides placed at a single dwell position. Four different shield thicknesses (0, 3, 6, and 10 mm) and three different source depths (0, 5, and 10 mm) in water were considered, with the lead shield placed at the phantom surface. Backscatter dose enhancement and transmission data were obtained for the lead shields. Results were corrected to account for a realistic clinical case with multiple dwell positions. The range of the high backscatter dose enhancement in water is 3 mm for 60 Co and 1 mm for both 192 Ir and 169 Yb. Transmission data for 60 Co and 192 Ir are smaller than those reported by Papagiannis et al (2008 Med. Phys. 35 4898–4906) for brachytherapy facility shielding; for 169 Yb, the difference is negligible. In conclusion, the backscatter overdose produced by the lead shield can be avoided by just adding a few millimetres of bolus. Transmission data provided in this work as a function of lead thickness can be used to estimate healthy organ equivalent dose saving. Use of a lead shield is justified. (paper)

  9. Escaping the correction for body surface area when calculating glomerular filtration rate in children

    International Nuclear Information System (INIS)

    Piepsz, Amy; Tondeur, Marianne; Ham, Hamphrey

    2008-01-01

    51 Cr ethylene diamine tetraacetic acid ( 51 Cr EDTA) clearance is nowadays considered as an accurate and reproducible method for measuring glomerular filtration rate (GFR) in children. Normal values in function of age, corrected for body surface area, have been recently updated. However, much criticism has been expressed about the validity of body surface area correction. The aim of the present paper was to present the normal GFR values, not corrected for body surface area, with the associated percentile curves. For that purpose, the same patients as in the previous paper were selected, namely those with no recent urinary tract infection, having a normal left to right 99m Tc MAG3 uptake ratio and a normal kidney morphology on the early parenchymal images. A single blood sample method was used for 51 Cr EDTA clearance measurement. Clearance values, not corrected for body surface area, increased progressively up to the adolescence. The percentile curves were determined and allow, for a single patient, to estimate accurately the level of non-corrected clearance and the evolution with time, whatever the age. (orig.)

  10. Escaping the correction for body surface area when calculating glomerular filtration rate in children

    Energy Technology Data Exchange (ETDEWEB)

    Piepsz, Amy; Tondeur, Marianne [CHU St. Pierre, Department of Radioisotopes, Brussels (Belgium); Ham, Hamphrey [University Hospital Ghent, Department of Nuclear Medicine, Ghent (Belgium)

    2008-09-15

    {sup 51}Cr ethylene diamine tetraacetic acid ({sup 51}Cr EDTA) clearance is nowadays considered as an accurate and reproducible method for measuring glomerular filtration rate (GFR) in children. Normal values in function of age, corrected for body surface area, have been recently updated. However, much criticism has been expressed about the validity of body surface area correction. The aim of the present paper was to present the normal GFR values, not corrected for body surface area, with the associated percentile curves. For that purpose, the same patients as in the previous paper were selected, namely those with no recent urinary tract infection, having a normal left to right {sup 99m}Tc MAG3 uptake ratio and a normal kidney morphology on the early parenchymal images. A single blood sample method was used for {sup 51}Cr EDTA clearance measurement. Clearance values, not corrected for body surface area, increased progressively up to the adolescence. The percentile curves were determined and allow, for a single patient, to estimate accurately the level of non-corrected clearance and the evolution with time, whatever the age. (orig.)

  11. Magnetic field effects on coating deposition rate and surface morphology coatings using magnetron sputtering

    International Nuclear Information System (INIS)

    Yang, Yu-Sen; Huang, Wesley

    2010-01-01

    Chromium nitride coatings exhibit superior hardness, excellent wear and oxidation resistance, and are widely applied in the die and mold industries. The aim of this study was to investigate magnetic field effects on the deposition rate and surface morphology of chromium nitride coatings deposited by magnetron sputtering. Four types of magnetic field configurations, including the magnetron sputtering system, SNSN, SNNN, and intermediate magnetron modification, are discussed in this paper. SKD11 cold work die steel and a silicon (100) chip were used as substrates in the chromium nitride depositions. The process parameters, such as target current, substrate bias, and the distance between the substrate and target, are at fixed conditions, except for the magnetic arrangement type. The experimental results showed that the deposition rates of the four types of magnetic field configurations were 1.06, 1.38, 1.67 and 1.26 µm h −1 , respectively. In these cases, the SNNN type performs more than 58% faster than the unbalanced magnetron configuration does for the deposition rate. The surface morphology of chromium nitride films was also examined by SEM and is discussed in this paper

