WorldWideScience

Sample records for surface diffusion model

  1. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  2. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  3. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  4. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  5. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  6. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  7. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  8. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  9. Models of diffuse solar radiation

    Energy Technology Data Exchange (ETDEWEB)

    Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)

    2008-04-15

    For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)

  10. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  12. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  13. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  14. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  15. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  16. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  17. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  18. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  19. Symmetries and modelling functions for diffusion processes

    International Nuclear Information System (INIS)

    Nikitin, A G; Spichak, S V; Vedula, Yu S; Naumovets, A G

    2009-01-01

    A constructive approach to the theory of diffusion processes is proposed, which is based on application of both symmetry analysis and the method of modelling functions. An algorithm for construction of the modelling functions is suggested. This algorithm is based on the error function expansion (ERFEX) of experimental concentration profiles. The high-accuracy analytical description of the profiles provided by ERFEX approximation allows a convenient extraction of the concentration dependence of diffusivity from experimental data and prediction of the diffusion process. Our analysis is exemplified by its employment in experimental results obtained for surface diffusion of lithium on the molybdenum (1 1 2) surface precovered with dysprosium. The ERFEX approximation can be directly extended to many other diffusion systems.

  20. Lagrangian-similarity diffusion-deposition model

    International Nuclear Information System (INIS)

    Horst, T.W.

    1979-01-01

    A Lagrangian-similarity diffusion model has been incorporated into the surface-depletion deposition model. This model predicts vertical concentration profiles far downwind of the source that agree with those of a one-dimensional gradient-transfer model

  1. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  2. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  3. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  4. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  5. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  6. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  7. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  8. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  9. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  10. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  11. Modelling of diffuse solar fraction with multiple predictors

    Energy Technology Data Exchange (ETDEWEB)

    Ridley, Barbara; Boland, John [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Lauret, Philippe [Laboratoire de Physique du Batiment et des Systemes, University of La Reunion, Reunion (France)

    2010-02-15

    For some locations both global and diffuse solar radiation are measured. However, for many locations, only global radiation is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from direct on some other plane using trigonometry, we need to have diffuse radiation on the horizontal plane available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia. Boland et al. developed a validated model for Australian conditions. Boland et al. detailed our recent advances in developing the theoretical framework for the use of the logistic function instead of piecewise linear or simple nonlinear functions and was the first step in identifying the means for developing a generic model for estimating diffuse from global and other predictors. We have developed a multiple predictor model, which is much simpler than previous models, and uses hourly clearness index, daily clearness index, solar altitude, apparent solar time and a measure of persistence of global radiation level as predictors. This model performs marginally better than currently used models for locations in the Northern Hemisphere and substantially better for Southern Hemisphere locations. We suggest it can be used as a universal model. (author)

  12. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  13. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  14. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  15. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  16. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  17. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  18. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  19. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  20. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  1. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  2. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  3. A new model of anomalous phosphorus diffusion in silicon

    International Nuclear Information System (INIS)

    Budil, M.; Poetzl, H.; Stingeder, G.; Grasserbauer, M.

    1989-01-01

    A model is presented to describe the 'kink and tail' diffusion of phosphorus. The diffusion behaviour of phosphorus is expplained by the motion of phosphorus-interstitial and phosphorus-vacancy pairs in different charge states. The model yields the enhancement of diffusion in the tail region depending on surface concentration. Furthermore it yields the same selfdiffusion coefficient for interstitials as the gold diffusion experiments. A transformation of the diffusion equation was found to reduce the number of simulation equations. (author) 7 refs., 5 figs

  4. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  5. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  6. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  7. Multiphase Microfluidics The Diffuse Interface Model

    CERN Document Server

    2012-01-01

    Multiphase flows are typically described assuming that the different phases are separated by a sharp interface, with appropriate boundary conditions. This approach breaks down whenever the lengthscale of the phenomenon that is being studied is comparable with the real interface thickness, as it happens, for example, in the coalescence and breakup of bubbles and drops, the wetting and dewetting of solid surfaces and, in general, im micro-devices. The diffuse interface model resolves these probems by assuming that all quantities can vary continuously, so that interfaces have a non-zero thickness, i.e. they are "diffuse". The contributions in this book review the theory and describe some relevant applications of the diffuse interface model for one-component, two-phase fluids and for liquid binary mixtures, to model multiphase flows in confined geometries.

  8. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  9. Inclusion of the diffuseness in the schematic model of heavy ion collisions

    International Nuclear Information System (INIS)

    Marta, H.D.

    1989-01-01

    The schematic model of central heavy ion collisions developed by Swiatecki includes the Coulomb and surface contributions to the potential energy of the system and one-body dissipation. This model is extended by considering the diffuseness of the nuclear surface; this has the implication that we must consider the proximity forces in the dynamics of the collisions. For the sake of simplicity we work with symmetrical systems. The results of the model studied are compared with experimental data and with other theoretical calculations. We conclude that the detailed consideration of the diffuseness of the nuclear surfaces does not substantially change the results of the schematic model for sharp surfaces in which the diffuseness is considered only through the parameters. (author) [pt

  10. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  11. A diffusive ink transport model for lipid dip-pen nanolithography

    Science.gov (United States)

    Urtizberea, A.; Hirtz, M.

    2015-09-01

    Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus/substrate interface. Feature shape is controlled by the substrate surface energy. The results are analyzed within a modified model for the ink transport of diffusive inks. At any humidity the dependence of the area spread on the dwell time shows two diffusion regimes: at short dwell times growth is controlled by meniscus diffusion while at long dwell times surface diffusion governs the process. The critical point for the switch of regime depends on the humidity.Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus

  12. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  13. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  14. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  15. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  16. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  17. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  18. Diffuse radiation models and monthly-average, daily, diffuse data for a wide latitude range

    International Nuclear Information System (INIS)

    Gopinathan, K.K.; Soler, A.

    1995-01-01

    Several years of measured data on global and diffuse radiation and sunshine duration for 40 widely spread locations in the latitude range 36° S to 60° N are used to develop and test models for estimating monthly-mean, daily, diffuse radiation on horizontal surfaces. Applicability of the clearness-index (K) and sunshine fraction (SSO) models for diffuse estimation and the effect of combining several variables into a single multilinear equation are tested. Correlations connecting the diffuse to global fraction (HdH) with K and SSO predict Hd values more accurately than their separate use. Among clearness-index and sunshine-fraction models, SSO models are found to have better accuracy if correlations are developed for wide latitude ranges. By including a term for declinations in the correlation, the accuracy of the estimated data can be marginally improved. The addition of latitude to the equation does not help to improve the accuracy further. (author)

  19. A generalized diffusion model for growth of nanoparticles synthesized by colloidal methods.

    Science.gov (United States)

    Wen, Tianlong; Brush, Lucien N; Krishnan, Kannan M

    2014-04-01

    A nanoparticle growth model is developed to predict and guide the syntheses of monodisperse colloidal nanoparticles in the liquid phase. The model, without any a priori assumptions, is based on the Fick's law of diffusion, conservation of mass and the Gibbs-Thomson equation for crystal growth. In the limiting case, this model reduces to the same expression as the currently accepted model that requires the assumption of a diffusion layer around each nanoparticle. The present growth model bridges the two limiting cases of the previous model i.e. complete diffusion controlled and adsorption controlled growth of nanoparticles. Specifically, the results show that a monodispersion of nanoparticles can be obtained both with fast monomer diffusion and with surface reaction under conditions of small diffusivity to surface reaction constant ratio that results is growth 'focusing'. This comprehensive description of nanoparticle growth provides new insights and establishes the required conditions for fabricating monodisperse nanoparticles critical for a wide range of applications. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Integrated sorption and diffusion model for bentonite. Part 1. Clay-water interaction and sorption modeling in dispersed systems

    International Nuclear Information System (INIS)

    Tachi, Yukio; Suyama, Tadahiro; Ochs, Michael

    2014-01-01

    To predict the long-term migration of radionuclides (RNs) under variable conditions within the framework of safety analyses for geological disposal, thermodynamic sorption models are very powerful tools. The integrated sorption and diffusion (ISD) model for compacted bentonite was developed to achieve a consistent combination of clay–water interaction, sorption, and diffusion models. The basic premise considered in the ISD model was to consistently use the same simple surface model design and parameters for describing RNs sorption/diffusion as well as clay surface and porewater chemistry. A simple 1-site non-electrostatic surface complexation model in combination with a 1-site ion exchange model was selected to keep sorption model characteristics relatively robust for compacted systems. Fundamental parameters for the proposed model were evaluated from surface titration data for purified montmorillonite. The resulting basic model was then parameterized on the basis of selected published sorption data-sets for Np(V), Am(III), and U(VI) in dispersed systems, which cover a range of key geochemical conditions such as pH, ionic strength, and carbonate concentration. The sorption trends for these RNs can be quantitatively described by the model considering a full suite of surface species including hydrolytic and carbonate species. The application of these models to the description of diffusive-sorptive transport in compacted bentonites is presented in Part 2. (author)

  1. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  2. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Directory of Open Access Journals (Sweden)

    Murat Kuscu

    Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  3. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Science.gov (United States)

    Kuscu, Murat; Akan, Ozgur B

    2018-01-01

    We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  4. A diffusive ink transport model for lipid dip-pen nanolithography.

    Science.gov (United States)

    Urtizberea, A; Hirtz, M

    2015-10-14

    Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus/substrate interface. Feature shape is controlled by the substrate surface energy. The results are analyzed within a modified model for the ink transport of diffusive inks. At any humidity the dependence of the area spread on the dwell time shows two diffusion regimes: at short dwell times growth is controlled by meniscus diffusion while at long dwell times surface diffusion governs the process. The critical point for the switch of regime depends on the humidity.

  5. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  6. Modelling of Innovation Diffusion

    Directory of Open Access Journals (Sweden)

    Arkadiusz Kijek

    2010-01-01

    Full Text Available Since the publication of the Bass model in 1969, research on the modelling of the diffusion of innovation resulted in a vast body of scientific literature consisting of articles, books, and studies of real-world applications of this model. The main objective of the diffusion model is to describe a pattern of spread of innovation among potential adopters in terms of a mathematical function of time. This paper assesses the state-of-the-art in mathematical models of innovation diffusion and procedures for estimating their parameters. Moreover, theoretical issues related to the models presented are supplemented with empirical research. The purpose of the research is to explore the extent to which the diffusion of broadband Internet users in 29 OECD countries can be adequately described by three diffusion models, i.e. the Bass model, logistic model and dynamic model. The results of this research are ambiguous and do not indicate which model best describes the diffusion pattern of broadband Internet users but in terms of the results presented, in most cases the dynamic model is inappropriate for describing the diffusion pattern. Issues related to the further development of innovation diffusion models are discussed and some recommendations are given. (original abstract

  7. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  8. A new model of tail diffusion of phosphorus and boron in silicon

    International Nuclear Information System (INIS)

    Morehead, F.F.; Lever, R.F.

    1986-01-01

    It is well known that high surface concentration phosphorus diffusion leads to deeply penetrating tails in its concentration profile. At 700 0 C the tail diffusivity exceeds that of low concentration phosphorus by a factor of a thousand. Less spectacular, but very significant tailing also affects boron, making the conventional models contained in commonly available process simulation programs quite inaccurate for boron diffusions with high surface concentrations. The authors show that the observed tailing can be accounted for by a model whose central assumption is the local equality of dopant and oppositely directed defect fluxes. As predicted by the model, the effect is greatest for normal processing at low temperatures for high surface concentrations. It is minimal for the high temperatures of rapid thermal annealing and unrelated to transient effects

  9. Catchment Models and Management Tools for diffuse Contaminants (Sediment, Phosphorus and Pesticides): DIFFUSE Project

    Science.gov (United States)

    Mockler, Eva; Reaney, Simeon; Mellander, Per-Erik; Wade, Andrew; Collins, Adrian; Arheimer, Berit; Bruen, Michael

    2017-04-01

    The agricultural sector is the most common suspected source of nutrient pollution in Irish rivers. However, it is also often the most difficult source to characterise due to its predominantly diffuse nature. Particulate phosphorus in surface water and dissolved phosphorus in groundwater are of particular concern in Irish water bodies. Hence the further development of models and indices to assess diffuse sources of contaminants are required for use by the Irish Environmental Protection Agency (EPA) to provide support for river basin planning. Understanding connectivity in the landscape is a vital component of characterising the source-pathway-receptor relationships for water-borne contaminants, and hence is a priority in this research. The DIFFUSE Project will focus on connectivity modelling and incorporation of connectivity into sediment, nutrient and pesticide risk mapping. The Irish approach to understanding and managing natural water bodies has developed substantially in recent years assisted by outputs from multiple research projects, including modelling and analysis tools developed during the Pathways and CatchmentTools projects. These include the Pollution Impact Potential (PIP) maps, which are an example of research output that is used by the EPA to support catchment management. The PIP maps integrate an understanding of the pollution pressures and mobilisation pathways and, using the source-pathways-receptor model, provide a scientific basis for evaluation of mitigation measures. These maps indicate the potential risk posed by nitrate and phosphate from diffuse agricultural sources to surface and groundwater receptors and delineate critical source areas (CSAs) as a means of facilitating the targeting of mitigation measures. Building on this previous research, the DIFFUSE Project will develop revised and new catchment managements tools focused on connectivity, sediment, phosphorus and pesticides. The DIFFUSE project will strive to identify the state

  10. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  11. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  12. Mathematical modeling of synthesis gas fueled electrochemistry and transport including H2/CO co-oxidation and surface diffusion in solid oxide fuel cell

    Science.gov (United States)

    Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin

    2015-10-01

    Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.

