WorldWideScience

Sample records for surface diffusion rates

  1. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  2. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  3. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  4. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  5. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  6. Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

    Science.gov (United States)

    Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

    2015-01-01

    The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

  7. Diffusion rates for elevated releases

    International Nuclear Information System (INIS)

    Ramsdell, J.V.

    1983-11-01

    A search of the literature related to diffusion from elevated sources has determined that an adequate data base exists for use in developing parameterizations for estimating diffusion rates for material released from free standing stacks at nuclear power plants. A review of published data analyses indicates that a new parameterization of horizontal diffusion rates specifically for elevated releases is not likely to significantly change the magnitudes of horizontal diffusion coefficients on the average. However, the uncertainties associated with horizontal diffusion coefficient estimates under any given set of atmospheric conditions could be reduced by a new parameterization. Similarly, a new parameterization of vertical diffusion rates would be unlikely to significantly alter the magnitudes of diffusion coefficients for unstable atmospheric conditons. However, for neutral and stable atmospheric conditions, a new parameterization of vertical diffusion rates might increase vertical diffusion coefficients significantly. The increase would move ground-level time-integrated concentration maxima closer to the plant and would increase the maxima. 55 references, 2 figures, 4 tables

  8. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  9. Evaporation rates and surface profiles on heterogeneous surfaces with mass transfer and surface reaction

    Energy Technology Data Exchange (ETDEWEB)

    Flytzani-Stephanopoulos, M; Schmidt, L D

    1979-01-01

    Simple models incorporating surface reaction and diffusion of volatile products through a boundary layer are developed to calculate effective rates of evaporation and local surface profiles on surfaces having active and inactive regions. The coupling between surface heterogeneities with respect to a particular reaction and external mass transfer may provide a mechanism for the surface rearrangement and metal loss encountered in several catalytic systems of practical interest. Calculated transport rates for the volatilization of platinum in oxidizing environments and the rearrangement of this metal during the ammonia oxidation reaction agree well with published experimental data.

  10. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  11. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  12. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  13. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  14. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  15. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  16. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  17. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  18. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  19. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  20. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  1. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  2. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  3. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  4. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  5. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  6. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  7. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  8. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  9. Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

    International Nuclear Information System (INIS)

    Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

    1976-01-01

    Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

  10. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  11. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  12. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  13. Flow, diffusion, and rate processes

    International Nuclear Information System (INIS)

    Sieniutycz, S.; Salamon, P.

    1992-01-01

    This volume contains recent results obtained for the nonequilibrium thermodynamics of transport and rate processes are reviewed. Kinetic equations, conservation laws, and transport coefficients are obtained for multicomponent mixtures. Thermodynamic principles are used in the design of experiments predicting heat and mass transport coefficients. Highly nonstationary conditions are analyzed in the context of transient heat transfer, nonlocal diffusion in stress fields and thermohydrodynamic oscillatory instabilities. Unification of the dynamics of chemical systems with other sorts of processes (e.g. mechanical) is given. Thermodynamics of reacting surfaces is developed. Admissible reaction paths are studied and a consistency of chemical kinetics with thermodynamics is shown. Oscillatory reactions are analyzed in a unifying approach showing explosive, conservation or damped behavior. A comprehensive review of transport processes in electrolytes and membranes is given. Applications of thermodynamics to thermoelectric systems and ionized gas (plasma) systems are reviewed

  14. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  15. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  16. A first-passage scheme for determination of overall rate constants for non-diffusion-limited suspensions

    Science.gov (United States)

    Lu, Shih-Yuan; Yen, Yi-Ming

    2002-02-01

    A first-passage scheme is devised to determine the overall rate constant of suspensions under the non-diffusion-limited condition. The original first-passage scheme developed for diffusion-limited processes is modified to account for the finite incorporation rate at the inclusion surface by using a concept of the nonzero survival probability of the diffusing entity at entity-inclusion encounters. This nonzero survival probability is obtained from solving a relevant boundary value problem. The new first-passage scheme is validated by an excellent agreement between overall rate constant results from the present development and from an accurate boundary collocation calculation for the three common spherical arrays [J. Chem. Phys. 109, 4985 (1998)], namely simple cubic, body-centered cubic, and face-centered cubic arrays, for a wide range of P and f. Here, P is a dimensionless quantity characterizing the relative rate of diffusion versus surface incorporation, and f is the volume fraction of the inclusion. The scheme is further applied to random spherical suspensions and to investigate the effect of inclusion coagulation on overall rate constants. It is found that randomness in inclusion arrangement tends to lower the overall rate constant for f up to the near close-packing value of the regular arrays because of the inclusion screening effect. This screening effect turns stronger for regular arrays when f is near and above the close-packing value of the regular arrays, and consequently the overall rate constant of the random array exceeds that of the regular array. Inclusion coagulation too induces the inclusion screening effect, and leads to lower overall rate constants.

  17. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  18. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  19. Rate Theory for Correlated Processes: Double Jumps in Adatom Diffusion

    DEFF Research Database (Denmark)

    Jacobsen, J.; Jacobsen, Karsten Wedel; Sethna, J.

    1997-01-01

    We study the rate of activated motion over multiple barriers, in particular the correlated double jump of an adatom diffusing on a missing-row reconstructed platinum (110) surface. We develop a transition path theory, showing that the activation energy is given by the minimum-energy trajectory...... which succeeds in the double jump. We explicitly calculate this trajectory within an effective-medium molecular dynamics simulation. A cusp in the acceptance region leads to a root T prefactor for the activated rate of double jumps. Theory and numerical results agree....

  20. Diffusion-controlled reaction. V. Effect of concentration-dependent diffusion coefficient on reaction rate in graft polymerization

    International Nuclear Information System (INIS)

    Imre, K.; Odian, G.

    1979-01-01

    The effect of diffusion on radiation-initiated graft polymerization has been studied with emphasis on the single- and two-penetrant cases. When the physical properties of the penetrants are similar, the two-penetrant problems can be reduced to the single-penetrant problem by redefining the characteristic parameters of the system. The diffusion-free graft polymerization rate is assumed to be proportional to the upsilon power of the monomer concentration respectively, and, in which the proportionality constant a = k/sub p/R/sub i//sup w//k/sub t//sup z/, where k/sub p/ and k/sub t/ are the propagation and termination rate constants, respectively, and R/sub i/ is the initiation rate. The values of upsilon, w, and z depend on the particular reaction system. The results of earlier work were generalized by allowing a non-Fickian diffusion rate which predicts an essentially exponential dependence on the monomer concentration of the diffusion coefficient, D = D 0 [exp(deltaC/M)], where M is the saturation concentration. A reaction system is characterized by the three dimensionless parameters, upsilon, delta, and A = (L/2)[aM/sup (upsilon--1)//D 0 ]/sup 1/2/, where L is the polymer film thickness. Graft polymerization tends to become diffusion controlled as A increases. Larger values of delta and ν cause a reaction system to behave closer to the diffusion-free regime. Transition from diffusion-free to diffusion-controlled reaction involves changes in the dependence of the reaction rate on film thickness, initiation rate, and monomer concentration. Although the diffusion-free rate is w order in initiation rate, upsilon order in monomer, and independent of film thickness, the diffusion-controlled rate is w/2 order in initiator rate and inverse first-order in film thickness. Dependence of the diffusion-controlled rate on monomer is dependent in a complex manner on the diffusional characteristics of the reaction system. 11 figures, 4 tables

  1. Visualization and quantification of heterogeneous diffusion rates in granodiorite samples by X-ray absorption imaging. Diffusion within gouge materials, altered rim and intact rock matrix

    Energy Technology Data Exchange (ETDEWEB)

    Altman, S.J.; Tidwell, V.C. [Sandia National Laboratories, Albuquerque, NM (United States); Uchida, M. [Japan Nuclear Cycle Development Inst., Ibaraki (Japan)

    2001-08-01

    Matrix diffusion is one of the most important contaminant migration retardation processes in crystalline rocks. Performance assessment calculations in various countries assume that only the area of the fracture surface where advection is active provides access to the rock matrix. However, accessibility to the matrix could be significantly enhanced with diffusion into stagnant zones, fracture fillings, and through an alteration rim in the matrix. Laboratory visualization experiments were conducted on granodiorite samples to investigate and quantify diffusion rates within different zones of a Cretaceous granodiorite. Samples were collected from the Kamaishi experimental site in the northern part of the main island of Japan. Diffusion of iodine out of the sample is visualized and rates are measured using x-ray absorption imaging. X-ray images allow for measurements of relative iodine concentration and relative iodine mass as a function of time and two-dimensional space at a sub-millimeter spatial resolution. In addition, two-dimensional heterogeneous porosity fields (at the same resolution as the relative concentration fields) are measured. This imaging technique allows for a greater understanding of the spatial variability of diffusion rates than can be accomplished with standard bulk measurements. It was found that diffusion rates were fastest in partially gouge-filled fractures. Diffusion rates in the recrystallized calcite-based fracture-filling material were up to an order of magnitude lower than in gouge-filled fractures. Diffusion in altered matrix around the fractures was over an order of magnitude lower than that in the gouge-filled fractures. Healed fractures did not appear to have different diffusion rates than the unaltered matrix.

  2. Visualization and quantification of heterogeneous diffusion rates in granodiorite samples by X-ray absorption imaging. Diffusion within gouge materials, altered rim and intact rock matrix

    International Nuclear Information System (INIS)

    Altman, S.J.; Tidwell, V.C.; Uchida, M.

    2001-01-01

    Matrix diffusion is one of the most important contaminant migration retardation processes in crystalline rocks. Performance assessment calculations in various countries assume that only the area of the fracture surface where advection is active provides access to the rock matrix. However, accessibility to the matrix could be significantly enhanced with diffusion into stagnant zones, fracture fillings, and through an alteration rim in the matrix. Laboratory visualization experiments were conducted on granodiorite samples to investigate and quantify diffusion rates within different zones of a Cretaceous granodiorite. Samples were collected from the Kamaishi experimental site in the northern part of the main island of Japan. Diffusion of iodine out of the sample is visualized and rates are measured using x-ray absorption imaging. X-ray images allow for measurements of relative iodine concentration and relative iodine mass as a function of time and two-dimensional space at a sub-millimeter spatial resolution. In addition, two-dimensional heterogeneous porosity fields (at the same resolution as the relative concentration fields) are measured. This imaging technique allows for a greater understanding of the spatial variability of diffusion rates than can be accomplished with standard bulk measurements. It was found that diffusion rates were fastest in partially gouge-filled fractures. Diffusion rates in the recrystallized calcite-based fracture-filling material were up to an order of magnitude lower than in gouge-filled fractures. Diffusion in altered matrix around the fractures was over an order of magnitude lower than that in the gouge-filled fractures. Healed fractures did not appear to have different diffusion rates than the unaltered matrix

  3. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  4. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  5. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  6. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  7. Effective reaction rates in diffusion-limited phosphorylation-dephosphorylation cycles

    Science.gov (United States)

    Szymańska, Paulina; Kochańczyk, Marek; Miekisz, Jacek; Lipniacki, Tomasz

    2015-02-01

    We investigate the kinetics of the ubiquitous phosphorylation-dephosphorylation cycle on biological membranes by means of kinetic Monte Carlo simulations on the triangular lattice. We establish the dependence of effective macroscopic reaction rate coefficients as well as the steady-state phosphorylated substrate fraction on the diffusion coefficient and concentrations of opposing enzymes: kinases and phosphatases. In the limits of zero and infinite diffusion, the numerical results agree with analytical predictions; these two limits give the lower and the upper bound for the macroscopic rate coefficients, respectively. In the zero-diffusion limit, which is important in the analysis of dense systems, phosphorylation and dephosphorylation reactions can convert only these substrates which remain in contact with opposing enzymes. In the most studied regime of nonzero but small diffusion, a contribution linearly proportional to the diffusion coefficient appears in the reaction rate. In this regime, the presence of opposing enzymes creates inhomogeneities in the (de)phosphorylated substrate distributions: The spatial correlation function shows that enzymes are surrounded by clouds of converted substrates. This effect becomes important at low enzyme concentrations, substantially lowering effective reaction rates. Effective reaction rates decrease with decreasing diffusion and this dependence is more pronounced for the less-abundant enzyme. Consequently, the steady-state fraction of phosphorylated substrates can increase or decrease with diffusion, depending on relative concentrations of both enzymes. Additionally, steady states are controlled by molecular crowders which, mostly by lowering the effective diffusion of reactants, favor the more abundant enzyme.

  8. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  9. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  10. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  11. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  12. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  13. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  14. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  15. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  16. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  17. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  18. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  19. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  20. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  1. Rate of riboflavin diffusion from intrastromal channels before corneal crosslinking.

    Science.gov (United States)

    McQuaid, Rebecca; Mrochen, Michael; Vohnsen, Brian

    2016-03-01

    To determine the diffusion of riboflavin from intrastromal channels through the effective diffusion coefficients compared with traditional axial diffusion with epithelium on or off. Advanced Optical Imaging Laboratory, University College Dublin, and Wellington Eye Clinic, Sandyford, Dublin, Ireland. Experimental study. The rate of diffusion in whole-mounted porcine eyes was monitored for a 30 minutes using an optical setup with a charge-coupled device camera and a bandpass filter (central wavelength 550 nm and 40 nm bandpass) to image the fluorescence under ultraviolet illumination (365 nm wavelength). For comparison, an isotropic corneal stroma with an annular channel was modeled numerically for different diffusion constants and boundary conditions. Numerical and experimental results were compared, allowing determination of the effective diffusion coefficient for each case. Experimental results for 6 different riboflavin solutions were in all cases found to be higher than for the common crosslinking (CXL) riboflavin protocol, where the diffusion constant is D0 = 6.5 × 10(-5) mm(2)/sec. For the intrastromal channel, 2 isotonic solutions containing riboflavin 0.1% correlated with a diffusion constant of 5D0 = 32.5 × 10(-5) mm(2)/sec. Hypotonic solutions and transepithelium had a higher diffusion coefficient approaching 10D0 = 65.0 × 10(-5) mm(2)/sec, which is an order-of-magnitude increase compared with the typical diffusion coefficient found in standard CXL. In this study, riboflavin had a faster stromal diffusion when injected into a corneal channel than when applied as drops to the anterior corneal surface. Further numerical modeling might allow optimization of the channel structure for any specific choice of riboflavin. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  2. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  3. Electro-oxidation of methanol diffused through proton exchange membrane on Pt surface: crossover rate of methanol

    International Nuclear Information System (INIS)

    Jung, Inhwa; Kim, Doyeon; Yun, Yongsik; Chung, Suengyoung; Lee, Jaeyoung; Tak, Yongsug

    2004-01-01

    Methanol crossover rate through proton exchange membrane (Nafion 117) was investigated with a newly designed electrochemical stripping cell. Nanosize Pt electrode was prepared by the electroless deposition. Distinct electrocatalytic oxidation behaviors of methanol inside membrane were similar to the methanol oxidation in aqueous electrolyte, except adsorption/desorption of hydrogen. The amount of methanol diffused through membrane was calculated from the charge of methanol oxidation during repetitive cyclic voltammetry (CV) and methanol crossover rate was estimated to be 0.69 nmol/s

  4. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  5. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  6. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  7. A calculation of the surface recombination rate constant for hydrogen isotopes on metals

    International Nuclear Information System (INIS)

    Baskes, M.J.

    1980-01-01

    The surface recombination rate constant for hydrogen isotopes on a metal has been calculated using a simple model whose parameters may be determined by direct experimental measurements. Using the experimental values for hydrogen diffusivity, solubility, and sticking coefficient at zero surface coverage a reasonable prediction of the surface recombination constant may be made. The calculated recombination constant is in excellent agreement with experiment for bcc iron. A heuristic argument is developed which, along with the rate constant calculation, shows that surface recombination is important in those metals in which hydrogen has an exothermic heat of solution. (orig.)

  8. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  9. The Chern-Simons diffusion rate in improved holographic QCD

    NARCIS (Netherlands)

    Gürsoy, U.; Iatrakis, I.; Kiritsis, E.; Nitti, F.; O’Bannon, A.

    2013-01-01

    In (3 + 1)-dimensional SU(N c) Yang-Mills (YM) theory, the Chern-Simons diffusion rate, ΓCS, is determined by the zero-momentum, zero-frequency limit of the retarded two-point function of the CP-odd operator tr [F ∧ F ], with F the YM field strength. The Chern-Simons diffusion rate is a crucial

  10. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  11. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  12. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  13. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  14. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  15. Diffusion equations and the time evolution of foreign exchange rates

    Energy Technology Data Exchange (ETDEWEB)

    Figueiredo, Annibal; Castro, Marcio T. de [Institute of Physics, Universidade de Brasília, Brasília DF 70910-900 (Brazil); Fonseca, Regina C.B. da [Department of Mathematics, Instituto Federal de Goiás, Goiânia GO 74055-110 (Brazil); Gleria, Iram, E-mail: iram@fis.ufal.br [Institute of Physics, Federal University of Alagoas, Brazil, Maceió AL 57072-900 (Brazil)

    2013-10-01

    We investigate which type of diffusion equation is most appropriate to describe the time evolution of foreign exchange rates. We modify the geometric diffusion model assuming a non-exponential time evolution and the stochastic term is the sum of a Wiener noise and a jump process. We find the resulting diffusion equation to obey the Kramers–Moyal equation. Analytical solutions are obtained using the characteristic function formalism and compared with empirical data. The analysis focus on the first four central moments considering the returns of foreign exchange rate. It is shown that the proposed model offers a good improvement over the classical geometric diffusion model.

  16. Diffusion equations and the time evolution of foreign exchange rates

    Science.gov (United States)

    Figueiredo, Annibal; de Castro, Marcio T.; da Fonseca, Regina C. B.; Gleria, Iram

    2013-10-01

    We investigate which type of diffusion equation is most appropriate to describe the time evolution of foreign exchange rates. We modify the geometric diffusion model assuming a non-exponential time evolution and the stochastic term is the sum of a Wiener noise and a jump process. We find the resulting diffusion equation to obey the Kramers-Moyal equation. Analytical solutions are obtained using the characteristic function formalism and compared with empirical data. The analysis focus on the first four central moments considering the returns of foreign exchange rate. It is shown that the proposed model offers a good improvement over the classical geometric diffusion model.

  17. Diffusion equations and the time evolution of foreign exchange rates

    International Nuclear Information System (INIS)

    Figueiredo, Annibal; Castro, Marcio T. de; Fonseca, Regina C.B. da; Gleria, Iram

    2013-01-01

    We investigate which type of diffusion equation is most appropriate to describe the time evolution of foreign exchange rates. We modify the geometric diffusion model assuming a non-exponential time evolution and the stochastic term is the sum of a Wiener noise and a jump process. We find the resulting diffusion equation to obey the Kramers–Moyal equation. Analytical solutions are obtained using the characteristic function formalism and compared with empirical data. The analysis focus on the first four central moments considering the returns of foreign exchange rate. It is shown that the proposed model offers a good improvement over the classical geometric diffusion model.

  18. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  19. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  20. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  1. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  2. Gaussian and Affine Approximation of Stochastic Diffusion Models for Interest and Mortality Rates

    Directory of Open Access Journals (Sweden)

    Marcus C. Christiansen

    2013-10-01

    Full Text Available In the actuarial literature, it has become common practice to model future capital returns and mortality rates stochastically in order to capture market risk and forecasting risk. Although interest rates often should and mortality rates always have to be non-negative, many authors use stochastic diffusion models with an affine drift term and additive noise. As a result, the diffusion process is Gaussian and, thus, analytically tractable, but negative values occur with positive probability. The argument is that the class of Gaussian diffusions would be a good approximation of the real future development. We challenge that reasoning and study the asymptotics of diffusion processes with affine drift and a general noise term with corresponding diffusion processes with an affine drift term and an affine noise term or additive noise. Our study helps to quantify the error that is made by approximating diffusive interest and mortality rate models with Gaussian diffusions and affine diffusions. In particular, we discuss forward interest and forward mortality rates and the error that approximations cause on the valuation of life insurance claims.

  3. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  4. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  5. Molecular Dynamics and Monte Carlo simulations resolve apparent diffusion rate differences for proteins confined in nanochannels

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, J.W., E-mail: tringe2@llnl.gov [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Ileri, N. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Levie, H.W. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Stroeve, P.; Ustach, V.; Faller, R. [Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Renaud, P. [Swiss Federal Institute of Technology, Lausanne, (EPFL) (Switzerland)

    2015-08-18

    Highlights: • WGA proteins in nanochannels modeled by Molecular Dynamics and Monte Carlo. • Protein surface coverage characterized by atomic force microscopy. • Models indicate transport characteristics depend strongly on surface coverage. • Results resolve of a four orders of magnitude difference in diffusion coefficient values. - Abstract: We use Molecular Dynamics and Monte Carlo simulations to examine molecular transport phenomena in nanochannels, explaining four orders of magnitude difference in wheat germ agglutinin (WGA) protein diffusion rates observed by fluorescence correlation spectroscopy (FCS) and by direct imaging of fluorescently-labeled proteins. We first use the ESPResSo Molecular Dynamics code to estimate the surface transport distance for neutral and charged proteins. We then employ a Monte Carlo model to calculate the paths of protein molecules on surfaces and in the bulk liquid transport medium. Our results show that the transport characteristics depend strongly on the degree of molecular surface coverage. Atomic force microscope characterization of surfaces exposed to WGA proteins for 1000 s show large protein aggregates consistent with the predicted coverage. These calculations and experiments provide useful insight into the details of molecular motion in confined geometries.

  6. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  7. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  8. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  9. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  10. Liquid Film Diffusion on Reaction Rate in Submerged Biofilters

    DEFF Research Database (Denmark)

    Christiansen, Pia; Hollesen, Line; Harremoës, Poul

    1995-01-01

    Experiments were carried out in order to investigate the influence of liquid film diffusion on reaction rate in a submerged biofilter with denitrification and in order to compare with a theoretical study of the mass transfer coefficient. The experiments were carried out with varied flow, identified...... by the empty bed velocity of inflow and recirculation, respectively 1.3, 2.8, 5.6 and 10.9 m/h. The filter material consisted of 3 mm biostyren spheres. The results indicate that the influence of liquid film diffusion on reaction rate can be ignored....

  11. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  12. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  13. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  14. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  15. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  16. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  17. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  18. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  19. Application of the multi-rate diffusion approach in tracer test studies at Aespoe HRL. Final report

    International Nuclear Information System (INIS)

    Haggerty, R.

    1999-11-01

    This report summarizes an investigation into heterogeneous diffusivity and associated parameters within granitic rocks at the Aespoe Hard Rock Laboratory (HRL). Our tasks for this investigation were: (1) to assess the potential for either anomalous or multi-rate diffusion within Aespoe rocks; (2) to evaluate existing data relating to anomalous and multi-rate diffusion within Aespoe rocks; (3) to perform scoping calculations in support of a Long Term Diffusion Experiment (LTDE) design; and (4) to begin developing a mathematical and computer model for solute advection in the presence of anomalous matrix diffusion. In addition to carrying out these tasks, we also report on (5) the late-time behavior of breakthrough curves. First, in regard to the potential for anomalous and multi-rate diffusion and analyses of existing data, we find that (1) in a literature review of 100 column experiments in various types of rock and sediment, rate coefficients decrease with experimental observation time. This is precisely what would be expected of both multi-rate and anomalous diffusion. (2) Three sets of through-diffusion experiments in Fenno-Scandian granitic rock found decreasing effective diffusivity, D e , with sample length, while one set did not. (3) Based on diffusivity and sorption data, and speculation on matrix block size variability, the total variability of D a /a 2 may reasonably be expected to exceed 4 orders of magnitude. (4) Analyses of two-well tracer data completed to date are ambiguous with respect to multi-rate diffusion. Analyses of TRUE data are currently underway and may support multi-rate diffusion. Second, in regard to the potential consequences of multi-rate and anomalous diffusion on nuclear waste disposal, we found the following key points: (1) No single value of diffusivity can represent the diffusion process at all time- or length-scales if diffusion is truly anomalous, while a single value of diffusivity will represent diffusion adequately for some

  20. Application of the multi-rate diffusion approach in tracer test studies at Aespoe HRL. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Haggerty, R. [Oregon State Univ., Corvallis, OR (United States). Dept. of Geosciences

    1999-11-01

    This report summarizes an investigation into heterogeneous diffusivity and associated parameters within granitic rocks at the Aespoe Hard Rock Laboratory (HRL). Our tasks for this investigation were: (1) to assess the potential for either anomalous or multi-rate diffusion within Aespoe rocks; (2) to evaluate existing data relating to anomalous and multi-rate diffusion within Aespoe rocks; (3) to perform scoping calculations in support of a Long Term Diffusion Experiment (LTDE) design; and (4) to begin developing a mathematical and computer model for solute advection in the presence of anomalous matrix diffusion. In addition to carrying out these tasks, we also report on (5) the late-time behavior of breakthrough curves. First, in regard to the potential for anomalous and multi-rate diffusion and analyses of existing data, we find that (1) in a literature review of 100 column experiments in various types of rock and sediment, rate coefficients decrease with experimental observation time. This is precisely what would be expected of both multi-rate and anomalous diffusion. (2) Three sets of through-diffusion experiments in Fenno-Scandian granitic rock found decreasing effective diffusivity, D{sub e}, with sample length, while one set did not. (3) Based on diffusivity and sorption data, and speculation on matrix block size variability, the total variability of D{sub a}/a{sup 2} may reasonably be expected to exceed 4 orders of magnitude. (4) Analyses of two-well tracer data completed to date are ambiguous with respect to multi-rate diffusion. Analyses of TRUE data are currently underway and may support multi-rate diffusion. Second, in regard to the potential consequences of multi-rate and anomalous diffusion on nuclear waste disposal, we found the following key points: (1) No single value of diffusivity can represent the diffusion process at all time- or length-scales if diffusion is truly anomalous, while a single value of diffusivity will represent diffusion

  1. Computing Rates of Small Molecule Diffusion Through Protein Channels Using Markovian Milestoning

    Science.gov (United States)

    Abrams, Cameron

    2014-03-01

    Measuring diffusion rates of ligands plays a key role in understanding the kinetic processes inside proteins. For example, although many molecular simulation studies have reported free energy barriers to infer rates for CO diffusion in myoglobin (Mb), they typically do not include direct calculation of diffusion rates because of the long simulation times needed to infer these rates with statistical accuracy. We show in this talk how to apply Markovian milestoning along minimum free-energy pathways to calculate diffusion rates of CO inside Mb. In Markovian milestoning, one partitions a suitable reaction coordinate space into regions and performs restrained molecular dynamics in each region to accumulate kinetic statistics that, when assembled across regions, provides an estimate of the mean first-passage time between states. The mean escape time for CO directly from the so-called distal pocket (DP) through the histidine gate (HG) is estimated at about 24 ns, confirming the importance of this portal for CO. But Mb is known to contain several internal cavities, and cavity-to-cavity diffusion rates are also computed and used to build a complete kinetic network as a Markov state model. Within this framework, the effective mean time of escape to the solvent through HG increases to 30 ns. Our results suggest that carrier protein structure may have evolved under pressure to modulate dissolved gas release rates using a network of ligand-accessible cavities. Support: NIH R01GM100472.

  2. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  3. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  4. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  5. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  6. Electrolyte diffusion in compacted montmorillonite engineered barriers

    International Nuclear Information System (INIS)

    Jahnke, F.M.; Radke, C.J.

    1985-09-01

    The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab

  7. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  8. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  9. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  10. Are US utility standby rates inhibiting diffusion of customer-owned generating systems?

    International Nuclear Information System (INIS)

    Jackson, Jerry

    2007-01-01

    New, small-scale electric generation technologies permit utility customers to generate some of their own electric power and to utilize waste heat for space heating and other applications at the building site. This combined heat and power (CHP) characteristic can provide significant energy-cost savings. However, most current US utility regulations leave CHP standby rate specification largely to utility discretion resulting in claims by CHP advocates that excessive standby rates are significantly reducing CHP-related savings and inhibiting CHP diffusion. The impacts of standby rates on the adoption of CHP are difficult to determine; however, because of the characteristically slow nature of new technology diffusion. This study develops an agent-based microsimulation model of CHP technology choice using cellular automata to represent new technology information dispersion and knowledge acquisition. Applying the model as an n-factorial experiment quantifies the impacts of standby rates on CHP technologies under alternative diffusion paths. Analysis of a sample utility indicates that, regardless of the likely diffusion process, reducing standby rates to reflect the cost of serving a large number of small, spatially clustered CHP systems significantly increases the adoption of these technologies

  11. Mathematical modelling of the influenced of diffusion rate on macro nutrient availability in paddy field

    Science.gov (United States)

    Renny; Supriyanto

    2018-04-01

    Nutrition is the chemical compounds that needed by the organism for the growth process. In plants, nutrients are organic or inorganic compounds that are absorbed from the roots of the soil. It consist of macro and micro nutrient. Macro nutrients are nutrition that needed by plants in large quantities, such as, nitrogen, calcium, pottacium, magnesium, and sulfur. The total soil nutrient is the difference between the input nutrient and the output nutrients. Input nutrients are nutrient that derived from the decomposition of organic substances. Meanwhile, the output nutrient consists of the nutrients that absorbed by plant roots (uptake), the evaporated nutrients (volatilized) and leached nutrients. The nutrient transport can be done through diffusion process. The diffusion process is essential in removing the nutrient from one place to the root surface. It will cause the rate of absorption of nutrient by the roots will be greater. Nutrient concept in paddy filed can be represented into a mathematical modelling, by making compartment models. The rate of concentration change in the compartment model forms a system of homogeneous linear differential equations. In this research, we will use Laplaces transformation to solve the compartment model and determined the dynamics of macro nutrition due to diffusion process.

  12. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  13. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  14. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  15. Absence of saturation of void growth in rate theory with anisotropic diffusion

    CERN Document Server

    Hudson, T S; Sutton, A P

    2002-01-01

    We present a first attempt at solution the problem of the growth of a single void in the presence of anisotropically diffusing radiation induced self-interstitial atom (SIA) clusters. In order to treat a distribution of voids we perform ensemble averaging over the positions of centres of voids using a mean-field approximation. In this way we are able to model physical situations in between the Standard Rate Theory (SRT) treatment of swelling (isotropic diffusion), and the purely 1-dimensional diffusion of clusters in the Production Bias Model. The background absorption by dislocations is however treated isotropically, with a bias for interstitial cluster absorption assumed similar to that of individual SIAs. We find that for moderate anisotropy, unsaturated void growth is characteristic of this anisotropic diffusion of clusters. In addition we obtain a higher initial void swelling rate than predicted by SRT whenever the diffusion is anisotropic.

  16. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  17. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A Method for Medical Diagnosis Based on Optical Fluence Rate Distribution at Tissue Surface.

    Science.gov (United States)

    Hamdy, Omnia; El-Azab, Jala; Al-Saeed, Tarek A; Hassan, Mahmoud F; Solouma, Nahed H

    2017-09-20

    Optical differentiation is a promising tool in biomedical diagnosis mainly because of its safety. The optical parameters' values of biological tissues differ according to the histopathology of the tissue and hence could be used for differentiation. The optical fluence rate distribution on tissue boundaries depends on the optical parameters. So, providing image displays of such distributions can provide a visual means of biomedical diagnosis. In this work, an experimental setup was implemented to measure the spatially-resolved steady state diffuse reflectance and transmittance of native and coagulated chicken liver and native and boiled breast chicken skin at 635 and 808 nm wavelengths laser irradiation. With the measured values, the optical parameters of the samples were calculated in vitro using a combination of modified Kubelka-Munk model and Bouguer-Beer-Lambert law. The estimated optical parameters values were substituted in the diffusion equation to simulate the fluence rate at the tissue surface using the finite element method. Results were verified with Monte-Carlo simulation. The results obtained showed that the diffuse reflectance curves and fluence rate distribution images can provide discrimination tools between different tissue types and hence can be used for biomedical diagnosis.

  19. A Method for Medical Diagnosis Based on Optical Fluence Rate Distribution at Tissue Surface

    Directory of Open Access Journals (Sweden)

    Omnia Hamdy

    2017-09-01

    Full Text Available Optical differentiation is a promising tool in biomedical diagnosis mainly because of its safety. The optical parameters’ values of biological tissues differ according to the histopathology of the tissue and hence could be used for differentiation. The optical fluence rate distribution on tissue boundaries depends on the optical parameters. So, providing image displays of such distributions can provide a visual means of biomedical diagnosis. In this work, an experimental setup was implemented to measure the spatially-resolved steady state diffuse reflectance and transmittance of native and coagulated chicken liver and native and boiled breast chicken skin at 635 and 808 nm wavelengths laser irradiation. With the measured values, the optical parameters of the samples were calculated in vitro using a combination of modified Kubelka-Munk model and Bouguer-Beer-Lambert law. The estimated optical parameters values were substituted in the diffusion equation to simulate the fluence rate at the tissue surface using the finite element method. Results were verified with Monte-Carlo simulation. The results obtained showed that the diffuse reflectance curves and fluence rate distribution images can provide discrimination tools between different tissue types and hence can be used for biomedical diagnosis.

  20. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  1. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  2. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  3. Strain rate effect on sooting characteristics in laminar counterflow diffusion flames

    KAUST Repository

    Wang, Yu

    2016-01-20

    The effects of strain rate, oxygen enrichment and fuel type on the sooting characteristics of counterflow diffusion flames were studied. The sooting structures and relative PAH concentrations were measured with laser diagnostics. Detailed soot modeling using recently developed PAH chemistry and surface reaction mechanism was performed and the results were compared with experimental data for ethylene flames, focusing on the effects of strain rates. The results showed that increase in strain rate reduced soot volume fraction, average size and peak number density. Increase in oxygen mole fraction increased soot loading and decreased its sensitivity on strain rate. The soot volume fractions of ethane, propene and propane flames were also measured as a function of global strain rate. The sensitivity of soot volume fraction to strain rate was observed to be fuel dependent at a fixed oxygen mole fraction, with the sensitivity being higher for more sooting fuels. However, when the soot loadings were matched at a reference strain rate for different fuels by adjusting oxygen mole fraction, the dependence of soot loading on strain rate became comparable among the tested fuels. PAH concentrations were shown to decrease with increase in strain rate and the dependence on strain rate is more pronounced for larger PAHs. Soot modeling was performed using detailed PAH growth chemistry with molecular growth up to coronene. A qualitative agreement was obtained between experimental and simulation results, which was then used to explain the experimentally observed strain rate effect on soot growth. However, quantitatively, the simulation result exhibits higher sensitivity to strain rate, especially for large PAHs and soot volume fractions.