  12. Surface strain rate colour map of the Tatra Mountains region (Slovakia based on GNSS data

    Directory of Open Access Journals (Sweden)

    Bednárik Martin

    2016-12-01

    Full Text Available The surface deformation of the Tatra Mountains region in Western Carpathians can nowadays be studied directly thanks to precise geodetic measurements using the GNSS. The strain or stress tensor field is, however, a rather complex “data structure” difficult to present legibly and with sufficient resolution in the form of a classical map. A novel and promising approach to the solution of this problem is coding the three principal strain or stress values into the three colour channels (red, green, blue of an RGB colour. In our previous study, the colour depended on the stress tensor shape descriptors. In the current study, the adapted colouring scheme uses a subset of shape descriptors common to stress and strain, which differ only in the scaling factor. In this manner, we generate the colour map of the surface strain rate field, where the colour of each grid point carries the information about the shape of the strain rate tensor at that point. The resulting strain rate colour map can be displayed simultaneously with the map of the faults or elevations and be easily checked for the data or interpolation method errors and incompatibility with the geophysical and geological expectations.

  13. Diffusion Under Geometrical Constraint

    OpenAIRE

    Ogawa, Naohisa

    2014-01-01

    Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

  14. Substantiation of rate setting of surface contamination with amino acids, labelled with tritium

    International Nuclear Information System (INIS)

    Zhesko, T.V.

    1987-01-01

    For rate setting of surface contamination with the wide-spread biogenic tritium compounds-protein predecessors-experimental study of skin absorption and skin deposit of amino acids labelled with tritium is carried out on rats. While extrapolating data to people and calculating tolerable skin contamination with 3 H- amino acids, it is supposed that people arm skin, 100-500 cm 2 , has no defects and that the skin surface decontamination after radionuclide contact is carried out with a preparation, efficiency of which is not less than 97%. The value of tolerable skin absorption of tritium amino acids, being 110-550 MBq/year or 4.8 kBq/cm 2 per one working day, is calculated

  15. Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Amber; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)

    2015-10-07

    We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

  16. A multi-level surface rebalancing approach for efficient convergence acceleration of 3D full core multi-group fine grid nodal diffusion iterations

    International Nuclear Information System (INIS)

    Geemert, René van

    2014-01-01

    Highlights: • New type of multi-level rebalancing approach for nodal transport. • Generally improved and more mesh-independent convergence behavior. • Importance for intended regime of 3D pin-by-pin core computations. - Abstract: A new multi-level surface rebalancing (MLSR) approach has been developed, aimed at enabling an improved non-linear acceleration of nodal flux iteration convergence in 3D steady-state and transient reactor simulation. This development is meant specifically for anticipating computational needs for solving envisaged multi-group diffusion-like SP N calculations with enhanced mesh resolution (i.e. 3D multi-box up to 3D pin-by-pin grid). For the latter grid refinement regime, the previously available multi-level coarse mesh rebalancing (MLCMR) strategy has been observed to become increasingly inefficient with increasing 3D mesh resolution. Furthermore, for very fine 3D grids that feature a very fine axial mesh as well, non-convergence phenomena have been observed to emerge. In the verifications pursued up to now, these problems have been resolved by the new approach. The novelty arises from taking the interface current balance equations defined over all Cartesian box edges, instead of the nodal volume-integrated process-rate balance equation, as an appropriate restriction basis for setting up multi-level acceleration of fine grid interface current iterations. The new restriction strategy calls for the use of a newly derived set of adjoint spectral equations that are needed for computing a limited set of spectral response vectors per node. This enables a straightforward determination of group-condensed interface current spectral coupling operators that are of crucial relevance in the new rebalancing setup. Another novelty in the approach is a new variational method for computing the neutronic eigenvalue. Within this context, the latter is treated as a control parameter for driving another, newly defined and numerically more fundamental

  17. Coexistence and competition of surface diffusion and geometric shielding in the growth of 1D bismuth nanostructures and their ohmic contact

    International Nuclear Information System (INIS)