  13. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  14. Diffuse solar radiation estimation models for Turkey's big cities

    International Nuclear Information System (INIS)

    Ulgen, Koray; Hepbasli, Arif

    2009-01-01

    A reasonably accurate knowledge of the availability of the solar resource at any place is required by solar engineers, architects, agriculturists, and hydrologists in many applications of solar energy such as solar furnaces, concentrating collectors, and interior illumination of buildings. For this purpose, in the past, various empirical models (or correlations) have been developed in order to estimate the solar radiation around the world. This study deals with diffuse solar radiation estimation models along with statistical test methods used to statistically evaluate their performance. Models used to predict monthly average daily values of diffuse solar radiation are classified in four groups as follows: (i) From the diffuse fraction or cloudness index, function of the clearness index, (ii) From the diffuse fraction or cloudness index, function of the relative sunshine duration or sunshine fraction, (iii) From the diffuse coefficient, function of the clearness index, and (iv) From the diffuse coefficient, function of the relative sunshine duration or sunshine fraction. Empirical correlations are also developed to establish a relationship between the monthly average daily diffuse fraction or cloudness index (K d ) and monthly average daily diffuse coefficient (K dd ) with the monthly average daily clearness index (K T ) and monthly average daily sunshine fraction (S/S o ) for the three big cities by population in Turkey (Istanbul, Ankara and Izmir). Although the global solar radiation on a horizontal surface and sunshine duration has been measured by the Turkish State Meteorological Service (STMS) over all country since 1964, the diffuse solar radiation has not been measured. The eight new models for estimating the monthly average daily diffuse solar radiation on a horizontal surface in three big cites are validated, and thus, the most accurate model is selected for guiding future projects. The new models are then compared with the 32 models available in the

  15. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  16. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  17. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  18. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  19. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  20. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  1. Mean field diffusion models for precipitation in crystalline GaAs including surface tension and bulk stresses

    Energy Technology Data Exchange (ETDEWEB)

    Dreyer, Wolfgang [Weierstrass-Institut fuer Angewandte Analysis und Stochastik (WIAS) im Forschungsverbund Berlin e.V. (Germany); Kimmerle, Sven-Joachim [Humboldt-Univ. Berlin (Germany). Dept. of Mathematics

    2009-07-01

    Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first class of models treats the diffusion-controlled regime of interface motion, while the second class is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. We consider homogenised models, where different length scales of the experimental situation have been exploited in order to simplify the equations. These homogenised models generalise the well-known Lifshitz-Slyozov-Wagner model for Ostwald ripening. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

  2. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  3. Dissolution model for a glass having an adherent insoluble surface layer

    International Nuclear Information System (INIS)

    Harvey, K.B.; Larocque, C.A.B.

    1990-01-01

    Waste form glasses that contain substantial quantities of iron, manganese, and aluminum oxides, such as the Savannah River SRL TDS-131 glass, form a thick, hydrated surface layer when placed in contact with water. The dissolution of such a glass has been modeled with the Savannah River Model. The authors showed previously that the equations of the Savannah River Model could be fitted to published experimental data if a time-dependent diffusion coefficient was assumed for species of diffusing through the surface layer. The Savannah River Model assumes that all of the material dissolved from the glass enters solution, whereas it was observed that substantial quantities of material were retained in the surface layer. An alternative model, presented contains a mass balance equation that allows material either to enter solution or to be retained in the surface layer. It is shown that the equations derived using this model can be fitted to the published experimental data assuming a constant diffusion coefficient for species diffusing through the surface layer

  4. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  5. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  6. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  7. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  8. Estimation and prediction under local volatility jump-diffusion model

    Science.gov (United States)

    Kim, Namhyoung; Lee, Younhee

    2018-02-01

    Volatility is an important factor in operating a company and managing risk. In the portfolio optimization and risk hedging using the option, the value of the option is evaluated using the volatility model. Various attempts have been made to predict option value. Recent studies have shown that stochastic volatility models and jump-diffusion models reflect stock price movements accurately. However, these models have practical limitations. Combining them with the local volatility model, which is widely used among practitioners, may lead to better performance. In this study, we propose a more effective and efficient method of estimating option prices by combining the local volatility model with the jump-diffusion model and apply it using both artificial and actual market data to evaluate its performance. The calibration process for estimating the jump parameters and local volatility surfaces is divided into three stages. We apply the local volatility model, stochastic volatility model, and local volatility jump-diffusion model estimated by the proposed method to KOSPI 200 index option pricing. The proposed method displays good estimation and prediction performance.

  9. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  10. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  11. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  12. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  13. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  14. Validation of a mixture-averaged thermal diffusion model for premixed lean hydrogen flames

    Science.gov (United States)

    Schlup, Jason; Blanquart, Guillaume

    2018-03-01

    The mixture-averaged thermal diffusion model originally proposed by Chapman and Cowling is validated using multiple flame configurations. Simulations using detailed hydrogen chemistry are done on one-, two-, and three-dimensional flames. The analysis spans flat and stretched, steady and unsteady, and laminar and turbulent flames. Quantitative and qualitative results using the thermal diffusion model compare very well with the more complex multicomponent diffusion model. Comparisons are made using flame speeds, surface areas, species profiles, and chemical source terms. Once validated, this model is applied to three-dimensional laminar and turbulent flames. For these cases, thermal diffusion causes an increase in the propagation speed of the flames as well as increased product chemical source terms in regions of high positive curvature. The results illustrate the necessity for including thermal diffusion, and the accuracy and computational efficiency of the mixture-averaged thermal diffusion model.

  15. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  16. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  17. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  18. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  19. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  20. Modelling of diffusion in presurface silicon layer under the action of pulsed high-intensity ion beam

    International Nuclear Information System (INIS)

    Aktaev, N.E.; Remnev, G.E.

    2015-01-01

    The influence of the pulsed high-intensity ion beam on the silicon is studied by use the developed theoretical model. The input parameters of the model were the settings of the experimental setup of the TEMP-4. It is shown, that at the short-pulsed implantation regime of the TEMP-4 the silicon surface does not melt. However, the regime leads to the high temperature gradient which promotes the diffusion process from the surface into the depth the silicon simple. The diffused particles are the carbon atoms adsorbed on the silicon surface by the various cases. Thus, it is shown that the carbon atom diffused from the surface make the main contribution to the forming of the concentration profile. The concentration of the implanted carbon ions less more than tree orders compared with the concentration of the diffused carbon atoms. (authors)

  1. Models for the estimation of diffuse solar radiation for typical cities in Turkey

    International Nuclear Information System (INIS)

    Bakirci, Kadir

    2015-01-01

    In solar energy applications, diffuse solar radiation component is required. Solar radiation data particularly in terms of diffuse component are not readily affordable, because of high price of measurements as well as difficulties in their maintenance and calibration. In this study, new empirical models for predicting the monthly mean diffuse solar radiation on a horizontal surface for typical cities in Turkey are established. Therefore, fifteen empirical models from studies in the literature are used. Also, eighteen diffuse solar radiation models are developed using long term sunshine duration and global solar radiation data. The accuracy of the developed models is evaluated in terms of different statistical indicators. It is found that the best performance is achieved for the third-order polynomial model based on sunshine duration and clearness index. - Highlights: • Diffuse radiation is given as a function of clearness index and sunshine fraction. • The diffuse radiation is an important parameter in solar energy applications. • The diffuse radiation measurement is for limited periods and it is very rare. • The new models can be used to estimate monthly average diffuse solar radiation. • The accuracy of the models is evaluated on the basis of statistical indicators

  2. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  3. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  4. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  5. Modeling of Reaction Processes Controlled by Diffusion

    International Nuclear Information System (INIS)

    Revelli, Jorge

    2003-01-01

    Stochastic modeling is quite powerful in science and technology.The technics derived from this process have been used with great success in laser theory, biological systems and chemical reactions.Besides, they provide a theoretical framework for the analysis of experimental results on the field of particle's diffusion in ordered and disordered materials.In this work we analyze transport processes in one-dimensional fluctuating media, which are media that change their state in time.This fact induces changes in the movements of the particles giving rise to different phenomena and dynamics that will be described and analyzed in this work.We present some random walk models to describe these fluctuating media.These models include state transitions governed by different dynamical processes.We also analyze the trapping problem in a lattice by means of a simple model which predicts a resonance-like phenomenon.Also we study effective diffusion processes over surfaces due to random walks in the bulk.We consider different boundary conditions and transitions movements.We derive expressions that describe diffusion behaviors constrained to bulk restrictions and the dynamic of the particles.Finally it is important to mention that the theoretical results obtained from the models proposed in this work are compared with Monte Carlo simulations.We find, in general, excellent agreements between the theory and the simulations

  6. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  7. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  8. Optimizing the Diffusion Welding Process for Alloy 800H: Thermodynamic, Diffusion Modeling, and Experimental Work

    International Nuclear Information System (INIS)

    Mizia, R.E.; Clark, D.E.; Glazoff, M.V.; Lister, Tedd E.; Trowbridge, T.L.

    2011-01-01

    A research effort was made to evaluate the usefulness of modern thermodynamic and diffusion computational tools, Thermo-Calc(copyright) and Dictra(copyright), in optimizing the parameters for diffusion welding of Alloy 800H. This would achieve a substantial reduction in the overall number of experiments required to achieve optimal welding and post-weld heat treatment conditions. This problem is important because diffusion welded components of Alloy 800H are being evaluated for use in assembling compact, micro-channel heat exchangers that are being proposed in the design of a high temperature gas-cooled reactor by the US Department of Energy. The modeling was done in close contact with experimental work. The latter included using the Gleeble 3500 System(reg sign) for welding simulation, mechanical property measurement, and light optical and Scanning Electron Microscopy. The modeling efforts suggested a temperature of 1150 C for 1 hour with an applied pressure of 5 MPa using a 15 μm Ni foil as a joint filler to reduce chromium oxidation on the welded surfaces. Good agreement between modeled and experimentally determined concentration gradients was achieved, and model refinements to account for the complexity of actual alloy materials are suggested.

  9. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  10. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  11. A current induced diffusion model of gas sputtering

    International Nuclear Information System (INIS)

    Hotston, E.S.

    1980-01-01

    A model is proposed to explain the experimental results on deuteron trapping in stainless steel targets at low temperatures carried out at Garching and Culham. The model proposes that the ions are trapped in two kinds of sites: Deep sites with high activation energy and shallow sites of low activation energy. Trapped deuterons reach the surface of the target by being expelled from shallow sites by the action of the ion beam and migrate to nearby sites in a random way, thus moving by a bombardment induced diffusion. Ions diffusing to the target surface and being released are said to be sputtered from the target. It has been necessary to assume numerical values for sizes of some of the processes which occur. With a suitable choice of values the model successfully predicts the numbers of deuterons trapped per unit area of the target, the obserbed density profile of the trapped ions and the threshold at which sputtering starts. The model also successfully describes the replacement of the trapped deuterons by protons, when the deuteron beam is replaced by a proton beam. The collision cross-section for beam ions and ions trapped in shallow sites is too large, 4 x 10 -13 cm 2 , for a binary collision and it is tentatively suggested that the ions in the shallow sites may be in small voids in the target which may be connected with blister formation. Comparison of the present model with one being developed to describe the trapping of deuterons in carbon suggests that it may be possible to describe all gas sputtering experiments in terms of diffusion processes. (orig.)

  12. Development of an atmospheric diffusion numerical model for a nuclear facility. Numerical calculation method incorporating building effects

    International Nuclear Information System (INIS)

    Sada, Koichi; Michioka, Takenobu; Ichikawa, Yoichi

    2002-01-01

    Because effluent gas is sometimes released from low positions, viz., near the ground surface and around buildings, the effects caused by buildings within the site area are not negligible for gas diffusion predictions. For these reasons, the effects caused by buildings for gas diffusion are considered under the terrain following calculation coordinate system in this report. Numerical calculation meshes on the ground surface are treated as the building with the adaptation of wall function techniques of turbulent quantities in the flow calculations using a turbulence closure model. The reflection conditions of released particles on building surfaces are taken into consideration in the diffusion calculation using the Lagrangian particle model. Obtained flow and diffusion calculation results are compared with those of wind tunnel experiments around the building. It was apparent that features observed in a wind tunnel, viz., the formation of cavity regions behind the building and the gas diffusion to the ground surface behind the building, are also obtained by numerical calculation. (author)

  13. A first approximation for modeling the liquid diffusion pathway at the greater confinement disposal facilities

    International Nuclear Information System (INIS)

    Olague, N.E.; Price, L.L.

    1991-01-01

    The greater confinement disposal (GCD) project is an ongoing project examining the disposal of orphan wastes in Area 5 of the Nevada Test Site. One of the major tasks for the project is performance assessment. With regard to performance assessment, a preliminary conceptual model for ground-water flow and radionuclide transport to the accessible environment at the GCD facilities has been developed. One of the transport pathways that has been postulated is diffusion of radionuclides in the liquid phase upward to the land surface. This pathway is not usually considered in a performance assessment, but is included in the GCD conceptual model because of relatively low recharge estimates at the GCD site and the proximity of the waste to the land surface. These low recharge estimates indicate that convective flow downward to the water table may be negligible; thus, diffusion upward to the land surface may then become important. As part of a preliminary performance assessment which considered a basecase scenario and a climate-change scenario, a first approximation for modeling the liquid-diffusion pathway was formulated. The model includes an analytical solution that incorporates both diffusion and radioactivity decay. Overall, these results indicate that, despite the configuration of the GCD facilities that establishes the need for considering the liquid-diffusion pathway, the GCD disposal concept appears to be a technically feasible method for disposing of orphan wastes. Future analyses will consist of investigating the underlying assumptions of the liquid-diffusion model, refining the model is necessary, and reducing uncertainty in the input parameters. 11 refs., 6 figs

  14. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  15. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  16. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  17. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  18. A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

    Science.gov (United States)

    Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

    2016-01-01

    Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

  19. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  20. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  1. Surface desorption and bulk diffusion models of tritium release from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles

    Energy Technology Data Exchange (ETDEWEB)

    Avila, R.E., E-mail: ravila@cchen.c [Departamento de Materiales Nucleares, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile); Pena, L.A.; Jimenez, J.C. [Departamento de Produccion y Servicios, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile)

    2010-10-30

    The release of tritium from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles, in batch experiments, is studied by means of temperature programmed desorption. Data reduction focuses on the analysis of the non-oxidized and oxidized tritium components in terms of release limited by diffusion from the bulk of ceramic grains, or by first or second order surface desorption. By analytical and numerical methods the in-furnace tritium release is deconvoluted from the ionization chamber transfer functions, for which a semi-empirical form is established. The release from Li{sub 2}TiO{sub 3} follows second order desorption kinetics, requiring a temperature for a residence time of 1 day (T{sub 1dRes}) of 620 K, and 603 K, of the non-oxidized, and the oxidized components, respectively. The release from Li{sub 2}ZrO{sub 3} appears as limited by either diffusion from the bulk of the ceramic grains, or by first order surface desorption, the first possibility being the more probable. The respective values of T{sub 1dRes} for the non-oxidized component are 661 K, according to the first order surface desorption model, and 735 K within the bulk diffusion limited model.