  4. Hydrogen Diffusion and H{sub 2}S Corrosion in Steel

    Energy Technology Data Exchange (ETDEWEB)

    Haugstveit, Bjarte Erlend

    2001-01-01

    The electrochemical permeation technique introduced by Devanathan and Stachurski has been used to measure the effective diffusivity of hydrogen in steel in a H{sub 2}S-saturated aqueous environment. The linear polarization resistance (LPR) method has been used to measure the corrosion rate. The effective diffusion coefficient of hydrogen has been found to be in the range of 1*10-12 to 7*10-11, depending on the environmental conditions. The corrosion film was identified as mackinawite, and it affected the permeation process of hydrogen. The results supported the assumption that the diffusion process can be described by a three layer model and indicated that the model could be reduced to a two layer model in the cases of iron and steel. A model aimed to describe the reaction pathway of hydrogen through the surface film and into the steel is proposed. The corrosion film influenced the corrosion rate, and it was least protective against corrosion at pH 6.5. Corrosion rates were in the range of 0.2-1 mm/year. The corrosion rate was increased significantly at pH 3.5, but the effect of the surface film was stronger and overshadowed the pH effect at the higher pH values. Increased flow velocity also lead to increased corrosion rate, but this effect was less significant compared to the effect of pH and the surface film. DEG decreased the corrosion rate. The uncertainty in the diffusion measurements was mainly due to the assumption of a constant sub-surface concentration of atomic hydrogen, which was not fulfilled. A method less dependent on constant surface conditions would probably yield better estimates of the effective diffusivity. The uncertainty in the corrosion measurements was mainly due to the uncertainty in the value of the Stern-Geary constant. The qualitative assumptions based on the results in this thesis are assumed to be valid. A test section designed for this thesis was tested and was found successful in corrosion rate measurements, but proved to be

  5. First-order dissolution rate law and the role of surface layers in glass performance assessment

    Science.gov (United States)

    Grambow, B.; Müller, R.

    2001-09-01

    potential mechanical destruction it will be reformed instantaneously. The same is true for radiation damage. The dissolution of silica from the surface in this concept is considered as rate limiting for the release of soluble elements from the glass. After surface stabilization by local solid/solution equilibrium the release of soluble radionuclides continues with lower rates, but this is considered as resulting from parallel leaching mechanism. In fact, the deconvolutions of the overall leach mechanism into individual parallel and sequential rate limiting steps (not necessarily elementary reactions) is fundamental to this concept. In concept (2) surface stability as well as surface morphology are fundamental. A fracture in the protective surface would increase glass corrosion. The protective effect is based on the low diffusivities of radionuclides and other glass constituents in this layer. However, a true relation between layer thickness and rates is seldom observed. Diffusion coefficients are considered to vary with time as well as with the surface area to solution volume S/ V ratio. Sometimes, extremely low diffusivities in extremely thin layers are invoked to explain experimental data. The two concepts are not so different from each other and one is tempted to think of a problem of semantics. In fact, there are two alternative ways by which the protective layer concept can be coupled to the saturation concept: (a) the layer may be formed by solubility effects as proposed in [loc.cit] and/or (b) the layer plays the role of a silica diffusion barrier limiting glass dissolution rates according to the first-order rate law at the interface between the pristine glass and the surface layer. However, the mathematical models based on these conceptual models yield quite different long-term predictions, even though the models may equally well fit a given set of experimental data. The models are also different with respect to the number of interrelated parameters. In the case of

  6. Mechanobiology of LDL mass transport in the arterial wall under the effect of magnetic field, part I: Diffusion rate

    Energy Technology Data Exchange (ETDEWEB)

    Aminfar, Habib, E-mail: hh_aminfar@tabrizu.ac.ir [Faculty of Mechanical Engineering, University of Tabriz, Tabriz (Iran, Islamic Republic of); Mohammadpourfard, Mousa, E-mail: Mohammadpour@tabrizu.ac.ir [Faculty of Chemical and Petroleum Engineering, University of Tabriz, Tabriz 5166616471 (Iran, Islamic Republic of); Khajeh, Kosar, E-mail: k.khajeh.2005@tabrizu.ac.ir [Faculty of Mechanical Engineering, University of Tabriz, Tabriz (Iran, Islamic Republic of)

    2017-03-15

    It is well-known that the Low Density Lipoprotein (LDL) can accumulate and penetrate into the arterial wall. Here, we have investigated the diffusion rate of macromolecules across the porous layer of blood vessel under the effects of magnetic force. By using a finite volume technique, it was found that magnetic field makes alterations in diffusion rate of LDLs, also surface concentration of macromolecules on the walls. As well, the influence of different value of Re and Sc number in the presence of a magnetic field have shown as nondimensional concentration profiles. Magnetic field considered as a body force, porous layer simulated by using Darcy's law and the blood regarded as nano fluid which was examined as a single phase model. - Highlights: • LDLs mass transfer across the arterial wall under magnetic field has simulated numerically. • Arterial wall assumed as a homogeneous porous layer by using Darcy's law. • Blood containing 4% Vol. Fe{sub 3}O{sub 4} regarded as nanofluid and has examined by single phase model. • Magnetic field significantly affects the diffusion rate of LDLs through porous arterial wall.

  7. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  8. Determinants of Inter-Country Internet Diffusion Rates

    OpenAIRE

    Wunnava, Phanindra V.; Leiter, Daniel B.

    2008-01-01

    This paper employs cross-sectional data from 100 countries to analyze the main determinants of inter-country Internet diffusion rates. We set up an empirical model based on strong theoretical foundations, in which we regress Internet usage on variables that capture social, economic and political differences between these countries. Our results support past findings that economic strength, infrastructure and knowledge of the English language positively affect Internet connectivity. In addition...

  9. Effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stresses in cylindrical Li-ion batteries

    International Nuclear Information System (INIS)

    Zhang, Tao; Guo, Zhansheng

    2014-01-01

    The effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stress in a cylindrical Li-ion battery are studied. It is found that hydrostatic pressure or elastic modulus variation in the active layer have little effect on the distribution of Li ions for a higher diffusivity coefficient, but both can facilitate Li ion diffusion for a lower diffusivity coefficient. The elastic modulus variation has a significant effect on the distribution of stress and hydrostatic pressure can reduce the surface stress for the lower diffusivity coefficient. A higher charging rate causes a more transient response in the stress history, but a linear charging history is observed for slow charging rates. A higher charging rate would not inflict extra damage on the electrode for the higher diffusivity coefficient and the stress history becomes highly transient and charging rate dependent for the lower diffusivity coefficient. The effect of fabricated pressure can be neglected. (paper)

  10. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  11. Effect of macromolecular crowding on the rate of diffusion-limited ...

    Indian Academy of Sciences (India)

    The enzymatic reaction rate has been shown to be affected by the presence of such macromolecules. A simple numerical model is proposed here based on percolation and diffusion in disordered systems to study the effect of macromolecular crowding on the enzymatic reaction rates. The model qualitatively explains some ...

  12. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  13. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  14. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  15. Quantitation of chemical exchange rates using pulsed-field-gradient diffusion measurements

    International Nuclear Information System (INIS)

    Andrec, Michael; Prestegard, James H.

    1997-01-01

    A new approach to the quantitation of chemical exchange rates is presented, and its utility is illustrated with application to the exchange of protein amide protons with bulk water. The approach consists of a selective-inversion exchange HMQC experiment in which a short spin echo diffusion filter has been inserted into the exchange period. In this way, the kinetics of exchange are encoded directly in an apparent diffusion coefficient which is a function of the position of the diffusion filter in the pulse sequence. A detailed theoretical analysis of this experiment indicates that, in addition to the measurement of simple exchange rates, the experiment is capable of measuring the effect of mediated exchange, e.g. the transfer of magnetization from bulk water to an amide site mediated by an internal bound water molecule or a labile protein side-chain proton in fast exchange with bulk water. Experimental results for rapid water/amide exchange in acyl carrier protein are shown to be quantitatively consistent with the exchange rates measured using a selective-inversion exchange experiment

  16. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  17. The determination of volatile chlorinated hydrocarbons in air. Sampling rate and efficiency of diffuse samplers

    Energy Technology Data Exchange (ETDEWEB)

    Giese, U.; Stenner, H.; Kettrup, A.

    1989-05-01

    When applicating diffusive sampling-systems to workplace air-monitoring it is necessary to know the behaviour of the diffusive-rate and the efficiency in dependence of concentration, exposition time and the type of pollutant. Especially concerning mixtures of pollutants there are negative influences by competition and mutual displacement possible. Diffusive-rate and discovery for CH/sub 2/Cl/sub 2/ and CHCl/sub 3/ were investigated using two different types of diffuse samplers. For this it was necessary to develop suitable defices for standard gas generation and for the exposition of diffusive-samplers to a standard gas mixture. (orig.).

  18. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  19. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  1. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  2. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  3. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  4. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  5. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  6. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  7. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  8. A diffusive ink transport model for lipid dip-pen nanolithography

    Science.gov (United States)

    Urtizberea, A.; Hirtz, M.

    2015-09-01

    Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus/substrate interface. Feature shape is controlled by the substrate surface energy. The results are analyzed within a modified model for the ink transport of diffusive inks. At any humidity the dependence of the area spread on the dwell time shows two diffusion regimes: at short dwell times growth is controlled by meniscus diffusion while at long dwell times surface diffusion governs the process. The critical point for the switch of regime depends on the humidity.Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus

  9. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  10. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  11. 3D-CFD analysis of diffusion and emission of VOCs in a FLEC cavity.

    Science.gov (United States)

    Zhu, Q; Kato, S; Murakami, S; Ito, K

    2007-06-01

    This study is performed as a part of research that examines the emission and diffusion characteristics of volatile organic compounds (VOCs) from indoor building materials. In this paper, the flow field and the emission field of VOCs from the surface of building materials in a Field and Laboratory Emission Cell (FLEC) cavity are examined by 3D Computational Fluid Dynamics (CFD) analysis. The flow field within the FLEC cavity is laminar. With a total flow of 250 ml/min, the air velocity near the test material surface ranges from 0.1 to 4.5 cm/s. Three types of emission from building materials are studied here: (i) emission phenomena controlled by internal diffusion, (ii) emission phenomena controlled by external diffusion, and (iii) emission phenomena controlled by mixed diffusion (internal + external diffusion). In the case of internal diffusion material, with respect to the concentration distribution in the cavity, the local VOC emission rate becomes uniform and the FLEC works well. However, in the case of evaporation type (external diffusion) material, or mixed type materials (internal + external diffusion) when the resistance to transporting VOCs in the material is small, the FLEC is not suitable for emission testing because of the thin FLEC cavity. In this case, the mean emission rate is restricted to a small value, since the VOC concentration in the cavity rises to the same value as the surface concentration through molecular diffusion within the thin cavity, and the concentration gradient normal to the surface becomes small. The diffusion field and emission rate depend on the cavity concentration and on the Loading Factor. That is, when the testing material surface in the cavity is partially sealed to decrease the Loading Factor, the emission rate become higher with the decrease in the exposed area of the testing material. The flow field and diffusion field within the FLEC cavity are investigated by CFD method. After presenting a summary of the velocity

  12. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  13. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  14. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  15. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  16. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  17. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  18. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  19. Surface controlled dissolution rates of gypsum in aqueous solutions exhibit nonlinear dissolution kinetics

    Science.gov (United States)

    Jeschke, Alexander A.; Vosbeck, Katrin; Dreybrodt, Wolfgang

    2001-01-01

    The effective dissolution rates of gypsum are determined by mixed kinetics, where the rate constants of dissolution at the surface and the transport constant of molecular diffusion of dissolved material are similar. To obtain the surface reaction rate law it is necessary to know the transport constant. We have determined the surface rate law for monocrystalline selenite by using a rotating disc set-up, where the transport coefficients are well known. As a result, up to a calcium concentration of 0.6 · ceq, we find a nearly linear rate law Rs = ksl (1- cs/ ceq) n1, where cs is the total calcium concentration at the surface and ceq the equilibrium concentration with respect to gypsum, n1 = 1.2 ± 0.2, and ksl = 1.1 · 10 -4 mmol cm -2 s -1 ± 15%. We also employed batch-experiments for selenite, alabaster and gypsum rock samples. The result of these experiments were interpreted by using a transport constant determined by NaCl dissolution experiments under similar physical conditions. The batch experiments reveal a dissolution rate law Rs = ksl (1- cs/ ceq) n1, ksl = 1.3 · 10 -4 mmol · cm -2 s -1, n1 = 1.2 ± 0.2 for c ≤ 0.94 · ceq. Close to equilibrium a nonlinear rate law, Rs = ks2 (1- cs/ ceq) n2, is observed, where ks2 is in the order of 10 mmol · cm -2 s -1 and n2 ≈ 4.5. The experimentally observed gypsum dissolution rates from the batch experiments could be accurately fitted, with only minor variations of the surface reaction constant obtained from the rotating disk experiment and the transport coefficient from the NaCl dissolution batch experiment. Batch experiments on pure synthetic gypsum, reveal a linear rate law up to equilibrium. This indicates inhibition of dissolution in natural samples close to equilibrium, as is known also for calcite minerals.

  20. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  1. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  2. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  3. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  4. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  5. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  6. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  7. Strain rate effect on sooting characteristics in laminar counterflow diffusion flames

    KAUST Repository

    Wang, Yu; Chung, Suk-Ho

    2016-01-01

    The effects of strain rate, oxygen enrichment and fuel type on the sooting characteristics of counterflow diffusion flames were studied. The sooting structures and relative PAH concentrations were measured with laser diagnostics. Detailed soot

  8. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  9. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  10. Efficient kinetic Monte Carlo method for reaction-diffusion problems with spatially varying annihilation rates

    Science.gov (United States)

    Schwarz, Karsten; Rieger, Heiko

    2013-03-01

    We present an efficient Monte Carlo method to simulate reaction-diffusion processes with spatially varying particle annihilation or transformation rates as it occurs for instance in the context of motor-driven intracellular transport. Like Green's function reaction dynamics and first-passage time methods, our algorithm avoids small diffusive hops by propagating sufficiently distant particles in large hops to the boundaries of protective domains. Since for spatially varying annihilation or transformation rates the single particle diffusion propagator is not known analytically, we present an algorithm that generates efficiently either particle displacements or annihilations with the correct statistics, as we prove rigorously. The numerical efficiency of the algorithm is demonstrated with an illustrative example.

  11. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  12. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  13. Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

    Science.gov (United States)

    Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

    2017-12-01

    This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

  14. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  15. A diffusive ink transport model for lipid dip-pen nanolithography.

    Science.gov (United States)

    Urtizberea, A; Hirtz, M

    2015-10-14

    Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus/substrate interface. Feature shape is controlled by the substrate surface energy. The results are analyzed within a modified model for the ink transport of diffusive inks. At any humidity the dependence of the area spread on the dwell time shows two diffusion regimes: at short dwell times growth is controlled by meniscus diffusion while at long dwell times surface diffusion governs the process. The critical point for the switch of regime depends on the humidity.

  16. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  17. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  18. Moisture diffusivity in structure of random fractal fiber bed

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Fanglong, E-mail: zhufanglong_168@163.com [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); The Chinese People' s Armed Police Forces Academy, Langfan City (China); Zhou, Yu; Feng, Qianqian [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); Xia, Dehong [School of Mechanical Engineering, University of Science and Technology, Beijing (China)

    2013-11-08

    A theoretical expression related to effective moisture diffusivity to random fiber bed is derived by using fractal theory and considering both parallel and perpendicular channels to diffusion flow direction. In this Letter, macroporous structure of hydrophobic nonwoven material is investigated, and Knudsen diffusion and surface diffusion are neglected. The effective moisture diffusivity predicted by the present fractal model are compared with water vapor transfer rate (WVTR) experiment data and calculated values obtained from other theoretical models. This verifies the validity of the present fractal diffusivity of fibrous structural beds.

  19. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  20. Ion-exchange equilibria and diffusion in engineered backfill

    International Nuclear Information System (INIS)

    Soudek, A.; Jahnke, F.M.; Radke, C.J.

    1984-01-01

    Engineered backfill can add confidence to confinement times of high-level nuclear waste stored in geologic media. This paper discusses the design and operation of a unique radial-flow diffusion cell to determine ion migration rates in backfill material under realistic repository conditions. New experimental results were reported for diffusion of CsCl in a background of NaCl into compacted bentonite and bentonite/quartz mixtures. Representation of the measured diffusion rates by the traditional, homogeneous porous-medium model significantly underestimates cesium penetration distances into the backfill. Surface diffusion is suggested as an additional mechanism by which cations transport in swollen montmorillonite; the surface diffusion coefficients for cesium is determined to be approximately 10 -7 cm 2 /s. An electrostatic site-binding model is developed for ion-exchange equilibria on montmorillonite clay. The effect of pH, ionic strength, and specific adsorption are evaluated and compared favorably to new, experimental exchange isotherms measured on disaggregated clay. The electrostatic site-binding model permits a prediction of the influence of backfill compaction on K/sub d/ values. We find that for strongly adsorbing cations, compactions has little effect. However, anions exhibit significant Donnan exclusion with clay compaction. 40 references, 12 figures

  1. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  2. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  3. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  4. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  5. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  6. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  7. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  8. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  9. Surface Potential and Particle Size Effect on the Rate of Perikinetic Coagulation

    International Nuclear Information System (INIS)

    Molina-Bolivar, J. A.; Galisteo-Gonzalez, F.; Cabrerizo-Vilchez, M.; Hidalgo-alvarez, R.

    1998-01-01

    The diffusion-controlled rapid coagulation rate of monodisperse polystyrene particles in aqueous solutions has been measured with a low angle scattering apparatus (nephelometer). We have refined this technique by using a narrow scattering flow cell and a pneumatic addicting-mixing device to introduce the salt solution and the latex sample in the cell. Coagulation rate constants were determined from analysis of the scattered light intensity dependence with time at an angle of 4.5 degree centigrade ± 1 degree centigrade. Experiments were designed to check the effects of particle size, surface potential and counterion valency on rapid coagulation constant. The particle ranged in diameter from 151 nm to 530 nm. The results are compared with the predictions of Smoluchowski's theory. Experiments to obtain the stability diagrams and the critical coagulation concentration of latexes have been performed. (Author) 31 refs

  10. THE IMPLICATIONS OF A HIGH COSMIC-RAY IONIZATION RATE IN DIFFUSE INTERSTELLAR CLOUDS

    International Nuclear Information System (INIS)

    Indriolo, Nick; Fields, Brian D.; McCall, Benjamin J.

    2009-01-01

    Diffuse interstellar clouds show large abundances of H + 3 which can only be maintained by a high ionization rate of H 2 . Cosmic rays are the dominant ionization mechanism in this environment, so the large ionization rate implies a high cosmic-ray flux, and a large amount of energy residing in cosmic rays. In this paper, we find that the standard propagated cosmic-ray spectrum predicts an ionization rate much lower than that inferred from H + 3 . Low-energy (∼10 MeV) cosmic rays are the most efficient at ionizing hydrogen, but cannot be directly detected; consequently, an otherwise unobservable enhancement of the low-energy cosmic-ray flux offers a plausible explanation for the H + 3 results. Beyond ionization, cosmic rays also interact with the interstellar medium by spalling atomic nuclei and exciting atomic nuclear states. These processes produce the light elements Li, Be, and B, as well as gamma-ray lines. To test the consequences of an enhanced low-energy cosmic-ray flux, we adopt two physically motivated cosmic-ray spectra which by construction reproduce the ionization rate inferred in diffuse clouds, and investigate the implications of these spectra on dense cloud ionization rates, light-element abundances, gamma-ray fluxes, and energetics. One spectrum proposed here provides an explanation for the high ionization rate seen in diffuse clouds while still appearing to be broadly consistent with other observables, but the shape of this spectrum suggests that supernovae remnants may not be the predominant accelerators of low-energy cosmic rays.

  11. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  12. Experimental Investigation of Diffuser Hub Injection to Improve Centrifugal Compressor Stability

    Science.gov (United States)

    Skoch, Gary J.

    2004-01-01

    Results from a series of experiments to investigate whether centrifugal compressor stability could be improved by injecting air through the diffuser hub surface are reported. The research was conducted in a 4:1 pressure ratio centrifugal compressor configured with a vane-island diffuser. Injector nozzles were located just upstream of the leading edge of the diffuser vanes. Nozzle orientations were set to produce injected streams angled at 8, 0 and +8 degrees relative to the vane mean camber line. Several injection flow rates were tested using both an external air supply and recirculation from the diffuser exit. Compressor flow range did not improve at any injection flow rate that was tested. Compressor flow range did improve slightly at zero injection due to the flow resistance created by injector openings on the hub surface. Leading edge loading and semi-vaneless space diffusion showed trends similar to those reported earlier from shroud surface experiments that did improve compressor flow range. Opposite trends are seen for hub injection cases where compressor flow range decreased. The hub injection data further explain the range improvement provided by shroud-side injection and suggest that different hub-side techniques may produce range improvement in centrifugal compressors.

  13. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  14. Backtracking and Mixing Rate of Diffusion on Uncorrelated Temporal Networks

    Directory of Open Access Journals (Sweden)

    Martin Gueuning

    2017-10-01

    Full Text Available We consider the problem of diffusion on temporal networks, where the dynamics of each edge is modelled by an independent renewal process. Despite the apparent simplicity of the model, the trajectories of a random walker exhibit non-trivial properties. Here, we quantify the walker’s tendency to backtrack at each step (return where he/she comes from, as well as the resulting effect on the mixing rate of the process. As we show through empirical data, non-Poisson dynamics may significantly slow down diffusion due to backtracking, by a mechanism intrinsically different from the standard bus paradox and related temporal mechanisms. We conclude by discussing the implications of our work for the interpretation of results generated by null models of temporal networks.

  15. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  16. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  17. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  18. Locating the rate-limiting step for the interaction of hydrogen with Mg(0001) using density-functional theory calculations and rate theory

    DEFF Research Database (Denmark)

    Vegge, Tejs

    2004-01-01

    The dissociation of molecular hydrogen on a Mgs0001d surface and the subsequent diffusion of atomic hydrogen into the magnesium substrate is investigated using Density Functional Theory (DFT) calculations and rate theory. The minimum energy path and corresponding transition states are located usi...... to be rate-limiting for the ab- and desorption of hydrogen, respectively. Zero-point energy contributions are found to be substantial for the diffusion of atomic hydrogen, but classical rates are still found to be within an order of magnitude at room temperature.......The dissociation of molecular hydrogen on a Mgs0001d surface and the subsequent diffusion of atomic hydrogen into the magnesium substrate is investigated using Density Functional Theory (DFT) calculations and rate theory. The minimum energy path and corresponding transition states are located using...

  19. Jump locations of jump-diffusion processes with state-dependent rates

    International Nuclear Information System (INIS)

    Miles, Christopher E; Keener, James P

    2017-01-01

    We propose a general framework for studying statistics of jump-diffusion systems driven by both Brownian noise (diffusion) and a jump process with state-dependent intensity. Of particular natural interest in many physical systems are the jump locations: the system evaluated at the jump times. As an example, this could be the voltage at which a neuron fires, or the so-called ‘threshold voltage’. However, the state-dependence of the jump rate provides direct coupling between the diffusion and jump components, making it difficult to disentangle the two to study individually. In this work, we provide an iterative map formulation of the sequence of distributions of jump locations. The distributions computed by this map can be used to elucidate other interesting quantities about the process, including statistics of the interjump times. Ultimately, the limit of the map reveals that knowledge of the stationary distribution of the full process is sufficient to recover (but not necessarily equal to) the distribution of jump locations. We propose two biophysical examples to illustrate the use of this framework to provide insight about a system. We find that a sharp threshold voltage emerges robustly in a simple stochastic integrate-and-fire neuronal model. The interplay between the two sources of noise is also investigated in a stepping model of molecular motor in intracellular transport pulling a diffusive cargo. (paper)

  20. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  1. Competing quantum effects in the free energy profiles and diffusion rates of hydrogen and deuterium molecules through clathrate hydrates.

    Science.gov (United States)

    Cendagorta, Joseph R; Powers, Anna; Hele, Timothy J H; Marsalek, Ondrej; Bačić, Zlatko; Tuckerman, Mark E

    2016-11-30

    Clathrate hydrates hold considerable promise as safe and economical materials for hydrogen storage. Here we present a quantum mechanical study of H 2 and D 2 diffusion through a hexagonal face shared by two large cages of clathrate hydrates over a wide range of temperatures. Path integral molecular dynamics simulations are used to compute the free-energy profiles for the diffusion of H 2 and D 2 as a function of temperature. Ring polymer molecular dynamics rate theory, incorporating both exact quantum statistics and approximate quantum dynamical effects, is utilized in the calculations of the H 2 and D 2 diffusion rates in a broad temperature interval. We find that the shape of the quantum free-energy profiles and their height relative to the classical free energy barriers at a given temperature, as well as the rate of diffusion, are strongly affected by competing quantum effects: above 25 K, zero-point energy (ZPE) perpendicular to the reaction path for diffusion between cavities decreases the quantum rate compared to the classical rate, whereas at lower temperatures tunneling outcompetes the ZPE and as a result the quantum rate is greater than the classical rate.

  2. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  3. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  4. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  5. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  6. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  7. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  8. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  9. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  10. Experimental Methodology for Estimation of Local Heat Fluxes and Burning Rates in Steady Laminar Boundary Layer Diffusion Flames.

    Science.gov (United States)

    Singh, Ajay V; Gollner, Michael J

    2016-06-01

    Modeling the realistic burning behavior of condensed-phase fuels has remained out of reach, in part because of an inability to resolve the complex interactions occurring at the interface between gas-phase flames and condensed-phase fuels. The current research provides a technique to explore the dynamic relationship between a combustible condensed fuel surface and gas-phase flames in laminar boundary layers. Experiments have previously been conducted in both forced and free convective environments over both solid and liquid fuels. A unique methodology, based on the Reynolds Analogy, was used to estimate local mass burning rates and flame heat fluxes for these laminar boundary layer diffusion flames utilizing local temperature gradients at the fuel surface. Local mass burning rates and convective and radiative heat feedback from the flames were measured in both the pyrolysis and plume regions by using temperature gradients mapped near the wall by a two-axis traverse system. These experiments are time-consuming and can be challenging to design as the condensed fuel surface burns steadily for only a limited period of time following ignition. The temperature profiles near the fuel surface need to be mapped during steady burning of a condensed fuel surface at a very high spatial resolution in order to capture reasonable estimates of local temperature gradients. Careful corrections for radiative heat losses from the thermocouples are also essential for accurate measurements. For these reasons, the whole experimental setup needs to be automated with a computer-controlled traverse mechanism, eliminating most errors due to positioning of a micro-thermocouple. An outline of steps to reproducibly capture near-wall temperature gradients and use them to assess local burning rates and heat fluxes is provided.

  11. Sorption kinetics of polycyclic aromatic hydrocarbons removal using granular activated carbon: Intraparticle diffusion coefficients

    International Nuclear Information System (INIS)

    Valderrama, C.; Gamisans, X.; Heras, X. de las; Farran, A.; Cortina, J.L.

    2008-01-01

    Granular activated carbon (GAC) was evaluated as a suitable sorbent for polycyclic aromatic hydrocarbons (PAHs) removal from aqueous solutions. For this purpose, kinetic measurements on the extraction of a family of six PAHs were taken. A morphology study was performed by means of a scanning electron microscopy (SEM) analysis of GAC samples. Analyses of the batch rate data for each PAH were carried out using two kinetic models: the homogenous particle diffusion model (HPDM) and the shell progressive model (SPM). The process was controlled by diffusion rate the solutes (PAHs) that penetrated the reacted layer at PAH concentrations in the range of 0.2-10 mg L -1 . The effective particle diffusion coefficients (D eff ) derived from the two models were determined from the batch rate data. The Weber and Morris intraparticle diffusion model made a double contribution to the surface and pore diffusivities in the sorption process. The D eff values derived from both the HPMD and SPM equations varied from 1.1 x 10 -13 to 6.0 x 10 -14 m 2 s -1 . The simplest model, the pore diffusion model, was applied first for data analysis. The model of the next level of complexity, the surface diffusion model, was applied in order to gain a deeper understanding of the diffusion process. This model is able to explain the data, and the apparent surface diffusivities are in the same order of magnitude as the values for the sorption of functionalized aromatic hydrocarbons (phenols and sulphonates) that are described in the literature

  12. Determination of H2 Diffusion Rates through Various Closures on TRU Waste Bag-Out Bags

    International Nuclear Information System (INIS)

    Noll, Phillip D. Jr.; Callis, E. Larry; Norman, Kirsten M.

    1999-01-01

    The amount of H 2 diffusion through twist and tape (horse-tail), wire tie, plastic tie, and heat sealed closures on transuranic (TRU) waste bag-out bags has been determined. H 2 diffusion through wire and plastic tie closures on TRU waste bag-out bags has not been previously characterized and, as such, TRU waste drums containing bags with these closures cannot be certified and/or shipped to the Waste Isolation Pilot Plant (WIPP). Since wire ties have been used at Los Alamos National Laboratory (LANL) from 1980 to 1991 and the plastic ties from 1991 to the present, there are currently thousands of waste drums that cannot be shipped to the WIPP site. Repackaging the waste would be prohibitively expensive. Diffusion experiments performed on the above mentioned closures show that the diffusion rates of plastic tie and horse-tail closures are greater than the accepted value presented in the TRU-PACT 11 Safety Analysis Report (SAR). Diffusion rates for wire tie closures are not statistically different from the SAR value. Thus, drums containing bags with these closures can now potentially be certified which would allow for their consequent shipment to WIPP

  13. Inverse method for determining radon diffusion coefficient and free radon production rate of fragmented uranium ore

    International Nuclear Information System (INIS)

    Ye, Yong-jun; Wang, Li-heng; Ding, De-xin; Zhao, Ya-li; Fan, Nan-bin

    2014-01-01

    The radon diffusion coefficient and the free radon production rate are important parameters for describing radon migration in the fragmented uranium ore. In order to determine the two parameters, the pure diffusion migration equation for radon was firstly established and its analytic solution with the two parameters to be determined was derived. Then, a self manufactured experimental column was used to simulate the pure diffusion of the radon, the improved scintillation cell method was used to measure the pore radon concentrations at different depths of the column loaded with the fragmented uranium ore, and the nonlinear least square algorithm was used to inversely determine the radon diffusion coefficient and the free radon production rate. Finally, the solution with the two inversely determined parameters was used to predict the pore radon concentrations at some depths of the column, and the predicted results were compared with the measured results. The results show that the predicted results are in good agreement with the measured results and the numerical inverse method is applicable to the determination of the radon diffusion coefficient and the free radon production rate for the fragmented uranium ore. - Highlights: • Inverse method for determining two transport parameters of radon is proposed. • A self-made experimental apparatus is used to simulate radon diffusion process. • Sampling volume and position for measuring radon concentration are optimized. • The inverse results of an experimental sample are verified

  14. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  15. Cooling Rates of Mantle Peridotites Estimated from Lithophile Trace Element Diffusion in Orthopyroxene

    Science.gov (United States)

    von der Handt, A.; Hellebrand, E.; Snow, J. E.

    2007-12-01

    Cooling rates of ocean floor mantle rocks from mid-ocean ridges can potentially provide important information about ridge dynamics, emplacement mechanisms and mantle uplift. There are a growing number of geospeedometric methods to retrieve such cooling rates in various settings. However, few exist for typical four- phase mantle peridotites and they only cover temperatures below 800° C. The down-temperature lithophile trace element exchange between clinopyroxene (cpx) and orthopyroxene (opx) can provide such a high- temperature spinel peridotite geospeedometer. Orthopyroxenes studied by SIMS from two fresh Gakkel Ridge peridotites are zoned in all trace elements while clinopyroxenes are homogeneous. This allows the calculation of equilibrium temperatures [1]. Several profiles in opx cover a range of 1250° C (opx core) to 800° C (opx rim) and are in agreement with straightforward diffusion and closure temperature models. The systematics of REE diffusion in opx deviate from the results of a recent experimental study [2]. The data allow us to estimate diffusion systematics of 16 elements (REE and TE) and their cation distributions in orthopyroxene. The data set is internally coherent as all elements were subjected to the same extrinsic parameters. 1. Decreasing ionic radius increases REE diffusion in opx (as it does in cpx). 2. M2-site diffusion is controlled more by ionic radius than by cationic charge. 3. M1-site diffusion is controlled by both ionic radius and cationic charge. 4. M1-site diffusion is generally slower than M2-site diffusion for isovalent cations, most likely because of higher M1- site energies compared to M2-site. The advantages of this geospeedometer should be its relatively good precision, use of standard analytical methods and its coverage of the important range between solidus temperatures and 800° C. In combination with other geospeedometers it will be possible to retrieve the continuous cooling history of a mantle rock from its solidus down

  16. Studies of ionic diffusion in crystalline rock

    International Nuclear Information System (INIS)

    Ohlsson, Yvonne

    2001-01-01

    Matrix diffusion is of great importance in delaying radionuclides escaping from a deep geologic repository, on their way to the biosphere. There are, however, poorly understood mechanisms related to transport in pores with charged pore surfaces. Ions are affected by this charge and may be repelled or attracted by it. The rate of transport may be reduced, or even enhanced, as a result of this. Transport of ions is studied by traditional diffusion experiments, but mainly by a faster electrical conductivity method. With this method the pore connectivity, the formation factor variability and its relation to the porosity, as well as the surface conductivity are investigated. The method is compared. with traditional diffusion experiments, and an in-situ application is suggested and qualitatively tested. Furthermore, surface diffusion is studied by evaluating literature data and recently developed diffusion models. The pore connectivity reached to a depth of at least 15 cm in the rocks studied. The formation factor did not generally decrease with increasing sample length. It was also found that not only cations in the free pore water add to the electrical conductivity, but also at least part of those sorbed to the pore surfaces of the minerals. This surface conductivity influences the determination of the formation factor in low ionic strength pore waters, and was also found to be a function of the formation factor. It was furthermore dependent on the type of ion at the surface, giving for example a higher conductivity for Na + than for Cs + . It is not fully understood which part of the sorbed ions that are mobile. A simple model was developed assigning the mobile ions to the diffuse layer, and this model explained experimental data for diffusion of Cs + in clay well. This is contradicted by surface conductivity measurements that have shown that most mobile ions are found behind the Stern layer. The in-situ formation factor determination method seems promising. The most

  17. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  18. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  19. An approximate stationary solution for multi-allele neutral diffusion with low mutation rates.