    Tian, Ye; Jiang, Lianjun; Zhang, Xuejun; Deng, Yangbao; Deng, Shuguang

    2014-01-01

    We study the physical-vapor-deposition of 1D bismuth nanostructures. Bi nanowire elongating along [012] and/or [110] direction as well as anisotropic Bi nano-columns are physical-vapor-deposited successfully. The coexistence and competition of surface diffusion and geometric shielding are critical to their formation as well as growth mode transition among them. Since physical-vapor-deposition is a vacuum process, we make use of it to fabricate the ohmic contact to prevent the damage to the bismuth nanostructures brought by the etching to their thick surface oxide layer. (paper)

  18. Evolution of Cell Size Homeostasis and Growth Rate Diversity during Initial Surface Colonization of Shewanella oneidensis.

    Science.gov (United States)

    Lee, Calvin K; Kim, Alexander J; Santos, Giancarlo S; Lai, Peter Y; Lee, Stella Y; Qiao, David F; Anda, Jaime De; Young, Thomas D; Chen, Yujie; Rowe, Annette R; Nealson, Kenneth H; Weiss, Paul S; Wong, Gerard C L

    2016-09-06

    Cell size control and homeostasis are fundamental features of bacterial metabolism. Recent work suggests that cells add a constant size between birth and division ("adder" model). However, it is not known how cell size homeostasis is influenced by the existence of heterogeneous microenvironments, such as those during biofilm formation. Shewanella oneidensis MR-1 can use diverse energy sources on a range of surfaces via extracellular electron transport (EET), which can impact growth, metabolism, and size diversity. Here, we track bacterial surface communities at single-cell resolution to show that not only do bacterial motility appendages influence the transition from two- to three-dimensional biofilm growth and control postdivisional cell fates, they strongly impact cell size homeostasis. For every generation, we find that the average growth rate for cells that stay on the surface and continue to divide (nondetaching population) and that for cells that detach before their next division (detaching population) are roughly constant. However, the growth rate distribution is narrow for the nondetaching population, but broad for the detaching population in each generation. Interestingly, the appendage deletion mutants (ΔpilA, ΔmshA-D, Δflg) have significantly broader growth rate distributions than that of the wild type for both detaching and nondetaching populations, which suggests that Shewanella appendages are important for sensing and integrating environmental inputs that contribute to size homeostasis. Moreover, our results suggest multiplexing of appendages for sensing and motility functions contributes to cell size dysregulation. These results can potentially provide a framework for generating metabolic diversity in S. oneidensis populations to optimize EET in heterogeneous environments.

  19. Collisional Dissociation of CO: ab initio Potential Energy Surfaces and Quasiclassical Trajectory Rate Coefficients

    Science.gov (United States)

    Schwenke, David W.; Jaffe, Richard L.; Chaban, Galina M.

    2016-01-01

    We have generated accurate global potential energy surfaces for CO+Ar and CO+O that correlate with atom-diatom pairs in their ground electronic states based on extensive ab initio electronic structure calculations and used these potentials in quasi-classical trajectory nuclear dynamics calculations to predict the thermal dissociation rate coefficients over 5000- 35000 K. Our results are not compatible with the 20-45 year old experimental results. For CO + Ar we obtain fairly good agreement with the experimental rate coefficients of Appleton et al. (1970) and Mick and Roth (1993), but our computed rate coefficients exhibit a stronger temperature dependence. For CO + O our dissociation rate coefficient is in close agreement with the value from the Park model, which is an empirical adjustment of older experimental results. However, we find the rate coefficient for CO + O is only 1.5 to 3.3 times larger than CO + Ar over the temperature range of the shock tube experiments (8000-15,000 K). The previously accepted value for this rate coefficient ratio is 15, independent of temperature. We also computed the rate coefficient for the CO + O ex- change reaction which forms C + O2. We find this reaction is much faster than previously believed and is the dominant process in the removal of CO at temperatures up to 16,000 K. As a result, the dissociation of CO is accomplished in two steps (react to form C+O2 and then O2 dissociates) that are endothermic by 6.1 and 5.1 eV, instead of one step that requires 11.2 eV to break the CO bond.