  2. Numerical modeling of turbulent jet diffusion flames in the atmospheric surface layer

    NARCIS (Netherlands)

    Hernández, J.; Crespo, A.; Duijm, N.J.

    1995-01-01

    The evolution of turbulent jet diffusion flames of natural gas in air is predicted using a finite-volume procedure for solving the flow equations. The model is three dimensional, elliptic and based on the conserved-scalar approach and the laminar flamelet concept. A laminar flamelet prescription for

  3. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  4. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  5. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  6. Modeling Cryptosporidium spp. Oocyst Inactivation in Bubble-Diffuser Ozone Contactors

    Science.gov (United States)

    1998-07-01

    requirements for Giardia lamblia (G. lamblia) and viruses under the Surface Water Treatment Rule (SWTR). Minimum CT requirements include relatively...parvum and C. muris ) oocysts in ozone bubble-diffuser contactors. The model is calibrated with semi-batch kinetic data, verified with pilot-scale

  7. An axisymmetric non-hydrostatic model for double-diffusive water systems

    Science.gov (United States)

    Hilgersom, Koen; Zijlema, Marcel; van de Giesen, Nick

    2018-02-01

    The three-dimensional (3-D) modelling of water systems involving double-diffusive processes is challenging due to the large computation times required to solve the flow and transport of constituents. In 3-D systems that approach axisymmetry around a central location, computation times can be reduced by applying a 2-D axisymmetric model set-up. This article applies the Reynolds-averaged Navier-Stokes equations described in cylindrical coordinates and integrates them to guarantee mass and momentum conservation. The discretized equations are presented in a way that a Cartesian finite-volume model can be easily extended to the developed framework, which is demonstrated by the implementation into a non-hydrostatic free-surface flow model. This model employs temperature- and salinity-dependent densities, molecular diffusivities, and kinematic viscosity. One quantitative case study, based on an analytical solution derived for the radial expansion of a dense water layer, and two qualitative case studies demonstrate a good behaviour of the model for seepage inflows with contrasting salinities and temperatures. Four case studies with respect to double-diffusive processes in a stratified water body demonstrate that turbulent flows are not yet correctly modelled near the interfaces and that an advanced turbulence model is required.

  8. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  9. A simplified model exploration research of new anisotropic diffuse radiation model

    International Nuclear Information System (INIS)

    Yao, Wanxiang; Li, Zhengrong; Wang, Xiao; Zhao, Qun; Zhang, Zhigang; Lin, Lin

    2016-01-01

    Graphical abstract: The specific process of measured diffuse radiation data. - Highlights: • Simplified diffuse radiation model is extremely important for solar radiation simulation and energy simulation. • A new simplified anisotropic diffuse radiation model (NSADR model) is proposed. • The accuracy of existing models and NSADR model is compared based on the measured values. • The accuracy of the NSADR model is higher than that of the existing models, and suitable for calculating diffuse radiation. - Abstract: More accurate new anisotropic diffuse radiation model (NADR model) has been proposed, but the parameters and calculation process of NADR model used in the process are complex. So it is difficult to widely used in the simulation software and engineering calculation. Based on analysis of the diffuse radiation model and measured diffuse radiation data, this paper put forward three hypotheses: (1) diffuse radiation from sky horizontal region is concentrated in a very thin layer which is close to the line source; (2) diffuse radiation from circumsolar region is concentrated in the point of the sun; (3) diffuse radiation from orthogonal region is concentrated in the point located at 90 degree angles with the Sun. Based on these hypotheses, NADR model is simplified to a new simplified anisotropic diffuse radiation model (NSADR model). Then the accuracy of NADR model and its simplified model (NSADR model) are compared with existing models based on the measured values, and the result shows that Perez model and its simplified model are relatively accurate among existing models. However, the accuracy of these two models is lower than the NADR model and NSADR model due to neglect the influence of the orthogonal diffuse radiation. The accuracy of the NSADR model is higher than that of the existing models, meanwhile, another advantage is that the NSADR model simplifies the process of solution parameters and calculation. Therefore it is more suitable for

  10. Double diffusivity model under stochastic forcing

    Science.gov (United States)

    Chattopadhyay, Amit K.; Aifantis, Elias C.

    2017-05-01

    The "double diffusivity" model was proposed in the late 1970s, and reworked in the early 1980s, as a continuum counterpart to existing discrete models of diffusion corresponding to high diffusivity paths, such as grain boundaries and dislocation lines. It was later rejuvenated in the 1990s to interpret experimental results on diffusion in polycrystalline and nanocrystalline specimens where grain boundaries and triple grain boundary junctions act as high diffusivity paths. Technically, the model pans out as a system of coupled Fick-type diffusion equations to represent "regular" and "high" diffusivity paths with "source terms" accounting for the mass exchange between the two paths. The model remit was extended by analogy to describe flow in porous media with double porosity, as well as to model heat conduction in media with two nonequilibrium local temperature baths, e.g., ion and electron baths. Uncoupling of the two partial differential equations leads to a higher-ordered diffusion equation, solutions of which could be obtained in terms of classical diffusion equation solutions. Similar equations could also be derived within an "internal length" gradient (ILG) mechanics formulation applied to diffusion problems, i.e., by introducing nonlocal effects, together with inertia and viscosity, in a mechanics based formulation of diffusion theory. While being remarkably successful in studies related to various aspects of transport in inhomogeneous media with deterministic microstructures and nanostructures, its implications in the presence of stochasticity have not yet been considered. This issue becomes particularly important in the case of diffusion in nanopolycrystals whose deterministic ILG-based theoretical calculations predict a relaxation time that is only about one-tenth of the actual experimentally verified time scale. This article provides the "missing link" in this estimation by adding a vital element in the ILG structure, that of stochasticity, that takes into

  11. Impact of the solution ionic strength on strontium diffusion through the Callovo-Oxfordian clayrocks: An experimental and modeling study

    International Nuclear Information System (INIS)

    Savoye, S.; Beaucaire, C.; Grenut, B.; Fayette, A.

    2015-01-01

    Highlights: • HTO and 85 Sr diffusion is studied in clayrocks under increasing ionic strengths. • Sr diffusive flux is 5 times higher than HTO under standard porewater ionic strength. • Sr diffusive flux is reduced when the porewater ionic strength increases. • The Sr diffusive evolution is qualitatively reproduced by a surface diffusion model. - Abstract: Diffusion of cations in clayrocks is widely investigated, because deep clay-rich formations are currently considered as one of the potential host rocks for radioactive waste repositories. However, several authors have already reported that sorbing cations seem to diffuse at rates larger than those predicted by a simple pore diffusion model from their sorption coefficients and from the diffusive flux of non-sorbing water tracers. This process has been attributed to the migration of cations within the electrical double layer, next to the mineral surfaces, called the surface diffusion phenomenon. The aim of this work was to verify whether this “enhanced” cation diffusion compared to neutral species was observed for strontium and, if so, to what extent this effect might vary with the salinity of the synthetic solutions. These questions were addressed by performing batch sorption, through-diffusion and out-diffusion experiments on rock samples from the Callovo-Oxfordian claystone formation (France). The results showed that there was a good agreement of the distribution ratios (R D ) determined on crushed and intact rocks by batch and through-diffusion methods with a R D decrease related to the increase of the sodium concentration, a sorption competitor. Such a trend was also well reproduced by means of a geochemical modeling based on the multi-site ion exchange (MSIE) theory. Moreover, the “enhanced” diffusion for strontium was clearly observed in this study: the Sr diffusive flux was almost five times higher than that for HTO in the cell with the lowest ionic strength, and diminished to less than 1

  12. A dissolution-diffusion sliding model for soft rock grains with hydro-mechanical effect

    Directory of Open Access Journals (Sweden)

    Z. Liu

    2018-06-01

    Full Text Available The deformation and failure of soft rock affected by hydro-mechanical (HM effect are one of the most concerns in geotechnical engineering, which are basically attributed to the grain sliding of soft rock. This study tried to develop a dissolution-diffusion sliding model for the typical red bed soft rock in South China. Based on hydration film, mineral dissolution and diffusion theory, and geochemical thermodynamics, a dissolution-diffusion sliding model with the HM effect was established to account for the sliding rate. Combined with the digital image processing technology, the relationship between the grain size of soft rock and the amplitude of sliding surface was presented. An equation for the strain rate of soft rocks under steady state was also derived. The reliability of the dissolution-diffusion sliding model was verified by triaxial creep tests on the soft rock with the HM coupling effect and by the relationship between the inversion average disjoining pressure and the average thickness of the hydration film. The results showed that the sliding rate of the soft rock grains was affected significantly by the waviness of sliding surface, the shear stress, and the average thickness of hydration film. The average grain size is essential for controlling the steady-state creep rate of soft rock. This study provides a new idea for investigating the deformation and failure of soft rock with the HM effect. Keywords: Soft rock, Hydro-mechanical (HM effect, Mineral dissolution-diffusion, Grain sliding model

  13. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  14. Fractal diffusion equations: Microscopic models with anomalous diffusion and its generalizations

    International Nuclear Information System (INIS)

    Arkhincheev, V.E.

    2001-04-01

    To describe the ''anomalous'' diffusion the generalized diffusion equations of fractal order are deduced from microscopic models with anomalous diffusion as Comb model and Levy flights. It is shown that two types of equations are possible: with fractional temporal and fractional spatial derivatives. The solutions of these equations are obtained and the physical sense of these fractional equations is discussed. The relation between diffusion and conductivity is studied and the well-known Einstein relation is generalized for the anomalous diffusion case. It is shown that for Levy flight diffusion the Ohm's law is not applied and the current depends on electric field in a nonlinear way due to the anomalous character of Levy flights. The results of numerical simulations, which confirmed this conclusion, are also presented. (author)

  15. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  16. Model of diffusers / permeators for hydrogen processing

    International Nuclear Information System (INIS)

    Jacobs, W. D.; Hang, T.

    2008-01-01

    Palladium-silver (Pd-Ag) diffusers are mainstays of hydrogen processing. Diffusers separate hydrogen from inert species such as nitrogen, argon or helium. The tubing becomes permeable to hydrogen when heated to more than 250 C and a differential pressure is created across the membrane. The hydrogen diffuses better at higher temperatures. Experimental or experiential results have been the basis for determining or predicting a diffuser's performance. However, the process can be mathematically modeled, and comparison to experimental or other operating data can be utilized to improve the fit of the model. A reliable model-based diffuser system design is the goal which will have impacts on tritium and hydrogen processing. A computer model has been developed to solve the differential equations for diffusion given the operating boundary conditions. The model was compared to operating data for a low pressure diffuser system. The modeling approach and the results are presented in this paper. (authors)

  17. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  18. Modeling the diffusion of scientific publications

    NARCIS (Netherlands)

    D. Fok (Dennis); Ph.H.B.F. Franses (Philip Hans)

    2005-01-01

    textabstractThis paper illustrates that salient features of a panel of time series of annual citations can be captured by a Bass type diffusion model. We put forward an extended version of this diffusion model, where we consider the relation between key characteristics of the diffusion process and

  19. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  20. Diffraction and diffusion in room acoustics

    DEFF Research Database (Denmark)

    Rindel, Jens Holger; Rasmussen, Birgit

    1996-01-01

    Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

  1. Modeling of hydrogen desorption from tungsten surface

    Energy Technology Data Exchange (ETDEWEB)

    Guterl, J., E-mail: jguterl@ucsd.edu [University of California, San Diego, La Jolla, CA 92093 (United States); Smirnov, R.D. [University of California, San Diego, La Jolla, CA 92093 (United States); Krasheninnikov, S.I. [University of California, San Diego, La Jolla, CA 92093 (United States); Nuclear Research National University MEPhI, Moscow 115409 (Russian Federation); Uberuaga, B.; Voter, A.F.; Perez, D. [Los Alamos National Laboratory, Los Alamos, NM 8754 (United States)

    2015-08-15

    Hydrogen retention in metallic plasma-facing components is among key-issues for future fusion devices. For tungsten, which has been chosen as divertor material in ITER, hydrogen desorption parameters experimentally measured for fusion-related conditions show large discrepancies. In this paper, we therefore investigate hydrogen recombination and desorption on tungsten surfaces using molecular dynamics simulations and accelerated molecular dynamics simulations to analyze adsorption states, diffusion, hydrogen recombination into molecules, and clustering of hydrogen on tungsten surfaces. The quality of tungsten hydrogen interatomic potential is discussed in the light of MD simulations results, showing that three body interactions in current interatomic potential do not allow to reproduce hydrogen molecular recombination and desorption. Effects of surface hydrogen clustering on hydrogen desorption are analyzed by introducing a kinetic model describing the competition between surface diffusion, clustering and recombination. Different desorption regimes are identified and reproduce some aspects of desorption regimes experimentally observed.

  2. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  3. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  4. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  5. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  6. Putting atomic diffusion theory of magnetic ApBp stars to the test: evaluation of the predictions of time-dependent diffusion models

    Science.gov (United States)

    Kochukhov, O.; Ryabchikova, T. A.