    Science.gov (United States)

    Burden, Conrad J; Tang, Yurong

    2016-12-01

    We address the problem of determining the stationary distribution of the multi-allelic, neutral-evolution Wright-Fisher model in the diffusion limit. A full solution to this problem for an arbitrary K×K mutation rate matrix involves solving for the stationary solution of a forward Kolmogorov equation over a (K-1)-dimensional simplex, and remains intractable. In most practical situations mutations rates are slow on the scale of the diffusion limit and the solution is heavily concentrated on the corners and edges of the simplex. In this paper we present a practical approximate solution for slow mutation rates in the form of a set of line densities along the edges of the simplex. The method of solution relies on parameterising the general non-reversible rate matrix as the sum of a reversible part and a set of (K-1)(K-2)/2 independent terms corresponding to fluxes of probability along closed paths around faces of the simplex. The solution is potentially a first step in estimating non-reversible evolutionary rate matrices from observed allele frequency spectra. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  1. Diffusion and flow of water vapours in chromatographic Alumina gel

    International Nuclear Information System (INIS)

    Khan, M.; Shah, H. U.

    2005-01-01

    The kinetics of sorption of water vapours in chromatographic alumina gel was studied. Water vapours are adsorbed on the gel at temperature (15 degree C) at different constant relative pressure from 0.1-0.93 p/p. Rate constant, Effective diffusivities, Knudsen diffusivities and bulk diffusivities were determined through Fick type equation. Total pore volume is 0.498 cc g-1 and specific surface area comes to be 465 m2 g-1 as obtained by Gurvitsch rule and Kieselve's quantities respectively. An average pore radius (hydraulic) is 1.1x10/sub -7/ cm. The study of these quantities provide a strong basis for evaluating surface properties. (author)

  2. Effects on atmospheric diffusion of meterological processes in coastal zones

    International Nuclear Information System (INIS)

    Raynor, G.S.

    1977-01-01

    Meteorological processes in coastal zones differ from those inland because of the surface discontinuity between land and water. The difference in heating between the two surfaces gives rise to sea or lake breeze circulations which can transport pollutants in nongradient directions and recirculate them over source areas. The step change in surface characteristics at the land-water interface also causes formation of internal boundary layers having different transport velocities and diffusion rates than unmodified air upwind or above the boundary. These features require a more extensive measurement program and more versatile diffusion models than at inland sites

  3. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  4. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  5. Prediction Of Abrasive And Diffusive Tool Wear Mechanisms In Machining

    Science.gov (United States)

    Rizzuti, S.; Umbrello, D.

    2011-01-01

    Tool wear prediction is regarded as very important task in order to maximize tool performance, minimize cutting costs and improve the quality of workpiece in cutting. In this research work, an experimental campaign was carried out at the varying of cutting conditions with the aim to measure both crater and flank tool wear, during machining of an AISI 1045 with an uncoated carbide tool P40. Parallel a FEM-based analysis was developed in order to study the tool wear mechanisms, taking also into account the influence of the cutting conditions and the temperature reached on the tool surfaces. The results show that, when the temperature of the tool rake surface is lower than the activation temperature of the diffusive phenomenon, the wear rate can be estimated applying an abrasive model. In contrast, in the tool area where the temperature is higher than the diffusive activation temperature, the wear rate can be evaluated applying a diffusive model. Finally, for a temperature ranges within the above cited values an adopted abrasive-diffusive wear model furnished the possibility to correctly evaluate the tool wear phenomena.

  6. Oxide film assisted dopant diffusion in silicon carbide

    Energy Technology Data Exchange (ETDEWEB)

    Tin, Chin-Che, E-mail: cctin@physics.auburn.ed [Department of Physics, Auburn University, Alabama 36849 (United States); Mendis, Suwan [Department of Physics, Auburn University, Alabama 36849 (United States); Chew, Kerlit [Department of Electrical and Electronic Engineering, Faculty of Engineering and Science, Universiti Tunku Abdul Rahman, Kuala Lumpur (Malaysia); Atabaev, Ilkham; Saliev, Tojiddin; Bakhranov, Erkin [Physical Technical Institute, Uzbek Academy of Sciences, 700084 Tashkent (Uzbekistan); Atabaev, Bakhtiyar [Institute of Electronics, Uzbek Academy of Sciences, 700125 Tashkent (Uzbekistan); Adedeji, Victor [Department of Chemistry, Geology and Physics, Elizabeth City State University, North Carolina 27909 (United States); Rusli [School of Electrical and Electronic Engineering, Nanyang Technological University (Singapore)

    2010-10-01

    A process is described to enhance the diffusion rate of impurities in silicon carbide so that doping by thermal diffusion can be done at lower temperatures. This process involves depositing a thin film consisting of an oxide of the impurity followed by annealing in an oxidizing ambient. The process uses the lower formation energy of silicon dioxide relative to that of the impurity-oxide to create vacancies in silicon carbide and to promote dissociation of the impurity-oxide. The impurity atoms then diffuse from the thin film into the near-surface region of silicon carbide.

  7. Oxide film assisted dopant diffusion in silicon carbide

    International Nuclear Information System (INIS)

    Tin, Chin-Che; Mendis, Suwan; Chew, Kerlit; Atabaev, Ilkham; Saliev, Tojiddin; Bakhranov, Erkin; Atabaev, Bakhtiyar; Adedeji, Victor; Rusli

    2010-01-01

    A process is described to enhance the diffusion rate of impurities in silicon carbide so that doping by thermal diffusion can be done at lower temperatures. This process involves depositing a thin film consisting of an oxide of the impurity followed by annealing in an oxidizing ambient. The process uses the lower formation energy of silicon dioxide relative to that of the impurity-oxide to create vacancies in silicon carbide and to promote dissociation of the impurity-oxide. The impurity atoms then diffuse from the thin film into the near-surface region of silicon carbide.

  8. The Diffusive Boundary-Layer of Sediments - Oxygen Microgradients Over a Microbial Mat

    DEFF Research Database (Denmark)

    JØRGENSEN, BB; MARAIS, DJD

    1990-01-01

    Oxygen microelectrodes were used to analyze the distribution of the diffusive boundary layer (DBL) at the sedimen-water interface in relation to surface topography and flow velocity. The sediment, collected from saline ponds, was covered by a microbial mat that had high oxygen consumption rate...... and well-defined surface structure. Diffusion through the DBL constituted an important rate limitation to the oxygen uptake of the sediment. The mean effective DBL thickness decreased from 0.59 to 0.16 mm as the flow velocity of the overlying water was increased from 0.3 to 7.7 cm s-1 (measured 1 cm above...

  9. Transition Process from Diffuser Stall to Stage Stall in a Centrifugal Compressor with a Vaned Diffuser

    Directory of Open Access Journals (Sweden)

    Nobumichi Fujisawa

    2017-01-01

    Full Text Available The transition process from a diffuser rotating stall to a stage stall in a centrifugal compressor with a vaned diffuser was investigated by experimental and numerical analyses. From the velocity measurements, it was found that the rotating stall existed on the shroud side of the diffuser passage in the off-design flow condition. The numerical results revealed the typical vortical structure of the diffuser stall. The diffuser stall cell was caused by the systematic vortical structure which consisted of the tornado-type vortex, the longitudinal vortex at the shroud/suction surface corner (i.e., leading edge vortex (LEV, and the vortex in the throat area of the diffuser passages. Furthermore, the stage stall, which rotated within both the impeller and diffuser passages, occurred instead of the diffuser stall as the mass flow rate was decreased. According to the velocity measurements at the diffuser inlet, the diffuser stall which rotated on the shroud side was shifted to the hub side. Then, the diffuser stall moved into the impeller passages and formed the stage stall. Therefore, the stage stall was caused by the development of the diffuser stall, which transferred from the shroud side to the hub side in the vaneless space and expanded to the impeller passages.

  10. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  11. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  12. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  13. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  14. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  15. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  16. Rates of convergence and asymptotic normality of curve estimators for ergodic diffusion processes

    NARCIS (Netherlands)

    J.H. van Zanten (Harry)

    2000-01-01

    textabstractFor ergodic diffusion processes, we study kernel-type estimators for the invariant density, its derivatives and the drift function. We determine rates of convergence and find the joint asymptotic distribution of the estimators at different points.

  17. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  18. Fluorine atom subsurface diffusion and reaction in photoresist

    International Nuclear Information System (INIS)

    Greer, Frank; Fraser, D.; Coburn, J.W.; Graves, David B.

    2003-01-01

    Kinetic studies of fluorine and deuterium atoms interacting with an OiR 897 10i i-line photoresist (PR) are reported. All experiments were conducted at room temperature. Films of this PR were coated on quartz-crystal microbalance (QCM) substrates and exposed to alternating fluxes of these atoms in a high vacuum apparatus. Mass changes of the PR were observed in situ and in real time during the atom beam exposures using the QCM. A molecular-beam sampled differentially pumped quadrupole mass spectrometer (QMS) was used to measure the species desorbing from the PR surface during the F and D atom exposures. During the D atom exposures, hydrogen abstraction and etching of the PR was observed, but no DF formation was detected. However, during the F atom exposures, the major species observed to desorb from the surface was DF, formed from fluorine abstraction of deuterium from the photoresist. No evidence of film etching or fluorine self-abstraction was observed. The film mass increased during F atom exposure, evidently due to the replacement of D by F in the film. The rate of DF formation and mass uptake were both characterized by the same kinetics: An initially rapid step declining exponentially with time (e -t/τ ), followed by a much slower step following inverse square root of time (t -1/2 ) kinetics. The initially rapid step was interpreted as surface abstraction of D by F to form DF, which desorbs, with subsequent F impacting the surface inserted into surface C dangling bonds. The slower step was interpreted as F atoms diffusing into the fluorinated photoresist, forming DF at the boundary of the fluorinated carbon layer. The t -1/2 kinetics of this step are interpreted to indicate that F diffusion through the fluorinated carbon layer is much slower than the rate of F abstraction of D to form DF, or the rate of F insertion into the carbon dangling bonds left behind after DF formation. A diffusion-limited growth model was formulated, and the model parameters are

  19. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  20. Internal Diffusion-Controlled Enzyme Reaction: The Acetylcholinesterase Kinetics.

    Science.gov (United States)

    Lee, Sangyun; Kim, Ji-Hyun; Lee, Sangyoub

    2012-02-14

    Acetylcholinesterase is an enzyme with a very high turnover rate; it quenches the neurotransmitter, acetylcholine, at the synapse. We have investigated the kinetics of the enzyme reaction by calculating the diffusion rate of the substrate molecule along an active site channel inside the enzyme from atomic-level molecular dynamics simulations. In contrast to the previous works, we have found that the internal substrate diffusion is the determinant of the acetylcholinesterase kinetics in the low substrate concentration limit. Our estimate of the overall bimolecular reaction rate constant for the enzyme is in good agreement with the experimental data. In addition, the present calculation provides a reasonable explanation for the effects of the ionic strength of solution and the mutation of surface residues of the enzyme. The study suggests that internal diffusion of the substrate could be a key factor in understanding the kinetics of enzymes of similar characteristics.

  1. Modelling and analysis of material removal rate and surface roughness in wire-cut EDM of armour materials

    Directory of Open Access Journals (Sweden)

    Ravindranadh Bobbili

    2015-12-01

    Full Text Available The current work presents a comparative study of wire electrical discharge machining (WEDM of armour materials such as aluminium alloy 7017 and rolled homogeneous armour (RHA steel using buckingham pi theorem to model the input variables and thermo-physical characteristics of WEDM on material removal rate (MRR and surface roughness (Ra of Al 7017 and RHA steel. The parameters of the model such as pulse-on time, flushing pressure, input power, thermal diffusivity and latent heat of vaporization have been determined through design of experiment methodology. Wear rate of brass wire increases with rise in input energy in machining Al 7017. The dependence of thermo-physical properties and machining variables on mechanism of MRR and Ra has been described by performing scanning electron microscope (SEM study. The rise in pulse-on time from 0.85μs to 1.25μs causes improvement in MRR and deterioration of surface finish. The machined surface has revealed that craters are found on the machined surface. The propensity of formation of craters increases during WEDM with a higher current and larger pulse-on time.

  2. The rate of diffusion into advanced gas cooled reactor moderator bricks: an equivalent cylinder model

    International Nuclear Information System (INIS)

    Kyte, W.S.

    1980-01-01

    The graphite moderator bricks which make up the moderator of an advanced gas-cooled nuclear reactor (AGR) are of many different and complex shapes. Many physico-chemical processes that occur within these porous bricks include a diffusional step and thus to model these processes it is necessary to solve the diffusion equation (with chemical reaction) in a porous medium of complex shape. A finite element technique is applied to calculating the rate at which nitrogen diffuses into and out of the porous moderator graphite during operation of a shutdown procedure for an AGR. However, the finite element method suffers from several disadvantages that undermine its general usefulness for calculating rates of diffusion in AGR moderator cores. A model which overcomes some of these disadvantages is presented (the equivalent cylinder model) and it is shown that this gives good results for a variety of different boundary and initial conditions

  3. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  4. Isopleths of surface concentration and surface exposure rate due to a radioactive cloud released from a stack

    International Nuclear Information System (INIS)

    Kobayashi, Hideo; Yabuta, Hajimu; Katagiri, Hiroshi; Obata, Kazuichi; Kokubu, Morinobu

    1982-03-01

    Various calculations are made to estimate the distributions of concentration and γ-exposure rate due to a radioactive cloud released from a point source to the atmosphere. In this report, the isopleths of concentration and γ-exposure rate which were calculated are given in graphs to enable rapid prediction of the influence of released radioactive material in the emergency situation. Recently there are facilities which are equipped with a system to display the calculation results on CRT; but such practice is rather rare. By placing the calculated isopleths of reduction scale 1/25000 or 1/50000 on the usual map, any facilities without the CRT system can readily estimate the influence of an accidental release. The graphs of isopleths are given with the release height (11 values of 0 to 200 m at about 20 m intervals) and the atmospheric stability (6 classes) as parameters. Calculations of γ-exposure rates were made using the computer code GAMPUL developed by T. Hayashi and T. Shiraishi. In the calculation of radioactive concentrations and γ-exposure rates, the vertical diffusion depths, σsub(z), exceeding 1000 m are taken to be 1000 m according to the Meteorological Guide for the Safety Analysis of Power Reactor (J.AEC). The comparison between with and without this limitation in σsub(z) is made in the case of downwind axial surface distributions. (author)

  5. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  6. A photo-tunable membrane based on inter-particle crosslinking for decreasing diffusion rates

    KAUST Repository

    Li, Song; Moosa, Basem; Chen, Ye; Li, Wengang; Khashab, Niveen M.

    2015-01-01

    %. To prove the applicability of the designed system, the composite membrane was coated on a model drug reservoir tablet. Upon irradiating the tablet with UV light, the original permeability decreased by 57%, and consequently the diffusion rate of the cargo

  7. Detection of 41Ar diffusion from a TRIGA pool

    International Nuclear Information System (INIS)

    Foss, Scott; Nelson, George

    1990-01-01

    Argon-41 levels in very low concentrations in the reactor room air can be inferred from the rate of escape from the pool water surface. The rate of Argon-41 diffusion from pool water to room air was determined by the measurement of the activity buildup in containers of air in contact with the pool surface. The Argon-41 concentration in each container was measured by gamma-ray spectrometry with a calibrated GeLi detector. At 100 KW power with the water temperature at 10 deg. Celsius the total release of Argon-41 was determined to be 3.5e10±15% atoms for 80 minutes of operation. The corresponding activity released from the pool was 98.6 microcuries, while the total activity produced in the pool was 4900 microcuries. The diffusion coefficient of Argon-41 from the pool water surface to the air at this temperature was measured to be 3.14e-14 sec-cm 2 . (author)

  8. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    International Nuclear Information System (INIS)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S.; Jarašiūnas, K.; Vengris, M.; Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D.

    2014-01-01

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10 18  cm −3 , a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses

  9. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    Energy Technology Data Exchange (ETDEWEB)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S., E-mail: saulius.nargelas@ff.vu.lt; Jarašiūnas, K. [Department of Semiconductor Optoelectronics, Institute of Applied Research, Vilnius University, Saulėtekio 9–III, 10222 Vilnius (Lithuania); Vengris, M. [Laser Research Center, Vilnius University, Saulėtekio 10, 10223 Vilnius (Lithuania); Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D. [Veeco Instruments, Turbodisc Operations, 394 Elizabeth Avenue, Somerset, New Jersey 08873 (United States)

    2014-01-13

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10{sup 18} cm{sup −3}, a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses.

  10. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  11. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  12. Electrochemical evidences and consequences of significant differences in ions diffusion rate in polyacrylate-based ion-selective membranes.

    Science.gov (United States)

    Woźnica, Emilia; Mieczkowski, Józef; Michalska, Agata

    2011-11-21

    The origin and effect of surface accumulation of primary ions within the ion-selective poly(n-butyl acrylate)-based membrane, obtained by thermal polymerization, is discussed. Using a new method, based on the relation between the shape of a potentiometric plot and preconditioning time, the diffusion of copper ions in the membrane was found to be slow (the diffusion coefficient estimated to be close to 10(-11) cm(2) s(-1)), especially when compared to ion-exchanger counter ions--sodium cations diffusion (a diffusion coefficient above 10(-9) cm(2) s(-1)). The higher mobility of sodium ions than those of the copper-ionophore complex results in exposed ion-exchanger role leading to undesirably exposed sensitivity to sodium or potassium ions.

  13. Diffusion Influenced Adsorption Kinetics.

    Science.gov (United States)

    Miura, Toshiaki; Seki, Kazuhiko

    2015-08-27

    When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

  14. On diffusion processes with variable drift rates as models for decision making during learning

    International Nuclear Information System (INIS)

    Eckhoff, P; Holmes, P; Law, C; Connolly, P M; Gold, J I

    2008-01-01

    We investigate Ornstein-Uhlenbeck and diffusion processes with variable drift rates as models of evidence accumulation in a visual discrimination task. We derive power-law and exponential drift-rate models and characterize how parameters of these models affect the psychometric function describing performance accuracy as a function of stimulus strength and viewing time. We fit the models to psychophysical data from monkeys learning the task to identify parameters that best capture performance as it improves with training. The most informative parameter was the overall drift rate describing the signal-to-noise ratio of the sensory evidence used to form the decision, which increased steadily with training. In contrast, secondary parameters describing the time course of the drift during motion viewing did not exhibit steady trends. The results indicate that relatively simple versions of the diffusion model can fit behavior over the course of training, thereby giving a quantitative account of learning effects on the underlying decision process

  15. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  16. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  17. Diffraction and diffusion in room acoustics

    DEFF Research Database (Denmark)

    Rindel, Jens Holger; Rasmussen, Birgit

    1996-01-01

    Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

  18. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  19. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  20. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  1. An investigation of multi-rate sound decay under strongly non-diffuse conditions: The crypt of the Cathedral of Cadiz

    Science.gov (United States)

    Martellotta, Francesco; Álvarez-Morales, Lidia; Girón, Sara; Zamarreño, Teófilo

    2018-05-01

    Multi-rate sound decays are often found and studied in complex systems of coupled volumes where diffuse field conditions generally apply, although the openings connecting different sub-spaces are by themselves potential causes of non-diffuse behaviour. However, in presence of spaces in which curved surfaces clearly prevent diffuse field behaviour from being established, things become more complex and require more sophisticated tools (or, better, combinations of them) to be fully understood. As an example of such complexity, the crypt of the Cathedral of Cadiz is a relatively small space characterised by a central vaulted rotunda, with five radial galleries with flat and low ceiling. In addition, the crypt is connected to the main cathedral volume by means of several small openings. Acoustic measurements carried out in the crypt pointed out the existence of at least two decay processes combined, in some points, with flutter echoes. Application of conventional methods of analysis pointed out the existence of significant differences between early decay time and reverberation time, but was inconclusive in explaining the origin of the observed phenomena. The use of more robust Bayesian analysis permitted the conclusion that the late decay appearing in the crypt had a different rate than that observed in the cathedral, thus excluding the explanation based on acoustic coupling of different volumes. Finally, processing impulse responses collected by means of a B-format microphone to obtain directional intensity maps demonstrated that the late decay was originated from the rotunda where a repetitive reflection pattern appeared between the floor and the dome causing both flutter echoes and a longer reverberation time.

  2. Functional evaluation of hydronephrosis by diffusion-weighted MR imaging: Relationship between apparent diffusion coefficient and split glomerular filtration rate

    International Nuclear Information System (INIS)

    Toyoshima, S.; Noguchi, K.; Seto, H.; Shimizu, M.; Watanabe, N.

    2000-01-01

    To determine the relationship between apparent diffusion coefficient (ADC) values measured by diffusion-weighted MR imaging and split renal function determined by renal scintigraphy in patients with hydronephrosis. Material and Methods: Diffusion-weighted imaging on a 1.5 T MR unit and renal scintigraphy were performed in 36 patients with hydronephrosis (45 hydronephrotic kidneys, 21 non-hydronephrotic kidneys). ADC values of the individual kidneys were measured by diffusion-weighted MR imaging. Split renal function (glomerular filtration rate (GFR)) was determined by renal scintigraphy using 99m Tc-DTPA. The relationship between ADC values and split GFR was examined in 66 kidneys. The hydronephrotic kidneys were further classified into three groups (severe renal dysfunction, GFR 25 ml/min, n=28), and mean values for ADCs were calculated. Results: In hydronephrotic kidneys, there was a moderate positive correlation between ADC values and split GFR (R2=0.56). On the other hand, in non-hydronephrotic kidneys, poor correlation between ADC values and split GFR was observed (R2=0.08). The mean values for ADCs of the dysfunctioning hydronephrotic kidneys (severe renal dysfunction, 1.32x10 -3 ±0.18x10 -3 mm 2 /s; moderate renal dysfunction, 1.38x10 -3 ±0.10x10 -3 mm2/s) were significantly lower than that of the normal functioning hydronephrotic kidneys (1.63x10 -3 ±0.12±10 -3 mm 2 /s). Conclusion: These results indicated that measurement of ADC values by diffusion-weighted MR imaging has a potential value in the evaluation of the functional status of hydronephrotic kidneys

  3. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  4. Surface and sub-surface thermal oxidation of thin ruthenium films

    Energy Technology Data Exchange (ETDEWEB)

    Coloma Ribera, R.; Kruijs, R. W. E. van de; Yakshin, A. E.; Bijkerk, F. [MESA+ Institute for Nanotechnology, University of Twente, P.O. Box 217, 7500 AE Enschede (Netherlands); Kokke, S.; Zoethout, E. [FOM Dutch Institute for Fundamental Energy Research (DIFFER), P.O. Box 1207, 3430 BE Nieuwegein (Netherlands)

    2014-09-29

    A mixed 2D (film) and 3D (nano-column) growth of ruthenium oxide has been experimentally observed for thermally oxidized polycrystalline ruthenium thin films. Furthermore, in situ x-ray reflectivity upon annealing allowed the detection of 2D film growth as two separate layers consisting of low density and high density oxides. Nano-columns grow at the surface of the low density oxide layer, with the growth rate being limited by diffusion of ruthenium through the formed oxide film. Simultaneously, with the growth of the columns, sub-surface high density oxide continues to grow limited by diffusion of oxygen or ruthenium through the oxide film.

  5. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  6. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  7. Edge flame instability in low-strain-rate counterflow diffusion flames

    Energy Technology Data Exchange (ETDEWEB)

    Park, June Sung; Hwang, Dong Jin; Park, Jeong; Kim, Jeong Soo; Kim, Sungcho [School of Mechanical and Aerospace Engineering, Sunchon National University, 315 Maegok-dong, Suncheon, Jeonnam 540-742 (Korea, Republic of); Keel, Sang In [Environment & amp; Energy Research Division, Korea Institute of Machinery and Materials, P.O. Box 101, Yusung-gu, Taejon 305-343 (Korea, Republic of); Kim, Tae Kwon [School of Mechanical & amp; Automotive Engineering, Keimyung University, 1000 Sindang-dong, Dalseo-gu, Daegu 704-701 (Korea, Republic of); Noh, Dong Soon [Energy System Research Department, Korea Institute of Energy Research, 71-2 Jang-dong, Yusung-gu, Taejon 305-343 (Korea, Republic of)

    2006-09-15

    Experiments in low-strain-rate methane-air counterflow diffusion flames diluted with nitrogen have been conducted to study flame extinction behavior and edge flame oscillation in which flame length is less than the burner diameter and thus lateral conductive heat loss, in addition to radiative loss, could be high at low global strain rates. The critical mole fraction at flame extinction is examined in terms of velocity ratio and global strain rate. Onset conditions of the edge flame oscillation and the relevant modes are also provided with global strain rate and nitrogen mole fraction in the fuel stream or in terms of fuel Lewis number. It is observed that flame length is intimately relevant to lateral heat loss, and this affects flame extinction and edge flame oscillation considerably. Lateral heat loss causes flame oscillation even at fuel Lewis number less than unity. Edge flame oscillations, which result from the advancing and retreating edge flame motion of the outer flame edge of low-strain-rate flames, are categorized into three modes: a growing, a decaying, and a harmonic-oscillation mode. A flame stability map based on the flame oscillation modes is also provided for low-strain-rate flames. The important contribution of lateral heat loss even to edge flame oscillation is clarified finally. (author)

  8. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  9. A Reaction-Diffusion-Based Coding Rate Control Mechanism for Camera Sensor Networks

    Directory of Open Access Journals (Sweden)

    Naoki Wakamiya

    2010-08-01

    Full Text Available A wireless camera sensor network is useful for surveillance and monitoring for its visibility and easy deployment. However, it suffers from the limited capacity of wireless communication and a network is easily overflown with a considerable amount of video traffic. In this paper, we propose an autonomous video coding rate control mechanism where each camera sensor node can autonomously determine its coding rate in accordance with the location and velocity of target objects. For this purpose, we adopted a biological model, i.e., reaction-diffusion model, inspired by the similarity of biological spatial patterns and the spatial distribution of video coding rate. Through simulation and practical experiments, we verify the effectiveness of our proposal.

  10. A reaction-diffusion-based coding rate control mechanism for camera sensor networks.

    Science.gov (United States)

    Yamamoto, Hiroshi; Hyodo, Katsuya; Wakamiya, Naoki; Murata, Masayuki

    2010-01-01

    A wireless camera sensor network is useful for surveillance and monitoring for its visibility and easy deployment. However, it suffers from the limited capacity of wireless communication and a network is easily overflown with a considerable amount of video traffic. In this paper, we propose an autonomous video coding rate control mechanism where each camera sensor node can autonomously determine its coding rate in accordance with the location and velocity of target objects. For this purpose, we adopted a biological model, i.e., reaction-diffusion model, inspired by the similarity of biological spatial patterns and the spatial distribution of video coding rate. Through simulation and practical experiments, we verify the effectiveness of our proposal.

  11. Surface energy anisotropy of tungsten

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, R; Grenga, H E [Georgia Inst. of Tech., Atlanta (USA). School of Chemical Engineering

    1976-10-01

    Field-ion microscopy was used to study the faceting behavior and/or surface energy anisotropy of tungsten in vacuum and in hydrogen. In vacuum below 1700 K the activation energy for (110) facet growth agreed with values previously reported for surface diffusion on tungsten. The observed anisotropy values at 0.5 Tsub(m), where Tsub(m) is the absolute melting temperature of tungsten (approximately 3680 K), were different from those previously reported at higher temperatures and more nearly agreed with broken bond calculations based on Mie potential using m=5, n=8, and a 1.5% lattice expansion. Hydrogen appeared to have a negligible effect on surface energy anisotropy, but did preferentially increase surface diffusion rates on (310) regions.

  12. A dissolution-diffusion sliding model for soft rock grains with hydro-mechanical effect

    Directory of Open Access Journals (Sweden)

    Z. Liu

    2018-06-01

    Full Text Available The deformation and failure of soft rock affected by hydro-mechanical (HM effect are one of the most concerns in geotechnical engineering, which are basically attributed to the grain sliding of soft rock. This study tried to develop a dissolution-diffusion sliding model for the typical red bed soft rock in South China. Based on hydration film, mineral dissolution and diffusion theory, and geochemical thermodynamics, a dissolution-diffusion sliding model with the HM effect was established to account for the sliding rate. Combined with the digital image processing technology, the relationship between the grain size of soft rock and the amplitude of sliding surface was presented. An equation for the strain rate of soft rocks under steady state was also derived. The reliability of the dissolution-diffusion sliding model was verified by triaxial creep tests on the soft rock with the HM coupling effect and by the relationship between the inversion average disjoining pressure and the average thickness of the hydration film. The results showed that the sliding rate of the soft rock grains was affected significantly by the waviness of sliding surface, the shear stress, and the average thickness of hydration film. The average grain size is essential for controlling the steady-state creep rate of soft rock. This study provides a new idea for investigating the deformation and failure of soft rock with the HM effect. Keywords: Soft rock, Hydro-mechanical (HM effect, Mineral dissolution-diffusion, Grain sliding model

  13. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  14. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  15. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  16. The Dynamics of Controlled Flow Separation within a Diverter Duct Diffuser

    Science.gov (United States)

    Peterson, C. J.; Vukasinovic, B.; Glezer, A.

    2016-11-01

    The evolution and receptivity to fluidic actuation of the flow separation within a rectangular, constant-width, diffuser that is branched off of a primary channel is investigated experimentally at speeds up to M = 0.4. The coupling between the diffuser's adverse pressure gradient and the internal separation that constricts nearly half of the flow passage through the duct is controlled using a spanwise array of fluidic actuators on the surface upstream of the diffuser's inlet plane. The dynamics of the separating surface vorticity layer in the absence and presence of actuation are investigated using high-speed particle image velocimetry combined with surface pressure measurements and total pressure distributions at the primary channel's exit plane. It is shown that the actuation significantly alters the incipient dynamics of the separating vorticity layer as the characteristic cross stream scales of the boundary layer upstream of separation and of the ensuing vorticity concentrations within the separated flow increase progressively with actuation level. It is argued that the dissipative (high frequency) actuation alters the balance between large- and small-scale motions near separation by intensifying the large-scale motions and limiting the small-scale dynamics. Controlling separation within the diffuser duct also has a profound effect on the global flow. In the presence of actuation, the mass flow rate in the primary duct increases 10% while the fraction of the diverted mass flow rate in the diffuser increases by more than 45% at 0.7% actuation mass fraction. Supported by the Boeing Company.

  17. A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

    Science.gov (United States)

    Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

    2016-01-01

    Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

  18. Flagella-Driven Flows Circumvent Diffusive Bottlenecks that Inhibit Metabolite Exchange

    Science.gov (United States)

    Short, Martin; Solari, Cristian; Ganguly, Sujoy; Kessler, John; Goldstein, Raymond; Powers, Thomas

    2006-03-01

    The evolution of single cells to large and multicellular organisms requires matching the organisms' needs to the rate of exchange of metabolites with the environment. This logistic problem can be a severe constraint on development. For organisms with a body plan that approximates a spherical shell, such as colonies of the volvocine green algae, the required current of metabolites grows quadratically with colony radius whereas the rate at which diffusion can exchange metabolites grows only linearly with radius. Hence, there is a bottleneck radius beyond which the diffusive current cannot keep up with metabolic demands. Using Volvox carteri as a model organism, we examine experimentally and theoretically the role that advection of fluid by surface-mounted flagella plays in enhancing nutrient uptake. We show that fluid flow driven by the coordinated beating of flagella produces a convective boundary layer in the concentration of a diffusing solute which in turn renders the metabolite exchange rate quadratic in the colony radius. This enhanced transport circumvents the diffusive bottleneck, allowing increase in size and thus evolutionary transitions to multicellularity in the Volvocales.

  19. Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

    2016-09-15

    Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

  20. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  1. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  2. Phototransformation rate constants of PAHs associated with soot particles

    International Nuclear Information System (INIS)

    Kim, Daekyun; Young, Thomas M.; Anastasio, Cort

    2013-01-01

    Photodegradation is a key process governing the residence time and fate of polycyclic aromatic hydrocarbons (PAHs) in particles, both in the atmosphere and after deposition. We have measured photodegradation rate constants of PAHs in bulk deposits of soot particles illuminated with simulated sunlight. The photodegradation rate constants at the surface (k p 0 ), the effective diffusion coefficients (D eff ), and the light penetration depths (z 0.5 ) for PAHs on soot layers of variable thickness were determined by fitting experimental data with a model of coupled photolysis and diffusion. The overall disappearance rates of irradiated low molecular weight PAHs (with 2–3 rings) on soot particles were influenced by fast photodegradation and fast diffusion kinetics, while those of high molecular weight PAHs (with 4 or more rings) were apparently controlled by either the combination of slow photodegradation and slow diffusion kinetics or by very slow diffusion kinetics alone. The value of z 0.5 is more sensitive to the soot layer thickness than the k p 0 value. As the thickness of the soot layer increases, the z 0.5 values increase, but the k p 0 values are almost constant. The effective diffusion coefficients calculated from dark experiments are generally higher than those from the model fitting method for illumination experiments. Due to the correlation between k p 0 and z 0.5 in thinner layers, D eff should be estimated by an independent method for better accuracy. Despite some limitations of the model used in this study, the fitted parameters were useful for describing empirical results of photodegradation of soot-associated PAHs. - Highlights: ► PAHs on soot were evaluated by a model of coupled photolysis and diffusion. ► Photodegradation rate at the surface, diffusion coefficient, and light penetration path were determined. ► Low MW PAHs were influenced by fast photodegradation and fast diffusion. ► High MW PAHs were controlled either by slow

  3. Models of diffuse solar radiation

    Energy Technology Data Exchange (ETDEWEB)

    Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)

    2008-04-15

    For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)

  4. Rating of roofs’ surfaces regarding their solar potential and suitability for PV systems, based on LiDAR data

    International Nuclear Information System (INIS)

    Lukač, Niko; Žlaus, Danijel; Seme, Sebastijan; Žalik, Borut; Štumberger, Gorazd

    2013-01-01

    Highlights: ► A new method for estimating and rating buildings roofs’ solar potential is presented. ► Considering LiDAR geospatial data together with pyranometer measurements. ► Use of multi-resolution shadowing model with new heuristic vegetation shadowing. ► High correlation between estimated solar potential and onsite measurements. -- Abstract: The roof surfaces within urban areas are constantly attracting interest regarding the installation of photovoltaic systems. These systems can improve self-sufficiency of electricity supply, and can help to decrease the emissions of greenhouse gases throughout urban areas. Unfortunately, some roof surfaces are unsuitable for installing photovoltaic systems. This presented work deals with the rating of roof surfaces within urban areas regarding their solar potential and suitability for the installation of photovoltaic systems. The solar potential of a roof’s surface is determined by a new method that combines extracted urban topography from LiDAR data with the pyranometer measurements of global and diffuse solar irradiances. Heuristic annual vegetation shadowing and a multi-resolution shadowing model, complete the proposed method. The significance of different influential factors (e.g. shadowing) was analysed extensively. A comparison between the results obtained by the proposed method and measurements performed on an actual PV power plant showed a correlation agreement of 97.4%.