  20. Annual absorbed dose rate at the surface of 38 hot and mineral springs in Iran

    Energy Technology Data Exchange (ETDEWEB)

    Bahreyni Toosi, M.; Orougi, M.H.; Sadeghzadeh, A.; Aghamir, A.; Jomehzadeh, A.; Zare, H. [Mashhad Univ. of Medical Sciences, Medical Physics Dep., Faculty of Medicine (Iran, Islamic Republic of)

    2006-07-01

    Full text of publication follows: Measurement of background radiation is very important from different points of view especially to human health. In some cases exposure rate near hot and mineral springs are higher than those of normal areas. The high background radiation of hot and mineral springs is primarily due to the presence of very high amounts of Ra 226 and its decay products. In this research, environmental gamma radiation of hot and mineral springs in Khorasan, Mazandaran and Sareeyn town in Ardabil province have been measured. Equipment used in this work included: a survey meter (R.D.S. -110), a tripod and an aluminium frame to hold the survey meter horizontally.R.D.S. -110 is a microprocessor controlled detector. This survey meter has been designed for monitoring X and rays and radiation. Measurements were carried out at one meter above water level in the vicinity of hot and mineral springs. Dose rates were recorded for one hour. The average of all recorded dose rates over one hour period was taken as the exposure rate for each station. The results indicate that in Khorasan province the highest and lowest annual absorbed dose rates were equal to 10.80 mSv/y at Shanigarmab and 0.52 mSv/y at Nasradin source respectively. In Mazandaran province maximum and minimum exposure rates equal to 54.4 and 0.53 mSv/y were obtained at the surface of Talleshmahalleh and Ghormerz sources. Exposure rates at the vicinity of Sarein sources were not very different and ranged from 1.39 to 1.59 mSv/y. The results indicate that in Khorasan province Shahingarmab hot spring has the highest annual absorbed dose rate (10.80 mSv/y) and Nasraddin in Sarbisheh has the lowest level of radiation (0.62 mSv/y). In Mazandaran province Taleshmahalleh hot mineral spring has the highest annual absorbed dose rate (54.41 mSv/y) and Ghormerz mineral spring has the lowest radiation level (0.53 mSv/y). Also in Sareeyn (in Ardabil province) Abechashm source has the highest annual absorbed dose

  1. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

    International Nuclear Information System (INIS)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-01-01

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

  2. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

    Science.gov (United States)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-09-29

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

  3. Enhanced Sensitivity of Surface Acoustic Wave-Based Rate Sensors Incorporating Metallic Dot Arrays

    Directory of Open Access Journals (Sweden)

    Wen Wang

    2014-02-01

    Full Text Available A new surface acoustic wave (SAW-based rate sensor pattern incorporating metallic dot arrays was developed in this paper. Two parallel SAW delay lines with a reverse direction and an operation frequency of 80 MHz on a same X-112°Y LiTaO3 wafer are fabricated as the feedback of two SAW oscillators, and mixed oscillation frequency was used to characterize the external rotation. To enhance the Coriolis force effect acting on the SAW propagation, a copper (Cu dot array was deposited along the SAW propagation path of the SAW devices. The approach of partial-wave analysis in layered media was referred to analyze the response mechanisms of the SAW based rate sensor, resulting in determination of the optimal design parameters. To improve the frequency stability of the oscillator, the single phase unidirectional transducers (SPUDTs and combed transducer were used to form the SAW device to minimize the insertion loss and accomplish the single mode selection, respectively. Excellent long-term (measured in hours frequency stability of 0.1 ppm/h was obtained. Using the rate table with high precision, the performance of the developed SAW rate sensor was evaluated experimentally; satisfactory detection sensitivity (16.7 Hz∙deg∙s−1 and good linearity were observed.

  4. Seismic potential of weak, near-surface faults revealed at plate tectonic slip rates.

    Science.gov (United States)

    Ikari, Matt J; Kopf, Achim J

    2017-11-01

    The near-surface areas of major faults commonly contain weak, phyllosilicate minerals, which, based on laboratory friction measurements, are assumed to creep stably. However, it is now known that shallow faults can experience tens of meters of earthquake slip and also host slow and transient slip events. Laboratory experiments are generally performed at least two orders of magnitude faster than plate tectonic speeds, which are the natural driving conditions for major faults; the absence of experimental data for natural driving rates represents a critical knowledge gap. We use laboratory friction experiments on natural fault zone samples at driving rates of centimeters per year to demonstrate that there is abundant evidence of unstable slip behavior that was not previously predicted. Specifically, weak clay-rich fault samples generate slow slip events (SSEs) and have frictional properties favorable for earthquake rupture. Our work explains growing field observations of shallow SSE and surface-breaking earthquake slip, and predicts that such phenomena should be more widely expected.