    2018-02-01

    A series of recent theoretical atomic diffusion studies has address the challenging problem of predicting inhomogeneous vertical and horizontal chemical element distributions in the atmospheres of magnetic ApBp stars. Here we critically assess the most sophisticated of such diffusion models - based on a time-dependent treatment of the atomic diffusion in a magnetized stellar atmosphere - by direct comparison with observations as well by testing the widely used surface mapping tools with the spectral line profiles predicted by this theory. We show that the mean abundances of Fe and Cr are grossly underestimated by the time-dependent theoretical diffusion model, with discrepancies reaching a factor of 1000 for Cr. We also demonstrate that Doppler imaging inversion codes, based either on modelling of individual metal lines or line-averaged profiles simulated according to theoretical three-dimensional abundance distribution, are able to reconstruct correct horizontal chemical spot maps despite ignoring the vertical abundance variation. These numerical experiments justify a direct comparison of the empirical two-dimensional Doppler maps with theoretical diffusion calculations. This comparison is generally unfavourable for the current diffusion theory, as very few chemical elements are observed to form overabundance rings in the horizontal field regions as predicted by the theory and there are numerous examples of element accumulations in the vicinity of radial field zones, which cannot be explained by diffusion calculations.

  7. Predicting the weathering of fuel and oil spills: A diffusion-limited evaporation model.

    Science.gov (United States)

    Kotzakoulakis, Konstantinos; George, Simon C

    2018-01-01

    The majority of the evaporation models currently available in the literature for the prediction of oil spill weathering do not take into account diffusion-limited mass transport and the formation of a concentration gradient in the oil phase. The altered surface concentration of the spill caused by diffusion-limited transport leads to a slower evaporation rate compared to the predictions of diffusion-agnostic evaporation models. The model presented in this study incorporates a diffusive layer in the oil phase and predicts the diffusion-limited evaporation rate. The information required is the composition of the fluid from gas chromatography or alternatively the distillation data. If the density or a single viscosity measurement is available the accuracy of the predictions is higher. Environmental conditions such as water temperature, air pressure and wind velocity are taken into account. The model was tested with synthetic mixtures, petroleum fuels and crude oils with initial viscosities ranging from 2 to 13,000 cSt. The tested temperatures varied from 0 °C to 23.4 °C and wind velocities from 0.3 to 3.8 m/s. The average absolute deviation (AAD) of the diffusion-limited model ranged between 1.62% and 24.87%. In comparison, the AAD of a diffusion-agnostic model ranged between 2.34% and 136.62% against the same tested fluids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. 3-D Spherical Convection Modeling Applied to Mercury: Dislocation Versus Diffusion Rheology

    Science.gov (United States)

    Robertson, S. D.; King, S. D.

    2016-12-01

    Mercury is the smallest among the terrestrial planets and, prior to NASA's MESSENGER mission was thought to be the least tectonically and volcanically active body. Gravity and moment of inertia from MESSENGER constrain Mercury to have a thin silicate mantle shell of approximately 400 km over a massive iron core. This mantle is thinner than previously thought and the smallest end-member in comparison with the other terrestrial planets. Although Mercury currently has a stagnant lid and the present day mantle is likely not convecting, a significant proportion of Mercury's surface features could have been derived from convection in the viscous mantle. Given Mercury's small size, the amount of volcanism and tectonic activity was a surprise. We investigate the effect of dislocation creep rheology in olivine on the dynamics of Mercury. At the pressures and temperatures of Mercury's mantle, laboratory creep studies indicate that olivine deforms by dislocation creep. Previous studies using diffusion creep rheology find that the thin mantle shell of Mercury quickly becomes diffusive and, this is difficult to reconcile with the surface observations. We use the three-dimensional spherical code, CitcomS, to compare numerical models with both dislocation and diffusion creep. We compare gravity, topography, and mantle temperature as a function of time from the models with constraints on the timing of volcanic and tectonic activity on Mercury. The results show that with the dislocation creep mechanism, there is potential for convective flow in the mantle over billions of years. In contrast, models with the diffusion creep mechanism start with a convecting mantle that transitions to global diffusive cooling within 500 Myrs. Diffusion creep rheology does not adequately produce a dynamic interior that is consistent with the historical volcanic and tectonic evolution of the planet. This research is the result of participation in GLADE, a nine-week summer REU program directed by Dave

  9. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  10. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  11. Diffusion-controlled interface kinetics-inclusive system-theoretic propagation models for molecular communication systems

    Science.gov (United States)

    Chude-Okonkwo, Uche A. K.; Malekian, Reza; Maharaj, B. T.

    2015-12-01

    Inspired by biological systems, molecular communication has been proposed as a new communication paradigm that uses biochemical signals to transfer information from one nano device to another over a short distance. The biochemical nature of the information transfer process implies that for molecular communication purposes, the development of molecular channel models should take into consideration diffusion phenomenon as well as the physical/biochemical kinetic possibilities of the process. The physical and biochemical kinetics arise at the interfaces between the diffusion channel and the transmitter/receiver units. These interfaces are herein termed molecular antennas. In this paper, we present the deterministic propagation model of the molecular communication between an immobilized nanotransmitter and nanoreceiver, where the emission and reception kinetics are taken into consideration. Specifically, we derived closed-form system-theoretic models and expressions for configurations that represent different communication systems based on the type of molecular antennas used. The antennas considered are the nanopores at the transmitter and the surface receptor proteins/enzymes at the receiver. The developed models are simulated to show the influence of parameters such as the receiver radius, surface receptor protein/enzyme concentration, and various reaction rate constants. Results show that the effective receiver surface area and the rate constants are important to the system's output performance. Assuming high rate of catalysis, the analysis of the frequency behavior of the developed propagation channels in the form of transfer functions shows significant difference introduce by the inclusion of the molecular antennas into the diffusion-only model. It is also shown that for t > > 0 and with the information molecules' concentration greater than the Michaelis-Menten kinetic constant of the systems, the inclusion of surface receptors proteins and enzymes in the models

  12. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  13. Assessing Quasi-Steady State in Evaporation of Sessile Drops by Diffusion Models

    Science.gov (United States)

    Martin, Cameron; Nguyen, Hoa; Kelly-Zion, Peter; Pursell, Chris

    2017-11-01

    The vapor distributions surrounding sessile drops of methanol are modeled as the solutions of the steady-state and transient diffusion equations using Matlab's PDE Toolbox. The goal is to determine how quickly the transient diffusive transport reaches its quasi-steady state as the droplet geometry is varied between a Weber's disc, a real droplet shape, and a spherical cap with matching thickness or contact angle. We assume that the only transport mechanism at work is diffusion. Quasi-steady state is defined using several metrics, such as differences between the transient and steady-state solutions, and change in the transient solution over time. Knowing the vapor distribution, the gradient is computed to evaluate the diffusive flux. The flux is integrated along the surface of a control volume surrounding the drop to obtain the net rate of diffusion out of the volume. Based on the differences between the transient and steady-state diffusive fluxes at the discrete points along the control-volume surface, the time to reach quasi-steady state evaporation is determined and is consistent with other proposed measurements. By varying the dimensions of the control volume, we can also assess what regimes have equivalent or different quasi-steady states for different droplet geometries. Petroleum Research Fund.

  14. Diffusivity, solubility and thermodynamic modelling of diffusion growth of Ga"3"+-doped LiTaO_3 thin film for integrated optics

    International Nuclear Information System (INIS)

    Zhang, De-Long; Zhang, Qun; Zhang, Pei; Kang, Jian; Wong, Wing-Han; Yu, Dao-Yin

    2016-01-01

    Graphical abstract: Diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film was studied thermodynamically. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. The Ga"3"+ profile in the grown thin film was analyzed by secondary ion mass spectrometry. Form the measured Ga"3"+ profiles, some thermodynamic parameters were obtained. These include diffusivity, diffusion constant, chemical activation energy, solubility, solubility constant and enthalpy of solution. These parameters are crucial to design and growth of a Ga"3"+-doped LT thin film with desired Ga"3"+ profile for integrated optics application. A thermodynamic model is suggested for the growth and verified experimentally. - Highlights: • Diffusion growth of Ga"3"+-doped LiTaO_3 thin film were studied thermodynamically. • Diffusion constant is 1.41 · 10"−"6 m"2/s and activation energy is 237.2 kJ/mol. • Solubility constant is 22.9 · 10"2"6 ions/m"3 and enthalpy of solution is 28.9 kJ/mol. • Ga"3"+ dopant has small effect on LiTaO_3 refractive index. • Ga"3"+ growth can be described by a Fick-type equation with a constant diffusivity. - Abstract: A thermodynamic study was performed on diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film for integrated optics. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. After growth, the refractive indices at Ga"3"+-doped and un-doped surface parts were measured by prism coupling technique and Li composition there was evaluated from the measured refractive indices. The results show that Ga"3"+ dopant has small effect on the LT index. Li_2O out-diffusion is not measurable. The Ga"3"+ profile in the grown thin film was analysed by secondary ion mass spectrometry. It is found that the grown Ga"3"+ ions follow a complementary error function profile. A

  15. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  16. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  17. Parameter estimation in fractional diffusion models

    CERN Document Server

    Kubilius, Kęstutis; Ralchenko, Kostiantyn

    2017-01-01

    This book is devoted to parameter estimation in diffusion models involving fractional Brownian motion and related processes. For many years now, standard Brownian motion has been (and still remains) a popular model of randomness used to investigate processes in the natural sciences, financial markets, and the economy. The substantial limitation in the use of stochastic diffusion models with Brownian motion is due to the fact that the motion has independent increments, and, therefore, the random noise it generates is “white,” i.e., uncorrelated. However, many processes in the natural sciences, computer networks and financial markets have long-term or short-term dependences, i.e., the correlations of random noise in these processes are non-zero, and slowly or rapidly decrease with time. In particular, models of financial markets demonstrate various kinds of memory and usually this memory is modeled by fractional Brownian diffusion. Therefore, the book constructs diffusion models with memory and provides s...

  18. Reaction-diffusion modeling of hydrogen in beryllium

    Energy Technology Data Exchange (ETDEWEB)

    Wensing, Mirko; Matveev, Dmitry; Linsmeier, Christian [Forschungszentrum Juelich GmbH, Institut fuer Energie- und Klimaforschung - Plasmaphysik (Germany)

    2016-07-01

    Beryllium will be used as first-wall material for the future fusion reactor ITER as well as in the breeding blanket of DEMO. In both cases it is important to understand the mechanisms of hydrogen retention in beryllium. In earlier experiments with beryllium low-energy binding states of hydrogen were observed by thermal desorption spectroscopy (TDS) which are not yet well understood. Two candidates for these states are considered: beryllium-hydride phases within the bulk and surface effects. The retention of deuterium in beryllium is studied by a reaction rate approach using a coupled reaction diffusion system (CRDS)-model relying on ab initio data from density functional theory calculations (DFT). In this contribution we try to assess the influence of surface recombination.

  19. Modelling Ni diffusion in bentonite using different sorption models

    International Nuclear Information System (INIS)

    Pfingsten, W.; Baeyens, B.; Bradbury, M.

    2010-01-01

    (II) retardation on the Fe(II) concentration level in the bentonite pore water and the related Fe(II) sorption on exchange and surface complexation sites. The Ni(II) retardation is lower for higher Fe(II) concentrations. Generally, assuming that the Fe(II) background concentration in the bentonite is determined by saturation with siderite, Fe(II) competition reduces the Ni retardation by an order of magnitude compared to the case without competition. Since the Fe(II) concentration in the near-field of a high-level radioactive waste repository may change with time due to canister corrosion processes and mineral precipitation/dissolution reactions, the diffusion of Ni(II), and more generally also metals which are chemically similar (valence state, hydrolysis behaviour) e.g. Co, Zn, Mn.. should be modelled using mechanistic sorption models taking into account competitive sorption processes, i.e. using a more detailed reactive transport approach to describe radionuclide transport within the bentonite correctly. (authors)

  20. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  1. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  2. Modeling dendrite density from magnetic resonance diffusion measurements

    DEFF Research Database (Denmark)

    Jespersen, Sune Nørhøj; Kroenke, CD; Østergaard, Leif

    2007-01-01

    in this model: (i) the dendrites and axons, which are modeled as long cylinders with two diffusion coefficients, parallel (DL) and perpendicular (DT) to the cylindrical axis, and (ii) an isotropic monoexponential diffusion component describing water diffusion within and across all other structures, i.......e., in extracellular space and glia cells. The model parameters are estimated from 153 diffusion-weighted images acquired from a formalin-fixed baboon brain. A close correspondence between the data and the signal model is found, with the model parameters consistent with literature values. The model provides......Diffusion-weighted imaging (DWI) provides a noninvasive tool to probe tissue microstructure. We propose a simplified model of neural cytoarchitecture intended to capture the essential features important for water diffusion as measured by NMR. Two components contribute to the NMR signal...

  3. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  4. Analysis of effective diffusivity of cement based materials by multi-scale modelling

    International Nuclear Information System (INIS)

    Dridi, Wissem

    2013-01-01

    This paper presents a simplified composite model, which considers the contribution of each phase participating to the transport within OPC pastes and concretes. At the micrometer scale, the phases considered hereafter are capillary porosity (macro-porosity) and the Low Density and the High Density C-S-H both containing gel pores (nano-porosity). Predicted values of tritiated water (HTO) diffusivity in OPC pastes with various (w/c) ratios are confronted to experimental results with a good agreement. The approach is then extended to mortars and concretes scale where microstructure is described by a three phase composite sphere assemblage. Here, elementary phase distribution is assumed to change as a function of distance from aggregate surface. Model results about HTO diffusivities of mortars and concretes are presented with some experimental values. The competition between the more diffusing ITZ zone and the less diffusing bulk matrix is investigated from a sensitive analysis. The dominance of the ITZ control is confirmed. (authors)

  5. Measurements of cesium and strontium diffusion in biotite gneiss

    International Nuclear Information System (INIS)

    Skagius, K.; Neretnieks, I.