  5. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  6. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  7. Deuterium permeation and diffusion in high-purity beryllium

    International Nuclear Information System (INIS)

    Abramov, E.; Riehm, M.P.; Thompson, D.A.; Smeltzer, W.W.

    1990-01-01

    The permeation rate of deuterium through high-purity beryllium membranes was measured using the gas-driven permeation technique. The time-dependent and the steady-state deuterium flux data were analyzed and the effective diffusivities of the samples were determined. Using multilayer permeation theory the effects of surface oxide were eliminated and the diffusion coefficients of the bulk beryllium determined. The diffusion parameters obtained for the extra-grade beryllium samples (99.8%) are D 0 =6.7x10 -9 m 2 /s and E D =28.4 kJ/mol. For the high-grade beryllium samples (99%) the parameters are D 0 =8.0x10 -9 m 2 /s and E D =35.1 kJ/mol. (orig.)

  8. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  9. Durability predictions from rate of diffusion testing of normal portland cement, fly ash, and slag concrete

    International Nuclear Information System (INIS)

    Philipose, K.E.

    1991-09-01

    A waste repository for the belowground disposal of low-level radioactive waste, labelled IRUS (Intrusion Resistant Underground Structure), is planned at the Chalk River Laboratories. It relies greatly on the durability of concrete for a minimum of 500 years of service life. A research program based on laboratory testing to design a durable concrete and predict its useful engineered service life is in progress. The durability of concrete depends on its resistance to deterioration from both internal and external causes. Since the rate of degradation depends to a major extent on the rate of ingress of aggressive ions into concrete, laboratory testing is in progress to establish the diffusion rates of chlorides and sulphate ions. A total of 1000 concrete specimens and 500 paste specimens are being exposed at 22 degrees and 45 degrees C to twenty-five different combinations of corrosive agents, including CO 2 . Procedures to measure the ionic penetration profile and to determine the factors controlling diffusion of ions in the various concretes have been developed. The paper presents the initial results from the research program and the longevity predictions to qualify concretes for the IRUS waste repository, based on 16 months of diffusion testing on laboratory specimens

  10. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  11. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  12. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  13. Surface migration in sorption processes

    International Nuclear Information System (INIS)

    Rasmuson, A.; Neretnieks, J.

    1983-03-01

    Diffusion rates of sorbing chemical species in granites and clays are in several experiments within the KBS study, higher than can be explained by pore diffusion only. One possible additional transport mechanism is transport of of sorbed molecules/ions along the intrapore surfaces. As a first step a literature investigation on on solid surfaces has been conducted. A lot of experimental evidence of the mobility of the sorbed molecules has been gathered through the years, particulary for metal surfaces and chemical engineering systems. For clays however, there are only a few articles, and for granites none. Two types of surface migration models have been proposed in the litterature: i) Surface flow as a result of a gradient in spreading pressure. ii) Surface diffusion as a result of a gradient in concentration. The surface flow model has only been applied to gaseous systems. However, it should be equally applicable to liquid systems. The models i) and ii) are conceptually very different. However, the resulting expressions for surface flux are complicated and it will not be an easy task to distinguish between them. There seem to be three ways of discriminating between the transport mechanisms: a) Temperature dependence. b) Concentration dependence. c) Order of magnitude. (Forf)

  14. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

    Energy Technology Data Exchange (ETDEWEB)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  15. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

    Science.gov (United States)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  16. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  17. Deuterium permeation and diffusion in high purity beryllium

    International Nuclear Information System (INIS)

    Abramov, E.

    1990-05-01

    The permeation rate of deuterium through high-purity beryllium membranes was measured using the gas-driven permeation technique. The time-dependent and the steady-state deuterium flux data were analyzed and the effective diffusivities of the samples were determined. A multilayer permeation theory was used in order to eliminate the surface oxide effects and the diffusion coefficients of the bulk beryllium were determined. The diffusion parameters obtained for the extra-grade beryllium samples (99.8%) are D 0 = 6.7 x 10 -9 [m 2 /s] and E D = 28.4 [KJ/mol]; and for the high-grade beryllium samples (99%) the parameters are D 0 = 8.0 x 10 -9 [m 2 /s] and E D = 35.1 [KJ/mol

  18. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  19. Tracer gas diffusion sampling test plan

    International Nuclear Information System (INIS)

    Rohay, V.J.

    1993-01-01

    Efforts are under way to employ active and passive vapor extraction to remove carbon tetrachloride from the soil in the 200 West Area an the Hanford Site as part of the 200 West Area Carbon Tetrachloride Expedited Response Action. In the active approach, a vacuum is applied to a well, which causes soil gas surrounding the well to be drawn up to the surface. The contaminated air is cleaned by passage through a granular activated carbon bed. There are questions concerning the radius of influence associated with application of the vacuum system and related uncertainties about the soil-gas diffusion rates with and without the vacuum system present. To address these questions, a series of tracer gas diffusion sampling tests is proposed in which an inert, nontoxic tracer gas, sulfur hexafluoride (SF 6 ), will be injected into a well, and the rates of SF 6 diffusion through the surrounding soil horizon will be measured by sampling in nearby wells. Tracer gas tests will be conducted at sites very near the active vacuum extraction system and also at sites beyond the radius of influence of the active vacuum system. In the passive vapor extraction approach, barometric pressure fluctuations cause soil gas to be drawn to the surface through the well. At the passive sites, the effects of barometric ''pumping'' due to changes in atmospheric pressure will be investigated. Application of tracer gas testing to both the active and passive vapor extraction methods is described in the wellfield enhancement work plan (Rohay and Cameron 1993)

  20. Fractional diffusion equations and anomalous diffusion

    CERN Document Server

    Evangelista, Luiz Roberto

    2018-01-01

    Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

  1. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  2. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  3. Applicability of the Fokker-Planck equation to the description of diffusion effects on nucleation

    Science.gov (United States)

    Sorokin, M. V.; Dubinko, V. I.; Borodin, V. A.

    2017-01-01

    The nucleation of islands in a supersaturated solution of surface adatoms is considered taking into account the possibility of diffusion profile formation in the island vicinity. It is shown that the treatment of diffusion-controlled cluster growth in terms of the Fokker-Planck equation is justified only provided certain restrictions are satisfied. First of all, the standard requirement that diffusion profiles of adatoms quickly adjust themselves to the actual island sizes (adiabatic principle) can be realized only for sufficiently high island concentration. The adiabatic principle is essential for the probabilities of adatom attachment to and detachment from island edges to be independent of the adatom diffusion profile establishment kinetics, justifying the island nucleation treatment as the Markovian stochastic process. Second, it is shown that the commonly used definition of the "diffusion" coefficient in the Fokker-Planck equation in terms of adatom attachment and detachment rates is justified only provided the attachment and detachment are statistically independent, which is generally not the case for the diffusion-limited growth of islands. We suggest a particular way to define the attachment and detachment rates that allows us to satisfy this requirement as well. When applied to the problem of surface island nucleation, our treatment predicts the steady-state nucleation barrier, which coincides with the conventional thermodynamic expression, even though no thermodynamic equilibrium is assumed and the adatom diffusion is treated explicitly. The effect of adatom diffusional profiles on the nucleation rate preexponential factor is also discussed. Monte Carlo simulation is employed to analyze the applicability domain of the Fokker-Planck equation and the diffusion effect beyond it. It is demonstrated that a diffusional cloud is slowing down the nucleation process for a given monomer interaction with the nucleus edge.

  4. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  5. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  6. Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-09-15

    Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

  7. Performance of a contact textile-based light diffuser for photodynamic therapy.

    Science.gov (United States)

    Khan, Tania; Unternährer, Merthan; Buchholz, Julia; Kaser-Hotz, Barbara; Selm, Bärbel; Rothmaier, Markus; Walt, Heinrich

    2006-03-01

    Medical textiles offer a unique contact opportunity that could provide value-added comfort, reliability, and safety for light or laser-based applications. We investigated a luminous textile diffuser for use in photodynamic therapy. Textile diffusers are produced by an embroidery process. Plastic optical fibers are bent and sewn into textile to release light by macrobending. A reflective backing is incorporated to improve surface homogeneity, intensity, and safety. Clonogenic assay (MCF-7 cells) and trypan blue exclusion (NuTu19 cells) tests were performed in vitro using 0.1μg/ml m-THPC with three textile diffusers and a standard front lens diffuser. Heating effects were studied in solution and on human skin. PDT application in vivo was performed with the textile diffuser on equine sarcoids (three animals, 50mW/cm(2), 10-20J) and eight research animals. Lastly, computer simulations were performed to see how the textile diffuser might work on a curved object. At low fluency rate, there is a trend for the textile diffuser to have lower survival rates than the front lens diffuser for both cell lines. The textile diffuser was observed to retain more heat over a long period (>1min). All animals tolerated the treatments well and showed similar initial reactions. The simulations showed a likely focusing effect in a curved geometry. The initial feasibility and application using a textile-based optical diffuser has been demonstrated. Possibilities that provide additional practical advantages of the textile diffuser are discussed.

  8. Surface mobilities on solid materials

    International Nuclear Information System (INIS)

    Binh, V.T.

    1983-01-01

    This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

  9. Variation in diffusion-induced solidification rate of liquated Ni-Cr-B insert during TLP bonding of Waspaloy superalloy

    International Nuclear Information System (INIS)

    Tokoro, K.; Wikstrom, N.P.; Ojo, O.A.; Chaturvedi, M.C.

    2008-01-01

    A microstructural study was performed on transient liquid phase (TLP) bonded Waspaloy superalloy with a Ni-Cr-B filler. The applicability of a diffusion model based on Fick's second law of diffusion to determine the time required for complete isothermal solidification (t f ) was investigated. Over the temperature range of 1065-1110 deg. C, experimental observations of t f were in reasonable agreement with t f values predicted by the diffusion model. However, a notable deviation was observed in joints prepared between 1175 and 1225 deg. C in that the rate of isothermal solidification was reduced at these temperatures resulting in the formation of a centerline eutectic-type microconstituent, which in contrast, was prevented from forming after holding the brazing assembly for an equivalent bonding time at a lower temperature of 1145 deg. C. Boride particles were observed as part of the eutectic product, which suggested that diffusion of boron out of the liquated insert was also reduced at these higher temperatures. A decrease in solubility of the melting point depressing solute, boron, with increase in temperature is suggested to be an important factor contributing to the reduction in isothermal solidification rate observed at the higher bonding temperatures

  10. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  11. Modeling the Influence of Diffusion-Controlled Reactions and Residual Termination and Deactivation on the Rate and Control of Bulk ATRP at High Conversions

    Directory of Open Access Journals (Sweden)

    Ali Mohammad Rabea

    2015-04-01

    Full Text Available In high-conversion atom transfer radical polymerization (ATRP, all the reactions, such as radical termination, radical deactivation, dormant chain activation, monomer propagation, etc. could become diffusion controlled sooner or later, depending on relative diffusivities of the involved reacting species. These diffusion-controlled reactions directly affect the rate of polymerization and the control of polymer molecular weight. A model is developed to investigate the influence of diffusion-controlled reactions on the high conversion ATRP kinetics. Model simulation reveals that diffusion-controlled termination slightly increases the rate, but it is the diffusion-controlled deactivation that causes auto-acceleration in the rate (“gel effect” and loss of control. At high conversions, radical chains are “trapped” because of high molecular weight. However, radical centers can still migrate through (1 radical deactivation–activation cycles and (2 monomer propagation, which introduce “residual termination” reactions. It is found that the “residual termination” does not have much influence on the polymerization kinetics. The migration of radical centers through propagation can however facilitate catalytic deactivation of radicals, which improves the control of polymer molecular weight to some extent. Dormant chain activation and monomer propagation also become diffusion controlled and finally stop the polymerization when the system approaches its glass state.

  12. Properties of water surface discharge at different pulse repetition rates

    International Nuclear Information System (INIS)

    Ruma,; Yoshihara, K.; Hosseini, S. H. R.; Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-01-01

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H 2 O 2 ) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H 2 O 2 and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  13. A grain-boundary diffusion model of dynamic grain growth during superplastic deformation

    International Nuclear Information System (INIS)

    Kim, Byung-Nam; Hiraga, Keijiro; Sakka, Yoshio; Ahn, Byung-Wook

    1999-01-01

    Dynamic grain growth during superplastic deformation is modelled on the basis of a grain-boundary diffusion mechanism. On the grain boundary where a static and a dynamic potential difference coexist, matter transport along the boundary is assumed to contribute to dynamic grain growth through depositing the matter on the grain surface located opposite to the direction of grain-boundary migration. The amount of the diffusive matter during deformation is calculated for an aggregate of spherical grains and is converted to the increment of mean boundary migration velocity. The obtained relationship between the strain rate and the dynamic grain growth rate is shown to be independent of deformation mechanisms, provided that the grain growth is controlled by grain-boundary diffusion. The strain dependence, strain-rate dependence and temperature dependence of grain growth predicted from this model are consistent with those observed in superplastic ZrO 2 -dispersed Al 2 O 3

  14. Chemical ageing and transformation of diffusivity in semi-solid multi-component organic aerosol particles

    Science.gov (United States)

    Pfrang, C.; Shiraiwa, M.; Pöschl, U.

    2011-07-01

    Recent experimental evidence underlines the importance of reduced diffusivity in amorphous semi-solid or glassy atmospheric aerosols. This paper investigates the impact of diffusivity on the ageing of multi-component reactive organic particles approximating atmospheric cooking aerosols. We apply and extend the recently developed KM-SUB model in a study of a 12-component mixture containing oleic and palmitoleic acids. We demonstrate that changes in the diffusivity may explain the evolution of chemical loss rates in ageing semi-solid particles, and we resolve surface and bulk processes under transient reaction conditions considering diffusivities altered by oligomerisation. This new model treatment allows prediction of the ageing of mixed organic multi-component aerosols over atmospherically relevant timescales and conditions. We illustrate the impact of changing diffusivity on the chemical half-life of reactive components in semi-solid particles, and we demonstrate how solidification and crust formation at the particle surface can affect the chemical transformation of organic aerosols.

  15. Chemical ageing and transformation of diffusivity in semi-solid multi-component organic aerosol particles

    Directory of Open Access Journals (Sweden)

    C. Pfrang

    2011-07-01

    Full Text Available Recent experimental evidence underlines the importance of reduced diffusivity in amorphous semi-solid or glassy atmospheric aerosols. This paper investigates the impact of diffusivity on the ageing of multi-component reactive organic particles approximating atmospheric cooking aerosols. We apply and extend the recently developed KM-SUB model in a study of a 12-component mixture containing oleic and palmitoleic acids. We demonstrate that changes in the diffusivity may explain the evolution of chemical loss rates in ageing semi-solid particles, and we resolve surface and bulk processes under transient reaction conditions considering diffusivities altered by oligomerisation. This new model treatment allows prediction of the ageing of mixed organic multi-component aerosols over atmospherically relevant timescales and conditions. We illustrate the impact of changing diffusivity on the chemical half-life of reactive components in semi-solid particles, and we demonstrate how solidification and crust formation at the particle surface can affect the chemical transformation of organic aerosols.

  16. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  17. Evaluation of surface tension and Tolman length as a function of droplet radius from experimental nucleation rate and supersaturation ratio: metal vapor homogeneous nucleation.

    Science.gov (United States)

    Onischuk, A A; Purtov, P A; Baklanov, A M; Karasev, V V; Vosel, S V

    2006-01-07

    Zinc and silver vapor homogeneous nucleations are studied experimentally at the temperature from 600 to 725 and 870 K, respectively, in a laminar flow diffusion chamber with Ar as a carrier gas at atmospheric pressure. The size, shape, and concentration of aerosol particles outcoming the diffusion chamber are analyzed by a transmission electron microscope and an automatic diffusion battery. The wall deposit is studied by a scanning electron microscope (SEM). Using SEM data the nucleation rate for both Zn and Ag is estimated as 10(10) cm(-3) s(-1). The dependence of critical supersaturation on temperature for Zn and Ag measured in this paper as well as Li, Na, Cs, Ag, Mg, and Hg measured elsewhere is analyzed. To this aim the classical nucleation theory is extended by the dependence of surface tension on the nucleus radius. The preexponent in the formula for the vapor nucleation rate is derived using the formula for the work of formation of noncritical embryo [obtained by Nishioka and Kusaka [J. Chem. Phys. 96, 5370 (1992)] and later by Debenedetti and Reiss [J. Chem. Phys. 108, 5498 (1998)

  18. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  19. A preliminary assessment of gas diffusion and migration

    Energy Technology Data Exchange (ETDEWEB)

    Tanai, Kenji; Sato, Haruo [Waste Isolation Research Division, Tokai Works, Japan Nuclear Cycle Development Inst., Tokai, Ibaraki (Japan); Murakami, Tomohiro [Toyo Engineering Corp., Tokyo (Japan); Inoue, Masahiro [Kyushu Univ., Fukuoka (Japan)

    1999-11-01

    In the anaerobic environment in the deep underground water, carbon-steel overpack corrodes and generates molecular hydrogen. It is conceivable that this hydrogen either dissolves into the porewater of the buffer and migrates through the buffer. If the rate of aqueous diffusion of hydrogen is too low compared to the rate of hydrogen generation, the concentration of hydrogen at the overpack surface will increase until a solubility limit is attained and a free hydrogen gas phase forms. It is possible that the pressure in this accumulating gas phase will increase, affecting the stability of the buffer or the surrounding rock mass. There is also a concern of possible effects on nuclide migration, as it is also conceivable that the flow of gas could push out radionuclide-bearing porewater in the buffer when it floes through the buffer. As such, experimental and analytical study must be carried out on such phenomenon to evaluate such potential phenomena. (1) Diffusion experiment of dissolved hydrogen. (2) Gas permeability. (3) Evaluation of diffusion of dissolved hydrogen and hydrogen gas migration. (J.P.N.)

  20. KMC Simulation of Surface Growth of Semiconductors

    International Nuclear Information System (INIS)

    Esen, M.

    2004-01-01

    In this work we have studied the growth and equilibration of semiconductor surfaces consisting of monoatomic steps separated by flat terraces using kinetic Monte Carlo method. Atomistic processes such as diffusion on terraces, attachment/detachment particles to/from step edges, attachment of particles from an upper terrace to a bounding step, diffusion of particles along step edges are considered. A rate equation for each, these processes is written and the overall transition probabilities are calculated where processes are ordered to make the distinction between slow and fast processes Iractal The interaction of steps is also included in the calculation of rate equations. The growth of such a surface is simulated when there is a particle flux to the surface. The rough of the surface and its dependence on both temperature and kinetic parameters such edge diffusion barrier are investigated. The formation of islands on terraces is prohibited and the distribution of their number and sizes are investigated as a function of temperature and appropriate kinetic parameters. In the absence of a flux to the surface, the equilibration of the surface is investigated paying particular attention to the top of the profile when the initial surface is a periodic profile where parallel monoatomic steps separated by terraces. It is observed that during equilibration of the profile, the topmost step disintegrates quickly and leads to many islands on the top of the profile due to. collision and annihilation of step edges of opposite sign. The islands then quickly disintegrate due to the line tension effect and this scenario repeats itself until the surface completely flattens

  1. Results on positron diffusion in Si

    International Nuclear Information System (INIS)

    Nielsen, B.; Lynn, K.G.; Vehanen, A.; Schultz, P.J.

    1984-10-01

    Positron diffusion in Si(100) and Si(111) has been measured using a variable energy positron beam. The diffusion related parameter, E 0 is found to be 4.2 +- 0.2 keV, significantly longer than previously reported values. The positron diffusion coefficient is estimated at D/sub +/ = 2.3 +- 0.4 cm 2 /sec, the uncertainty arising mainly from the characteristics of the assumed positron implantation profile. A drastic reduction in E 0 is found after heating the sample to 1300 0 K, showing that previously reported low values of E 0 are associated with the thermal history of the sample. A high sensitivity to defects introduced by low energy ion bombardment is found, and the defect recovery was followed during heat treatments. Reconstruction of the Si(111) surface into the so-called 7 x 7 structure had no detectable influence on the positron diffusion behavior. No changes in the positron diffusion was observed after covering the surface with atomic hydrogen. However the yield of positronium formation at the surface was enhanced, attributed to an increased density of states at the surface

  2. Dominant rate process of silicon surface etching by hydrogen chloride gas

    International Nuclear Information System (INIS)

    Habuka, Hitoshi; Suzuki, Takahiro; Yamamoto, Sunao; Nakamura, Akio; Takeuchi, Takashi; Aihara, Masahiko

    2005-01-01

    Silicon surface etching and its dominant rate process are studied using hydrogen chloride gas in a wide concentration range of 1-100% in ambient hydrogen at atmospheric pressure in a temperature range of 1023-1423 K, linked with the numerical calculation accounting for the transport phenomena and the surface chemical reaction in the entire reactor. The etch rate, the gaseous products and the surface morphology are experimentally evaluated. The dominant rate equation accounting for the first-order successive reactions at silicon surface by hydrogen chloride gas is shown to be valid. The activation energy of the dominant surface process is evaluated to be 1.5 x 10 5 J mol - 1 . The silicon deposition by the gaseous by-product, trichlorosilane, is shown to have a negligible influence on the silicon etch rate

  3. Propagation and diffusion-limited extinction of nonadiabatic heterogeneous flame in the SHS process

    International Nuclear Information System (INIS)

    Makino, Atsushi

    1994-01-01

    Nonadiabatic heterogeneous flame propagation and extinction in self-propagating high-temperature synthesis (SHS) are analyzed based on a premixed mode of propagation for the bulk flame supported by the nonpremixed reaction of dispersed nonmetals in the liquid metal. The formulation allows for volumetric heat loss throughout the bulk flame, finite-rate Arrhenius reaction at the particle surface, and temperature-sensitive Arrhenius mass diffusion in the liquid. Results show that, subsequent to melting of the metal, the flame structure consists of a relatively thin diffusion-consumption/convection zone followed by a relatively thick convection-loss zone, that the flame propagation rate decreases with increasing heat loss, that at a critical heat-loss rate the flame extinguishes as indicated by the characteristic turning-point behavior, that the surface reaction is diffusion limited such that the nonlinear, temperature-sensitive nature of the system is actually a consequence of the Arrhenius mass diffusion, and that extinction is sensitively affected by the mixture ratio, the degree of dilution, the initial temperature of the compact, and the size of the nonmetal particles. An explicit expression is derived for the normalized mass burning rate, which exhibits the characteristic turning point and shows that extinction occurs when this value is reduced to e -1/2 , which is the same as that for the nonadiabatic gaseous premixed flame. It is further shown that the theoretical results agree well with available experimental data, indicating that the present formulation captures the essential features of the nonadiabatic heterogeneous SHS processes and its potential for extension to describe other SHS phenomena

  4. Measurements of cesium and strontium diffusion in biotite gneiss

    International Nuclear Information System (INIS)

    Skagius, K.; Neretnieks, I.

    1988-01-01

    A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel

  5. Diffusion measurements of cesium and strontium in biotite gneiss

    International Nuclear Information System (INIS)

    Skagius, K.; Neretnieks, I.

    1985-01-01

    A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)

  6. Monitoring quiescent volcanoes by diffuse He degassing: case study Teide volcano

    Science.gov (United States)

    Pérez, Nemesio M.; Melián, Gladys; Asensio-Ramos, María; Padrón, Eleazar; Hernández, Pedro A.; Barrancos, José; Padilla, Germán; Rodríguez, Fátima; Calvo, David; Alonso, Mar

    2016-04-01

    Tenerife (2,034 km2), the largest of the Canary Islands, is the only island that has developed a central volcanic complex (Teide-Pico Viejo stratovolcanoes), characterized by the eruption of differentiated magmas. This central volcanic complex has been built in the intersection of the three major volcanic rift-zones of Tenerife, where most of the historical volcanic activity has taken place. The existence of a volcanic-hydrothermal system beneath Teide volcano is suggested by the occurrence of a weak fumarolic system, steamy ground and high rates of diffuse CO2 degassing all around the summit cone of Teide (Pérez et al., 2013). Diffuse emission studies of non-reactive and/or highly mobile gases such as helium have recently provided promising results to detect changes in the magmatic gas component at surface related to volcanic unrest episodes (Padrón et al., 2013). The geochemical properties of He minimize the interaction of this noble gas on its movement toward the earth's surface, and its isotopic composition is not affected by subsequent chemical reactions. It is highly mobile, chemically inert, physically stable, non-biogenic, sparingly soluble in water under ambient conditions, almost non-adsorbable, and highly diffusive with a diffusion coefficient ˜10 times that of CO2. As part of the geochemical monitoring program for the volcanic surveillance of Teide volcano, yearly surveys of diffuse He emission through the surface of the summit cone of Teide volcano have been performed since 2006. Soil He emission rate was measured yearly at ˜130 sampling sites selected in the surface environment of the summit cone of Teide volcano (Tenerife, Canary Islands), covering an area of ˜0.5 km2, assuming that He emission is governed by convection and diffusion. The distribution of the sampling sites was carefully chosen to homogeneously cover the target area, allowing the computation of the total He emission by sequential Gaussian simulation (sGs). Nine surveys have been

  7. The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

    Directory of Open Access Journals (Sweden)

    K.A. Widi

    2016-09-01

    Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

  8. Determination of surface dose rate for cloisonne using thermoluminescent dosimeters

    Energy Technology Data Exchange (ETDEWEB)

    Hengyuan, Zhao; Yulian, Zhang

    1985-07-01

    In this paper, the measuring method and results of surface dose rate of cloisonne using CaSO/sub 4/ Dy-Teflon foil dosimeter are described. The surface dose rate of all products are below 0.015 mrad/h. These products contain 42 sorts of jewelery and 20 sets of wares (such as vases, plates, ash-trays, etc.). Most of the data fall within the range of natural background. For comparison, some jewelery from Taiwan and 3 vases from Japan are measured. The highest surface dose rate of 0.78 mrad/h is due to the necklace jewelery from Taiwan.

  9. Rate-Dependent Slip of Newtonian Liquid at Smooth Surfaces

    International Nuclear Information System (INIS)

    Zhu, Yingxi; Granick, Steve

    2001-01-01

    Newtonian fluids were placed between molecularly smooth surfaces whose spacing was vibrated at spacings where the fluid responded as a continuum. Hydrodynamic forces agreed with predictions from the no-slip boundary condition only provided that flow rate (peak velocity normalized by spacing) was low, but implied partial slip when it exceeded a critical level, different in different systems, correlated with contact angle (surface wettability). With increasing flow rate and partially wetted surfaces, hydrodynamic forces became up to 2--4 orders of magnitude less than expected by assuming the no-slip boundary condition that is commonly stated in textbooks

  10. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  11. Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

    International Nuclear Information System (INIS)

    Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

    1985-06-01

    A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

  12. Simple computation of reaction–diffusion processes on point clouds

    KAUST Repository

    Macdonald, Colin B.

    2013-05-20

    The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

  13. Simple computation of reaction–diffusion processes on point clouds

    KAUST Repository

    Macdonald, Colin B.; Merriman, Barry; Ruuth, Steven J.

    2013-01-01

    The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

  14. Radon exhalation rates corrected for leakage and back diffusion – Evaluation of radon chambers and radon sources with application to ceramic tile

    Directory of Open Access Journals (Sweden)

    M. Abo-Elmagd

    2014-10-01

    Full Text Available The natural radon decay, leakage and back diffusion are the main removal processes of radon from its container. Ignoring these processes leads to underestimate the measured value of radon related parameters like exhalation rate and radium content. This work is aimed to evaluate two different radon chambers through determining their leakage rate λv and evaluation of radon source by determine its back diffusion rate λb inside the evaluated radon chambers as well as a small sealed cup. Two different methods are adapted for measuring both the leakage rate and the back diffusion rate. The leakage rate can be determined from the initial slope of the radon decay curve or from the exponential fitting of the whole decay curve. This can be achieved if a continuous monitoring of radon concentration inside the chamber is available. Also, the back diffusion rate is measured by sealing the radon source in the chamber and used the initial slope of the buildup curve to determine λb and therefore the exhalation rate of the source. This method was compared with simple equation for λb based on the ratio of the source to the chamber volume. The obtained results are applied to ceramic tile as an important radon source in homes. The measurement is targeted the ceramic glaze before and after firing as well as the obtained tile after adhere the glaze on the tile main body. Also, six different tile brands from Egyptian market are subjected to the study for comparison.

  15. Diffusion Under Geometrical Constraint

    OpenAIRE

    Ogawa, Naohisa

    2014-01-01

    Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

  16. Order of current variance and diffusivity in the rate one totally asymmetric zero range process

    NARCIS (Netherlands)

    Balázs, M.; Komjáthy, J.

    2008-01-01

    We prove that the variance of the current across a characteristic is of order t 2/3 in a stationary constant rate totally asymmetric zero range process, and that the diffusivity has order t 1/3. This is a step towards proving universality of this scaling behavior in the class of one-dimensional

  17. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  18. Measurements of dry-deposition rates on various earth surfaces by 212Pb

    International Nuclear Information System (INIS)

    Osaki, S.; Sugihara, S.; Maeda, Y.

    2004-01-01

    Dry deposition rates of 212 Pb on a coniferous forest (Japanese cedar) and a broad-leaf forest (Pasania edulis) have been measured. Those on various kinds of grass fields, various states on artificial surface such as water, paper, and standing paper have been also measured. The dry deposition rates depend on the characteristics of depositing particles and the conditions of deposited surfaces. Dry deposition rates on the forest of Japanese cedar are highest because of the complex and adhesive surface of the leaves. Those on various grass fields are roughly depend on the logarithm of the height of their grasses. The total deposition rates of 7 Be do not depend on the densities or heights of the grasses. 7 Be may be not kept on their leaves or surface soil for a long time. The dry deposition rates of on artificial surface, e.g. paper and water surfaces make clear the mechanism on dry deposition, and suggest that more chances of collision and more adhesive of the surface are important for the dry deposition. About 90% of all deposition on the artificial paper grass was attached on the standing paper. On water surface, 60% of the rate of paper grass was attached, but only about 20% were attached on a dry paper plate. The aerosol particles are deposited by collision with the surface, therefore the deposition velocity depends on the chance of collision and the characteristics of the surface. Therefore the dry deposition rates on forests are larger and those of coniferous forest are largest. (author)

  19. Assessing Quasi-Steady State in Evaporation of Sessile Drops by Diffusion Models

    Science.gov (United States)

    Martin, Cameron; Nguyen, Hoa; Kelly-Zion, Peter; Pursell, Chris

    2017-11-01

    The vapor distributions surrounding sessile drops of methanol are modeled as the solutions of the steady-state and transient diffusion equations using Matlab's PDE Toolbox. The goal is to determine how quickly the transient diffusive transport reaches its quasi-steady state as the droplet geometry is varied between a Weber's disc, a real droplet shape, and a spherical cap with matching thickness or contact angle. We assume that the only transport mechanism at work is diffusion. Quasi-steady state is defined using several metrics, such as differences between the transient and steady-state solutions, and change in the transient solution over time. Knowing the vapor distribution, the gradient is computed to evaluate the diffusive flux. The flux is integrated along the surface of a control volume surrounding the drop to obtain the net rate of diffusion out of the volume. Based on the differences between the transient and steady-state diffusive fluxes at the discrete points along the control-volume surface, the time to reach quasi-steady state evaporation is determined and is consistent with other proposed measurements. By varying the dimensions of the control volume, we can also assess what regimes have equivalent or different quasi-steady states for different droplet geometries. Petroleum Research Fund.

  20. Electrodiffusion of Lipids on Membrane Surfaces

    OpenAIRE

    Zhou, Y. C.

    2011-01-01

    Random lateral translocation of lipids and proteins is a universal process on membrane surfaces. Local aggregation or organization of lipids and proteins can be induced when this lateral random diffusion is mediated by the electrostatic interactions and membrane curvature. Though the lateral diffusion rates of lipids on membrane of various compositions are measured and the electrostatic free energies of predetermined protein-membrane-lipid systems can be computed, the process of the aggregati...

  1. γ-irradiation effect on gas diffusion in polymer films. Part I : Hydrogen diffusion through mylar film

    International Nuclear Information System (INIS)

    Rao, K.A.; Pushpa, K.K.; Iyer, R.M.

    1980-01-01

    γ-irradiation of polymers results in further crosslinking in the polymer or breakdown of the polymer or a combination of both these phenomena depending on the type of polymer, the dose as well as the environment in which irradiation is carried out. The gas diffusion through polymer films is expected to vary depending on these changes. With a view to A evaluate the feasibility of effecting selective diffusion of specific gases and also to correlate the change in diffusion rates with the polymer characteristics these studies have been initiated. Hydrogen diffusion through mylar film γ-irradiated under varying conditions upto a dose of approximately 50 Mrads is reported in this paper. The results indicate negligible change in hydrogen diffusion rates on γ-irradiation. However, γ-irradiation induced crosslinking of acrylic acid on Mylar reduced the hydrogen diffusion rate. The hydrogen diffusion studies may also be useful in finding the glass transition temperature of polymer films as is apparent from the gas diffusion curves. (author)

  2. The Diffusive Boundary-Layer of Sediments - Oxygen Microgradients Over a Microbial Mat

    DEFF Research Database (Denmark)

    JØRGENSEN, BB; MARAIS, DJD

    1990-01-01

    Oxygen microelectrodes were used to analyze the distribution of the diffusive boundary layer (DBL) at the sedimen-water interface in relation to surface topography and flow velocity. The sediment, collected from saline ponds, was covered by a microbial mat that had high oxygen consumption rate...