  5. Effect of reacting surface density on the overall graphite oxidation rate

    International Nuclear Information System (INIS)

    Oh, Chang; Kim, Eung; Lim, Jong; Schultz, Richard; Petti, David

    2009-01-01

    Graphite oxidation in an air-ingress accident is presently a very important issue for the reactor safety of the very high temperature gas cooled-reactor (VHTR), the concept of the next generation nuclear plant (NGNP) because of its potential problems such as mechanical degradation of the supporting graphite in the lower plenum of the VHTR might lead to core collapse if the countermeasure is taken carefully. The oxidation process of graphite has known to be affected by various factors, including temperature, pressure, oxygen concentration, types of graphite, graphite shape and size, flow distribution, etc. However, our recent study reveals that the internal pore characteristics play very important roles in the overall graphite oxidation rate. One of the main issues regarding graphite oxidation is the potential core collapse problem that may occur following the degradation of graphite mechanical strength. In analyzing this phenomenon, it is very important to understand the relationship between the degree of oxidization and strength degradation. In addition, the change of oxidation rate by graphite oxidation degree characterization by burn-off (ratio of the oxidized graphite density to the original density) should be quantified because graphite strength degradation is followed by graphite density decrease, which highly affects oxidation rates and patterns. Because the density change is proportional to the internal pore surface area, they should be quantified in advance. In order to understand the above issues, the following experiments were performed: (1) Experiment on the fracture of the oxidized graphite and validation of the previous correlations, (2) Experiment on the change of oxidation rate using graphite density and data collection, (3) Measure the BET surface area of the graphite. The experiments were performed using H451 (Great Lakes Carbon Corporation) and IG-110 (Toyo Tanso Co., Ltd) graphite. The reason for the use of those graphite materials is because

  6. Surface Passivation of MoO3 Nanorods by Atomic Layer Deposition Towards High Rate Durable Li Ion Battery Anodes

    KAUST Repository

    Ahmed, Bilal

    2015-06-03

    We demonstrate an effective strategy to overcome the degradation of MoO3 nanorod anodes in Lithium (Li) ion batteries at high rate cycling. This is achieved by conformal nanoscale surface passivation of the MoO3 nanorods by HfO2 using atomic layer deposition (ALD). At high current density such as 1500 mA/g, the specific capacity of HfO2 coated MoO3 electrodes is 68% higher than bare MoO3 electrodes after 50 charge/discharge cycles. After 50 charge/discharge cycles, HfO2 coated MoO3 electrodes exhibited specific capacity of 657 mAh/g, on the other hand, bare MoO3 showed only 460 mAh/g. Furthermore, we observed that HfO2 coated MoO3 electrodes tend to stabilize faster than bare MoO3 electrodes because nanoscale HfO2 layer prevents structural degradation of MoO3 nanorods. Additionally, the growth temperature of MoO3 nanorods and the effect of HfO2 layer thickness was studied and found to be important parameters for optimum battery performance. The growth temperature defines the microstructural features and HfO2 layer thickness defines the diffusion coefficient of Li–ions through the passivation layer to the active material. Furthermore, ex–situ HRTEM, X–ray photoelectron spectroscopy (XPS), Raman spectroscopy and X–ray diffraction was carried out to explain the capacity retention mechanism after HfO2 coating.

  7. Surface Passivation of MoO3 Nanorods by Atomic Layer Deposition Towards High Rate Durable Li Ion Battery Anodes

    KAUST Repository

    Ahmed, Bilal; Shahid, Muhammad; Nagaraju, Doddahalli H.; Anjum, Dalaver H.; Hedhili, Mohamed N.; Alshareef, Husam N.