    1988-01-01

    A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel

  6. Diffusion measurements of cesium and strontium in biotite gneiss

    International Nuclear Information System (INIS)

    Skagius, K.; Neretnieks, I.

    1985-01-01

    A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)

  7. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  8. The impact of changes in parameterizations of surface drag and vertical diffusion on the large-scale circulation in the Community Atmosphere Model (CAM5)

    Science.gov (United States)

    Lindvall, Jenny; Svensson, Gunilla; Caballero, Rodrigo

    2017-06-01

    Simulations with the Community Atmosphere Model version 5 (CAM5) are used to analyze the sensitivity of the large-scale circulation to changes in parameterizations of orographic surface drag and vertical diffusion. Many GCMs and NWP models use enhanced turbulent mixing in stable conditions to improve simulations, while CAM5 cuts off all turbulence at high stabilities and instead employs a strong orographic surface stress parameterization, known as turbulent mountain stress (TMS). TMS completely dominates the surface stress over land and reduces the near-surface wind speeds compared to simulations without TMS. It is found that TMS is generally beneficial for the large-scale circulation as it improves zonal wind speeds, Arctic sea level pressure and zonal anomalies of the 500-hPa stream function, compared to ERA-Interim. It also alleviates atmospheric blocking frequency biases in the Northern Hemisphere. Using a scheme that instead allows for a modest increase of turbulent diffusion at higher stabilities only in the planetary boundary layer (PBL) appears to in some aspects have a similar, although much smaller, beneficial effect as TMS. Enhanced mixing throughout the atmospheric column, however, degrades the CAM5 simulation. Evaluating the simulations in comparison with detailed measurements at two locations reveals that TMS is detrimental for the PBL at the flat grassland ARM Southern Great Plains site, giving too strong wind turning and too deep PBLs. At the Sodankylä forest site, the effect of TMS is smaller due to the larger local vegetation roughness. At both sites, all simulations substantially overestimate the boundary layer ageostrophic flow.

  9. A tracer diffusion model derived from microstructure

    International Nuclear Information System (INIS)

    Lehikoinen, Jarmo; Muurinen, Arto; Olin, Markus

    2012-01-01

    Document available in extended abstract form only. Full text of publication follows: Numerous attempts have been made to explain the tracer diffusion of various solutes in compacted clays. These attempts have commonly suffered from an inability to describe the diffusion of uncharged and charged solutes with a single unified model. Here, an internally consistent approach to describing the diffusion of solutes in a heterogeneous porous medium, such as compacted bentonite, in terms of its microstructure is presented. The microstructure is taken to be represented by a succession of unit cells, which consist of two consecutive regions (Do, 1996). In the first region, the diffusion is viewed to occur in two parallel paths: one through microcrystalline units (micropores) and the other through meso-pores between the microcrystalline units. Solutes exiting these two paths are then joined together to continue diffusing through the second, disordered, region, connecting the two adjacent microcrystalline units. Adsorption (incl. co-ion exclusion) is thought to occur in the micropores, whereas meso-pores and the disordered region accommodate free species alone. Co-ions are also assumed to experience transfer resistance into and out of the micropores, which is characterized in the model by a transmission coefficient. Although the model is not new per se, its application to compacted clays has never been attempted before. It is shown that in the limit of strong adsorption, the effective diffusivity is limited from above only by the microstructural parameters of the model porous medium. As intuitive and logical as this result may appear, it has not been proven before. In the limit of vanishing disordered region, the effective diffusivity is no longer explicitly constrained by any of the model parameters. The tortuosity of the diffusion path, i.e. the quotient of the actual diffusion path length in the porous-medium coordinates and the characteristic length of the laboratory frame

  10. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  11. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  13. Modeling the reemergence of information diffusion in social network

    Science.gov (United States)

    Yang, Dingda; Liao, Xiangwen; Shen, Huawei; Cheng, Xueqi; Chen, Guolong

    2018-01-01

    Information diffusion in networks is an important research topic in various fields. Existing studies either focus on modeling the process of information diffusion, e.g., independent cascade model and linear threshold model, or investigate information diffusion in networks with certain structural characteristics such as scale-free networks and small world networks. However, there are still several phenomena that have not been captured by existing information diffusion models. One of the prominent phenomena is the reemergence of information diffusion, i.e., a piece of information reemerges after the completion of its initial diffusion process. In this paper, we propose an optimized information diffusion model by introducing a new informed state into traditional susceptible-infected-removed model. We verify the proposed model via simulations in real-world social networks, and the results indicate that the model can reproduce the reemergence of information during the diffusion process.

  14. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  15. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  16. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  17. Diffusion coefficient adaptive correction in Lagrangian puff model

    International Nuclear Information System (INIS)

    Tan Wenji; Wang Dezhong; Ma Yuanwei; Ji Zhilong

    2014-01-01

    Lagrangian puff model is widely used in the decision support system for nuclear emergency management. The diffusion coefficient is one of the key parameters impacting puff model. An adaptive method was proposed in this paper, which could correct the diffusion coefficient in Lagrangian puff model, and it aimed to improve the accuracy of calculating the nuclide concentration distribution. This method used detected concentration data, meteorological data and source release data to estimate the actual diffusion coefficient with least square method. The diffusion coefficient adaptive correction method was evaluated by Kincaid data in MVK, and was compared with traditional Pasquill-Gifford (P-G) diffusion scheme method. The results indicate that this diffusion coefficient adaptive correction method can improve the accuracy of Lagrangian puff model. (authors)

  18. Sooting Characteristics and Modeling in Counterflow Diffusion Flames

    KAUST Repository

    Wang, Yu

    2013-11-01

    Soot formation is one of the most complex phenomena in combustion science and an understanding of the underlying physico-chemical mechanisms is important. This work adopted both experimental and numerical approaches to study soot formation in laminar counterfl ow diffusion flames. As polycyclic aromatic hydrocarbons (PAHs) are the precursors of soot particles, a detailed gas-phase chemical mechanism describing PAH growth upto coronene for fuels with 1 to 4 carbon atoms was validated against laminar premixed and counter- flow diffusion fl ames. Built upon this gas-phase mechanism, a soot model was then developed to describe soot inception and surface growth. This soot model was sub- sequently used to study fuel mixing effect on soot formation in counterfl ow diffusion flames. Simulation results showed that compared to the baseline case of the ethylene flame, the doping of 5% (by volume) propane or ethane in ethylene tends to increase the soot volume fraction and number density while keeping the average soot size almost unchanged. These results are in agreement with experimental observations. Laser light extinction/scattering as well as laser induced fluorescence techniques were used to study the effect of strain rate on soot and PAH formation in counterfl ow diffusion ames. The results showed that as strain rate increased both soot volume fraction and PAH concentrations decreased. The concentrations of larger PAH were more sensitive to strain rate compared to smaller ones. The effect of CO2 addition on soot formation was also studied using similar experimental techniques. Soot loading was reduced with CO2 dilution. Subsequent numerical modeling studies were able to reproduce the experimental trend. In addition, the chemical effect of CO2 addition was analyzed using numerical data. Critical conditions for the onset of soot were systematically studied in counterfl ow diffusion ames for various gaseous hydrocarbon fuels and at different strain rates. A sooting

  19. Advanced diffusion model in compacted bentonite based on modified Poisson-Boltzmann equations

    International Nuclear Information System (INIS)

    Yotsuji, K.; Tachi, Y.; Nishimaki, Y.

    2012-01-01

    Document available in extended abstract form only. Diffusion and sorption of radionuclides in compacted bentonite are the key processes in the safe geological disposal of radioactive waste. JAEA has developed the integrated sorption and diffusion (ISD) model for compacted bentonite by coupling the pore water chemistry, sorption and diffusion processes in consistent way. The diffusion model accounts consistently for cation excess and anion exclusion in narrow pores in compacted bentonite by the electric double layer (EDL) theory. The firstly developed ISD model could predict the diffusivity of the monovalent cation/anion in compacted bentonite as a function of dry density. This ISD model was modified by considering the visco-electric effect, and applied for diffusion data for various radionuclides measured under wide range of conditions (salinity, density, etc.). This modified ISD model can give better quantitative agreement with diffusion data for monovalent cation/anion, however, the model predictions still disagree with experimental data for multivalent cation and complex species. In this study we extract the additional key factors influencing diffusion model in narrow charged pores, and the effects of these factors were investigated to reach a better understanding of diffusion processes in compacted bentonite. We investigated here the dielectric saturation effect and the excluded volume effect into the present ISD model and numerically solved these modified Poisson-Boltzmann equations. In the vicinity of the negatively charged clay surfaces, it is necessary to evaluate concentration distribution of electrolytes considering the dielectric saturation effects. The Poisson-Boltzmann (P-B) equation coupled with the dielectric saturation effects was solved numerically by using Runge-Kutta and Shooting methods. Figure 1(a) shows the concentration distributions of Na + as numerical solutions of the modified and original P-B equations for 0.01 M pore water, 800 kg m -3

  20. A spatial structural derivative model for ultraslow diffusion

    Directory of Open Access Journals (Sweden)

    Xu Wei

    2017-01-01

    Full Text Available This study investigates the ultraslow diffusion by a spatial structural derivative, in which the exponential function ex is selected as the structural function to construct the local structural derivative diffusion equation model. The analytical solution of the diffusion equation is a form of Biexponential distribution. Its corresponding mean squared displacement is numerically calculated, and increases more slowly than the logarithmic function of time. The local structural derivative diffusion equation with the structural function ex in space is an alternative physical and mathematical modeling model to characterize a kind of ultraslow diffusion.

  1. A diffusive model for halo width growth during vertical displacement events

    International Nuclear Information System (INIS)

    Eidietis, N.W.; Humphreys, D.A.

    2011-01-01

    The electromagnetic loads produced by halo currents during vertical displacement events (VDEs) impose stringent requirements on the strength of ITER in-vessel components. A predictive understanding of halo current evolution is essential for ensuring the robust design of these components. A significant factor determining that evolution is the plasma resistance, which is a function of three quantities: the resistivities of the core and halo regions, and the halo region width. A diffusive model of halo width growth during VDEs has been developed, which provides one part of a physics basis for predictive halo current simulations. The diffusive model was motivated by DIII-D observations that VDEs with cold post-thermal quench plasma and a current decay time much faster than the vertical motion (type I VDE) possess much wider halo region widths than warmer plasma VDEs, where the current decay is much slower than the vertical motion (type II). A 2D finite element code is used to model the diffusion of toroidal halo current during selected type I and type II DIII-D VDEs. The model assumes a core plasma region within the last closed flux surface (LCFS) diffusing current into a halo plasma filling the vessel outside the LCFS. LCFS motion and plasma temperature are prescribed from experimental observations. The halo width evolution produced by this model compares favourably with experimental measurements of type I and type II toroidal halo current width evolution.

  2. Modelling water fluxes for the analysis of diffuse pollution at the river basin scale

    NARCIS (Netherlands)

    Wit, de M.; Meinardi, C.R.; Wendland, F.; Kunkel, R.

    2000-01-01

    Diffuse pollution is a significant and sometimes even major component of surface water pollution. Diffuse inputs of pollutants to the surface water are related to runoff of precipitation. This means that the analysis of diffuse pollutant fluxes from the land surface to the surface water requires an

  3. The Analytical Diffusion-Expansion Model for Forbush Decreases Caused by Flux Ropes

    Science.gov (United States)

    Dumbovic, M.; Temmer, M.

    2017-12-01

    Identification and tracking of interplanetary coronal mass ejections (ICMEs) throughout the heliosphere is a growingly important aspect of space weather research. One of the "signatures" of ICME passage is the corresponding Forbush decrease (FD), a short term decrease in the galactic cosmic ray flux. These depressions are observed at the surface of the Earth for over 50 years, by several spacecraft in interplanetary space in the past couple of decades, and recently also on Mars' surface with Curiosity rover. In order to use FDs as ICME signatures efficiently, it is important to model ICME interaction with energetic particles by taking into account ICME evolution and constraining the model with observational data. We present an analytical diffusion-expansion FD model ForbMod which is based on the widely used approach of the initially empty, closed magnetic structure (i.e. flux rope) which fills up slowly with particles by perpendicular diffusion. The model is restricted to explain only the depression caused by the magnetic structure of the ICME and not of the associated shock. We use remote CME observations and a 3D reconstruction method (the Graduated Cylindrical Shell method) to constrain initial and boundary conditions of the FD model and take into account CME evolutionary properties by incorporating flux rope expansion. Several options of flux rope expansion are regarded as the competing mechanism to diffusion which can lead to different FD characteristics. This project has received funding from the European Union's Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie grant agreement No 745782.

  4. Modeling of immision from power plants using stream-diffusion model

    International Nuclear Information System (INIS)

    Kanevce, Lj.; Kanevce, G.; Markoski, A.