  3. Sooting Characteristics and Modeling in Counterflow Diffusion Flames

    KAUST Repository

    Wang, Yu

    2013-11-01

    Soot formation is one of the most complex phenomena in combustion science and an understanding of the underlying physico-chemical mechanisms is important. This work adopted both experimental and numerical approaches to study soot formation in laminar counterfl ow diffusion flames. As polycyclic aromatic hydrocarbons (PAHs) are the precursors of soot particles, a detailed gas-phase chemical mechanism describing PAH growth upto coronene for fuels with 1 to 4 carbon atoms was validated against laminar premixed and counter- flow diffusion fl ames. Built upon this gas-phase mechanism, a soot model was then developed to describe soot inception and surface growth. This soot model was sub- sequently used to study fuel mixing effect on soot formation in counterfl ow diffusion flames. Simulation results showed that compared to the baseline case of the ethylene flame, the doping of 5% (by volume) propane or ethane in ethylene tends to increase the soot volume fraction and number density while keeping the average soot size almost unchanged. These results are in agreement with experimental observations. Laser light extinction/scattering as well as laser induced fluorescence techniques were used to study the effect of strain rate on soot and PAH formation in counterfl ow diffusion ames. The results showed that as strain rate increased both soot volume fraction and PAH concentrations decreased. The concentrations of larger PAH were more sensitive to strain rate compared to smaller ones. The effect of CO2 addition on soot formation was also studied using similar experimental techniques. Soot loading was reduced with CO2 dilution. Subsequent numerical modeling studies were able to reproduce the experimental trend. In addition, the chemical effect of CO2 addition was analyzed using numerical data. Critical conditions for the onset of soot were systematically studied in counterfl ow diffusion ames for various gaseous hydrocarbon fuels and at different strain rates. A sooting

  4. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  5. Using genetic data to estimate diffusion rates in heterogeneous landscapes.

    Science.gov (United States)

    Roques, L; Walker, E; Franck, P; Soubeyrand, S; Klein, E K

    2016-08-01

    Having a precise knowledge of the dispersal ability of a population in a heterogeneous environment is of critical importance in agroecology and conservation biology as it can provide management tools to limit the effects of pests or to increase the survival of endangered species. In this paper, we propose a mechanistic-statistical method to estimate space-dependent diffusion parameters of spatially-explicit models based on stochastic differential equations, using genetic data. Dividing the total population into subpopulations corresponding to different habitat patches with known allele frequencies, the expected proportions of individuals from each subpopulation at each position is computed by solving a system of reaction-diffusion equations. Modelling the capture and genotyping of the individuals with a statistical approach, we derive a numerically tractable formula for the likelihood function associated with the diffusion parameters. In a simulated environment made of three types of regions, each associated with a different diffusion coefficient, we successfully estimate the diffusion parameters with a maximum-likelihood approach. Although higher genetic differentiation among subpopulations leads to more accurate estimations, once a certain level of differentiation has been reached, the finite size of the genotyped population becomes the limiting factor for accurate estimation.

  6. Standard test method for accelerated leach test for diffusive releases from solidified waste and a computer program to model diffusive, fractional leaching from cylindrical waste forms

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This test method provides procedures for measuring the leach rates of elements from a solidified matrix material, determining if the releases are controlled by mass diffusion, computing values of diffusion constants based on models, and verifying projected long-term diffusive releases. This test method is applicable to any material that does not degrade or deform during the test. 1.1.1 If mass diffusion is the dominant step in the leaching mechanism, then the results of this test can be used to calculate diffusion coefficients using mathematical diffusion models. A computer program developed for that purpose is available as a companion to this test method (Note 1). 1.1.2 It should be verified that leaching is controlled by diffusion by a means other than analysis of the leach test solution data. Analysis of concentration profiles of species of interest near the surface of the solid waste form after the test is recommended for this purpose. 1.1.3 Potential effects of partitioning on the test results can...

  7. Dilution rate and microstructure of TIG arc Ni-Al powder surfacing layer

    Institute of Scientific and Technical Information of China (English)

    SHAN Jiguo; DONG Wei; TAN Wenda; ZHANG Di; PEN Jialie

    2007-01-01

    Surfacing beads are prepared by a direct current tungsten inert gas arc nickel-aluminum (Ni-Al) powder surfacing process. With the aim of controlling the dilution rate and obtaining surfacing beads rich in intermetallic compounds, the effects of surfacing parameters on geometric parameters, dilution rate, composition, and microstructure of the bead are investigated. An assistant cooler, which can potentially reduce the temperature of the base metal, is used in the surfacing process and its effect on dilution rate and microstructure is studied. The result indicates that with the surfacing parameter combination of low current and speed, the width and penetration of the bead decrease, reinforcement increases, and dilution rate drops markedly. With the reduc- tion of the parameter combination, the intergranular phase T-(Fe, Ni) is formed in the grain boundaries of Ni-Al interme- tallic matrix instead of the intergranular phase α-Fe, and large amount of intermetallics are obtained. With the use of an assistant cooler on a selected operation condition during the surfacing process, the reinforcement of the bead increases, penetration decreases, and dilution rate declines. The use of an assistant cooler helps obtain a surfacing bead composed of only intermetallics.

  8. Two-Phase Diffusion Technique for the Preparation of Ultramacroporous/Mesoporous Silica Microspheres via Interface Hydrolysis, Diffusion, and Gelation of TEOS.

    Science.gov (United States)

    Ju, Minhua; Li, Yupeng; Yu, Liang; Wang, Chongqing; Zhang, Lixiong

    2018-02-06

    Honeycombed hierarchical ultramacroporous/mesoporous silica microspheres were prepared via the hydrolysis of TEOS in the oil-water interface, with subsequent diffusion and gelation in the acidic water-phase microdroplets with the assistance of a simple homemade microdevice. The diffusion of furfuryl alcohol (FA) also happened at a relatively high rate during the hydrolysis and diffusion of TEOS. Therefore, plenty of FA will be inside of the water microdroplets and form a decent number of polyfurfuryl alcohol (PFA) microparticles, thereby obtaining honeycombed hierarchical porosity silica microspheres with abundant ultramacroporous cavities and mesopores after calcination. It was found that the concentration of FA, residence time, and reaction temperature have significant effects on the porosity and pore size due to the influence on the diffusion rate and amount of FA in water-phase microdroplets. The honeycombed silica microspheres have obvious microscopic visible ultramacroporous cavities with the submicrometer cavity diameter as high as 85% porosity based on the rough overall volume of microsphere. N 2 adsorption-desorption isotherms show that the honeycombed hierarchical porosity silica microspheres have a high surface area of 602 m 2 g -1 , a mesopore volume of 0.77 cm 3 /g, and a mesopore porosity of 99.6% based on the total pore volume of N 2 adsorption-desorption. On the basis of the experiment results, a rational formation process of the honeycombed hierarchical porosity silica microspheres was deduced.

  9. Oxygen transport in waterlogged soils, Part II. Diffusion coefficients

    International Nuclear Information System (INIS)

    Obando Moncayo, F.H.

    2004-01-01

    Several equations are available for Oxygen Transport in Waterlogged Soils and have been used for soils and plants. All of them are some form of first Fick's law as given by dQ = - DA(dc/dx)/dt. This equation illustrates some important aspects of aeration in waterlogged soils; first, D is a property of the medium and the gas, and is affected by temperature T. Likewise, the amount of diffusing substance dQ in dt is a direct function of the cross sectional area A and inversely proportional to the distance x. In fact, increasing the water content of air-dry soil, drastically decreases A and creates a further resistance for the flow of oxygen through water films around root plants, soil micro organisms and soil aggregates. The solid phase is also limiting the cross-section of surface of the free gaseous diffusion and the length and tortuosity of diffusion path in soil. In most of cases, soil gas porosity and tortuosity of soil voids are expressed in the equations of diffusion as a broad 'diffusion coefficient' (apparent coefficient diffusion). The process of soil respiration is complicated, involves many parameters, and is difficult to realistically quantify. With regard to the oxygen supply, it is convenient to distinguish macro and micro models, and hence, the flux of oxygen is assumed to have two steps. The first step is related to oxygen diffusion from the atmosphere and the air-filled porosity. The second step is related to the oxygen diffusion through water-films in and around plant roots, soil micro organisms and aggregates. Because of these models we obtain coefficients of macro or micro diffusion, rates of macro or micro diffusion, etc. In the macro diffusion process oxygen is transferred in the soil profile, mainly from the soil surface to a certain depth of the root zone, while micro diffusion deals with the flux over very short distances. Both processes, macro and micro diffusion are highly influenced by soil water content. Of course, if water is added to

  10. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  11. Nonlinear estimation of weathering rate parameters for uranium in surface soil near a nuclear facility

    International Nuclear Information System (INIS)

    Killough, G.G.; Rope, S.K.; Shleien, B.; Voilleque, P.G.

    1999-01-01

    A dynamic mass-balance model has been calibrated by a nonlinear parameter estimation method, using time-series measurements of uranium in surface soil near the former Feed Materials Production Center (FMPC) near Fernald, Ohio, USA. The time-series data, taken at six locations near the site boundary since 1971, show a statistically significant downtrend of above-background uranium concentration in surface soil for all six locations. The dynamic model is based on first-order kinetics in a surface-soil compartment 10 cm in depth. Median estimates of weathering rate coefficients for insoluble uranium in this soil compartment range from about 0.065-0.14 year -1 , corresponding to mean transit times of about 7-15 years, depending on the location sampled. The model, calibrated by methods similar to those discussed in this paper, has been used to simulate surface soil kinetics of uranium for a dose reconstruction study. It was also applied, along with other data, to make confirmatory estimates of airborne releases of uranium from the FMPC between 1951 and 1988. Two soil-column models (one diffusive and one advective, the latter similar to a catenary first-order kinetic box model) were calibrated to profile data taken at one of the six locations in 1976. The temporal predictions of the advective model approximate the trend of the time series data for that location. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  12. Multifractal scaling analysis of autopoisoning reactions over a rough surface

    International Nuclear Information System (INIS)

    Chaudhari, Ajay; Yan, Ching-Cher Sanders; Lee, S.-L.

    2003-01-01

    Decay type diffusion-limited reactions (DLR) over a rough surface generated by a random deposition model were performed. To study the effect of the decay profile on the reaction probability distribution (RPD), multifractal scaling analysis has been carried out. The dynamics of these autopoisoning reactions are controlled by the two parameters in the decay function, namely, the initial sticking probability (P ini ) of every site and the decay rate (m). The smaller the decay rate, the narrower is the range of α values in the α-f(α) multifractal spectrum. The results are compared with the earlier work of DLR over a surface of diffusion-limited aggregation (DLA). We also considered here the autopoisoning reactions over a smooth surface for comparing our results, which show clearly how the roughness affects the chemical reactions. The q-τ(q) multifractal curves for the smooth surface are linear whereas those for the rough surface are nonlinear. The range of α values in the case of a rough surface is wider than that of the smooth surface

  13. Experimental study of the inverse diffusion flame using high repetition rate OH/acetone PLIF and PIV

    KAUST Repository

    Elbaz, Ayman M.; Roberts, William L.

    2015-01-01

    Most previous work on inverse diffusion flames (IDFs) has focused on laminar IDF emissions and the soot formation characteristics. Here, we investigate the characteristics and structure of methane IDFs using high speed planar laser-induced fluorescence (PLIF) images of OH, particle image velocimetry (PIV), and acetone PLIF imaging for non-reacting cases. First, the flame appearance was investigated with fixed methane loading (mass flux) but with varying airflow rates, yielding a central air jet Reynolds number (Re) of 1,000 to 6,000 (when blow-off occurs). Next, it was investigated a fixed central air jet Re of 4500, but with varied methane mass flux such that the global equivalence ratio spanned 0.5 to 4. It was observed that at Re smaller than 2000, the inner air jet promotes the establishment of an inverse diffusion flame surrounded by a normal diffusion flame. However, when the Re was increased to 2500, two distinct zones became apparent in the flame, a lower entrainment zone and an upper mixing and combustion zone. 10 kHz OH-PLIF images, and 2D PIV allow the identification of the fate and spatial flame structure. Many flame features were identified and further analyzed using simple but effective image processing methods, where three types of structure in all the flames investigated here: flame holes or breaks; closures; and growing kernels. Insights about the rate of evolution of these features, the dynamics of local extinction, and the sequence of events that lead to re-ignition are reported here. In the lower entrainment zone, the occurrence of the flame break events is counterbalanced by closure events, and the edge propagation appears to control the rate at which the flame holes and closures propagate. The rate of propagation of holes was found to be statistically faster than the rate of closure. As the flames approach blow-off, flame kernels become the main mechanism for flame re-ignition further downstream. The simultaneous OH-PLIF/Stereo PIV

  14. Experimental study of the inverse diffusion flame using high repetition rate OH/acetone PLIF and PIV

    KAUST Repository

    Elbaz, Ayman M.

    2015-10-29

    Most previous work on inverse diffusion flames (IDFs) has focused on laminar IDF emissions and the soot formation characteristics. Here, we investigate the characteristics and structure of methane IDFs using high speed planar laser-induced fluorescence (PLIF) images of OH, particle image velocimetry (PIV), and acetone PLIF imaging for non-reacting cases. First, the flame appearance was investigated with fixed methane loading (mass flux) but with varying airflow rates, yielding a central air jet Reynolds number (Re) of 1,000 to 6,000 (when blow-off occurs). Next, it was investigated a fixed central air jet Re of 4500, but with varied methane mass flux such that the global equivalence ratio spanned 0.5 to 4. It was observed that at Re smaller than 2000, the inner air jet promotes the establishment of an inverse diffusion flame surrounded by a normal diffusion flame. However, when the Re was increased to 2500, two distinct zones became apparent in the flame, a lower entrainment zone and an upper mixing and combustion zone. 10 kHz OH-PLIF images, and 2D PIV allow the identification of the fate and spatial flame structure. Many flame features were identified and further analyzed using simple but effective image processing methods, where three types of structure in all the flames investigated here: flame holes or breaks; closures; and growing kernels. Insights about the rate of evolution of these features, the dynamics of local extinction, and the sequence of events that lead to re-ignition are reported here. In the lower entrainment zone, the occurrence of the flame break events is counterbalanced by closure events, and the edge propagation appears to control the rate at which the flame holes and closures propagate. The rate of propagation of holes was found to be statistically faster than the rate of closure. As the flames approach blow-off, flame kernels become the main mechanism for flame re-ignition further downstream. The simultaneous OH-PLIF/Stereo PIV

  15. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  16. Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

    Science.gov (United States)

    Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

    2005-09-01

    We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

  17. Steady-State Diffusion of Water through Soft-Contact LensMaterials

    Energy Technology Data Exchange (ETDEWEB)

    Fornasiero, Francesco; Krull, Florian; Radke, Clayton J.; Prausnitz, JohnM.

    2005-01-31

    Water transport through soft contact lenses (SCL) is important for acceptable performance on the human eye. Chemical-potential gradient-driven diffusion rates of water through soft-contact-lens materials are measured with an evaporation-cell technique. Water is evaporated from the bottom surface of a lens membrane by impinging air at controlled flow rate and humidity. The resulting weight loss of a water reservoir covering the top surface of the contact-lens material is recorded as a function of time. New results are reported for a conventional hydrogel material (SofLens{trademark} One Day, hilafilcon A, water content at saturation W{sub 10} = 70 weight %) and a silicone hydrogel material (PureVision{trademark}, balafilcon A, W{sub 10} = 36 %), with and without surface oxygen plasma treatment. Also, previously reported data for a conventional HEMA-SCL (W{sub 10} = 38 %) hydrogel are reexamined and compared with those for SofLens{trademark} One Day and PureVision{trademark} hydrogels. Measured steady-state water fluxes are largest for SofLens{trademark} One Day, followed by PureVision{trademark} and HEMA. In some cases, the measured steady-state water fluxes increase with rising relative air humidity. This increase, due to an apparent mass-transfer resistance at the surface (trapping skinning), is associated with formation of a glassy skin at the air/membrane interface when the relative humidity is below 55-75%. Steady-state water-fluxes are interpreted through an extended Maxwell-Stefan diffusion model for a mixture of species starkly different in size. Thermodynamic nonideality is considered through Flory-Rehner polymer-solution theory. Shrinking/swelling is self-consistently modeled by conservation of the total polymer mass. Fitted Maxwell-Stefan diffusivities increase significantly with water concentration in the contact lens.

  18. Surface defect chemistry and oxygen exchange kinetics in La2-xCaxNiO4+δ

    Science.gov (United States)

    Tropin, E. S.; Ananyev, M. V.; Farlenkov, A. S.; Khodimchuk, A. V.; Berenov, A. V.; Fetisov, A. V.; Eremin, V. A.; Kolchugin, A. A.

    2018-06-01

    Surface oxygen exchange kinetics and diffusion in La2-xCaxNiO4+δ (x = 0; 0.1; 0.3) have been studied by the isotope exchange method with gas phase equilibration in the temperature range of 600-800 °C and oxygen pressure range 0.13-2.5 kPa. Despite an enhanced electrical conductivity of La2-xCaxNiO4+δ theirs oxygen surface exchange (k*) and oxygen tracer diffusion (D*) coefficients were significantly lower in comparison with La2NiO4+δ. The rates of the elementary stages of oxygen exchange have been calculated. Upon Ca doping the change of the rate-determining stage was observed. The surface of the oxides was found to be inhomogeneous towards oxygen exchange process according to the recently developed model. The reasons of such inhomogeneity are discussed as well as Ca influence on the surface defect chemistry and oxygen surface exchange and diffusivity.

  19. The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

    2016-04-15

    We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

  20. Surface tiny grain-dependent enhanced rate performance of MoO3 nanobelts with pseudocapacitance contribution for lithium-ion battery anode

    Science.gov (United States)

    Cao, Liyun; He, Juju; Li, Jiayin; Yan, Jingwen; Huang, Jianfeng; Qi, Ying; Feng, Liangliang

    2018-07-01

    In order to improve the rate performance of MoO3, a novel MoO3 nanobelt with tiny grains on surface (named as d-MoO3) is fabricated via one-step facile hydrothermal method with citric acid adding, in which citric acid (CA) serves as a weak reductant as well as surface modification agent. When tested as an anode in LIBs, d-MoO3 displays an improved discharge capacity of 787 mAh·g-1 at 0.1 A g-1 over 100 cycles with capacity retention of ∼91% while MoO3 decays to 50 mAh·g-1 in the 100th cycle. Notably, d-MoO3 delivers enhanced rate capability (536 and 370 mAh·g-1 at high rates of 5 and 10 A g-1 respectively). We consider these excellent electrochemical properties of d-MoO3 electrode are associated with the tiny grains on MoO3 surface, which effectively maintains the electrode's structural integrity. Even though d-MoO3 nanobelt suffers from a degree of in-situ pulverization after several cycles, these pulverized active particles can still maintain stable electrochemical contact and are highly exposed to electrolyte, realizing ultrahigh e-/Li+ diffusion kinetics. In addition, part extrinsic pseudocapacitance contribution to the Li+ storage also explains the high-rate performance. Combining all these merits, d-MoO3 is potentially a high-energy, high-power and well-stable anode material for Li ion batteries (LIBs).

  1. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  2. Transient diffusion from a waste solid into water-saturated, fractured porous rock

    International Nuclear Information System (INIS)

    Ahn, J.; Chambre, P.L.; Pigford, T.H.; Lee, W.W.-L.

    1989-09-01

    Numerical illustrations for transient mass transfer from an infinitely long cylinder intersected by a planar fracture are shown based on Chambre's exact analytical solutions. The concentration at the cylinder surface is maintained at the solubility. In the fracture contaminant diffuses in the radial direction. In the rock matrix three-dimensional diffusion is assumed in the cylindrical coordinate. No advection is assumed. Radioactive decay and sorption equilibrium are included. Radioactive decay enhances the mass transfer from the cylinder. Due to the presence of the fracture, the mass flux from the cylinder to the rock matrix becomes smaller, but the fracture effect is limited in the vicinity of the fracture in early times. Even though the fracture is assumed to be a faster diffusion path than the rock matrix, the larger waste surface exposed to the matrix and the greater assumed matrix sorption result in greater release rate to the matrix than to the fracture. 8 refs., 4 figs

  3. Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

    Science.gov (United States)

    Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

    2017-11-01

    Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

  4. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  5. Argon Diffusion Measured in Rhyolite Melt at 100 MPa

    Science.gov (United States)

    Weldon, N.; Edwards, P. M.; Watkins, J. M.; Lesher, C. E.

    2016-12-01

    Argon diffusivity (D_{Ar} ) controls the rate and length scale of argon exchange between melt and gas phases and is used as a parameter to model noble gas fractionation during magma degassing. D_{Ar} may also be useful in geochronology to estimate the distribution of excess (non-radiogenic) atmospheric argon in lavas. Our measurements of D_{Ar} in molten anhydrous rhyolite near 1000 °C and 100 MPa add to the existing dataset. Using a rapid-quench cold seal pressure apparatus we exposed cylindrical charges drilled from a Miocene rhyolite flow near Buck Mtn., CA to a pure argon atmosphere resulting in a gradually lengthening argon concentration gradient between the saturated surface and the argon poor interior. Argon concentration was measured by electron microprobe along radial transects from the center to the surface of bisected samples. D_{Ar} was calculated for each transect by fitting relative argon concentration (as a function of distance from the surface) to Green's function (given each experiment's specific temperature, pressure and runtime). Variability (σ = 1.202{μm }^{2} /s) was smaller than in previous studies, but still greater than what is likely due to analytical or experimental uncertainty. We observed a symmetric geometric bias in the distribution of argon in our samples, possibly related to advective redistribution of argon accompanying the deformation of cylindrical charges into spheroids driven by surface tension. Average diffusivity, D_{Ar} = 4.791{μm }^{2} /s, is close to the predicted value, D_{Ar} = {μm }^{2} /s ( σ_{ \\bar{x} } = 1.576 {μm }^{2} /s), suggesting that Behrens and Zhang's (2001) empirical model is valid for anhydrous rhyolite melts to relatively higher temperatures and lower pressures. Behrens, H. and Y. Zhang (2001). "Ar diffusion in hydrous silicic melts: implications for volatile diffusion mechanisms and fractionation." Earth and Planetary Science Letters 192: 363-376.

  6. Symmetries and modelling functions for diffusion processes

    International Nuclear Information System (INIS)

    Nikitin, A G; Spichak, S V; Vedula, Yu S; Naumovets, A G

    2009-01-01

    A constructive approach to the theory of diffusion processes is proposed, which is based on application of both symmetry analysis and the method of modelling functions. An algorithm for construction of the modelling functions is suggested. This algorithm is based on the error function expansion (ERFEX) of experimental concentration profiles. The high-accuracy analytical description of the profiles provided by ERFEX approximation allows a convenient extraction of the concentration dependence of diffusivity from experimental data and prediction of the diffusion process. Our analysis is exemplified by its employment in experimental results obtained for surface diffusion of lithium on the molybdenum (1 1 2) surface precovered with dysprosium. The ERFEX approximation can be directly extended to many other diffusion systems.

  7. Spin-diffusions and diffusive molecular dynamics

    Science.gov (United States)

    Farmer, Brittan; Luskin, Mitchell; Plecháč, Petr; Simpson, Gideon

    2017-12-01

    Metastable configurations in condensed matter typically fluctuate about local energy minima at the femtosecond time scale before transitioning between local minima after nanoseconds or microseconds. This vast scale separation limits the applicability of classical molecular dynamics (MD) methods and has spurned the development of a host of approximate algorithms. One recently proposed method is diffusive MD which aims at integrating a system of ordinary differential equations describing the likelihood of occupancy by one of two species, in the case of a binary alloy, while quasistatically evolving the locations of the atoms. While diffusive MD has shown itself to be efficient and provide agreement with observations, it is fundamentally a model, with unclear connections to classical MD. In this work, we formulate a spin-diffusion stochastic process and show how it can be connected to diffusive MD. The spin-diffusion model couples a classical overdamped Langevin equation to a kinetic Monte Carlo model for exchange amongst the species of a binary alloy. Under suitable assumptions and approximations, spin-diffusion can be shown to lead to diffusive MD type models. The key assumptions and approximations include a well-defined time scale separation, a choice of spin-exchange rates, a low temperature approximation, and a mean field type approximation. We derive several models from different assumptions and show their relationship to diffusive MD. Differences and similarities amongst the models are explored in a simple test problem.

  8. Diffusion-controlled interface kinetics-inclusive system-theoretic propagation models for molecular communication systems

    Science.gov (United States)

    Chude-Okonkwo, Uche A. K.; Malekian, Reza; Maharaj, B. T.

    2015-12-01

    Inspired by biological systems, molecular communication has been proposed as a new communication paradigm that uses biochemical signals to transfer information from one nano device to another over a short distance. The biochemical nature of the information transfer process implies that for molecular communication purposes, the development of molecular channel models should take into consideration diffusion phenomenon as well as the physical/biochemical kinetic possibilities of the process. The physical and biochemical kinetics arise at the interfaces between the diffusion channel and the transmitter/receiver units. These interfaces are herein termed molecular antennas. In this paper, we present the deterministic propagation model of the molecular communication between an immobilized nanotransmitter and nanoreceiver, where the emission and reception kinetics are taken into consideration. Specifically, we derived closed-form system-theoretic models and expressions for configurations that represent different communication systems based on the type of molecular antennas used. The antennas considered are the nanopores at the transmitter and the surface receptor proteins/enzymes at the receiver. The developed models are simulated to show the influence of parameters such as the receiver radius, surface receptor protein/enzyme concentration, and various reaction rate constants. Results show that the effective receiver surface area and the rate constants are important to the system's output performance. Assuming high rate of catalysis, the analysis of the frequency behavior of the developed propagation channels in the form of transfer functions shows significant difference introduce by the inclusion of the molecular antennas into the diffusion-only model. It is also shown that for t > > 0 and with the information molecules' concentration greater than the Michaelis-Menten kinetic constant of the systems, the inclusion of surface receptors proteins and enzymes in the models

  9. Measuring methods of matrix diffusion

    International Nuclear Information System (INIS)

    Muurinen, A.; Valkiainen, M.

    1988-03-01

    In Finland the spent nuclear fuel is planned to be disposed of at large depths in crystalline bedrock. The radionuclides which are dissolved in the groundwater may be able to diffuse into the micropores of the porous rock matrix and thus be withdrawn from the flowing water in the fractures. This phenomenon is called matrix diffusion. A review over matrix diffusion is presented in the study. The main interest is directed to the diffusion of non-sorbing species. The review covers diffusion experiments and measurements of porosity, pore size, specific surface area and water permeability

  10. Circulation induced by diffused aeration in a shallow lake | Toné ...

    African Journals Online (AJOL)

    Field surveys were carried out to investigate the surface jet flows and the resulting circulation patterns generated by diffused aeration in a shallow lake. In conrast to previous studies, the experimental conditions included point-source bubble plumes with very high air flow rates (100–400 L/min) relative to the shallow water ...

  11. Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

    Science.gov (United States)

    Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

    2006-12-01

    Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

  12. Effect of substrate surface on electromigration-induced sliding at hetero-interfaces

    International Nuclear Information System (INIS)

    Kumar, Praveen; Dutta, Indranath

    2013-01-01

    Electromigration (EM)-induced interfacial sliding between a metal film and Si substrate occurs when (i) only few grains exist across the width of the film and (ii) diffusivity through the interfacial region is significantly greater than diffusivity through the film. Here, the effect of the substrate surface layer on the kinetics of EM-induced interfacial sliding is assessed using Si substrates coated with various thin film interlayers. The kinetics of interfacial sliding, and therefore the EM-driven mass flow rate, strongly depends on the type of the interlayer (and hence the substrate surface composition), such that strongly bonded interfaces with slower interfacial diffusivity produce slower sliding. (paper)

  13. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  14. Effect of high heating rate on thermal decomposition behaviour of ...

    Indian Academy of Sciences (India)

    Effect of high heating rate on thermal decomposition behaviour of titanium hydride ... hydride powder, while switching it from internal diffusion to chemical reaction. ... TiH phase and oxides form on the powder surface, controlling the process.

  15. Atmospheric turbulence and diffusion research

    International Nuclear Information System (INIS)

    Hosker, R.P. Jr.

    1993-01-01

    The Atmospheric Turbulence and Diffusion Division (well known in the atmospheric dispersion community as the Atmospheric Turbulence and Diffusion Laboratory, ATDL) is one of several field facilities of NOAAs Air Resources Laboratory, headquartered in Silver Spring, Maryland. The laboratory conducts research on matters of atmospheric diffusion and turbulent exchange, concerning air quality. ATDD focuses attention on the physics of the lower atmosphere, with special emphasis on the processes contributing to atmospheric transport, dispersion, deposition, and air-surface exchange, and on the development of predictive capabilities using the results of this research. Research is directed toward issues of national and global importance related to the missions of DOE, to DOE's Oak Ridge Field Office, and to NOAA. The program is divided into four major projects: plume transport and diffusion in the planetary boundary layer, complex topography, canopy micrometeorology, and air-surface exchange

  16. Increasing inhibitory input increases neuronal firing rate: why and when? Diffusion process cases

    Energy Technology Data Exchange (ETDEWEB)

    Feng Jianfeng [COGS, Sussex University (United Kingdom)]. E-mail: jf218@cam.ac.uk; Wei Gang [Department of Mathematics, Hong Kong Baptist University, Hong Kong (China)]. E-mail gwei@math.hkbu.edu.hk

    2001-09-21

    Increasing inhibitory input to single neuronal models, such as the FitzHugh-Nagumo model and the Hodgkin-Huxley model, can sometimes increase their firing rates, a phenomenon which we term inhibition-boosted firing (IBF). Here we consider neuronal models with diffusion approximation inputs, i.e. they share the identical first- and second-order statistics of the corresponding Poisson process inputs. Using the integrate-and-fire model and the IF-FHN model, we explore theoretically how and when IBF can happen. For both models, it is shown that there is a critical input frequency at which the efferent firing rate is identical when the neuron receives purely excitatory inputs or exactly balanced inhibitory and excitatory inputs. When the input frequency is lower than the critical frequency, IBF occurs. (author)

  17. Determination of sedimentation, diffusion, and mixing rates in coastal sediments of the eastern Red Sea via natural and anthropogenic fallout radionuclides.

    Science.gov (United States)

    Al-Mur, Bandar A; Quicksall, Andrew N; Kaste, James M

    2017-09-15

    The Red Sea is a unique ecosystem with high biodiversity in one of the warmest regions of the world. In the last five decades, Red Sea coastal development has rapidly increased. Sediments from continental margins are delivered to depths by advection and diffusion-like processes which are difficult to quantify yet provide invaluable data to researchers. Beryllium-7, lead-210 and ceseium-137 were analyzed from sediment cores from the near-coast Red Sea near Jeddah, Saudi Arabia. The results of this work are the first estimates of diffusion, mixing, and sedimentation rates of the Red Sea coastal sediments. Maximum chemical diffusion and particle mixing rates range from 69.1 to 380cm -2 y -1 and 2.54 to 6.80cm -2 y -1 , respectively. Sedimentation rate is constrained to approximately 0.6cm/yr via multiple methods. These data provide baselines for tracking changes in various environmental problems including erosion, marine benthic ecosystem silting, and particle-bound contaminant delivery to the seafloor. Copyright © 2017. Published by Elsevier Ltd.

  18. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  19. Influence of radon diffusion on the 210Pb distribution in sediments

    International Nuclear Information System (INIS)

    Imboden, D.M.; Stiller, M.

    1982-01-01

    A mathematical model is presented which describes the distribution of radon 222 in sediments having a constant or variable depth distribution of radium 226. The model is extended to the distribution of lead 210, taking into account the mobility of radon (the precursor of 210 Pb) within the sediment column. The 210 Pb model is compared, at constant radium activity, with the conventional approach which disregards the radon diffusion when estimating sedimentation rates by the 210 Pb method. The ratio between apparent and real sedimentation rate, s'/s, expressed as a function of three dimensionless parameters, demonstrates the importance of the radon diffusion effect. This effect is particularly important for sediments with small initial excess 210 Pb activity, small sedimentation rate, large radon diffusivity, or a combination of these factors. Applied to Lake Geneva, the sedimentation is estimated to be larger by 30--50% than the original value by Krishnaswami et al, (1971). In sediments which are mixed at the surface (physical mixing or bioturbation), the 210 PB activity in the mixed layer is diminished compared to that in the settling sediment material (Robbins et al., 1977), and radon diffusion makes the activity difference even larger, especially for low initial excess 210 Pb activity, small sedimentation rate, and large mixing intensity. This result may be of importance for the balance of 210 Pb in an aquatic system if the calculations are based on activities measured in the sediment

  20. Combined Diffusion Tensor Imaging and Apparent Transverse Relaxation Rate Differentiate Parkinson Disease and Atypical Parkinsonism.

    Science.gov (United States)

    Du, G; Lewis, M M; Kanekar, S; Sterling, N W; He, L; Kong, L; Li, R; Huang, X

    2017-05-01

    Both diffusion tensor imaging and the apparent transverse relaxation rate have shown promise in differentiating Parkinson disease from atypical parkinsonism (particularly multiple system atrophy and progressive supranuclear palsy). The objective of the study was to assess the ability of DTI, the apparent transverse relaxation rate, and their combination for differentiating Parkinson disease, multiple system atrophy, progressive supranuclear palsy, and controls. A total of 106 subjects (36 controls, 35 patients with Parkinson disease, 16 with multiple system atrophy, and 19 with progressive supranuclear palsy) were included. DTI and the apparent transverse relaxation rate measures from the striatal, midbrain, limbic, and cerebellar regions were obtained and compared among groups. The discrimination performance of DTI and the apparent transverse relaxation rate among groups was assessed by using Elastic-Net machine learning and receiver operating characteristic curve analysis. Compared with controls, patients with Parkinson disease showed significant apparent transverse relaxation rate differences in the red nucleus. Compared to those with Parkinson disease, patients with both multiple system atrophy and progressive supranuclear palsy showed more widespread changes, extending from the midbrain to striatal and cerebellar structures. The pattern of changes, however, was different between the 2 groups. For instance, patients with multiple system atrophy showed decreased fractional anisotropy and an increased apparent transverse relaxation rate in the subthalamic nucleus, whereas patients with progressive supranuclear palsy showed an increased mean diffusivity in the hippocampus. Combined, DTI and the apparent transverse relaxation rate were significantly better than DTI or the apparent transverse relaxation rate alone in separating controls from those with Parkinson disease/multiple system atrophy/progressive supranuclear palsy; controls from those with Parkinson

  1. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  2. [Diagnostic efficiency of decline rate of signal intensity and apparent diffusion coefficient with different b values for differentiating benign and malignant breast lesions on diffusion-weighted 3.0T magnetic resonance imaging].