    2015-01-01

    We demonstrate an effective strategy to overcome the degradation of MoO3 nanorod anodes in Lithium (Li) ion batteries at high rate cycling. This is achieved by conformal nanoscale surface passivation of the MoO3 nanorods by HfO2 using atomic layer deposition (ALD). At high current density such as 1500 mA/g, the specific capacity of HfO2 coated MoO3 electrodes is 68% higher than bare MoO3 electrodes after 50 charge/discharge cycles. After 50 charge/discharge cycles, HfO2 coated MoO3 electrodes exhibited specific capacity of 657 mAh/g, on the other hand, bare MoO3 showed only 460 mAh/g. Furthermore, we observed that HfO2 coated MoO3 electrodes tend to stabilize faster than bare MoO3 electrodes because nanoscale HfO2 layer prevents structural degradation of MoO3 nanorods. Additionally, the growth temperature of MoO3 nanorods and the effect of HfO2 layer thickness was studied and found to be important parameters for optimum battery performance. The growth temperature defines the microstructural features and HfO2 layer thickness defines the diffusion coefficient of Li–ions through the passivation layer to the active material. Furthermore, ex–situ HRTEM, X–ray photoelectron spectroscopy (XPS), Raman spectroscopy and X–ray diffraction was carried out to explain the capacity retention mechanism after HfO2 coating.

  8. Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

    Science.gov (United States)

    Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

    2017-11-01

    Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

  9. Morphometric partitioning of the respiratory surface area and diffusion capacity of the gills and swim bladder in juvenile Amazonian air-breathing fish, Arapaima gigas.

    Science.gov (United States)

    Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin

    2012-09-01

    The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Effective diffusion volume flow rates (Qe) for urea, creatinine, and inorganic phosphorous (Qeu, Qecr, QeiP) during hemodialysis.

    Science.gov (United States)

    Gotch, Frank A; Panlilio, Froilan; Sergeyeva, Olga; Rosales, Laura; Folden, Tom; Kaysen, George; Levin, Nathan

    2003-01-01

    In vivo solute clearances can be estimated from dialyzer blood (Qb) and dialysate (Qd) flow rates and a solute- and dialyzer-specific overall permeability membrane area product (KoA). However, these calculations require knowledge of the flow rate of the effective solute distribution volume in the flowing bloodstream (Qe) in order to calculate in vivo clearances and KoAs. We have determined Qe for urea, creatinine, and inorganic phosphorus from changes in concentrations across the blood compartment and mass balance between the blood and dialysate streams. We made four serial measurements over one dialysis in 23 patients and found that Qeu equals the total blood water flow rate, Qecr equals the plasma water flow rate plus 61% of red cell water flow rate, and QeiP is limited to the plasma water flow rate. Equations are derived to calculate Qe for each of these solutes from Qb and hematocrit and in vivo KoAs for each solute were calculated.

  11. Shaping optimal zinc coating on the surface of high-quality ductile iron casting. Part II – Technological formula and value of diffusion coefficient

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2017-03-01

    Full Text Available The completed research presented in the first part of the article has allowed linking the manufacturing technology of ductile iron castings with the process of hot dip galvanizing. On the basis of these data simulations were carried out to examine the behaviour of zinc diffusion coefficient D in the galvanized coating. The adopted model of zinc coating growth helped to explain the cases of excessive growth of the intermetallic phases in this type of coating. The paper analyzes covered the relationship between the roughness and phase composition of the top layer of product and the thickness and kinetics of zinc coating growth referred to individual sub-layers of the intermetallic phases.Roughness and phase composition in the surface layer of product were next related to the diffusion coefficient D examined in respective sublayers of the intermetallic phases.

  12. Self-diffusion on (100), (110), and (111) surfaces of Ni and Cu: A detailed study of prefactors and activation energies

    International Nuclear Information System (INIS)

    Ku'rpick, Ulrike

    2001-01-01

    We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values

  13. The change of longitudinal relaxation rate in oxygen enhanced pulmonary MRI depends on age and BMI but not diffusing capacity of carbon monoxide in healthy never-smokers.