    1996-01-01

    Analyses of simple empirical and integral immision models, comparing with complex three dimensional differential models is given. Complex differential models needs huge computer power, so they can't be useful for practical engineering calculations. In this paper immision modeling, using stream-diffusion approach is presented. Process of dispersion is divided into two parts. First part is called stream part, it's near the source of the pollutants, and it's presented with defected turbulent jet in wind field. This part finished when the velocity of stream (jet) becomes equal with wind speed. Boundary conditions in the end of the first part, are initial for the second, called diffusion part, which is modeling with tri dimensional diffusion equation. Gradient of temperature, wind speed profile and coefficient of diffusion in this model must not be constants, they can change with the height. Presented model is much simpler than the complete meteorological differential models which calculates whole fields of meteorological parameters. Also, it is more complex and gives more valuable results for dispersion of pollutants from widely used integral and empirical models

  5. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  6. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  7. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  8. Development of neutron diffuse scattering analysis code by thin film and multilayer film

    International Nuclear Information System (INIS)

    Soyama, Kazuhiko

    2004-01-01

    To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering by thin film, roughness of surface of thin film, correlation function, neutron propagation by thin film, diffuse scattering by DWBA theory, measurement model, SDIFFF (neutron diffuse scattering analysis program by thin film) and simulation results are explained. On neutron diffuse scattering by multilayer film, roughness of multilayer film, principle of diffuse scattering, measurement method and simulation examples by MDIFF (neutron diffuse scattering analysis program by multilayer film) are explained. (S.Y.)To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering

  9. A grain-boundary diffusion model of dynamic grain growth during superplastic deformation

    International Nuclear Information System (INIS)

    Kim, Byung-Nam; Hiraga, Keijiro; Sakka, Yoshio; Ahn, Byung-Wook

    1999-01-01

    Dynamic grain growth during superplastic deformation is modelled on the basis of a grain-boundary diffusion mechanism. On the grain boundary where a static and a dynamic potential difference coexist, matter transport along the boundary is assumed to contribute to dynamic grain growth through depositing the matter on the grain surface located opposite to the direction of grain-boundary migration. The amount of the diffusive matter during deformation is calculated for an aggregate of spherical grains and is converted to the increment of mean boundary migration velocity. The obtained relationship between the strain rate and the dynamic grain growth rate is shown to be independent of deformation mechanisms, provided that the grain growth is controlled by grain-boundary diffusion. The strain dependence, strain-rate dependence and temperature dependence of grain growth predicted from this model are consistent with those observed in superplastic ZrO 2 -dispersed Al 2 O 3

  10. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  11. Standard test method for accelerated leach test for diffusive releases from solidified waste and a computer program to model diffusive, fractional leaching from cylindrical waste forms

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This test method provides procedures for measuring the leach rates of elements from a solidified matrix material, determining if the releases are controlled by mass diffusion, computing values of diffusion constants based on models, and verifying projected long-term diffusive releases. This test method is applicable to any material that does not degrade or deform during the test. 1.1.1 If mass diffusion is the dominant step in the leaching mechanism, then the results of this test can be used to calculate diffusion coefficients using mathematical diffusion models. A computer program developed for that purpose is available as a companion to this test method (Note 1). 1.1.2 It should be verified that leaching is controlled by diffusion by a means other than analysis of the leach test solution data. Analysis of concentration profiles of species of interest near the surface of the solid waste form after the test is recommended for this purpose. 1.1.3 Potential effects of partitioning on the test results can...

  12. CROSS DIFFUSION AND NONLINEAR DIFFUSION PREVENTING BLOW UP IN THE KELLER–SEGEL MODEL

    KAUST Repository

    CARRILLO, JOSÉ ANTONIO; HITTMEIR, SABINE; JÜ NGEL, ANSGAR

    2012-01-01

    A parabolic-parabolic (Patlak-)Keller-Segel model in up to three space dimensions with nonlinear cell diffusion and an additional nonlinear cross-diffusion term is analyzed. The main feature of this model is that there exists a new entropy

  13. Urban diffusion problems

    International Nuclear Information System (INIS)

    Hanna, S.R.

    1976-01-01

    It is hoped that urban diffusion models of air pollutants can eventually confidently be used to make major decisions, such as in planning the layout of a new industrial park, determining the effects of a new highway on air quality, or estimating the results of a new automobile emissions exhaust system. The urban diffusion model itself should be able to account for point, line, and area sources, and the local aerodynamic effects of street canyons and building wakes. Removal or transformations due to dry or wet deposition and chemical reactions are often important. It would be best if the model included meteorological parameters such as wind speed and temperature as dependent variables, since these parameters vary significantly when air passes from rural surfaces over urban surfaces

  14. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  15. The influence of the solar radiation model on the calcutated solar radiation from a horizontal surface to a tilted surface

    DEFF Research Database (Denmark)

    Andersen, Elsa; Lund, Hans; Furbo, Simon

    2004-01-01

    Measured solar radiation data are most commonly available as total solar radiation on a horizontal surface. When using solar radiation measured on horizontal to calculate the solar radiation on tilted surfaces and thereby the thermal performance of different applications such as buildings and solar...... heating systems, different solar radiation models can be used. The calculation of beam radiation from a horizontal surface to a tilted surface can be done exactly whereas different solar radiation models can calculate the sky diffuse radiation. The sky diffuse radiation can either be assumed evenly...... in the calculation. The weather data are measured at the solar radiation measurement station, SMS at the Department of Civil Engineering at the Technical University of Denmark. In this study the weather data are combined with solar collector calculations based on solar collector test carried out at Solar Energy...

  16. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  17. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  18. Surface wind mixing in the Regional Ocean Modeling System (ROMS)

    Science.gov (United States)

    Robertson, Robin; Hartlipp, Paul

    2017-12-01

    Mixing at the ocean surface is key for atmosphere-ocean interactions and the distribution of heat, energy, and gases in the upper ocean. Winds are the primary force for surface mixing. To properly simulate upper ocean dynamics and the flux of these quantities within the upper ocean, models must reproduce mixing in the upper ocean. To evaluate the performance of the Regional Ocean Modeling System (ROMS) in replicating the surface mixing, the results of four different vertical mixing parameterizations were compared against observations, using the surface mixed layer depth, the temperature fields, and observed diffusivities for comparisons. The vertical mixing parameterizations investigated were Mellor- Yamada 2.5 level turbulent closure (MY), Large- McWilliams- Doney Kpp (LMD), Nakanishi- Niino (NN), and the generic length scale (GLS) schemes. This was done for one temperate site in deep water in the Eastern Pacific and three shallow water sites in the Baltic Sea. The model reproduced the surface mixed layer depth reasonably well for all sites; however, the temperature fields were reproduced well for the deep site, but not for the shallow Baltic Sea sites. In the Baltic Sea, the models overmixed the water column after a few days. Vertical temperature diffusivities were higher than those observed and did not show the temporal fluctuations present in the observations. The best performance was by NN and MY; however, MY became unstable in two of the shallow simulations with high winds. The performance of GLS nearly as good as NN and MY. LMD had the poorest performance as it generated temperature diffusivities that were too high and induced too much mixing. Further observational comparisons are needed to evaluate the effects of different stratification and wind conditions and the limitations on the vertical mixing parameterizations.

  19. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  20. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  1. Macroscopic diffusion models for precipitation in crystalline gallium arsenide

    Energy Technology Data Exchange (ETDEWEB)

    Kimmerle, Sven-Joachim Wolfgang

    2009-09-21

    Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose two different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first model treats the diffusion-controlled regime of interface motion, while the second model is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. These models generalise the well-known Mullins- Sekerka model for Ostwald ripening. We concentrate on arsenic-rich liquid spherical droplets in a gallium arsenide crystal. Droplets can shrink or grow with time but the centres of droplets remain fixed. The liquid is assumed to be homogeneous in space. Due to different scales for typical distances between droplets and typical radii of liquid droplets we can derive formally so-called mean field models. For a model in the diffusion-controlled regime we prove this limit by homogenisation techniques under plausible assumptions. These mean field models generalise the Lifshitz-Slyozov-Wagner model, which can be derived from the Mullins-Sekerka model rigorously, and is well understood. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. We determine possible equilibria and discuss their stability. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

  2. Stochastic Modelling of the Diffusion Coefficient for Concrete

    DEFF Research Database (Denmark)

    Thoft-Christensen, Palle

    In the paper, a new stochastic modelling of the diffusion coefficient D is presented. The modelling is based on physical understanding of the diffusion process and on some recent experimental results. The diffusion coefficients D is strongly dependent on the w/c ratio and the temperature....

  3. Ion diffusion in compacted bentonite

    Energy Technology Data Exchange (ETDEWEB)

    Lehikoinen, J. [VTT Chemical Technology, Espoo (Finland)

    1999-03-01

    In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K{sub d}, unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.) 45 refs.

  4. Ion diffusion in compacted bentonite

    International Nuclear Information System (INIS)

    Lehikoinen, J.

    1999-03-01

    In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K d , unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.)

  5. A diffusivity model for predicting VOC diffusion in porous building materials based on fractal theory

    International Nuclear Information System (INIS)

    Liu, Yanfeng; Zhou, Xiaojun; Wang, Dengjia; Song, Cong; Liu, Jiaping

    2015-01-01

    Highlights: • Fractal theory is introduced into the prediction of VOC diffusion coefficient. • MSFC model of the diffusion coefficient is developed for porous building materials. • The MSFC model contains detailed pore structure parameters. • The accuracy of the MSFC model is verified by independent experiments. - Abstract: Most building materials are porous media, and the internal diffusion coefficients of such materials have an important influences on the emission characteristics of volatile organic compounds (VOCs). The pore structure of porous building materials has a significant impact on the diffusion coefficient. However, the complex structural characteristics bring great difficulties to the model development. The existing prediction models of the diffusion coefficient are flawed and need to be improved. Using scanning electron microscope (SEM) observations and mercury intrusion porosimetry (MIP) tests of typical porous building materials, this study developed a new diffusivity model: the multistage series-connection fractal capillary-bundle (MSFC) model. The model considers the variable-diameter capillaries formed by macropores connected in series as the main mass transfer paths, and the diameter distribution of the capillary bundles obeys a fractal power law in the cross section. In addition, the tortuosity of the macrocapillary segments with different diameters is obtained by the fractal theory. Mesopores serve as the connections between the macrocapillary segments rather than as the main mass transfer paths. The theoretical results obtained using the MSFC model yielded a highly accurate prediction of the diffusion coefficients and were in a good agreement with the VOC concentration measurements in the environmental test chamber.

  6. CROSS DIFFUSION AND NONLINEAR DIFFUSION PREVENTING BLOW UP IN THE KELLER–SEGEL MODEL

    KAUST Repository

    CARRILLO, JOSÉ ANTONIO

    2012-12-01

    A parabolic-parabolic (Patlak-)Keller-Segel model in up to three space dimensions with nonlinear cell diffusion and an additional nonlinear cross-diffusion term is analyzed. The main feature of this model is that there exists a new entropy functional, yielding gradient estimates for the cell density and chemical concentration. For arbitrarily small cross-diffusion coefficients and for suitable exponents of the nonlinear diffusion terms, the global-in-time existence of weak solutions is proved, thus preventing finite-time blow up of the cell density. The global existence result also holds for linear and fast diffusion of the cell density in a certain parameter range in three dimensions. Furthermore, we show L∞ bounds for the solutions to the parabolic-elliptic system. Sufficient conditions leading to the asymptotic stability of the constant steady state are given for a particular choice of the nonlinear diffusion exponents. Numerical experiments in two and three space dimensions illustrate the theoretical results. © 2012 World Scientific Publishing Company.

  7. Fractional diffusion models of nonlocal transport

    International Nuclear Information System (INIS)

    Castillo-Negrete, D. del

    2006-01-01

    A class of nonlocal models based on the use of fractional derivatives (FDs) is proposed to describe nondiffusive transport in magnetically confined plasmas. FDs are integro-differential operators that incorporate in a unified framework asymmetric non-Fickian transport, non-Markovian ('memory') effects, and nondiffusive scaling. To overcome the limitations of fractional models in unbounded domains, we use regularized FDs that allow the incorporation of finite-size domain effects, boundary conditions, and variable diffusivities. We present an α-weighted explicit/implicit numerical integration scheme based on the Grunwald-Letnikov representation of the regularized fractional diffusion operator in flux conserving form. In sharp contrast with the standard diffusive model, the strong nonlocality of fractional diffusion leads to a linear in time response for a decaying pulse at short times. In addition, an anomalous fractional pinch is observed, accompanied by the development of an uphill transport region where the 'effective' diffusivity becomes negative. The fractional flux is in general asymmetric and, for steady states, it has a negative (toward the core) component that enhances confinement and a positive component that increases toward the edge and leads to poor confinement. The model exhibits the characteristic anomalous scaling of the confinement time, τ, with the system's size, L, τ∼L α , of low-confinement mode plasma where 1<α<2 is the order of the FD operator. Numerical solutions of the model with an off-axis source show that the fractional inward transport gives rise to profile peaking reminiscent of what is observed in tokamak discharges with auxiliary off-axis heating. Also, cold-pulse perturbations to steady sates in the model exhibit fast, nondiffusive propagation phenomena that resemble perturbative experiments

  8. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  9. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  10. Fractional diffusion equations and anomalous diffusion

    CERN Document Server

    Evangelista, Luiz Roberto

    2018-01-01

    Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

  11. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  12. Bag model with diffuse surface

    International Nuclear Information System (INIS)

    Phatak, S.C.

    1986-01-01

    The constraint of a sharp bag boundary in the bag model is relaxed in the present work. This has been achieved by replacing the square-well potential of the bag model by a smooth scalar potential and introducing a term similar to the bag pressure term. The constraint of the conservation of the energy-momentum tensor is used to obtain an expression for the added bag pressure term. The model is then used to determine the static properties of the nucleon. The calculation shows that the rms charge radius and the nucleon magnetic moment are larger than the corresponding bag model values. Also, the axial vector coupling constant and the πNN coupling constant are in better agreement with the experimental values

  13. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  14. Consistency in the description of diffusion in compacted bentonite

    International Nuclear Information System (INIS)

    Lehikoinen, J.; Muurinen, A.

    2009-01-01

    A macro-level diffusion model, which aims to provide a unifying framework for explaining the experimentally observed co-ion exclusion and greatly controversial counter-ion surface diffusion in a consistent fashion, is presented. It is explained in detail why a term accounting for the non-zero mobility of the counter-ion surface excess is required in the mathematical form of the macroscopic diffusion flux. The prerequisites for the consistency of the model and the problems associated with the interpretation of diffusion in such complex pore geometries as in compacted smectite clays are discussed. (author)

  15. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  16. Fractional diffusion models of transport in magnetically confined plasmas

    International Nuclear Information System (INIS)

    Castillo-Negrete, D. del; Carreras, B. A.; Lynch, V. E.