    Science.gov (United States)

    Jiang, Jing; Liu, Wanhua; Ye, Yuanyuan; Wang, Rui; Li, Fengfang; Peng, Chengyu

    2014-06-17

    To investigate the diagnostic efficiency of decline rate of signal intensity and apparent diffusion coefficient with different b values for differentiating benign and malignant breast lesions on diffusion-weighted 3.0 T magnetic resonance imaging. A total of 152 patients with 162 confirmed histopathologically breast lesions (85 malignant and 77 benign) underwent 3.0 T diffusion-weighted magnetic resonance imaging. Four b values (0, 400, 800 and 1 000 s/mm²) were used. The signal intensity and ADC values of breast lesions were measured respectively. The signal intensity decline rate (SIDR) and apparent diffusion coefficient decline rate (ADCDR) were calculated respectively. SIDR = (signal intensity of lesions with low b value-signal intensity of lesions with high b value)/signal intensity of lesions with low b value, ADCDR = (ADC value of lesions with low b value-ADC value of lesions with high b value) /ADC value of lesions with low b value. The independent sample t-test was employed for statistical analyses and the receiver operating characteristic (ROC) curve for evaluating the diagnosis efficiency of SIDR and ADCDR values. Significant differences were observed in SIDR between benign and malignant breast lesions with b values of 0-400, 400-800 and 800-1 000 s/mm². The sensitivities of SIDR for differentiating benign and malignant breast lesions were 61.2%, 68.2% and 67.1%, the specificities 74.0%, 85.7% and 67.5%, the diagnosis accordance rates 67.3%, 76.5% and 67.3%, the positive predictive values 72.2%, 84.1% and 69.5% and the negative predictive values 63.3%, 71.0% and 65.0% respectively. Significant differences were observed in ADCDR between benign and malignant breast lesions with b values of 400-800 s/mm² and 800-1 000 s/mm². The sensitivities of SDR for differentiating benign and malignant breast lesions were 80.0% and 65.9%, the specificities 72.7% and 65.0%, the diagnostic accordance rates 76.5% and 65.4%, the positive predictive values 76.4% and 67

  3. Radionuclide transfer onto ground surface in surface water flow, 1

    International Nuclear Information System (INIS)

    Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

    1991-07-01

    Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

  4. SEE rate estimation based on diffusion approximation of charge collection

    Science.gov (United States)

    Sogoyan, Armen V.; Chumakov, Alexander I.; Smolin, Anatoly A.

    2018-03-01

    The integral rectangular parallelepiped (IRPP) method remains the main approach to single event rate (SER) prediction for aerospace systems, despite the growing number of issues impairing method's validity when applied to scaled technology nodes. One of such issues is uncertainty in parameters extraction in the IRPP method, which can lead to a spread of several orders of magnitude in the subsequently calculated SER. The paper presents an alternative approach to SER estimation based on diffusion approximation of the charge collection by an IC element and geometrical interpretation of SEE cross-section. In contrast to the IRPP method, the proposed model includes only two parameters which are uniquely determined from the experimental data for normal incidence irradiation at an ion accelerator. This approach eliminates the necessity of arbitrary decisions during parameter extraction and, thus, greatly simplifies calculation procedure and increases the robustness of the forecast.

  5. The American Foreign Exchange Option in Time-Dependent One-Dimensional Diffusion Model for Exchange Rate

    International Nuclear Information System (INIS)

    Rehman, Nasir; Shashiashvili, Malkhaz

    2009-01-01

    The classical Garman-Kohlhagen model for the currency exchange assumes that the domestic and foreign currency risk-free interest rates are constant and the exchange rate follows a log-normal diffusion process.In this paper we consider the general case, when exchange rate evolves according to arbitrary one-dimensional diffusion process with local volatility that is the function of time and the current exchange rate and where the domestic and foreign currency risk-free interest rates may be arbitrary continuous functions of time. First non-trivial problem we encounter in time-dependent case is the continuity in time argument of the value function of the American put option and the regularity properties of the optimal exercise boundary. We establish these properties based on systematic use of the monotonicity in volatility for the value functions of the American as well as European options with convex payoffs together with the Dynamic Programming Principle and we obtain certain type of comparison result for the value functions and corresponding exercise boundaries for the American puts with different strikes, maturities and volatilities.Starting from the latter fact that the optimal exercise boundary curve is left continuous with right-hand limits we give a mathematically rigorous and transparent derivation of the significant early exercise premium representation for the value function of the American foreign exchange put option as the sum of the European put option value function and the early exercise premium.The proof essentially relies on the particular property of the stochastic integral with respect to arbitrary continuous semimartingale over the predictable subsets of its zeros. We derive from the latter the nonlinear integral equation for the optimal exercise boundary which can be studied by numerical methods

  6. Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

    International Nuclear Information System (INIS)

    Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

    2010-01-01

    This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

  7. The effect of heating rate on the surface chemistry of NiTi.

    Science.gov (United States)

    Undisz, Andreas; Hanke, Robert; Freiberg, Katharina E; Hoffmann, Volker; Rettenmayr, Markus

    2014-11-01

    The impact of the heating rate on the Ni content at the surface of the oxide layer of biomedical NiTi is explored. Heat treatment emulating common shape-setting procedures was performed by means of conventional and inductive heating for similar annealing time and temperature, applying various heating rates from ~0.25 K s(-1) to 250 K s(-1). A glow discharge optical emission spectroscopy method was established and employed to evaluate concentration profiles of Ni, Ti and O in the near-surface region at high resolution. The Ni content at the surface of the differently treated samples varies significantly, with maximum surface Ni concentrations of ~20 at.% at the lowest and ~1.5 at.% at the highest heating rate, i.e. the total amount of Ni contained in the surface region of the oxide layer decreases by >15 times. Consequently, the heating rate is a determinant for the biomedical characteristics of NiTi, especially since Ni available at the surface of the oxide layer may affect the hemocompatibility and be released promptly after surgical application of a respective implant. Furthermore, apparently contradictory results presented in the literature reporting surface Ni concentrations of ~3 at.% to >20 at.% after heat treatment are consistently explained considering the ascertained effect of the heating rate. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  8. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  9. Diffusion mechanisms of strontium, cesium and cobalt in compacted sodium bentonite

    International Nuclear Information System (INIS)

    Muurinen, A.; Rantanen, J.; Penttilae-Hiltunen, P.

    1986-01-01

    For a porous water-saturated material where diffusion in the porewater, sorption on the solid material and diffusion of the sorbed ions (surface diffusion) occur, a diffusion equation can be derived where the apparent diffusivity includes two terms. One represents diffusion in the pore-water, the other surface diffusion. In this research diffusion mechanisms were studied. The apparent diffusivities of strontium, cesium and cobalt in compacted sodium bentonite were measured by a non-steady state method. The sorption factors were adjusted using different sodium chloride solutions, groundwater and addition of EDTA for saturation of the bentonite samples. The corresponding sorption factors were measured by a batch method. The results suggest that cations diffuse also while being sorbed. A combined pore diffusion-surface diffusion model has been used to explain the transport and the corresponding diffusivities have been evaluated. The surface diffusivities (D/sub s/) of Sr and Cs were 8-9 x 10 -12 m 2 /s and 4-7 x 10 -13 m 2 /s respectively. The pore diffusivity epsilon D/sub p/ of Cs was 3.5 x 10 -11 m 2 /s which has been used also for Sr. The sorption mechanisms of Co seems to be different from that of Sr or Cs and the results allow no specific conclusions of the diffusion mechanisms of Co. The apparent diffusivity of Co ranged from 2 x 10 -14 to 7 x 10 -14 m 2 /s. The anionic Co-EDTA seems to follow some other diffusion mechanism than the cations

  10. Ion-Scale Structure in Mercury's Magnetopause Reconnection Diffusion Region

    Science.gov (United States)

    Gershman, Daniel J.; Dorelli, John C.; DiBraccio, Gina A.; Raines, Jim M.; Slavin, James A.; Poh, Gangkai; Zurbuchen, Thomas H.

    2016-01-01

    The strength and time dependence of the electric field in a magnetopause diffusion region relate to the rate of magnetic reconnection between the solar wind and a planetary magnetic field. Here we use approximately 150 milliseconds measurements of energetic electrons from the Mercury Surface, Space Environment, GEochemistry, and Ranging (MESSENGER) spacecraft observed over Mercury's dayside polar cap boundary (PCB) to infer such small-scale changes in magnetic topology and reconnection rates. We provide the first direct measurement of open magnetic topology in flux transfer events at Mercury, structures thought to account for a significant portion of the open magnetic flux transport throughout the magnetosphere. In addition, variations in PCB latitude likely correspond to intermittent bursts of approximately 0.3 to 3 millivolts per meter reconnection electric fields separated by approximately 5 to10 seconds, resulting in average and peak normalized dayside reconnection rates of approximately 0.02 and approximately 0.2, respectively. These data demonstrate that structure in the magnetopause diffusion region at Mercury occurs at the smallest ion scales relevant to reconnection physics.

  11. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  12. Development of neutron diffuse scattering analysis code by thin film and multilayer film

    International Nuclear Information System (INIS)

    Soyama, Kazuhiko

    2004-01-01

    To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering by thin film, roughness of surface of thin film, correlation function, neutron propagation by thin film, diffuse scattering by DWBA theory, measurement model, SDIFFF (neutron diffuse scattering analysis program by thin film) and simulation results are explained. On neutron diffuse scattering by multilayer film, roughness of multilayer film, principle of diffuse scattering, measurement method and simulation examples by MDIFF (neutron diffuse scattering analysis program by multilayer film) are explained. (S.Y.)To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering

  13. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    Science.gov (United States)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-12-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.

  14. Influence of atmospheric rainfall to γ radiation Kerma rate in surface air

    International Nuclear Information System (INIS)

    Xu Zhe; Wan Jun; Yu Rongsheng

    2009-01-01

    Objective: To investigate the influence rule of the atmospheric Rainfall to the γ radiation Kerma rate in surface air in order to revise the result of its measurement during rainfall. Methods: The influence factors of rainfall to the measurement of the γ radiation Kerma rate in air were analyzed and then the differential equation of the correlation factors was established theoretically, and by resolving the equation, the mathematical model Was obtained. The model was discussed through several practical examples. Results: The mathematical model was coincided with the tendency of curve about the measured data on the influence rule of rainfall to the γ radiation Kerma rate in surface air. Conclusion: By using the theoretical formula in this article which is established to explain the relationship between the rainfall and the γ radiation Kerma rate in surface air, the influence of rainfall to the γ radiation Kerma rate in surface air could be correctly revised. (authors)

  15. Mechanisms of self-diffusion on Pt(110)

    DEFF Research Database (Denmark)

    Lorensen, Henrik Qvist; Nørskov, Jens Kehlet; Jacobsen, Karsten Wedel

    1999-01-01

    The self-diffusion of Pt on the missing row reconstructed Pt(110) surface is discussed based on density functional calculations of activation energy barriers. Different competing diffusion mechanisms are considered and we show that several different diffusion paths along the reconstruction troughs...

  16. SMART, Radiation Dose Rates on Cask Surface

    International Nuclear Information System (INIS)

    Yamakoshi, Hisao

    1989-01-01

    1 - Description of program or function: SMART calculates radiation dose rate at the center of each cask surface by using characteristic functions for radiation shielding ability and for radiation current back-scattered from cask wall and cask cavity of each cask, once cask-type is specified. 2 - Method of solution: Matrix Calculation

  17. Isopleths of surface air concentration and surface air kerma rate due to a radioactive cloud released from a stack (3)

    International Nuclear Information System (INIS)

    Tachibana, Haruo; Kikuchi, Masamitsu; Sekita, Tsutomu; Yamaguchi, Takenori

    2004-06-01

    This report is a revised edition of 'Isopleths of Surface Air Concentration and Surface Air Absorbed Dose Rate due to a Radioactive Cloud Released from a Stack(II) '(JAERI-M 90-206) and based on the revised Nuclear Safety Guidelines reflected the ICRP1990 Recommendation. Characteristics of this report are the use of Air Karma Rate (Gy/h) instead of Air Absorbed Dose Rate (Gy/h), and the record of isopleths of surface air concentration and surface air karma rate on CD-ROM. These recorded data on CD-ROM can be printed out on paper and/or pasted on digital map by personal computer. (author)

  18. Bicarbonate diffusion through mucus.

    Science.gov (United States)

    Livingston, E H; Miller, J; Engel, E

    1995-09-01

    The mucus layer overlying duodenal epithelium maintains a pH gradient against high luminal acid concentrations. Despite these adverse conditions, epithelial surface pH remains close to neutrality. The exact nature of the gradient-forming barrier remains unknown. The barrier consists of mucus into which HCO3- is secreted. Quantification of the ability of HCO3- to establish and maintain the gradient depends on accurate measurement of this ion's diffusion coefficient through mucus. We describe new experimental and mathematical methods for diffusion measurement and report diffusion coefficients for HCO3- diffusion through saline, 5% mucin solutions, and rat duodenal mucus. The diffusion coefficients were 20.2 +/- 0.10, 3.02 +/- 0.31, and 1.81 +/- 0.12 x 10(-6) cm2/s, respectively. Modeling of the mucobicarbonate layer with this latter value suggests that for conditions of high luminal acid strength the neutralization of acid by HCO3- occurs just above the epithelial surface. Under these conditions the model predicts that fluid convection toward the lumen could be important in maintaining the pH gradient. In support of this hypothesis we were able to demonstrate a net luminal fluid flux of 5 microliters.min-1.cm-2 after perfusion of 0.15 N HCl in the rat duodenum.

  19. Formation and development of salt crusts on soil surfaces

    KAUST Repository

    Dai, Sheng; Shin, Hosung; Santamarina, Carlos

    2015-01-01

    The salt concentration gradually increases at the soil free surface when the evaporation rate exceeds the diffusive counter transport. Eventually, salt precipitates and crystals form a porous sodium chloride crust with a porosity of 0.43 ± 0.14. After detaching from soils, the salt crust still experiences water condensation and salt deliquescence at the bottom, brine transport across the crust driven by the humidity gradient, and continued air-side precipitation. This transport mechanism allows salt crust migration away from the soil surface at a rate of 5 μm/h forming salt domes above soil surfaces. The surface characteristics of mineral substrates and the evaporation rate affect the morphology and the crystal size of precipitated salt. In particular, substrate hydrophobicity and low evaporation rate suppress salt spreading.

  20. Formation and development of salt crusts on soil surfaces

    KAUST Repository

    Dai, Sheng

    2015-12-14

    The salt concentration gradually increases at the soil free surface when the evaporation rate exceeds the diffusive counter transport. Eventually, salt precipitates and crystals form a porous sodium chloride crust with a porosity of 0.43 ± 0.14. After detaching from soils, the salt crust still experiences water condensation and salt deliquescence at the bottom, brine transport across the crust driven by the humidity gradient, and continued air-side precipitation. This transport mechanism allows salt crust migration away from the soil surface at a rate of 5 μm/h forming salt domes above soil surfaces. The surface characteristics of mineral substrates and the evaporation rate affect the morphology and the crystal size of precipitated salt. In particular, substrate hydrophobicity and low evaporation rate suppress salt spreading.

  1. Diffusion in crystalline rocks of some sorbing and nonsorbing species

    International Nuclear Information System (INIS)

    Skagius, K.; Neretnieks, I.

    1983-01-01

    Laboratory experiments to determine the sorption and the rate of diffusion of cesium and strontium in pieces of granite have been performed. The effective diffusivity, D sub (p) x E sub (p) was found to be 1 - 2 x 10 - 12 m 2 /s for both cesium and strontium. The diffusion of non-sorbing species in granites and other rock materials have been studied in laboratory scale. The non-sorbing species were iodide, tritiated water, Cr-EDTA and Uranine. In granites the effective diffusivities were determined to be 0.7-1.3 x 10 - 13 m 2 /s for iodide and 1.3 - 1.8 x 10 - 13 m 2 /s for tritiated water. Electrical resistivity measurements in salt water saturated rock cores have been performed. The resistivity is measured in the saturated core and in the salt solution with which the core has been saturated. The ratio between these two resistivities has a direct relation to the ratio of the effective diffusivity for a component in the rock material and the diffusivity in free water for the same component. The results from the electrical resistivity measurements and the experiments with diffusion of non-sorbing species are in fair agreement. The effective diffusivity for cesium and strontium (sorbing species) are, however, more than ten times higher than expected from the results of diffusion of non-sorbing species and the electrical resistivity measurements. This is interpreted as an effect of surface diffusion. (Authors)

  2. Three-dimensional flow of Prandtl fluid with Cattaneo-Christov double diffusion

    Science.gov (United States)

    Hayat, Tasawar; Aziz, Arsalan; Muhammad, Taseer; Alsaedi, Ahmed

    2018-06-01

    This research paper intends to investigate the 3D flow of Prandtl liquid in the existence of improved heat conduction and mass diffusion models. Flow is created by considering linearly bidirectional stretchable sheet. Thermal and concentration diffusions are considered by employing Cattaneo-Christov double diffusion models. Boundary layer approach has been used to simplify the governing PDEs. Suitable nondimensional similarity variables correspond to strong nonlinear ODEs. Optimal homotopy analysis method (OHAM) is employed for solutions development. The role of various pertinent variables on temperature and concentration are analyzed through graphs. The physical quantities such as surface drag coefficients and heat and mass transfer rates at the wall are also plotted and discussed. Our results indicate that the temperature and concentration are decreasing functions of thermal and concentration relaxation parameters respectively.

  3. Lithium diffusion in silver vanadium oxide

    International Nuclear Information System (INIS)

    Takeuchi, E.S.; Thiebolt, W.C. III

    1989-01-01

    Lithium/silver vanadium oxide (SVO) batteries have been developed to power implantable devices. The voltage of Li/SVO cells decreases with discharge allowing state of charge assessment by accurate determination of the cells' open circuit voltage. The open circuit voltage recovery of Li/SVO cells was monitored during intermittent high rate discharge. It was found that the voltage does not recover at the same rate or magnitude at all depths of discharge. The authors describe lithium diffusion in SVO studied by low scan rate voltammetry where utilization of SVO at various scan rates was used to determine the diffusion rate of lithium. A pulse technique was also used where the rate of lithium diffusion was measured at various depths of discharge

  4. Rate and extent of aqueous perchlorate removal by iron surfaces.

    Science.gov (United States)

    Moore, Angela M; De Leon, Corinne H; Young, Thomas M

    2003-07-15

    The rate and extent of perchlorate reduction on several types of iron metal was studied in batch and column reactors. Mass balances performed on the batch experiments indicate that perchlorate is initially sorbed to the iron surface, followed by a reduction to chloride. Perchlorate removal was proportional to the iron dosage in the batch reactors, with up to 66% removal in 336 h in the highest dosage system (1.25 g mL(-1)). Surface-normalized reaction rates among three commercial sources of iron filings were similar for acid-washed samples. The most significant perchlorate removal occurred in solutions with slightly acidic or near-neutral initial pH values. Surface mediation of the reaction is supported by the absence of reduction in batch experiments with soluble Fe2+ and also by the similarity in specific reaction rate constants (kSA) determined for three different iron types. Elevated soluble chloride concentrations significantly inhibited perchlorate reduction, and lower removal rates were observed for iron samples with higher amounts of background chloride contamination. Perchlorate reduction was not observed on electrolytic sources of iron or on a mixed-phase oxide (Fe3O4), suggesting that the reactive iron phase is neither pure zerovalent iron nor the mixed oxide alone. A mixed valence iron hydr(oxide) coating or a sorbed Fe2+ surface complex represent the most likely sites for the reaction. The observed reaction rates are too slow for immediate use in remediation system design, but the findings may provide a basis for future development of cost-effective abiotic perchlorate removal techniques.

  5. Diffuse sound field: challenges and misconceptions

    DEFF Research Database (Denmark)

    Jeong, Cheol-Ho

    2016-01-01

    Diffuse sound field is a popular, yet widely misused concept. Although its definition is relatively well established, acousticians use this term for different meanings. The diffuse sound field is defined by a uniform sound pressure distribution (spatial diffusion or homogeneity) and uniform...... tremendously in different chambers because the chambers are non-diffuse in variously different ways. Therefore, good objective measures that can quantify the degree of diffusion and potentially indicate how to fix such problems in reverberation chambers are needed. Acousticians often blend the concept...... of mixing and diffuse sound field. Acousticians often refer diffuse reflections from surfaces to diffuseness in rooms, and vice versa. Subjective aspects of diffuseness have not been much investigated. Finally, ways to realize a diffuse sound field in a finite space are discussed....

  6. Beneficial Effect of Surface Decorations on the Surface Exchange of Lanthanum Strontium Ferrite and Dual Phase Composites

    DEFF Research Database (Denmark)

    Ovtar, Simona; Søgaard, Martin; Song, Jia

    2016-01-01

    . These perovskites possess a mixed ionic and electronic conductivity (MIEC), which can be highly beneficial for the processes on oxygen electrode surfaces. The oxygen transport through a MIEC is determined by the rate of the oxygen exchange over the gas-solid interface and the diffusivity of oxide ions and electrons...

  7. Impact of the solution ionic strength on strontium diffusion through the Callovo-Oxfordian clayrocks: An experimental and modeling study

    International Nuclear Information System (INIS)

    Savoye, S.; Beaucaire, C.; Grenut, B.; Fayette, A.

    2015-01-01

    Highlights: • HTO and 85 Sr diffusion is studied in clayrocks under increasing ionic strengths. • Sr diffusive flux is 5 times higher than HTO under standard porewater ionic strength. • Sr diffusive flux is reduced when the porewater ionic strength increases. • The Sr diffusive evolution is qualitatively reproduced by a surface diffusion model. - Abstract: Diffusion of cations in clayrocks is widely investigated, because deep clay-rich formations are currently considered as one of the potential host rocks for radioactive waste repositories. However, several authors have already reported that sorbing cations seem to diffuse at rates larger than those predicted by a simple pore diffusion model from their sorption coefficients and from the diffusive flux of non-sorbing water tracers. This process has been attributed to the migration of cations within the electrical double layer, next to the mineral surfaces, called the surface diffusion phenomenon. The aim of this work was to verify whether this “enhanced” cation diffusion compared to neutral species was observed for strontium and, if so, to what extent this effect might vary with the salinity of the synthetic solutions. These questions were addressed by performing batch sorption, through-diffusion and out-diffusion experiments on rock samples from the Callovo-Oxfordian claystone formation (France). The results showed that there was a good agreement of the distribution ratios (R D ) determined on crushed and intact rocks by batch and through-diffusion methods with a R D decrease related to the increase of the sodium concentration, a sorption competitor. Such a trend was also well reproduced by means of a geochemical modeling based on the multi-site ion exchange (MSIE) theory. Moreover, the “enhanced” diffusion for strontium was clearly observed in this study: the Sr diffusive flux was almost five times higher than that for HTO in the cell with the lowest ionic strength, and diminished to less than 1

  8. Review of enhanced vapor diffusion in porous media

    International Nuclear Information System (INIS)

    Webb, S.W.; Ho, C.K.

    1998-01-01

    Vapor diffusion in porous media in the presence of its own liquid has often been treated similar to gas diffusion. The gas diffusion rate in porous media is much lower than in free space due to the presence of the porous medium and any liquid present. However, enhanced vapor diffusion has also been postulated such that the diffusion rate may approach free-space values. Existing data and models for enhanced vapor diffusion, including those in TOUGH2, are reviewed in this paper

  9. Urban diffusion problems

    International Nuclear Information System (INIS)

    Hanna, S.R.

    1976-01-01

    It is hoped that urban diffusion models of air pollutants can eventually confidently be used to make major decisions, such as in planning the layout of a new industrial park, determining the effects of a new highway on air quality, or estimating the results of a new automobile emissions exhaust system. The urban diffusion model itself should be able to account for point, line, and area sources, and the local aerodynamic effects of street canyons and building wakes. Removal or transformations due to dry or wet deposition and chemical reactions are often important. It would be best if the model included meteorological parameters such as wind speed and temperature as dependent variables, since these parameters vary significantly when air passes from rural surfaces over urban surfaces

  10. Experimental and theoretical investigations on diffusion process for rare earth ores

    Energy Technology Data Exchange (ETDEWEB)

    He, Ye; Li, Wenzhi Z. [Changchun Univ. (China)

    2013-06-01

    The diffusion reaction kinetics of weathered crust elution-deposited rare earth with mixed ammonium salts was studied. The influence of concentration of reagents and particle size of ore on diffusion rate was investigated. The results showed that the diffusion process and diffusion rate could be improved by increasing reagents concentration and decreasing diffusion flowing rate and particle size. The diffusion process could be explained with the shrinking core Model, which could be controlled by the diffusion rate of reacting reagents in porous solid layer.

  11. Reaction and Aggregation Dynamics of Cell Surface Receptors

    Science.gov (United States)

    Wang, Michelle Dong

    This dissertation is composed of both theoretical and experimental studies of cell surface receptor reaction and aggregation. Project I studies the reaction rate enhancement due to surface diffusion of a bulk dissolved ligand with its membrane embedded target, using numerical calculations. The results show that the reaction rate enhancement is determined by ligand surface adsorption and desorption kinetic rates, surface and bulk diffusion coefficients, and geometry. In particular, we demonstrate that the ligand surface adsorption and desorption kinetic rates, rather than their ratio (the equilibrium constant), are important in rate enhancement. The second and third projects are studies of acetylcholine receptor clusters on cultured rat myotubes using fluorescence techniques after labeling the receptors with tetramethylrhodamine -alpha-bungarotoxin. The second project studies when and where the clusters form by making time-lapse movies. The movies are made from overlay of the pseudocolored total internal reflection fluorescence (TIRF) images of the cluster, and the schlieren images of the cell cultures. These movies are the first movies made using TIRF, and they clearly show the cluster formation from the myoblast fusion, the first appearance of clusters, and the eventual disappearance of clusters. The third project studies the fine structural features of individual clusters observed under TIRF. The features were characterized with six parameters by developing a novel fluorescence technique: spatial fluorescence autocorrelation. These parameters were then used to study the feature variations with age, and with treatments of drugs (oligomycin and carbachol). The results show little variation with age. However, drug treatment induced significant changes in some parameters. These changes were different for oligomycin and carbachol, which indicates that the two drugs may eliminate clusters through different mechanisms.

  12. Toward the existence of ultrafast diffusion paths in Cu with a gradient microstructure: Room temperature diffusion of Ni

    Science.gov (United States)

    Wang, Z. B.; Lu, K.; Wilde, G.; Divinski, S.

    2008-09-01

    Room temperature diffusion of Ni63 in Cu with a gradient microstructure prepared by surface mechanical attrition treatment (SMAT) was investigated by applying the radiotracer technique. The results reveal significant penetration of Ni into the nanostructured layer. The relevant diffusivity is higher than that along the conventional high-angle grain boundaries by about six orders of magnitude. This behavior is associated with a higher energy state of internal interfaces produced via plastic deformation. The diffusivity in the top surface layer is somewhat smaller than that in the subsurface layer. This fact is related to nanotwin formation in the former during SMAT.

  13. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)

    International Nuclear Information System (INIS)

    Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.

    2013-01-01

    In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)

  15. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

    International Nuclear Information System (INIS)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-01-01

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

  16. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

    Science.gov (United States)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-09-29

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

  17. Dynamics and profiles of a diffusive host-pathogen system with distinct dispersal rates

    Science.gov (United States)

    Wu, Yixiang; Zou, Xingfu

    2018-04-01

    In this paper, we investigate a diffusive host-pathogen model with heterogeneous parameters and distinct dispersal rates for the susceptible and infected hosts. We first prove that the solution of the model exists globally and the model system possesses a global attractor. We then identify the basic reproduction number R0 for the model and prove its threshold role: if R0 ≤ 1, the disease free equilibrium is globally asymptotically stable; if R0 > 1, the solution of the model is uniformly persistent and there exists a positive (pathogen persistent) steady state. Finally, we study the asymptotic profiles of the positive steady state as the dispersal rate of the susceptible or infected hosts approaches zero. Our result suggests that the infected hosts concentrate at certain points which can be characterized as the pathogen's most favoured sites when the mobility of the infected host is limited.

  18. Diffusion bonding and brazing of high purity copper for linear collider accelerator structures

    Directory of Open Access Journals (Sweden)

    J. W. Elmer

    2001-05-01

    Full Text Available Diffusion bonding and brazing of high purity copper were investigated to develop procedures for joining precision machined copper components for the Next Linear Collider (NLC. Diffusion bonds were made over a range of temperatures from 400 °C to 1000 °C, under two different loading conditions [3.45 kPa (0.5 psi and 3.45 MPa (500 psi], and on two different diamond machined surface finishes. Brazes were made using pure silver, pure gold, and gold-nickel alloys, and different heating rates produced by both radiation and induction heating. Braze materials were applied by both physical vapor deposition (PVD and conventional braze alloy shims. Results of the diffusion bonding experiments showed that bond strengths very near that of the copper base metal could be made at bonding temperatures of 700 °C or higher at 3.45 MPa bonding pressure. At lower temperatures, only partial strength diffusion bonds could be made. At low bonding pressures (3.45 kPa, full strength bonds were made at temperatures of 800 °C and higher, while no bonding (zero strength was observed at temperatures of 700 °C and lower. Observations of the fracture surfaces of the diffusion bonded samples showed the effects of surface finish on the bonding mechanism. These observations clearly indicate that bonding began by point asperity contact, and flatter surfaces resulted in a higher percentage of bonded area under similar bonding conditions. Results of the brazing experiments indicated that pure silver worked very well for brazing under both conventional and high heating rate scenarios. Similarly, pure silver brazed well for both the PVD layers and the braze alloy shims. The gold and gold-containing brazes had problems, mainly due to the high diffusivity of gold in copper. These problems led to the necessity of overdriving the temperature to ensure melting, the presence of porosity in the joint, and very wide braze joints. Based on the overall findings of this study, a two

  19. Oxygen exchange at gas/oxide interfaces: how the apparent activation energy of the surface exchange coefficient depends on the kinetic regime.

    Science.gov (United States)

    Fielitz, Peter; Borchardt, Günter

    2016-08-10

    In the dedicated literature the oxygen surface exchange coefficient KO and the equilibrium oxygen exchange rate [Fraktur R] are considered to be directly proportional to each other regardless of the experimental circumstances. Recent experimental observations, however, contradict the consequences of this assumption. Most surprising is the finding that the apparent activation energy of KO depends dramatically on the kinetic regime in which it has been determined, i.e. surface exchange controlled vs. mixed or diffusion controlled. This work demonstrates how the diffusion boundary condition at the gas/solid interface inevitably entails a correlation between the oxygen surface exchange coefficient KO and the oxygen self-diffusion coefficient DO in the bulk ("on top" of the correlation between KO and [Fraktur R] for the pure surface exchange regime). The model can thus quantitatively explain the range of apparent activation energies measured in the different regimes: in the surface exchange regime the apparent activation energy only contains the contribution of the equilibrium exchange rate, whereas in the mixed or in the diffusion controlled regime the contribution of the oxygen self-diffusivity has also to be taken into account, which may yield significantly higher apparent activation energies and simultaneously quantifies the correlation KO ∝ DO(1/2) observed for a large number of oxides in the mixed or diffusion controlled regime, respectively.

  20. Desorption kinetics of ciprofloxacin in municipal biosolids determined by diffusion gradient in thin films.

    Science.gov (United States)

    D'Angelo, E; Starnes, D

    2016-12-01

    Ciprofloxacin (CIP) is a commonly-prescribed antibiotic that is largely excreted by the body, and is often found at elevated concentrations in treated sewage sludge (biosolids) at municipal wastewater treatment plants. When biosolids are applied to soils, they could release CIP to surface runoff, which could adversely affect growth of aquatic organisms that inhabit receiving water bodies. The hazard risk largely depends on the amount of antibiotic in the solid phase that can be released to solution (labile CIP), its diffusion coefficient, and sorption/desorption exchange rates in biosolids particles. In this study, these processes were evaluated in a Class A Exceptional Quality Biosolids using a diffusion gradient in thin films (DGT) sampler that continuously removed CIP from solution, which induced desorption and diffusion in biosolids. Mass accumulation of antibiotic in the sampler over time was fit by a diffusion transport and exchange model available in the software tool 2D-DIFS to derive the distribution coefficient of labile CIP (K dl ) and sorption/desorption rate constants in the biosolids. The K dl was 13 mL g -1 , which equated to 16% of total CIP in the labile pool. Although the proportion of labile CIP was considerable, release rates to solution were constrained by slow desorption kinetics (desorption rate constant = 4 × 10 -6 s -1 ) and diffusion rate (effective diffusion coefficient = 6 × 10 -9  cm 2  s -1 . Studies are needed to investigate how changes in temperature, water content, pH and other physical and chemical characteristics can influence antibiotic release kinetics and availability and mobility in biosolid-amended soils. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Melatonin increases anagen hair rate in women with androgenetic alopecia or diffuse alopecia: results of a pilot randomized controlled trial.

    Science.gov (United States)

    Fischer, T W; Burmeister, G; Schmidt, H W; Elsner, P

    2004-02-01

    In addition to the well-known hormonal influences of testosterone and dihydrotestosterone on the hair cycle, melatonin has been reported to have a beneficial effect on hair growth in animals. The effect of melatonin on hair growth in humans has not been investigated so far. To examine whether topically applied melatonin influences anagen and telogen hair rate in women with androgenetic or diffuse hair loss. A double-blind, randomized, placebo-controlled study was conducted in 40 women suffering from diffuse alopecia or androgenetic alopecia. A 0.1% melatonin or a placebo solution was applied on the scalp once daily for 6 months and trichograms were performed to assess anagen and telogen hair rate. To monitor effects of treatment on physiological melatonin levels, blood samples were taken over the whole study period. Melatonin led to a significantly increased anagen hair rate in occipital hair in women with androgenetic hair loss compared with placebo (n=12; P=0.012). For frontal hair, melatonin gave a significant increase in the group with diffuse alopecia (n=28; P=0.046). The occipital hair samples of patients with diffuse alopecia and the frontal hair counts of those with androgenetic alopecia also showed an increase of anagen hair, but differences were not significant. Plasma melatonin levels increased under treatment with melatonin, but did not exceed the physiological night peak. To the authors' knowledge, this pilot study is the first to show that topically applied melatonin might influence hair growth in humans in vivo. The mode of action is not known, but the effect might result from an induction of anagen phase.