    Directory of Open Access Journals (Sweden)

    Simon Sven Ivan Kindvall

    Full Text Available Oxygen enhanced pulmonary MRI is a promising modality for functional lung studies and has been applied to a wide range of pulmonary conditions. The purpose of this study was to characterize the oxygen enhancement effect in the lungs of healthy, never-smokers, in light of a previously established relationship between oxygen enhancement and diffusing capacity of carbon monoxide in the lung (DL,CO in patients with lung disease.In 30 healthy never-smoking volunteers, an inversion recovery with gradient echo read-out (Snapshot-FLASH was used to quantify the difference in longitudinal relaxation rate, while breathing air and 100% oxygen, ΔR1, at 1.5 Tesla. Measurements were performed under multiple tidal inspiration breath-holds.In single parameter linear models, ΔR1 exhibit a significant correlation with age (p = 0.003 and BMI (p = 0.0004, but not DL,CO (p = 0.33. Stepwise linear regression of ΔR1 yields an optimized model including an age-BMI interaction term.In this healthy, never-smoking cohort, age and BMI are both predictors of the change in MRI longitudinal relaxation rate when breathing oxygen. However, DL,CO does not show a significant correlation with the oxygen enhancement. This is possibly because oxygen transfer in the lung is not diffusion limited at rest in healthy individuals. This work stresses the importance of using a physiological model to understand results from oxygen enhanced MRI.

  14. Surface sealing using self-assembled monolayers and its effect on metal diffusion in porous low-k dielectrics studied using monoenergetic positron beams

    International Nuclear Information System (INIS)

    Uedono, Akira; Armini, Silvia; Zhang, Yu; Kakizaki, Takeaki; Krause-Rehberg, Reinhard; Anwand, Wolfgang; Wagner, Andreas

    2016-01-01

    Graphical abstract: - Highlights: • Pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the low-k film. • For the sample without the SAM sealing process, metal atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. Almost all pore interiors were covered by those metals. • For the sample damaged by a plasma etch treatment before the SAM sealing process, self-assembled molecules diffused into the OSG film, and they were preferentially trapped by larger pores. - Abstract: Surface sealing effects on the diffusion of metal atoms in porous organosilicate glass (OSG) films were studied by monoenergetic positron beams. For a Cu(5 nm)/MnN(3 nm)/OSG(130 nm) sample fabricated with pore stuffing, C_4F_8 plasma etch, unstuffing, and a self-assembled monolayer (SAM) sealing process, it was found that pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the OSG film. For the sample without the SAM sealing process, metal (Cu and Mn) atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. As a result, almost all pore interiors were covered with those metals. For the sample damaged by an Ar/C_4F_8 plasma etch treatment before the SAM sealing process, SAMs diffused into the OSG film, and they were preferentially trapped by larger pores. The cubic pore side length in these pores containing self-assembled molecules was estimated to be 0.7 nm. Through this work, we have demonstrated that monoenergetic positron beams are a powerful tool for characterizing capped porous films and the trapping of atoms and molecules by pores.

  15. Selectivity control of photosensitive structures based on gallium arsenide phosphide solid solutions by changing the rate of surface recombination

    International Nuclear Information System (INIS)

    Tarasov, S A; Andreev, M Y; Lamkin, I A; Solomonov, A V

    2016-01-01

    In this paper, we demonstrate the effect of surface recombination on spectral sensitivity of structures based on gallium arsenide phosphide solid solutions. Simulation of the effect for structures based on a p-n junction and a Schottky barrier was carried out. Photodetectors with different rates of surface recombination were fabricated by using different methods of preliminary treatment of the semiconductor surface. We experimentally demonstrated the possibility to control photodetector selectivity by altering the rate of surface recombination. The full width at half maximum was reduced by almost 4 times, while a relatively small decrease in sensitivity at the maximum was observed. (paper)

  16. Impact of the structural anisotropy of La{sub 2}NiO{sub 4+δ} on on high temperature surface modifications and diffusion of oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Gauquelin, Nicolas

    2010-11-29

    La{sub 2}NiO{sub 4+δ} was first studied due to its structural similarities with the High Temperature superconductor La{sub 2}NiO{sub 4+δ} and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K{sub 2}NiF{sub 4} layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La{sub 2}NiO{sub 4+δ} were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new {sup 18}O-{sup 18}O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  17. Impact of the structural anisotropy of La2NiO4+δ on on high temperature surface modifications and diffusion of oxygen

    International Nuclear Information System (INIS)

    Gauquelin, Nicolas

    2010-01-01

    La 2 NiO 4+δ was first studied due to its structural similarities with the High Temperature superconductor La 2 NiO 4+δ and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K 2 NiF 4 layered structure and accom