    2005-01-01

    Experimental and theoretical evidence suggests that transport in magnetically confined fusion plasmas deviates from the standard diffusion paradigm. Some examples include the confinement time scaling in L-mode plasmas, rapid pulse propagation phenomena, and inward transport in off-axis fueling experiments. The limitations of the diffusion paradigm can be traced back to the restrictive assumptions in which it is based. In particular, Fick's law, one of the cornerstones of diffusive transport, assumes that the fluxes only depend on local quantities, i. e. the spatial gradient of the field (s). another key issue is the Markovian assumption that neglects memory effects. Also, at a microscopic level, standard diffusion assumes and underlying Gaussian, uncorrelated stochastic process (i. e. a Brownian random walk) with well defined characteristic spatio-temporal scales. Motivated by the need to develop models of non-diffusive transport, we discuss here a class of transport models base on the use of fractional derivative operators. The models incorporates in a unified way non-Fickian transport, non-Markovian processes or memory effects, and non-diffusive scaling. At a microscopic level, the models describe an underlying stochastic process without characteristic spatio-temporal scales that generalizes the Brownian random walk. As a concrete case study to motivate and test the model, we consider transport of tracers in three-dimensional, pressure-gradient-driven turbulence. We show that in this system transport is non-diffusive and cannot be described in the context of the standard diffusion parading. In particular, the probability density function (pdf) of the radial displacements of tracers is strongly non-Gaussian with algebraic decaying tails, and the moments of the tracer displacements exhibit super-diffusive scaling. there is quantitative agreement between the turbulence transport calculations and the proposed fractional diffusion model. In particular, the model

  17. Lévy flight with absorption: A model for diffusing diffusivity with long tails

    Science.gov (United States)

    Jain, Rohit; Sebastian, K. L.

    2017-03-01

    We consider diffusion of a particle in rearranging environment, so that the diffusivity of the particle is a stochastic function of time. In our previous model of "diffusing diffusivity" [Jain and Sebastian, J. Phys. Chem. B 120, 3988 (2016), 10.1021/acs.jpcb.6b01527], it was shown that the mean square displacement of particle remains Fickian, i.e., ∝T at all times, but the probability distribution of particle displacement is not Gaussian at all times. It is exponential at short times and crosses over to become Gaussian only in a large time limit in the case where the distribution of D in that model has a steady state limit which is exponential, i.e., πe(D ) ˜e-D /D0 . In the present study, we model the diffusivity of a particle as a Lévy flight process so that D has a power-law tailed distribution, viz., πe(D ) ˜D-1 -α with 0 <α <1 . We find that in the short time limit, the width of displacement distribution is proportional to √{T }, implying that the diffusion is Fickian. But for long times, the width is proportional to T1 /2 α which is a characteristic of anomalous diffusion. The distribution function for the displacement of the particle is found to be a symmetric stable distribution with a stability index 2 α which preserves its shape at all times.

  18. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  19. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  20. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  1. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  2. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  3. A variable-order fractal derivative model for anomalous diffusion

    Directory of Open Access Journals (Sweden)

    Liu Xiaoting

    2017-01-01

    Full Text Available This paper pays attention to develop a variable-order fractal derivative model for anomalous diffusion. Previous investigations have indicated that the medium structure, fractal dimension or porosity may change with time or space during solute transport processes, results in time or spatial dependent anomalous diffusion phenomena. Hereby, this study makes an attempt to introduce a variable-order fractal derivative diffusion model, in which the index of fractal derivative depends on temporal moment or spatial position, to characterize the above mentioned anomalous diffusion (or transport processes. Compared with other models, the main advantages in description and the physical explanation of new model are explored by numerical simulation. Further discussions on the dissimilitude such as computational efficiency, diffusion behavior and heavy tail phenomena of the new model and variable-order fractional derivative model are also offered.

  4. Supercritical fluid extraction of soybean oil from the surface of spiked quartz sand - modelling study

    OpenAIRE

    Stela Jokić; B. Nagy; K. Aladić; B. Simándi

    2013-01-01

    The extraction of soybean oil from the surface of spiked quartz sand using supercritical CO2 was investigated. Sand as solid was used; it is not porous material so the internal diffusion does not exist, all the soluble material is in the surface of the particles. Sovová’s model has been used in order to obtain an analytical solution to develop the required extraction yield curves. The model simplifies when the internal diffusion can be neglected. The external mass transfer coefficient was det...

  5. Incorporating photon recycling into the analytical drift-diffusion model of high efficiency solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Lumb, Matthew P. [The George Washington University, 2121 I Street NW, Washington, DC 20037 (United States); Naval Research Laboratory, Washington, DC 20375 (United States); Steiner, Myles A.; Geisz, John F. [National Renewable Energy Laboratory, Golden, Colorado 80401 (United States); Walters, Robert J. [Naval Research Laboratory, Washington, DC 20375 (United States)

    2014-11-21

    The analytical drift-diffusion formalism is able to accurately simulate a wide range of solar cell architectures and was recently extended to include those with back surface reflectors. However, as solar cells approach the limits of material quality, photon recycling effects become increasingly important in predicting the behavior of these cells. In particular, the minority carrier diffusion length is significantly affected by the photon recycling, with consequences for the solar cell performance. In this paper, we outline an approach to account for photon recycling in the analytical Hovel model and compare analytical model predictions to GaAs-based experimental devices operating close to the fundamental efficiency limit.

  6. Nonlinear Porous Diffusion Modeling of Hydrophilic Ionic Agrochemicals in Astomatous Plant Cuticle Aqueous Pores: A Mechanistic Approach.

    Science.gov (United States)

    Tredenick, Eloise C; Farrell, Troy W; Forster, W Alison; Psaltis, Steven T P

    2017-01-01

    The agricultural industry requires improved efficacy of sprays being applied to crops and weeds in order to reduce their environmental impact and deliver improved financial returns. Enhanced foliar uptake is one means of improving efficacy. The plant leaf cuticle is known to be the main barrier to diffusion of agrochemicals within the leaf. The usefulness of a mathematical model to simulate uptake of agrochemicals in plant cuticles has been noted previously in the literature, as the results of each uptake experiment are specific to each formulation of active ingredient, plant species and environmental conditions. In this work we develop a mathematical model and numerical simulation for the uptake of hydrophilic ionic agrochemicals through aqueous pores in plant cuticles. We propose a novel, nonlinear, porous diffusion model for ionic agrochemicals in isolated cuticles, which extends simple diffusion through the incorporation of parameters capable of simulating: plant species variations, evaporation of surface droplet solutions, ion binding effects on the cuticle surface and swelling of the aqueous pores with water. We validate our theoretical results against appropriate experimental data, discuss the key sensitivities in the model and relate theoretical predictions to appropriate physical mechanisms. Major influencing factors have been found to be cuticle structure, including tortuosity and density of the aqueous pores, and to a lesser extent humidity and cuticle surface ion binding effects.

  7. Nonlinear Porous Diffusion Modeling of Hydrophilic Ionic Agrochemicals in Astomatous Plant Cuticle Aqueous Pores: A Mechanistic Approach

    Directory of Open Access Journals (Sweden)

    Eloise C. Tredenick

    2017-05-01

    Full Text Available The agricultural industry requires improved efficacy of sprays being applied to crops and weeds in order to reduce their environmental impact and deliver improved financial returns. Enhanced foliar uptake is one means of improving efficacy. The plant leaf cuticle is known to be the main barrier to diffusion of agrochemicals within the leaf. The usefulness of a mathematical model to simulate uptake of agrochemicals in plant cuticles has been noted previously in the literature, as the results of each uptake experiment are specific to each formulation of active ingredient, plant species and environmental conditions. In this work we develop a mathematical model and numerical simulation for the uptake of hydrophilic ionic agrochemicals through aqueous pores in plant cuticles. We propose a novel, nonlinear, porous diffusion model for ionic agrochemicals in isolated cuticles, which extends simple diffusion through the incorporation of parameters capable of simulating: plant species variations, evaporation of surface droplet solutions, ion binding effects on the cuticle surface and swelling of the aqueous pores with water. We validate our theoretical results against appropriate experimental data, discuss the key sensitivities in the model and relate theoretical predictions to appropriate physical mechanisms. Major influencing factors have been found to be cuticle structure, including tortuosity and density of the aqueous pores, and to a lesser extent humidity and cuticle surface ion binding effects.

  8. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  9. A new top boundary condition for modeling surface diffusive exchange of a generic volatile tracer: theoretical analysis and application to soil evaporation

    Directory of Open Access Journals (Sweden)

    J. Y. Tang

    2013-02-01

    Full Text Available We describe a new top boundary condition (TBC for representing the air–soil diffusive exchange of a generic volatile tracer. This new TBC (1 accounts for the multi-phase flow of a generic tracer; (2 accounts for effects of soil temperature, pH, solubility, sorption, and desorption processes; (3 enables a smooth transition between wet and dry soil conditions; (4 is compatible with the conductance formulation for modeling air–water volatile tracer exchange; and (5 is applicable to site, regional, and global land models.

    Based on the new TBC, we developed new formulations for bare-soil resistance and corresponding soil evaporation efficiency. The new soil resistance is predicted as the reciprocal of the harmonic sum of two resistances: (1 gaseous and aqueous molecular diffusion and (2 liquid mass flow resulting from the hydraulic pressure gradient between the soil surface and center of the topsoil control volume. We compared the predicted soil evaporation efficiency with those from several field and laboratory soil evaporation measurements and found good agreement with the typically observed two-stage soil evaporation curves. Comparison with the soil evaporation efficiency equation of Lee and Pielke (1992; hereafter LP92 indicates that their equation can overestimate soil evaporation when the atmospheric resistance is low and underestimate soil evaporation when the soil is dry. Using a synthetic inversion experiment, we demonstrated that using inverted soil resistance data from field measurements to derive empirical soil resistance formulations resulted in large uncertainty because (1 the inverted soil resistance data are always severely impacted by measurement error and (2 the derived empirical equation is very sensitive to the number of data points and the assumed functional form of the resistance.

    We expect the application of our new TBC in land models will provide a consistent representation for the diffusive tracer

  10. Verification of atmospheric diffusion models using data of long term atmospheric diffusion experiments

    International Nuclear Information System (INIS)

    Tamura, Junji; Kido, Hiroko; Hato, Shinji; Homma, Toshimitsu

    2009-03-01

    Straight-line or segmented plume models as atmospheric diffusion models are commonly used in probabilistic accident consequence assessment (PCA) codes due to cost and time savings. The PCA code, OSCAAR developed by Japan Atomic Energy Research Institute (Present; Japan Atomic Energy Agency) uses the variable puff trajectory model to calculate atmospheric transport and dispersion of released radionuclides. In order to investigate uncertainties involved with the structure of the atmospheric dispersion/deposition model in OSCAAR, we have introduced the more sophisticated computer codes that included regional meteorological models RAMS and atmospheric transport model HYPACT, which were developed by Colorado State University, and comparative analyses between OSCAAR and RAMS/HYPACT have been performed. In this study, model verification of OSCAAR and RAMS/HYPACT was conducted using data of long term atmospheric diffusion experiments, which were carried out in Tokai-mura, Ibaraki-ken. The predictions by models and the results of the atmospheric diffusion experiments indicated relatively good agreements. And it was shown that model performance of OSCAAR was the same degree as it of RAMS/HYPACT. (author)

  11. [Modeling polarimetric BRDF of leaves surfaces].

    Science.gov (United States)

    Xie, Dong-Hui; Wang, Pei-Juan; Zhu, Qi-Jiang; Zhou, Hong-Min

    2010-12-01

    The purpose of the present paper is to model a physical polarimetric bidirectional reflectance distribution function (pBRDF), which can character not only the non-Lambertian but also the polarized features in order that the pBRDF can be applied to analyze the relationship between the degree of polarization and the physiological and biochemical parameters of leaves quantitatively later. Firstly, the bidirectional polarized reflectance distributions from several leaves surfaces were measured by the polarized goniometer developed by Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences. The samples of leaves include two pieces of zea mays L. leaves (young leaf and mature leaf) and a piece of E. palcherrima wild leaf. Non-Lambertian characteristics of directional reflectance from the surfaces of these three leaves are obvious. A Cook-Torrance model was modified by coupling the polarized Fresnel equations to simulate the bidirectional polarized reflectance properties of leaves surfaces. The three parameters in the modified pBRDF model, such as diffuse reflectivity, refractive index and roughness of leaf surface were inversed with genetic algorithm (GA). It was found that the pBRDF model can fit with the measured data well. In addition, these parameters in the model are related with both the physiological and biochemical properties and the polarized characteristics of leaves, therefore it is possible to build the relationships between them later.

  12. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  13. Polyphase diffusion of fission products in graphite

    International Nuclear Information System (INIS)

    Dannert, V.

    1989-05-01

    The report attempts to give an introduction into the subject of fission product transport in nuclear graphite and results in an extended proposal of a transport-model. Beginning with a rough description of the graphite in question, an idea about the physical transport-phenomena in graphite is developed. Some of the basic experimental methods, especially techniques of porosimetry, determination of sorption-isotherms and of course several transport-experiments, are briefly described and their results are discussed. Some of the most frequent transport models are introduced and assessed with the criteria emphasized in this report. An extended model is proposed including the following main ideas: The transport of the fission-products is regarded as a two-phase-diffusion process through the open pores of the graphite. The two phases are: surface-diffusion and gas-diffusion. A time-dependent coupling of the two diffusion-phases by sorption-isotherms and a concentration-dependence of the surface diffusion coefficient, also related to the physical behaviour of the sorption-isotherms, are the basic properties of the proposed model. (orig./HP) [de

  14. Vertical dispersion from surface and elevated releases: An investigation of a Non-Gaussian plume model

    International Nuclear Information System (INIS)

    Brown, M.J.; Arya, S.P.; Snyder, W.H.