  2. Polyamine sharing between tubulin dimers favours microtubule nucleation and elongation via facilitated diffusion.

    Directory of Open Access Journals (Sweden)

    Alain Mechulam

    2009-01-01

    Full Text Available We suggest for the first time that the action of multivalent cations on microtubule dynamics can result from facilitated diffusion of GTP-tubulin to the microtubule ends. Facilitated diffusion can promote microtubule assembly, because, upon encountering a growing nucleus or the microtubule wall, random GTP-tubulin sliding on their surfaces will increase the probability of association to the target sites (nucleation sites or MT ends. This is an original explanation for understanding the apparent discrepancy between the high rate of microtubule elongation and the low rate of tubulin association at the microtubule ends in the viscous cytoplasm. The mechanism of facilitated diffusion requires an attraction force between two tubulins, which can result from the sharing of multivalent counterions. Natural polyamines (putrescine, spermidine, and spermine are present in all living cells and are potent agents to trigger tubulin self-attraction. By using an analytical model, we analyze the implication of facilitated diffusion mediated by polyamines on nucleation and elongation of microtubules. In vitro experiments using pure tubulin indicate that the promotion of microtubule assembly by polyamines is typical of facilitated diffusion. The results presented here show that polyamines can be of particular importance for the regulation of the microtubule network in vivo and provide the basis for further investigations into the effects of facilitated diffusion on cytoskeleton dynamics.

  3. Reaction-diffusion modeling of hydrogen in beryllium

    Energy Technology Data Exchange (ETDEWEB)

    Wensing, Mirko; Matveev, Dmitry; Linsmeier, Christian [Forschungszentrum Juelich GmbH, Institut fuer Energie- und Klimaforschung - Plasmaphysik (Germany)

    2016-07-01

    Beryllium will be used as first-wall material for the future fusion reactor ITER as well as in the breeding blanket of DEMO. In both cases it is important to understand the mechanisms of hydrogen retention in beryllium. In earlier experiments with beryllium low-energy binding states of hydrogen were observed by thermal desorption spectroscopy (TDS) which are not yet well understood. Two candidates for these states are considered: beryllium-hydride phases within the bulk and surface effects. The retention of deuterium in beryllium is studied by a reaction rate approach using a coupled reaction diffusion system (CRDS)-model relying on ab initio data from density functional theory calculations (DFT). In this contribution we try to assess the influence of surface recombination.

  4. THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

    Energy Technology Data Exchange (ETDEWEB)

    Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

    2012-10-01

    To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

  5. Analysis of discrete reaction-diffusion equations for autocatalysis and continuum diffusion equations for transport

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chi-Jen [Iowa State Univ., Ames, IA (United States)

    2013-01-01

    In this thesis, we analyze both the spatiotemporal behavior of: (A) non-linear “reaction” models utilizing (discrete) reaction-diffusion equations; and (B) spatial transport problems on surfaces and in nanopores utilizing the relevant (continuum) diffusion or Fokker-Planck equations. Thus, there are some common themes in these studies, as they all involve partial differential equations or their discrete analogues which incorporate a description of diffusion-type processes. However, there are also some qualitative differences, as shall be discussed below.

  6. An inverse diffusivity problem for the helium production–diffusion equation

    International Nuclear Information System (INIS)

    Bao, Gang; Xu, Xiang

    2012-01-01

    Thermochronology is a technique for the extraction of information about the thermal history of rocks. Such information is crucial for determining the depth below the surface at which rocks were located at a given time (Bao G et al 2011 Commun. Comput. Phys. 9 129). Mathematically, extracting the time–temperature path can be formulated as an inverse diffusivity problem for the helium production–diffusion equation which is the underlying process of thermochronology. In this paper, to reconstruct the diffusivity which depends on space only and accounts for the structural information of rocks, a local Hölder conditional stability is obtained by a Carleman estimate. A uniqueness result is also proven for extracting the thermal history, i.e. identifying the time-dependant part of the diffusion coefficient, provided that it is analytical with respect to time. Numerical examples are presented to illustrate the validity and effectiveness of the proposed regularization scheme. (paper)

  7. Predicting the weathering of fuel and oil spills: A diffusion-limited evaporation model.

    Science.gov (United States)

    Kotzakoulakis, Konstantinos; George, Simon C

    2018-01-01

    The majority of the evaporation models currently available in the literature for the prediction of oil spill weathering do not take into account diffusion-limited mass transport and the formation of a concentration gradient in the oil phase. The altered surface concentration of the spill caused by diffusion-limited transport leads to a slower evaporation rate compared to the predictions of diffusion-agnostic evaporation models. The model presented in this study incorporates a diffusive layer in the oil phase and predicts the diffusion-limited evaporation rate. The information required is the composition of the fluid from gas chromatography or alternatively the distillation data. If the density or a single viscosity measurement is available the accuracy of the predictions is higher. Environmental conditions such as water temperature, air pressure and wind velocity are taken into account. The model was tested with synthetic mixtures, petroleum fuels and crude oils with initial viscosities ranging from 2 to 13,000 cSt. The tested temperatures varied from 0 °C to 23.4 °C and wind velocities from 0.3 to 3.8 m/s. The average absolute deviation (AAD) of the diffusion-limited model ranged between 1.62% and 24.87%. In comparison, the AAD of a diffusion-agnostic model ranged between 2.34% and 136.62% against the same tested fluids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Random-walk diffusion and drying of porous materials

    Science.gov (United States)

    Mehrafarin, M.; Faghihi, M.

    2001-12-01

    Based on random-walk diffusion, a microscopic model for drying is proposed to explain the characteristic features of the drying-rate curve of porous materials. The constant drying-rate period is considered as a normal diffusion process. The transition to the falling-rate regime is attributed to the fractal nature of porous materials which results in crossover to anomalous diffusion.

  9. Consistency in the description of diffusion in compacted bentonite

    International Nuclear Information System (INIS)

    Lehikoinen, J.; Muurinen, A.

    2009-01-01

    A macro-level diffusion model, which aims to provide a unifying framework for explaining the experimentally observed co-ion exclusion and greatly controversial counter-ion surface diffusion in a consistent fashion, is presented. It is explained in detail why a term accounting for the non-zero mobility of the counter-ion surface excess is required in the mathematical form of the macroscopic diffusion flux. The prerequisites for the consistency of the model and the problems associated with the interpretation of diffusion in such complex pore geometries as in compacted smectite clays are discussed. (author)

  10. Modelling water fluxes for the analysis of diffuse pollution at the river basin scale

    NARCIS (Netherlands)

    Wit, de M.; Meinardi, C.R.; Wendland, F.; Kunkel, R.

    2000-01-01

    Diffuse pollution is a significant and sometimes even major component of surface water pollution. Diffuse inputs of pollutants to the surface water are related to runoff of precipitation. This means that the analysis of diffuse pollutant fluxes from the land surface to the surface water requires an

  11. Addimer diffusions on Si(100)

    International Nuclear Information System (INIS)

    Lee, Gun Do; Wang, C. Z.; Lu, Z. Y.; Ho, K. M.

    1999-01-01

    The diffusion pathways along the trough and between the trough and the dimer row on the Si(100) surface are investigated by tight-binding molecular dynamics calculations using the environment dependent tight-binding silicon potential and by ab initio calculations using the Car-Parrinello method. The studies discover new diffusion pathways consisting of rotation of addimer. The calculated energy barrier are in excellent agreement with experiment. The rotational diffusion pathway between the trough and the dimer row is much more energetically favorable than other diffusion pathways by parallel and perpendicular addimer. The new pathway along the trough is nearly same as the energy barrier of the diffusion pathway by dissociation of the addimer

  12. Influence of Diffusivity in Room on its Acoustic Response

    Directory of Open Access Journals (Sweden)

    D. Šumarac Pavlović

    2010-11-01

    Full Text Available Diffusivity is a geometrical feature of the room which is proportional to the dimension of relief on its interior surfaces. This paper presents the results of analysis which investigates the correlation between diffusivity in a room and parameters calculated from a recorded impulse response. The analysis was performed using a specially prepared physical model of a parallelepipedic room with different combinations of flat and diffusive interior surfaces.

  13. Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

    Science.gov (United States)

    1979-01-01

    A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

  14. Diffusion-limited mixing by incompressible flows

    Science.gov (United States)

    Miles, Christopher J.; Doering, Charles R.

    2018-05-01

    Incompressible flows can be effective mixers by appropriately advecting a passive tracer to produce small filamentation length scales. In addition, diffusion is generally perceived as beneficial to mixing due to its ability to homogenize a passive tracer. However we provide numerical evidence that, in cases where advection and diffusion are both actively present, diffusion may produce negative effects by limiting the mixing effectiveness of incompressible optimal flows. This limitation appears to be due to the presence of a limiting length scale given by a generalised Batchelor length (Batchelor 1959 J. Fluid Mech. 5 113–33). This length scale limitation may in turn affect long-term mixing rates. More specifically, we consider local-in-time flow optimisation under energy and enstrophy flow constraints with the objective of maximising the mixing rate. We observe that, for enstrophy-bounded optimal flows, the strength of diffusion may not impact the long-term mixing rate. For energy-constrained optimal flows, however, an increase in the strength of diffusion can decrease the mixing rate. We provide analytical lower bounds on mixing rates and length scales achievable under related constraints (point-wise bounded speed and rate-of-strain) by extending the work of Lin et al (2011 J. Fluid Mech. 675 465–76) and Poon (1996 Commun. PDE 21 521–39).

  15. Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

    Czech Academy of Sciences Publication Activity Database

    Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

    2016-01-01

    Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

  16. Effect of surface roughness on the heating rates of large-angled hypersonic blunt cones

    Science.gov (United States)

    Irimpan, Kiran Joy; Menezes, Viren

    2018-03-01

    Surface-roughness caused by the residue of an ablative Thermal Protection System (TPS) can alter the turbulence level and surface heating rates on a hypersonic re-entry capsule. Large-scale surface-roughness that could represent an ablated TPS, was introduced over the forebody of a 120° apex angle blunt cone, in order to test for its influence on surface heating rates in a hypersonic freestream of Mach 8.8. The surface heat transfer rates measured on smooth and roughened models under the same freestream conditions were compared. The hypersonic flow-fields of the smooth and rough-surfaced models were visualized to analyse the flow physics. Qualitative numerical simulations and pressure measurements were carried out to have an insight into the high-speed flow physics. Experimental observations under moderate Reynolds numbers indicated a delayed transition and an overall reduction of 17-46% in surface heating rates on the roughened model.

  17. Physical bases for diffusion welding processes optimization

    International Nuclear Information System (INIS)

    Bulygina, S.M.; Berber, N.N.; Mukhambetov, D.G.

    1999-01-01

    One of wide-spread method of different materials joint is diffusion welding. It has being brought off at the expense of mutual diffusion of atoms of contacting surfaces under long-duration curing at its heating and compression. Welding regime in dependence from properties of welding details is defining of three parameters: temperature, pressure, time. Problem of diffusion welding optimization concludes in determination less values of these parameters, complying with requirements for quality of welded joint. In the work experiments on diffusion welding for calculated temperature and for given surface's roughness were carried out. Tests conduct on samples of iron and iron-nickel alloy with size 1·1·1 cm 3 . Optimal regime of diffusion welding of examined samples in vacuum is defined. It includes compression of welding samples, heating, isothermal holding at temperature 650 deg C during 0.5 h and affords the required homogeneity of joint

  18. Nuclear diffuseness as a degree of freedom

    Science.gov (United States)

    Myers, W. D.; ŚwiaŢecki, W. J.

    1998-12-01

    The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Süssmann width b.

  19. Nuclear diffuseness as a degree of freedom

    International Nuclear Information System (INIS)

    Myers, W.D.; Swiatecki, W.J.

    1998-01-01

    The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Suessmann width b. copyright 1998 The American Physical Society

  20. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  1. Predicting the influence of long-range molecular interactions on macroscopic-scale diffusion by homogenization of the Smoluchowski equation

    Energy Technology Data Exchange (ETDEWEB)

    Kekenes-Huskey, P. M., E-mail: pkekeneshuskey@ucsd.edu [Department of Pharmacology, University of California San Diego, La Jolla, California 92093-0636 (United States); Gillette, A. K. [Department of Mathematics, University of Arizona, Tucson, Arizona 85721-0089 (United States); McCammon, J. A. [Department of Pharmacology, University of California San Diego, La Jolla, California 92093-0636 (United States); Department of Chemistry, Howard Hughes Medical Institute, University of California San Diego, La Jolla, California 92093-0636 (United States)

    2014-05-07

    The macroscopic diffusion constant for a charged diffuser is in part dependent on (1) the volume excluded by solute “obstacles” and (2) long-range interactions between those obstacles and the diffuser. Increasing excluded volume reduces transport of the diffuser, while long-range interactions can either increase or decrease diffusivity, depending on the nature of the potential. We previously demonstrated [P. M. Kekenes-Huskey et al., Biophys. J. 105, 2130 (2013)] using homogenization theory that the configuration of molecular-scale obstacles can both hinder diffusion and induce diffusional anisotropy for small ions. As the density of molecular obstacles increases, van der Waals (vdW) and electrostatic interactions between obstacle and a diffuser become significant and can strongly influence the latter's diffusivity, which was neglected in our original model. Here, we extend this methodology to include a fixed (time-independent) potential of mean force, through homogenization of the Smoluchowski equation. We consider the diffusion of ions in crowded, hydrophilic environments at physiological ionic strengths and find that electrostatic and vdW interactions can enhance or depress effective diffusion rates for attractive or repulsive forces, respectively. Additionally, we show that the observed diffusion rate may be reduced independent of non-specific electrostatic and vdW interactions by treating obstacles that exhibit specific binding interactions as “buffers” that absorb free diffusers. Finally, we demonstrate that effective diffusion rates are sensitive to distribution of surface charge on a globular protein, Troponin C, suggesting that the use of molecular structures with atomistic-scale resolution can account for electrostatic influences on substrate transport. This approach offers new insight into the influence of molecular-scale, long-range interactions on transport of charged species, particularly for diffusion-influenced signaling events

  2. Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

    Science.gov (United States)

    Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

    2015-06-03

    Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Surface diffusivity of cleaved NaCl crystals as a function of humidity: Impedance spectroscopy measurements and implications for crack healing in rock salt

    NARCIS (Netherlands)

    Koelemeijer, P.J.; Peach, C.J.; Spiers, C.J.

    2012-01-01

    Rock salt offers an attractive host rock for geological storage applications, because of its naturally low permeability and the ability of excavation-induced cracks to heal by fluid-assisted diffusive mass transfer. However, while diffusive transport rates in bulk NaCl solution are rapid and well

  4. Statistical validation of the model of diffusion-convection (MDC) of 137Cs for the assessment of recent sedimentation rates in coastal systems

    International Nuclear Information System (INIS)

    Paulo Alves de Lima Ferreira; Eduardo Siegle; Michel Michaelovitch de Mahiques; Rubens Cesar Lopes Figueira; Carlos Augusto Franca Schettini

    2015-01-01

    This study aimed the validation of the model of diffusion-convection (MDC) of 137 Cs for the calculation of recent sedimentation rates in 13 sedimentary cores of two Brazilian coastal systems, the Cananeia-Iguape and Santos-Sao Vicente estuarine systems. The MDC covers key factors responsible for 137 Cs vertical migration in sediments: its diffusion to the interstitial water and the vertical convection of this water through the sediments. This study successfully validated the MDC use to determine sedimentation rates, which was statistically validated not only with 210 Pb xs (unsupported 210 Pb) models, widely used in oceanographic studies, but also by literature values for those regions. (author)

  5. Diffusion time scales and accretion in the sun

    International Nuclear Information System (INIS)

    Michaud, G.

    1977-01-01

    It is thought that surface abundances in the Sun could be due largely to accretion either of comets or grains, and it has been suggested that if surface convection zones were smaller than is usually indicated by model calculations, accretion would be especially important. Unless the zone immediately below the surface convection zone is sufficiently stable for diffusion to be important, other transport processes, such as turbulence and meridional circulation, more efficient than diffusion, will tend to homogenise the Sun. Diffusion is the slowest of the transport processes and will become important when other transport processes become inoperative. Using diffusion theory the minimum mass of the convection zone can be determined in order that transport processes at the bottom of the zone are not to influence abundances in the convection zone. If diffusion time scales are shorter than the life of the star (Sun) diffusion will modify the abundances in the convection zone. The mass in the convection zone for which diffusion time scales are equal to the life of the star on the main sequence then determines the minimum mass in the convection zone that justifies neglect of transport processes at the bottom of the convection zone. It is calculated here that, for the Sun, this mass is between 3 x 10 -3 and 10 -2 solar mass, and a general explosion is derived for the diffusion time scale as a function of the mass of the convection zone. (U.K.)

  6. Surface reaction rate and probability of ozone and alpha-terpineol on glass, polyvinyl chloride, and latex paint surfaces.

    Science.gov (United States)

    Shu, Shi; Morrison, Glenn C

    2011-05-15

    Ozone can react homogeneously with unsaturated organic compounds in buildings to generate undesirable products. However, these reactions can also occur on indoor surfaces, especially for low-volatility organics. Conversion rates of ozone with α-terpineol, a representative low-volatility compound, were quantified on surfaces that mimic indoor substrates. Rates were measured for α-terpineol adsorbed to beads of glass, polyvinylchloride (PVC), and dry latex paint, in a plug flow reactor. A newly defined second-order surface reaction rate coefficient, k(2), was derived from the flow reactor model. The value of k(2) ranged from 0.68 × 10(-14) cm(4)s(-1)molecule(-1) for α-terpineol adsorbed to PVC to 3.17 × 10(-14) cm(4)s(-1)molecule(-1) for glass, but was insensitive to relative humidity. Further, k(2) is only weakly influenced by the adsorbed mass but instead appears to be more strongly related to the interfacial activity α-terpineol. The minimum reaction probability ranged from 3.79 × 10(-6) for glass at 20% RH to 6.75 × 10(-5) for PVC at 50% RH. The combination of high equilibrium surface coverage and high reactivity for α-terpineol suggests that surface conversion rates are fast enough to compete with or even overwhelm other removal mechanisms in buildings such as gas-phase conversion and air exchange.

  7. Diffusion and sorption properties of radionuclides in compacted bentonite

    Energy Technology Data Exchange (ETDEWEB)

    Yu Ji-Wei; Neretnieks, I. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Chemical Engineering and Technology

    1997-07-01

    In this report, recent studies on sorption and diffusion of radionuclides in compacted bentonite have been reviewed. The sorption distribution coefficient and diffusion coefficient data obtained from experiments in the literature have been compiled. Based on these experimental data and the report SKB-TR--91-16 (Brandberg and Skagius, 1991), this report proposes a set of sorption distribution coefficient and diffusion coefficient values for modelling purpose for safety analysis of nuclear waste repositories. The variability and uncertainty of the diffusivity data span somewhat more than an order or magnitude up and down. Most of the nuclides have an effective diffusivity in around 10{sup -10} m{sup 2}/s. Ion exclusion effects are observed for C, Cl and for Tc in oxidizing waters. Effective diffusivities are nearly tow orders of magnitude lower for these elements and of the order of 10{sup -12} m{sup 2}/s. Surface diffusion effects are found for Cs, Ni, Pa, Pb, Ra, Sn, Sr and Zr. Effective diffusivities for these elements are of the order of 10{sup -8} m{sup 2}/s. The surface diffusion effect should decrease in saline waters which is seen for Cs and Sr where there are data available. It is also deemed that Ra will have this effect because of its similarity with Sr. The other nuclides should also show this decrease but no data is available. Sorption and diffusion mechanisms in compacted bentonite are discussed in the report. In highly compacted bentonite, sorption and hence its distribution coefficient is not well defined, and a pore diffusion coefficient or a surface diffusion coefficient is not well defined either. Therefore, an apparent diffusion coefficient and a total concentration gradient should be more relevant in describing the diffusion process in compacted bentonite. 99 refs.

  8. Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

    Science.gov (United States)

    Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

    2018-04-01

    The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

  9. Slaved diffusion in phospholipid bilayers

    Science.gov (United States)

    Zhang, Liangfang; Granick, Steve

    2005-01-01

    The translational diffusion of phospholipids in supported fluid bilayers splits into two populations when polyelectrolytes adsorb at incomplete surface coverage. Spatially resolved measurements using fluorescence correlation spectroscopy show that a slow mode, whose magnitude scales inversely with the degree of polymerization of the adsorbate, coexists with a fast mode characteristic of naked lipid diffusion. Inner and outer leaflets of the bilayer are affected nearly equally. Mobility may vary from spot to spot on the membrane surface, despite the lipid composition being the same. This work offers a mechanism to explain how nanosized domains with reduced mobility arise in lipid membranes. PMID:15967988

  10. Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

    International Nuclear Information System (INIS)

    Singh, Gyanendra; Mehta, Dalip Singh

    2013-01-01

    We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

  11. Ion diffusion in compacted bentonite

    Energy Technology Data Exchange (ETDEWEB)

    Lehikoinen, J. [VTT Chemical Technology, Espoo (Finland)

    1999-03-01

    In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K{sub d}, unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.) 45 refs.

  12. Ion diffusion in compacted bentonite

    International Nuclear Information System (INIS)

    Lehikoinen, J.

    1999-03-01

    In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K d , unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.)

  13. Diffusive epidemic process: theory and simulation

    International Nuclear Information System (INIS)

    Maia, Daniel Souza; Dickman, Ronald

    2007-01-01

    We study the continuous absorbing-state phase transition in the one-dimensional diffusive epidemic process via mean-field theory and Monte Carlo simulation. In this model, particles of two species (A and B) hop on a lattice and undergo reactions B → A and A+B → 2B; the total particle number is conserved. We formulate the model as a continuous-time Markov process described by a master equation. A phase transition between the (absorbing) B-free state and an active state is observed as the parameters (reaction and diffusion rates, and total particle density) are varied. Mean-field theory reveals a surprising, nonmonotonic dependence of the critical recovery rate on the diffusion rate of B particles. A computational realization of the process that is faithful to the transition rates defining the model is devised, allowing for direct comparison with theory. Using the quasi-stationary simulation method we determine the order parameter and the survival time in systems of up to 4000 sites. Due to strong finite-size effects, the results converge only for large system sizes. We find no evidence for a discontinuous transition. Our results are consistent with the existence of three distinct universality classes, depending on whether A particles diffusive more rapidly, less rapidly or at the same rate as B particles. We also perform quasi-stationary simulations of the triplet creation model, which yield results consistent with a discontinuous transition at high diffusion rates

  14. Diffusion of dilute gas in arrays of randomly distributed, vertically aligned, high-aspect-ratio cylinders

    Directory of Open Access Journals (Sweden)

    Wojciech Szmyt

    2017-01-01

    Full Text Available In this work we modelled the diffusive transport of a dilute gas along arrays of randomly distributed, vertically aligned nanocylinders (nanotubes or nanowires as opposed to gas diffusion in long pores, which is described by the well-known Knudsen theory. Analytical expressions for (i the gas diffusion coefficient inside such arrays, (ii the time between collisions of molecules with the nanocylinder walls (mean time of flight, (iii the surface impingement rate, and (iv the Knudsen number of such a system were rigidly derived based on a random-walk model of a molecule that undergoes memoryless, diffusive reflections from nanocylinder walls assuming the molecular regime of gas transport. It can be specifically shown that the gas diffusion coefficient inside such arrays is inversely proportional to the areal density of cylinders and their mean diameter. An example calculation of a diffusion coefficient is delivered for a system of titanium isopropoxide molecules diffusing between vertically aligned carbon nanotubes. Our findings are important for the correct modelling and optimisation of gas-based deposition techniques, such as atomic layer deposition or chemical vapour deposition, frequently used for surface functionalisation of high-aspect-ratio nanocylinder arrays in solar cells and energy storage applications. Furthermore, gas sensing devices with high-aspect-ratio nanocylinder arrays and the growth of vertically aligned carbon nanotubes need the fundamental understanding and precise modelling of gas transport to optimise such processes.

  15. Particle-size effect on the rate of TiO2 carbonizing

    International Nuclear Information System (INIS)

    Lekanova, T.L.; Ryabkov, Yu.I.; Sevbo, O.A.

    2003-01-01

    Dependence of recovery rate constant of titanium dioxide in TiO 2 -C system on the value of specific surface initial components at 1300 deg C was studied. It is shown that decrease in equivalent particle size of titanium dioxide and carbon particles in the range of 500-100 μm has a similar effect on increase in titanium dioxide recovery rate. Analysis of kinetic equations suggests diffusion character of titanium dioxide carbonizing at the values of initial components specific surface in excess of 100 m 2 /g [ru

  16. The influence of excess vacancy generation on the diffusion of ion implanted phosphorus into silicon

    International Nuclear Information System (INIS)

    Bakowski, A.

    1985-01-01

    The diffusion of ion implanted phosphorus in silicon has been studied. It was found that the diffusion coefficient is not only dependent on the phosphorus surface concentration (the concentration effect) but also on the conditions at the silicon surface (the surface effect). The phosphorus diffusion coefficient is considerably lower when the silicon surface during annealing is covered with a CVD oxide layer. It is suggested that excess vacancies generated at the surface are reponsible for both the concentration and surface effects. Enhanced phosphorus diffusion is attributed to the disturbance of thermodynamic equilibrium in the crystal through phosphorus-vacancy part formation by vacancies introduced into silicon at the surface. On the basis of the data presented, it can be concluded that two mechanisms for excess vacancy generation are involved. Assuming that phosphorus diffuses via E-centers, calculations of the concentration profiles and the diffusion coefficient were performed for different concentrations and surface conditions. (orig.)

  17. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-04-05

    Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

  18. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-01-01

    Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

  19. Investigation of the diffusion {proportional_to} brasses using methods depending on the evaporation or condensation of zinc; Etude de la diffusion dans les laitons {proportional_to} au moyen des methodes d'evaporation ou de condensation du zinc

    Energy Technology Data Exchange (ETDEWEB)

    Accary, A [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires; Centre d' Etudes de Chimie Metallurgique du CNRS (France)

    1959-07-01

    Diffusion in {alpha} brasses has been investigated using methods involving the evaporation and the condensation of zinc. Having shown that at sufficiently high temperatures intergranular diffusion has no effect, it was then proved that the rate of evaporation or of condensation can only be defined if the mechanical treatment of the test piece before diffusion, the direction of the diffusion and the nature of the impurities present are also defined. The coefficient of diffusion D is then given by the equation D ({pi}/4t){rho}{sup 2}{sub 0} where t is the duration of the diffusion; {rho}{sub 0} is the extrapolated value of {rho} = ({delta}m)/({delta}C) for a zero value of the variation of concentration ({delta}m in is the change in weight of the test piece per unit surface; {delta}C is the difference between the concentration at the surface and the initial concentration of the test piece). This method has been used to study the effect of the direction of the diffusion on the coefficient of diffusion. The coefficient for diffusion which decreases the concentration of zinc is 5 times greater than that for diffusion which increases the quantity of zinc in the metal; an interpretation of this phenomena based on the mechanism of diffusion vacancies in the structure has been proposed. By means of micrographic investigation and by weighing it has been shown that the presence of certain impurities, such as phosphorous, arsenic, antimony, silicon, and aluminium can result in a marked increase of the rate of diffusion: the effect of these impurities on the coefficient of diffusion has been related to their valency and atomic weight. (author) [French] La diffusion dans les laitons {alpha} a ete etudiee au moyen des methodes d'evaporation et de condensafion du zinc. Apres avoir montre qu'aux temperatures suffisamment elevees, la diffusion intergranulaire ne jouait aucun role, l'auteur a prouve que la vitesse d'evaporation ou de condensation n'est definie que dans la mesure ou

  20. Simple scaling laws for the evaporation of droplets pinned on pillars: Transfer-rate- and diffusion-limited regimes.

    Science.gov (United States)

    Hernandez-Perez, Ruth; García-Cordero, José L; Escobar, Juan V

    2017-12-01

    The evaporation of droplets can give rise to a wide range of interesting phenomena in which the dynamics of the evaporation are crucial. In this work, we find simple scaling laws for the evaporation dynamics of axisymmetric droplets pinned on millimeter-sized pillars. Different laws are found depending on whether evaporation is limited by the diffusion of vapor molecules or by the transfer rate across the liquid-vapor interface. For the diffusion-limited regime, we find that a mass-loss rate equal to 3/7 of that of a free-standing evaporating droplet brings a good balance between simplicity and physical correctness. We also find a scaling law for the evaporation of multicomponent solutions. The scaling laws found are validated against experiments of the evaporation of droplets of (1) water, (2) blood plasma, and (3) a mixture of water and polyethylene glycol, pinned on acrylic pillars of different diameters. These results shed light on the macroscopic dynamics of evaporation on pillars as a first step towards the understanding of other complex phenomena that may be taking place during the evaporation process, such as particle transport and chemical reactions.

  1. Simple scaling laws for the evaporation of droplets pinned on pillars: Transfer-rate- and diffusion-limited regimes

    Science.gov (United States)

    Hernandez-Perez, Ruth; García-Cordero, José L.; Escobar, Juan V.

    2017-12-01

    The evaporation of droplets can give rise to a wide range of interesting phenomena in which the dynamics of the evaporation are crucial. In this work, we find simple scaling laws for the evaporation dynamics of axisymmetric droplets pinned on millimeter-sized pillars. Different laws are found depending on whether evaporation is limited by the diffusion of vapor molecules or by the transfer rate across the liquid-vapor interface. For the diffusion-limited regime, we find that a mass-loss rate equal to 3/7 of that of a free-standing evaporating droplet brings a good balance between simplicity and physical correctness. We also find a scaling law for the evaporation of multicomponent solutions. The scaling laws found are validated against experiments of the evaporation of droplets of (1) water, (2) blood plasma, and (3) a mixture of water and polyethylene glycol, pinned on acrylic pillars of different diameters. These results shed light on the macroscopic dynamics of evaporation on pillars as a first step towards the understanding of other complex phenomena that may be taking place during the evaporation process, such as particle transport and chemical reactions.

  2. Diffusion and Clustering of Carbon Dioxide on Non-porous Amorphous Solid Water

    Energy Technology Data Exchange (ETDEWEB)

    He, Jiao; Emtiaz, Shahnewaj M.; Vidali, Gianfranco, E-mail: jhe08@syr.edu, E-mail: gvidali@syr.edu [Physics Department, Syracuse University, Syracuse, NY 13244 (United States)

    2017-03-01

    Observations by ISO and Spitzer toward young stellar objects showed that CO{sub 2} segregates in the icy mantles covering dust grains. Thermal processing of the ice mixture was proposed as being responsible for the segregation. Although several laboratories studied thermally induced segregation, a satisfying quantification is still missing. We propose that the diffusion of CO{sub 2} along pores inside water ice is the key to quantify segregation. We combined Temperature Programmed Desorption and Reflection Absorption InfraRed Spectroscopy to study how CO{sub 2} molecules interact on a non-porous amorphous solid water (np-ASW) surface. We found that CO{sub 2} diffuses significantly on an np-ASW surface above 65 K and clusters are formed at well below one monolayer. A simple rate equation simulation finds that the diffusion energy barrier of CO{sub 2} on np-ASW is 2150 ± 50 K, assuming a diffusion pre-exponential factor of 10{sup 12} s{sup −1}. This energy should also apply to the diffusion of CO{sub 2} on the wall of pores. The binding energy of CO{sub 2} from CO{sub 2} clusters and CO{sub 2} from H{sub 2}O ice has been found to be 2415 ± 20 K and 2250 ± 20 K, respectively, assuming the same prefactor for desorption. CO{sub 2}–CO{sub 2} interaction is stronger than CO{sub 2}–H{sub 2}O interaction, in agreement with the experimental finding that CO{sub 2} does not wet the np-ASW surface. For comparison, we carried out similar experiments with CO on np-ASW, and found that the CO–CO interaction is always weaker than CO–H{sub 2}O. As a result, CO wets the np-ASW surface. This study should be of help to uncover the thermal history of CO{sub 2} on the icy mantles of dust grains.

  3. Mechanism and kinetics of hydrated electron diffusion

    International Nuclear Information System (INIS)

    Tay, Kafui A.; Coudert, Francois-Xavier; Boutin, Anne

    2008-01-01

    Molecular dynamics simulations are used to study the mechanism and kinetics of hydrated electron diffusion. The electron center of mass is found to exhibit Brownian-type behavior with a diffusion coefficient considerably greater than that of the solvent. As previously postulated by both experimental and theoretical works, the instantaneous response of the electron to the librational motions of surrounding water molecules constitutes the principal mode of motion. The diffusive mechanism can be understood within the traditional framework of transfer diffusion processes, where the diffusive step is akin to the exchange of an extramolecular electron between neighboring water molecules. This is a second-order process with a computed rate constant of 5.0 ps -1 at 298 K. In agreement with experiment the electron diffusion exhibits Arrhenius behavior over the temperature range of 298-400 K. We compute an activation energy of 8.9 kJ mol -1 . Through analysis of Arrhenius plots and the application of a simple random walk model it is demonstrated that the computed rate constant for exchange of an excess electron is indeed the phenomenological rate constant associated with the diffusive process

  4. [Analyze nanofiltration separation rule of chlorogenic acid from low concentration ethanol by Donnan effect and solution-diffusion effect].

    Science.gov (United States)

    Li, Cun-Yu; Liu, Li-Cheng; Jin, Li-Yang; Li, Hong-Yang; Peng, Guo-Ping

    2017-07-01

    To separate chlorogenic acid from low concentration ethanol and explore the influence of Donnan effect and solution-diffusion effect on the nanofiltration separation rule. The experiment showed that solution pH and ethanol volume percent had influences on the separation of chlorogenic acid. Within the pH values from 3 to 7 for chlorogenic acid in 30% ethanol, the rejection rate of chlorogenic acid was changed by 70.27%. Through the response surface method for quadratic regression model, an interaction had been found in molecule weight cut-off, pH and ethanol volume percent. In fixed nanofiltration apparatus, the existence states of chlorogenic acid determinedits separation rules. With the increase of ethanol concentration, the free form chlorogenic acid was easily adsorbed, dissolved on membrane surface and then caused high transmittance due to the solution-diffusion effect. However, at the same time, due to the double effects of Donnan effect and solution-diffusion effect, the ionic state of chlorogenic acid was hard to be adsorbed in membrane surface and thus caused high rejection rate. The combination of Box-Behnken design and response surface analysis can well optimize the concentrate process by nanofiltration, and the results showed that nanofiltration had several big advantages over the traditional vacuum concentrate technology, meanwhile, and solved the problems of low efficiency and serious component lossesin the Chinese medicines separation process for low concentration organic solvent-water solution. Copyright© by the Chinese Pharmaceutical Association.

  5. A Study on the Characteristics of Design Variables for IRSS Diffuser

    Science.gov (United States)

    Cho, Yong-Jin; Ko, Dae-Eun

    2017-11-01

    In modern naval ships, infrared signature suppression systems (IRSS) are installed to decrease the temperature of waste gas generated in propulsion engine and the metallic surface temperature of heated exhaust pipes. Generally, IRSS is composed of eductor, mixing tube, and diffuser. Diffuser serves to reduce the temperature by creating an air film using the pressure difference between internal gas and external air. In this study, design variables were selected by analyzing the diffuser and the characteristics of design variables that affect the performance of diffuser were examined using Taguchi experiment method. For the diffuser performance analysis, a heat flow analysis technique established in previous research was used. The IRSS performance evaluation was carried out based on the average area value of the metal surface temperature and the temperature of the exhaust gas at the outlet of the diffuser, which are variables directly related to the intensity of infrared signature in naval ships. It was verified that the exhaust gas temperature is greatly affected by changes in the diameter of the diffuser outlet, and the metal surface temperature of diffuser is greatly affected by changes in the number of diffuser rings.

  6. Atmospheric diffusion of large clouds

    Energy Technology Data Exchange (ETDEWEB)

    Crawford, T. V. [Univ. of California, Lawrence Radiation Lab., Livermore, California (United States)

    1967-07-01

    Clouds of pollutants travel within a coordinate system that is fixed to the earth's surface, and they diffuse and grow within a coordinate system fixed to the cloud's center. This paper discusses an approach to predicting the cloud's properties, within the latter coordinate system, on space scales of a few hundred meters to a few hundred kilometers and for time periods of a few days. A numerical cloud diffusion model is presented which starts with a cloud placed arbitrarily within the troposphere. Similarity theories of atmospheric turbulence are used to predict the horizontal diffusivity as a function of initial cloud size, turbulent atmospheric dissipation, and time. Vertical diffusivity is input as a function of time and height. Therefore, diurnal variations of turbulent diffusion in the boundary layer and effects of temperature inversions, etc. can be modeled. Nondiffusive cloud depletion mechanisms, such as dry deposition, washout, and radioactive decay, are also a part of this numerical model. An effluent cloud, produced by a reactor run at the Nuclear Rocket Development Station, Nevada, is discussed in this paper. Measurements on this cloud, for a period of two days, are compared to calculations with the above numerical cloud diffusion model. In general, there is agreement. within a factor of two, for airborne concentrations, cloud horizontal area, surface air concentrations, and dry deposition as airborne concentration decreased by seven orders of magnitude during the two-day period. (author)

  7. Surface applicators for high dose rate brachytherapy in AIDS-related kaposi's sarcoma

    International Nuclear Information System (INIS)

    Evans, Michael D.C.; Yassa, Mariam; Podgorsak, Ervin B.; Roman, Ted N.; Schreiner, L. John; Souhami, Luis

    1997-01-01

    Purpose: The development of commercially available surface applicators using high dose rate remote afterloading devices has enabled radiotherapy centers to treat selected superficial lesions using a remote afterloading brachytherapy unit. The dosimetric parameters of these applicators, the clinical implementation of this technique, and a review of the initial patient treatment regimes are presented. Methods and Materials: A set of six fixed-diameter (1, 2, and 3 cm), tungsten/steel surface applicators is available for use with a single stepping-source (Ir-192, 370 GBq) high dose rate afterloader. The source can be positioned either in a parallel or perpendicular orientation to the treatment plane at the center of a conical aperture that sits at an SSD of approximately 15 mm and is used with a 1-mm thick removable plastic cap. The surface dose rates, percent depth dose, and off-axis ratios were measured. A custom-built, ceiling-mounted immobilization device secures the applicator on the surface of the patient's lesion during treatment. Results: Between November 1994, and September 1996, 16 AIDS-related Kaposi's sarcoma patients having a total of 120 lesions have been treated with palliative intent. Treatment sites were distributed between the head and neck, extremity, and torso. Doses ranged from 8 to 20 Gy, with a median dose of 10 Gy delivered in a single fraction. Treatments were well tolerated with minimal skin reaction, except for patients with lesions treated to 20 Gy who developed moderate/severe desquamation. Conclusion: Radiotherapy centers equipped with a high dose rate remote afterloading unit may treat small selected surface lesions with commercially available surface applicators. These surface applicators must be used with a protective cap to eliminate electron contamination. The optimal surface dose appears to be either 10 or 15 Gy depending upon the height of the lesion

  8. Creep effects in diffusion bonding of oxygen-free copper

    CERN Document Server

    Moilanen, Antti

    Diffusion is the transport of atoms or particles through the surrounding material. Various microstructural changes in metals are based on the diffusion phenomena. In solid metals the diffusion is closely related to crystallographic defects. In single-component metals the dominant mechanism of diffusion is the vacancy mechanism. Diffusion bonding is a direct technological application of diffusion. It is an advanced solidstate joining process in which the surfaces of two components are brought to contact with each other and heated under a pressing load in a controlled environment. During the process, the contact surfaces are bonded by atomic diffusion across the interface and as a result, one solid piece is formed. The condition of high temperature and low applied stress combined with relatively long process duration enables the creep effects to take place in bonded metals. Furthermore, creep causes unwanted permanent deformations in the bonded components. Some authors suggest that there could be a threshold fo...

  9. Diffuse Ceiling Ventilation and the Influence of Room Height and Heat Load Distribution

    DEFF Research Database (Denmark)

    Nielsen, Peter Vilhelm; Vilsbøll, Rasmus W; Liu, Li

    2015-01-01

    Diffuse ceiling (inlet) ventilation is an air distribution system that supplies air from the entire ceiling surface, giving a low supply velocity. The flow pattern in the room is controlled by the heat sources. The system generates high mixing flow and the air velocities in the room are expected...... to be not much influenced by the flow rate to the room but dependent on the heat load. Previous studies have shown that diffuse ceiling ventilation has an ability to remove large heat loads without compromising the indoor climate. However, recent experiments indicate that the maximum accepted heat load decreases...... with a large room height and it decreases in connection with certain heat load distributions. Room geometries and heat load distributions that are optimal for diffuse ceiling ventilation are discussed. A simplified design procedure is introduced....

  10. Controls on surface soil drying rates observed by SMAP and simulated by the Noah land surface model

    Science.gov (United States)

    Shellito, Peter J.; Small, Eric E.; Livneh, Ben

    2018-03-01

    Drydown periods that follow precipitation events provide an opportunity to assess controls on soil evaporation on a continental scale. We use SMAP (Soil Moisture Active Passive) observations and Noah simulations from drydown periods to quantify the role of soil moisture, potential evaporation, vegetation cover, and soil texture on soil drying rates. Rates are determined using finite differences over intervals of 1 to 3 days. In the Noah model, the drying rates are a good approximation of direct soil evaporation rates, and our work suggests that SMAP-observed drying is also predominantly affected by direct soil evaporation. Data cover the domain of the North American Land Data Assimilation System Phase 2 and span the first 1.8 years of SMAP's operation. Drying of surface soil moisture observed by SMAP is faster than that simulated by Noah. SMAP drying is fastest when surface soil moisture levels are high, potential evaporation is high, and when vegetation cover is low. Soil texture plays a minor role in SMAP drying rates. Noah simulations show similar responses to soil moisture and potential evaporation, but vegetation has a minimal effect and soil texture has a much larger effect compared to SMAP. When drying rates are normalized by potential evaporation, SMAP observations and Noah simulations both show that increases in vegetation cover lead to decreases in evaporative efficiency from the surface soil. However, the magnitude of this effect simulated by Noah is much weaker than that determined from SMAP observations.

  11. Determining Surface Infiltration Rate of Permeable Pavements with Digital Imaging

    Directory of Open Access Journals (Sweden)

    Caterina Valeo

    2018-01-01

    Full Text Available Cell phone images of pervious pavement surfaces were used to explore relationships between surface infiltration rates (SIR measured using the ASTM C1701 standard test and using a simple falling head test. A fiber-reinforced porous asphalt surface and a highly permeable material comprised of stone, rubber and a polymer binder (Porous Pave were tested. Images taken with a high-resolution cellphone camera were acquired as JPEG files and converted to gray scale images in Matlab® for analysis. The distribution of gray levels was compared to the surface infiltration rates obtained for both pavements with attention given to the mean of the distribution. Investigation into the relationships between mean SIR and parameters determined from the gray level distribution produced in the image analysis revealed that mean SIR measured in both pavements were proportional to the inverse of the mean of the distribution. The relationships produced a coefficient of determination over 85% using both the ASTM and the falling head test in the porous asphalt surface. SIR measurements determined with the ASTM method were highly correlated with the inverse mean of the distribution of gray levels in the Porous Pave material as well, producing coefficients of determination of over 90% and Kendall’s tau-b of roughly 70% for nonparametric data.

  12. Discrimination of thermal diffusivity

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2009-01-01

    Materials such as wood or metal which are at equal temperatures are perceived to be of different ‘coldness’ due to differences in thermal properties, such as the thermal diffusivity. The thermal diffusivity of a material is a parameter that controls the rate with which heat is extracted from the

  13. Model analysis of the influence of gas diffusivity in soil on CO and H2 uptake

    International Nuclear Information System (INIS)

    Yonemura, S.; Yokozawa, M.; Kawashima, S.; Tsuruta, H.

    2000-01-01

    CO and H 2 uptake by soil was studied as a diffusion process. A diffusion model was used to determine how the surface fluxes (net deposition velocities) were controlled by in-situ microbial uptake rates and soil gas diffusivity calculated from the 3-phase system (solid, liquid, gas) in the soil. Analytical solutions of the diffusion model assuming vertical uniformity of soil properties showed that physical properties such as air-filled porosity and soil gas diffusivity were more important in the uptake process than in the emission process. To incorporate the distribution of in-situ microbial uptake, we used a 2-layer model incorporating 'a microbiologically inactive layer and an active layer' as suggested from experimental results. By numerical simulation using the 2-layer model, we estimated the effect of several factors on deposition velocities. The variations in soil gas diffusivity due to physical properties, i.e., soil moisture and air-filled porosity, as well as to the depth of the inactive layer and in-situ microbial uptake, were found to be important in controlling deposition velocities. This result shows that the diffusion process in soil is critically important for CO and H 2 uptake by soil, at least in soils with higher in-situ uptake rates and/or with large variation in soil moisture. Similar uptake rates and the difference in deposition velocity between CO and H 2 may be attributable to differences in CO and H 2 molecular diffusivity. The inactive layer is resistant to diffusion and creates uptake limits in CO and H 2 by soil. The coupling of high temperature and a thick inactive layer, common in arid soils, markedly lowers net CO deposition velocity. The temperature for maximum uptake of CO changes with depth of the inactive layer

  14. High speed surface cleaning by a high repetition rated TEA-CO2 laser

    International Nuclear Information System (INIS)

    Tsunemi, Akira; Hirai, Ryo; Hagiwara, Kouji; Nagasaka, Keigo; Tashiro, Hideo

    1994-01-01

    We demonstrated the feasibility of high speed cleaning of solid surfaces by the laser ablation technique using a TEA-CO 2 laser. The laser pulses with the repetition rate of 1 kHz were applied to paint, rust, moss and dirt attached on the surfaces. The attachments were effectively removed without the damage of bulk surfaces by the irradiation of line-focused sequential pulses with an energy of 300 mJ/pulse. A cleaning rate reached to 17 m 2 /hour for the case of paint removal from iron surfaces. (author)

  15. Effects of temperature and surface orientation on migration behaviours of helium atoms near tungsten surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xiaoshuang; Wu, Zhangwen; Hou, Qing, E-mail: qhou@scu.edu.cn

    2015-10-15

    Molecular dynamics simulations were performed to study the dependence of migration behaviours of single helium atoms near tungsten surfaces on the surface orientation and temperature. For W{100} and W{110} surfaces, He atoms can quickly escape out near the surface without accumulation even at a temperature of 400 K. The behaviours of helium atoms can be well-described by the theory of continuous diffusion of particles in a semi-infinite medium. For a W{111} surface, the situation is complex. Different types of trap mutations occur within the neighbouring region of the W{111} surface. The trap mutations hinder the escape of He atoms, resulting in their accumulation. The probability of a He atom escaping into vacuum from a trap mutation depends on the type of the trap mutation, and the occurrence probabilities of the different types of trap mutations are dependent on the temperature. This finding suggests that the escape rate of He atoms on the W{111} surface does not show a monotonic dependence on temperature. For instance, the escape rate at T = 1500 K is lower than the rate at T = 1100 K. Our results are useful for understanding the structural evolution and He release on tungsten surfaces and for designing models in other simulation methods beyond molecular dynamics.

  16. 850-nm Zn-diffusion vertical-cavity surface-emitting lasers with with oxide-relief structure for high-speed and energy-efficient optical interconnects from very-short to medium (2km) reaches

    Science.gov (United States)

    Shi, Jin-Wei; Wei, Chia-Chien; Chen, Jason (Jyehong); Yang, Ying-Jay

    2015-03-01

    High-speed and "green" ~850 nm vertical-cavity surface-emitting lasers (VCSELs) have lately attracted lots of attention due to their suitability for applications in optical interconnects (OIs). To further enhance the speed and its maximum allowable linking distance of VCSELs are two major trends to meet the requirement of OI in next generation data centers. Recently, by use of the advanced 850 nm VCSEL technique, data rate as high as 64 Gbit/sec over 57m and 20 Gbit/sec over 2km MMF transmission have been demonstrated, respectively. Here, we will review our recent work about 850 nm Zn-diffusion VCSELs with oxide-relief apertures to further enhance the above-mentioned performances. By using Zn-diffusion, we can not only reduce the device resistance but also manipulate the number of optical modes to benefit transmission. Combing such device, which has excellent single-mode (SMSR >30 dB) and high-power (~7mW) performance, with advanced modulation format (OFDM), record-high bit-rate-distance-product through MMF (2.3 km×28 Gbit/sec) has been demonstrated. Furthermore, by selective etching away the oxide aperture inside Zn-diffusion VCSEL, significant enhancement of device speed, D-factor, and reliability can be observed. With such unique VCSEL structure, >40 Gbit/sec energy-efficient transmission over 100m MMF under extremely low-driving current density (<10kA/cm2) has been successfully demonstrated.

  17. Diffuse scattering and the fundamental properties of materials

    CERN Document Server

    EIce, Gene; Barabash, Rozaliya

    2009-01-01

    Diffuse Scattering-the use of off-specular X-Rays and neutrons from surfaces and interfaces-has grown rapidly as a tool for characterizing the surface properties of materials and related fundamental structural properties. It has proven to be especially useful in the understanding of local properties within materials. This book reflects the efforts of physicists and materials scientists around the world who have helped to refine the techniques and applications of diffuse scattering. Major topics specifically covered include: -- Scattering in Low Dimensions -- Elastic and Thermal Diffuse Scattering from Alloys -- Scattering from Complex and Disordered Materials -- Scattering from Distorted Crystals.

  18. Modelling of a 400 kW natural gas diffusion flame using finite-rate chemistry schemes

    International Nuclear Information System (INIS)

    Mueller, Christian; Kremer, Hans; Brink, Anders; Kilpinen, Pia; Hupa, Mikko

    1999-01-01

    The Eddy-Dissipation Combustion Model combined with three different reaction mechanisms is applied to simulate a fuel-rich 400 kW natural gas diffusion flame. The chemical schemes include a global 2-step and a global 4-step approach as well as a reduced 4-step mechanism systematically derived from an elementary scheme. The species and temperature distributions resulting from the different schemes are studied in detail and compared to each other and to experiments. Furthermore the method of implementing finite-rate chemistry to the Eddy-Dissipation Combustion Model is discussed. (author)

  19. Tiny Molybdenites Tell Diffusion Tales

    Science.gov (United States)

    Stein, H. J.; Hannah, J. L.

    2014-12-01

    Diffusion invokes micron-scale exchange during crystal growth and dissolution in magma chambers on short time-scales. Fundamental to interpreting such data are assumptions on magma-fluid dynamics at all scales. Nevertheless, elemental diffusion profiles are used to estimate time scales for magma storage, eruption, and recharge. An underutilized timepiece to evaluate diffusion and 3D mobility of magmatic fluids is high-precision Re-Os dating of molybdenite. With spatially unique molybdenite samples from a young ore system (e.g., 1 Ma) and a double Os spike, analytical errors of 1-3 ka unambiguously separate events in time. Re-Os ages show that hydrous shallow magma chambers locally recharge and expel Cu-Mo-Au-silica as superimposed stockwork vein networks at time scales less than a few thousand years [1]. Re-Os ages provide diffusion rates controlled by a dynamic crystal mush, accumulation and expulsion of metalliferous fluid, and magma reorganization after explosive crystallization events. Importantly, this approach has broad application far from ore deposits. Here, we use Re-Os dating of molybdenite to assess time scales for generating and diffusing metals through the deep crust. To maximize opportunity for chemical diffusion, we use a continental-scale Sveconorwegian mylonite zone for the study area. A geologically constrained suite of molybdenite samples was acquired from quarry exposures. Molybdenite, previously unreported, is extremely scarce. Tiny but telling molybdenites include samples from like occurrences to assure geologic accuracy in Re-Os ages. Ages range from mid-Mesoproterozoic to mid-Neoproterozoic, and correspond to early metamorphic dehydration of a regionally widespread biotite-rich gneiss, localized melting of gneiss to form cm-m-scale K-feldspar ± quartz pods, development of vapor-rich, vuggy mm stringers that serve as volatile collection surfaces in felsic leucosomes, and low-angle (relative to foliation) cross-cutting cm-scale quartz veins

  20. A photo-tunable membrane based on inter-particle crosslinking for decreasing diffusion rates

    KAUST Repository

    Li, Song

    2015-01-01

    Functional polymeric membranes are widely used to adjust and control the diffusion of molecules. Herein, photosensitive poly(hydroxycinnamic acid) (PHCA) microspheres, which were fabricated by an emulsification solvent-evaporation method, were embedded into an ethyl cellulose matrix to fabricate composite membranes with a photo-tunable property. The photoreaction of PHCA is based on the [2 + 2] cycloaddition of cinnamic moieties upon irradiation with 365 nm light. Intra-particle crosslinking in PHCA microspheres was confirmed in the solution phase, while inter-particle crosslinking between adjacent PHCA microspheres dominated the solid membrane phase. The inter-particle crosslinking turned down the permeability of the composite membranes by 74%. To prove the applicability of the designed system, the composite membrane was coated on a model drug reservoir tablet. Upon irradiating the tablet with UV light, the original permeability decreased by 57%, and consequently the diffusion rate of the cargo (Rhodamine B) from the tablet slowed down. Most importantly, the tablet showed sustained release for over 10 days. This controllability can be further tuned by adjusting the membrane thickness. Composite membranes showed excellent processing reproducibility together with consistent mechanical properties. These results demonstrate that the incorporation of photosensitive PHCA microspheres in polymeric membranes provides a promising photo-tunable material for different applications including coating and separation. This journal is © The Royal Society of Chemistry 2015.

  1. Mathematical modeling of synthesis gas fueled electrochemistry and transport including H2/CO co-oxidation and surface diffusion in solid oxide fuel cell

    Science.gov (United States)

    Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin

    2015-10-01

    Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.

  2. Rate equation analysis of hydrogen uptake on Si (100) surfaces

    International Nuclear Information System (INIS)

    Inanaga, S.; Rahman, F.; Khanom, F.; Namiki, A.

    2005-01-01

    We have studied the uptake process of H on Si (100) surfaces by means of rate equation analysis. Flowers' quasiequilibrium model for adsorption and desorption of H [M. C. Flowers, N. B. H. Jonathan, A. Morris, and S. Wright, Surf. Sci. 396, 227 (1998)] is extended so that in addition to the H abstraction (ABS) and β 2 -channel thermal desorption (TD) the proposed rate equation further includes the adsorption-induced desorption (AID) and β 1 -TD. The validity of the model is tested by the experiments of ABS and AID rates in the reaction system H+D/Si (100). Consequently, we find it can well reproduce the experimental results, validating the proposed model. We find the AID rate curve as a function of surface temperature T s exhibits a clear anti-correlation with the bulk dangling bond density versus T s curve reported in the plasma-enhanced chemical vapor deposition (CVD) for amorphous Si films. The significance of the H chemistry in plasma-enhanced CVD is discussed

  3. Multi-species counter-current diffusion model for etching depleted uranium oxide in NF3, RF glow discharge

    International Nuclear Information System (INIS)

    Saber, H.H.; El-Genk, M.S.

    1999-01-01

    Results of recent experiments investigating the decontamination of depleted UO 2 using NF 3 gas, RF gloss discharge, showed that etching rate decreased monotonically with immersion time to the end point. In addition to the formation of non-volatile reaction products on UO 2 surface, the accumulation of UF 6 in the sheath contributed to the decrease in etch rate with immersion time. To investigate the latter, a transient, multi-species, counter-current diffusion model for UO 2 etching is developed. Model results indicated that, depending on gas pressure and absorbed power, the diffusion coefficient of F in the sheath decreased at the end point by ∼15%. At 17.0 Pa and 200 W, the mole fraction of F at UO 2 surface decreased rapidly with immersion time to 61% and 86% of its initial value, after one and two characteristic etch time, respectively, it became almost zero at the end point, reached after 4--5 characteristic etch times

  4. Hydrogen diffusion along grain boundaries in erbium oxide coatings

    International Nuclear Information System (INIS)

    Mao, Wei; Chikada, Takumi; Suzuki, Akihiro; Terai, Takayuki

    2014-01-01

    Diffusion of interstitial atomic hydrogen in erbium oxide (Er 2 O 3 ) was investigated using density functional theory (DFT) and molecular dynamics (MD) methods. Hydrogen diffusivity in bulk, on (0 0 1) surface, and along Σ13 (4–3–1)/[1 1 1] symmetric tilt grain boundaries (GBs) were evaluated in a temperature range of 673–1073 K, as well as hydrogen diffusion barriers. It was found that H diffusion shows the faster on (0 0 1) surface than along GBs and in bulk. Also, energy barrier of H diffusion in bulk estimated by DFT and MD methods is somewhat higher than that along GBs evaluated in the experiments. This suggests that H diffusion in Er 2 O 3 coatings depends on GBs rather than bulk. In addition, with a correction of GB density, the simulated diffusivity along GBs in MD simulations is in good agreement with the experimental data within one order of magnitude. The discrepancy of H diffusivity between the experiments and the simulations should be reduced by considering H concentration, H diffusion direction, deviations of the initial configuration, vacancy defects, etc

  5. Polyphase diffusion of fission products in graphite

    International Nuclear Information System (INIS)

    Dannert, V.

    1989-05-01

    The report attempts to give an introduction into the subject of fission product transport in nuclear graphite and results in an extended proposal of a transport-model. Beginning with a rough description of the graphite in question, an idea about the physical transport-phenomena in graphite is developed. Some of the basic experimental methods, especially techniques of porosimetry, determination of sorption-isotherms and of course several transport-experiments, are briefly described and their results are discussed. Some of the most frequent transport models are introduced and assessed with the criteria emphasized in this report. An extended model is proposed including the following main ideas: The transport of the fission-products is regarded as a two-phase-diffusion process through the open pores of the graphite. The two phases are: surface-diffusion and gas-diffusion. A time-dependent coupling of the two diffusion-phases by sorption-isotherms and a concentration-dependence of the surface diffusion coefficient, also related to the physical behaviour of the sorption-isotherms, are the basic properties of the proposed model. (orig./HP) [de

  6. Diffusion and saponification inside porous cellulose triacetate fibers.

    Science.gov (United States)

    Braun, Jennifer L; Kadla, John F

    2005-01-01

    Cellulose triacetate (CTA) fibers were partially hydrolyzed in 0.054 N solutions of NaOH/H(2)O and NaOMe/MeOH. The surface concentration of acetyl groups was determined using ATR-FTIR. Total acetyl content was determined by the alkaline hydrolysis method. Fiber cross-sections were stained with Congo red in order to examine the interface between reacted and unreacted material; these data were used to estimate the rate constant k and effective diffusivity D(B) for each reagent during the early stages of reaction by means of a volume-based unreacted core model. For NaOH/H(2)O, k = 0.37 L mol(-1) min(-1) and D(B) = 6.2 x 10(-7) cm(2)/sec; for NaOMe/MeOH, k = 4.0 L mol(-1) min(-1) and D(B) = 5.7 x 10(-6) cm(2)/sec. The NaOMe/MeOH reaction has a larger rate constant due to solvent effects and the greater nucleophilicity of MeO(-) as compared to OH(-); the reaction has a larger effective diffusivity because CTA swells more in MeOH than it does in water. Similarities between calculated concentration profiles for each case indicate that the relatively diffuse interface seen in fibers from the NaOMe/MeOH reaction results from factors not considered in the model; shrinkage of stained fiber cross-sections suggests that increased disruption of intermolecular forces may be the cause.

  7. Surface studies of feldspar dissolution using surface replication combined with electron microscopic and spectroscopic techniques

    Energy Technology Data Exchange (ETDEWEB)

    Fung, P C [Petro-Canada, Calgary, Alberta; Sanipelli, G G

    1982-04-01

    The replica of a microcline cleavage surface was examined before and at various stages of interaction with water and acid solutions at 70/sup 0/C, as part of basic geochemical research for the Canadian Nuclear Fuel Waste Management Program to investigate the feasibility of disposal of these wastes in repositories mined in crystalline rocks. The objective of the report presented was to investigate the mechanism for Al and Si removal during incongruent dissolution of feldspars and its effect on dissolution rate. It was found that phase transformation, like dissolution occured preferentially along crystal defects on the surfaces of the feldspars. Secondary minerals always occured as discrete particles occupying only a very small fraction of the total parent surface, and hence, their presence would not affect the bulk composition or, in this regard, the overall dissolution rate of the feldspars by the formation of diffusion barriers.

  8. Hydrogen isotope in erbium oxide: Adsorption, penetration, diffusion, and vacancy trapping

    International Nuclear Information System (INIS)

    Mao, Wei; Chikada, Takumi; Suzuki, Akihiro; Terai, Takayuki; Matsuzaki, Hiroyuki

    2015-01-01

    Highlights: • H adsorption on cubic Er 2 O 3 surface results in electron transfer from H to the surface. • The H penetration energy of at least 1.6 eV is required for cubic Er 2 O 3 surface. • The dominated mechanisms of H diffusion in bulk Er 2 O 3 are elucidated. • H diffusion near or at vacancies in Er 2 O 3 is an exothermic reaction. - Abstract: In this study, we report results using first-principles density functional theory calculations for four critical aspects of the interaction: H adsorption on Er 2 O 3 surface, surface-to-subsurface penetration of H into Er 2 O 3 , bulk diffusion of H in Er 2 O 3 , and trapping of H at vacancies. We identify surface stable adsorption positions and find that H prefers to transfer electrons to the surfaces and form covalent bonds with the nearest neighboring four oxygen atoms. For low surface coverage of H as in our case (0.89 × 10 14 H/cm 2 ), a penetration energy of at least 1.60 eV is required for cubic Er 2 O 3 surfaces. Further, the H diffusion barrier between the planes defined by Er 2 O 3 units along the favorable <1 1 1> direction is found to be very small – 0.16 eV – whereas higher barriers of 0.41 eV and 1.64 eV are required for diffusion across the planes, somewhat higher than the diffusion energy barrier of 0.20 eV observed experimentally at 873 K. In addition, we predict that interstitial H is exothermically trapped when it approaches a vacancy with the vacancy defect behaving as an electron trap since the H-vacancy defect is found to be more stable than the intrinsic defect

  9. Morphometric partitioning of the respiratory surface area and diffusion capacity of the gills and swim bladder in juvenile Amazonian air-breathing fish, Arapaima gigas.

    Science.gov (United States)

    Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin

    2012-09-01

    The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Adsorption and diffusion of H and NH{sub x} as key steps of the NH{sub x} dehydrogenation reaction at the V{sub 2}O{sub 5} (010) surface

    Energy Technology Data Exchange (ETDEWEB)

    Gruber, Mathis; Hermann, Klaus [Fritz-Haber-Institut der MPG, und Sfb 546, Berlin (Germany)

    2009-07-01

    Various selective oxidation reactions as the selective catalytic reduction (SCR) of NO{sub x} or the ammoxidation of propane/propene to acrylonitrile are processed on vanadium based metal-oxide catalysts in the presence of ammonia. In the reactions the intermediates NH{sub 2}, NH{sub 3}, and NH{sub 4} are involved indicating that the adsorption and dehydrogenation of NH{sub x}, x < 4, are important steps. We have performed theoretical studies of corresponding reaction steps where the catalyst is simulated by a finite section of the V{sub 2}O{sub 5} (010) surface. The calculations apply density-functional theory combined with clusters modeling the adsorbate system. The substrate lowers corresponding dehydrogenation energies considerably compared with values for the gas phase reaction. However, the lowering is too small to make dehydrogenation of NH{sub 3} likely to happen. Our results on the role of oxygen vacancies for the dehydrogenation indicate that such surface defects become important for the reaction. Besides the energetics also the diffusion at the surface influences the reaction. A nudged elastic band (NEB) routine has been implemented to evaluate diffusion paths and barriers. Hydrogen diffusion on the surface will be discussed and additional examples for NH{sub x} diffusion will be shown. Based on these results possible reaction scenarios for the dehydrogenation reaction will be presented.

  11. An introduction to visualization of diffusion tensor imaging and its applications

    NARCIS (Netherlands)

    Vilanova, A.; Zhang, S.; Kindlmann, G.; Laidlaw, D.H.; Weickert, J.; Hagen, H.

    2005-01-01

    Summary. Water diffusion is anisotropic in organized tissues such as white matter and muscle. Diffusion tensor imaging (DTI), a non-invasive MR technique, measures water self-diffusion rates and thus gives an indication of the underlying tissue microstructure. The diffusion rate is often expressed

  12. Multicomponent diffusivities from the free volume theory

    NARCIS (Netherlands)

    Wesselingh, J.A; Bollen, A.M

    In this paper the free volume theory of diffusion is extended to multicomponent mixtures. The free volume is taken to be accessible for any component according to its surface. fraction. The resulting equations predict multicomponent (Maxwell-Stefan) diffusivities in simple liquid mixtures from pure

  13. Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Sun Jianzhong; Wang Zhikang; Gong Xiangyang

    2006-01-01

    Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

  14. Thermal diffusivity effect in opto-thermal skin measurements

    International Nuclear Information System (INIS)

    Xiao, P; Imhof, R E; Cui, Y; Ciortea, L I; Berg, E P

    2010-01-01

    We present our latest study on the thermal diffusivity effect in opto-thermal skin measurements. We discuss how thermal diffusivity affects the shape of opto-thermal signal, and how to measure thermal diffusivity in opto-thermal measurements of arbitrary sample surfaces. We also present a mathematical model for a thermally gradient material, and its corresponding opto-thermal signal. Finally, we show some of our latest experimental results of this thermal diffusivity effect study.

  15. Water Vapor Diffusion and Adsorption of Sandstones: Influence of Rock Texture and Composition

    Directory of Open Access Journals (Sweden)

    Martin Keppert

    2016-01-01

    Full Text Available The term sandstone is used for wide range of rocks containing quartz clasts which can be cemented by secondary precipitated quartz or calcite; moreover the space between clasts can be filled by matrix. These facts result in existence of numerous rocks having highly various properties. Sandstones have been used as construction materials due to their good accessibility and workability. Since most of sandstones are porous, water vapor can penetrate through sandstone constructions. The rate of water vapor diffusion, as well as the vapor sorption isotherm, was determined for range of sandstone types. The diffusion resistance factor was found to be dependent on the total porosity of sandstone but the sorption behavior was strongly influenced by nature of the particular sandstone; the specific surface area of stone and presence of clay matrix are determining its sorption isotherm. The published data enable estimating (i diffusion resistance factor of a sandstone via knowledge of its total porosity and (ii the sorption isotherm via knowledge of the stone’s nature and specific surface area. This approach can significantly reduce the time necessary to acquire vapor-related properties of a sandstone.

  16. Self-diffusion on (100), (110), and (111) surfaces of Ni and Cu: A detailed study of prefactors and activation energies

    International Nuclear Information System (INIS)

    Ku'rpick, Ulrike

    2001-01-01

    We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values

  17. Electrodiffusion of lipids on membrane surfaces.

    Science.gov (United States)

    Zhou, Y C

    2012-05-28

    Lateral translocation of lipids and proteins is a universal process on membrane surfaces. Local aggregation or organization of lipids and proteins can be induced when the random lateral motion is mediated by the electrostatic interactions and membrane curvature. Although the lateral diffusion rates of lipids on membranes of various compositions are measured and the electrostatic free energies of predetermined protein-membrane-lipid systems can be computed, the process of the aggregation and the evolution to the electrostatically favorable states remain largely undetermined. Here we propose an electrodiffusion model, based on the variational principle of the free energy functional, for the self-consistent lateral drift-diffusion of multiple species of charged lipids on membrane surfaces. Finite sizes of lipids are modeled to enforce the geometrical constraint of the lipid concentration on membrane surfaces. A surface finite element method is developed to appropriate the Laplace-Beltrami operators in the partial differential equations of the model. Our model properly describes the saturation of lipids on membrane surfaces, and correctly predicts that the MARCKS peptide can consistently sequester three multivalent phosphatidylinositol 4,5-bisphosphate lipids through its basic amino acid residues, regardless of a wide range of the percentage of monovalent phosphatidylserine in the membrane.

  18. Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

    International Nuclear Information System (INIS)

    Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

    2014-01-01

    Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

  19. Ethanol Diffusion on Rutile TiO2(110) Mediated by H Adatoms

    DEFF Research Database (Denmark)

    Huo, Peipei; Hansen, Jonas Ørbæk; Martinez, Umberto

    2012-01-01

    and perpendicular to the rows of surface Ti atoms. The diffusion of ethanol molecules perpendicular to the rows of surface Ti atoms was found to be mediated by H adatoms in the rows of bridge-bonded O (Obr) atoms similarly to previous results obtained for water monomers. In contrast, the diffusion of H adatoms...... across the Ti rows, mediated by ethanol molecules, was observed only very rarely and exclusively on fully hydrogenated TiO2(110) surfaces. Possible reasons why the diffusion of H adatoms across the Ti rows mediated by ethanol molecules occurs less frequently than the cross-row diffusion of ethanol...... molecules mediated by H adatoms are discussed....

  20. The effect of ambient pressure on the evaporation rate of materials

    Science.gov (United States)

    Naumann, R. J.; Russell, W. M.

    1972-01-01

    A simple expression is obtained using a diffusion model for the effect of ambient pressure on the outgassing or evaporation rate of materials. The correctness of the expression is demonstrated by comparing the estimates from this expression with actual weight loss measurements. It is shown that the rate of mass loss is governed by the ratio of mean free path to the characteristic dimension of the surface in question.