    1993-01-01

    The vertical diffusion of a passive tracer released from surface and elevated sources in a neutrally stratified boundary layer has been studied by comparing field and laboratory experiments with a non-Gaussian K-theory model that assumes power-law profiles for the mean velocity and vertical eddy diffusivity. Several important differences between model predictions and experimental data were discovered: (1) the model overestimated ground-level concentrations from surface and elevated releases at distances beyond the peak concentration; (2) the model overpredicted vertical mixing near elevated sources, especially in the upward direction; (3) the model-predicted exponent α in the exponential vertical concentration profile for a surface release [bar C(z)∝ exp(-z α )] was smaller than the experimentally measured exponent. Model closure assumptions and experimental short-comings are discussed in relation to their probable effect on model predictions and experimental measurements. 42 refs., 13 figs., 3 tabs

  15. Surface mobilities on solid materials

    International Nuclear Information System (INIS)

    Binh, V.T.

    1983-01-01

    This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

  16. Study of a diffusion flamelet model, with preferential diffusion effects included

    NARCIS (Netherlands)

    Delhaye, S.; Somers, L.M.T.; Bongers, H.; Oijen, van J.A.; Goey, de L.P.H.; Dias, V.

    2005-01-01

    The non-premixed flamelet model of Peters [1] (model1), which does not include preferential diffusion effects is investigated. Two similar models are presented, but without the assumption of unity Lewis numbers. One of these models was derived by Peters & Pitsch [2] (model2), while the other one was

  17. Investigation of surface boundary conditions for continuum modeling of RF plasmas

    Science.gov (United States)

    Wilson, A.; Shotorban, B.

    2018-05-01

    This work was motivated by a lacking general consensus in the exact form of the boundary conditions (BCs) required on the solid surfaces for the continuum modeling of Radiofrequency (RF) plasmas. Various kinds of number and energy density BCs on solid surfaces were surveyed, and how they interacted with the electric potential BC to affect the plasma was examined in two fundamental RF plasma reactor configurations. A second-order local mean energy approximation with equations governing the electron and ion number densities and the electron energy density was used to model the plasmas. Zero densities and various combinations of drift, diffusion, and thermal fluxes were considered to set up BCs. It was shown that the choice of BC can have a significant impact on the sheath and bulk plasma. The thermal and diffusion fluxes to the surface were found to be important. A pure drift BC for dielectric walls failed to produce a sheath.

  18. Diffusion in flexible pipes

    Energy Technology Data Exchange (ETDEWEB)

    Brogaard Kristensen, S

    2000-06-01

    This report describes the work done on modelling and simulation of the complex diffusion of gas through the wall of a flexible pipe. The diffusion and thus the pressure in annulus depends strongly on the diffusion and solubility parameters of the gas-polymer system and on the degree of blocking of the outer surface of the inner liner due to pressure reinforcements. The report evaluates the basis modelling required to describe the complex geometries and flow patterns. Qualitatively results of temperature and concentration profiles are shown in the report. For the program to serve any modelling purpose in 'real life' the results need to be validated and possibly the model needs corrections. Hopefully, a full-scale test of a flexible pipe will provide the required temperatures and pressures in annulus to validate the models. (EHS)

  19. Atmospheric diffusion of large clouds

    Energy Technology Data Exchange (ETDEWEB)

    Crawford, T. V. [Univ. of California, Lawrence Radiation Lab., Livermore, California (United States)

    1967-07-01

    Clouds of pollutants travel within a coordinate system that is fixed to the earth's surface, and they diffuse and grow within a coordinate system fixed to the cloud's center. This paper discusses an approach to predicting the cloud's properties, within the latter coordinate system, on space scales of a few hundred meters to a few hundred kilometers and for time periods of a few days. A numerical cloud diffusion model is presented which starts with a cloud placed arbitrarily within the troposphere. Similarity theories of atmospheric turbulence are used to predict the horizontal diffusivity as a function of initial cloud size, turbulent atmospheric dissipation, and time. Vertical diffusivity is input as a function of time and height. Therefore, diurnal variations of turbulent diffusion in the boundary layer and effects of temperature inversions, etc. can be modeled. Nondiffusive cloud depletion mechanisms, such as dry deposition, washout, and radioactive decay, are also a part of this numerical model. An effluent cloud, produced by a reactor run at the Nuclear Rocket Development Station, Nevada, is discussed in this paper. Measurements on this cloud, for a period of two days, are compared to calculations with the above numerical cloud diffusion model. In general, there is agreement. within a factor of two, for airborne concentrations, cloud horizontal area, surface air concentrations, and dry deposition as airborne concentration decreased by seven orders of magnitude during the two-day period. (author)

  20. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  1. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  2. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  3. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  4. Studies of ionic diffusion in crystalline rock

    International Nuclear Information System (INIS)

    Ohlsson, Yvonne

    2001-01-01

    Matrix diffusion is of great importance in delaying radionuclides escaping from a deep geologic repository, on their way to the biosphere. There are, however, poorly understood mechanisms related to transport in pores with charged pore surfaces. Ions are affected by this charge and may be repelled or attracted by it. The rate of transport may be reduced, or even enhanced, as a result of this. Transport of ions is studied by traditional diffusion experiments, but mainly by a faster electrical conductivity method. With this method the pore connectivity, the formation factor variability and its relation to the porosity, as well as the surface conductivity are investigated. The method is compared. with traditional diffusion experiments, and an in-situ application is suggested and qualitatively tested. Furthermore, surface diffusion is studied by evaluating literature data and recently developed diffusion models. The pore connectivity reached to a depth of at least 15 cm in the rocks studied. The formation factor did not generally decrease with increasing sample length. It was also found that not only cations in the free pore water add to the electrical conductivity, but also at least part of those sorbed to the pore surfaces of the minerals. This surface conductivity influences the determination of the formation factor in low ionic strength pore waters, and was also found to be a function of the formation factor. It was furthermore dependent on the type of ion at the surface, giving for example a higher conductivity for Na + than for Cs + . It is not fully understood which part of the sorbed ions that are mobile. A simple model was developed assigning the mobile ions to the diffuse layer, and this model explained experimental data for diffusion of Cs + in clay well. This is contradicted by surface conductivity measurements that have shown that most mobile ions are found behind the Stern layer. The in-situ formation factor determination method seems promising. The most

  5. A diffusivity model for predicting VOC diffusion in porous building materials based on fractal theory.

    Science.gov (United States)

    Liu, Yanfeng; Zhou, Xiaojun; Wang, Dengjia; Song, Cong; Liu, Jiaping

    2015-12-15

    Most building materials are porous media, and the internal diffusion coefficients of such materials have an important influences on the emission characteristics of volatile organic compounds (VOCs). The pore structure of porous building materials has a significant impact on the diffusion coefficient. However, the complex structural characteristics bring great difficulties to the model development. The existing prediction models of the diffusion coefficient are flawed and need to be improved. Using scanning electron microscope (SEM) observations and mercury intrusion porosimetry (MIP) tests of typical porous building materials, this study developed a new diffusivity model: the multistage series-connection fractal capillary-bundle (MSFC) model. The model considers the variable-diameter capillaries formed by macropores connected in series as the main mass transfer paths, and the diameter distribution of the capillary bundles obeys a fractal power law in the cross section. In addition, the tortuosity of the macrocapillary segments with different diameters is obtained by the fractal theory. Mesopores serve as the connections between the macrocapillary segments rather than as the main mass transfer paths. The theoretical results obtained using the MSFC model yielded a highly accurate prediction of the diffusion coefficients and were in a good agreement with the VOC concentration measurements in the environmental test chamber. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Verification of atmospheric diffusion models with data of atmospheric diffusion experiments

    International Nuclear Information System (INIS)

    Hato, Shinji; Homma, Toshimitsu

    2009-02-01

    The atmospheric diffusion experiments were implemented by Japan Atomic Energy Research Institute (JAERI) around Mount Tsukuba in 1989 and 1990, and the tracer gas concentration were monitored. In this study, the Gauss Plume Model and RAMS/HYPACT that are meteorological forecast code and atmospheric diffusion code with detailed physical law are made a comparison between monitored concentration. In conclusion, the Gauss Plume Model is better than RAM/HYPACT even complex topography if the estimation is around tens of kilometer form release point and the change in weather is constant for short time. This reason is difference of wind between RAMS and observation. (author)

  7. Diffuse-interface model for rapid phase transformations in nonequilibrium systems.

    Science.gov (United States)

    Galenko, Peter; Jou, David

    2005-04-01

    A thermodynamic approach to rapid phase transformations within a diffuse interface in a binary system is developed. Assuming an extended set of independent thermodynamic variables formed by the union of the classic set of slow variables and the space of fast variables, we introduce finiteness of the heat and solute diffusive propagation at the finite speed of the interface advancing. To describe transformations within the diffuse interface, we use the phase-field model which allows us to follow steep but smooth changes of phase within the width of the diffuse interface. Governing equations of the phase-field model are derived for the hyperbolic model, a model with memory, and a model of nonlinear evolution of transformation within the diffuse interface. The consistency of the model is proved by the verification of the validity of the condition of positive entropy production and by outcomes of the fluctuation-dissipation theorem. A comparison with existing sharp-interface and diffuse-interface versions of the model is given.

  8. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  9. Matrix diffusion model. In situ tests using natural analogues

    International Nuclear Information System (INIS)

    Rasilainen, K.

    1997-11-01

    Matrix diffusion is an important retarding and dispersing mechanism for substances carried by groundwater in fractured bedrock. Natural analogues provide, unlike laboratory or field experiments, a possibility to test the model of matrix diffusion in situ over long periods of time. This thesis documents quantitative model tests against in situ observations, done to support modelling of matrix diffusion in performance assessments of nuclear waste repositories

  10. Chromate adsorption on selected soil minerals: Surface complexation modeling coupled with spectroscopic investigation

    Energy Technology Data Exchange (ETDEWEB)

    Veselská, Veronika, E-mail: veselskav@fzp.czu.cz [Department of Environmental Geosciences, Faculty of Environmental Sciences, Czech University of Life Sciences Prague, Kamýcka 129, CZ-16521, Prague (Czech Republic); Fajgar, Radek [Department of Analytical and Material Chemistry, Institute of Chemical Process Fundamentals of the CAS, v.v.i., Rozvojová 135/1, CZ-16502, Prague (Czech Republic); Číhalová, Sylva [Department of Environmental Geosciences, Faculty of Environmental Sciences, Czech University of Life Sciences Prague, Kamýcka 129, CZ-16521, Prague (Czech Republic); Bolanz, Ralph M. [Institute of Geosciences, Friedrich-Schiller-University Jena, Carl-Zeiss-Promenade 10, DE-07745, Jena (Germany); Göttlicher, Jörg; Steininger, Ralph [ANKA Synchrotron Radiation Facility, Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, DE-76344, Eggenstein-Leopoldshafen (Germany); Siddique, Jamal A.; Komárek, Michael [Department of Environmental Geosciences, Faculty of Environmental Sciences, Czech University of Life Sciences Prague, Kamýcka 129, CZ-16521, Prague (Czech Republic)

    2016-11-15

    Highlights: • Study of Cr(VI) adsorption on soil minerals over a large range of conditions. • Combined surface complexation modeling and spectroscopic techniques. • Diffuse-layer and triple-layer models used to obtain fits to experimental data. • Speciation of Cr(VI) and Cr(III) was assessed. - Abstract: This study investigates the mechanisms of Cr(VI) adsorption on natural clay (illite and kaolinite) and synthetic (birnessite and ferrihydrite) minerals, including its speciation changes, and combining quantitative thermodynamically based mechanistic surface complexation models (SCMs) with spectroscopic measurements. Series of adsorption experiments have been performed at different pH values (3–10), ionic strengths (0.001–0.1 M KNO{sub 3}), sorbate concentrations (10{sup −4}, 10{sup −5}, and 10{sup −6} M Cr(VI)), and sorbate/sorbent ratios (50–500). Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, and X-ray absorption spectroscopy were used to determine the surface complexes, including surface reactions. Adsorption of Cr(VI) is strongly ionic strength dependent. For ferrihydrite at pH <7, a simple diffuse-layer model provides a reasonable prediction of adsorption. For birnessite, bidentate inner-sphere complexes of chromate and dichromate resulted in a better diffuse-layer model fit. For kaolinite, outer-sphere complexation prevails mainly at lower Cr(VI) loadings. Dissolution of solid phases needs to be considered for better SCMs fits. The coupled SCM and spectroscopic approach is thus useful for investigating individual minerals responsible for Cr(VI) retention in soils, and improving the handling and remediation processes.

  11. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  13. Bicarbonate diffusion through mucus.

    Science.gov (United States)

    Livingston, E H; Miller, J; Engel, E

    1995-09-01

    The mucus layer overlying duodenal epithelium maintains a pH gradient against high luminal acid concentrations. Despite these adverse conditions, epithelial surface pH remains close to neutrality. The exact nature of the gradient-forming barrier remains unknown. The barrier consists of mucus into which HCO3- is secreted. Quantification of the ability of HCO3- to establish and maintain the gradient depends on accurate measurement of this ion's diffusion coefficient through mucus. We describe new experimental and mathematical methods for diffusion measurement and report diffusion coefficients for HCO3- diffusion through saline, 5% mucin solutions, and rat duodenal mucus. The diffusion coefficients were 20.2 +/- 0.10, 3.02 +/- 0.31, and 1.81 +/- 0.12 x 10(-6) cm2/s, respectively. Modeling of the mucobicarbonate layer with this latter value suggests that for conditions of high luminal acid strength the neutralization of acid by HCO3- occurs just above the epithelial surface. Under these conditions the model predicts that fluid convection toward the lumen could be important in maintaining the pH gradient. In support of this hypothesis we were able to demonstrate a net luminal fluid flux of 5 microliters.min-1.cm-2 after perfusion of 0.15 N HCl in the rat duodenum.

  14. Diagnosing Model Errors in Simulations of Solar Radiation on Inclined Surfaces: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Yu; Sengupta, Manajit

    2016-06-01

    Transposition models have been widely used in the solar energy industry to simulate solar radiation on inclined PV panels. Following numerous studies comparing the performance of transposition models, this paper aims to understand the quantitative uncertainty in the state-of-the-art transposition models and the sources leading to the uncertainty. Our results suggest that an isotropic transposition model developed by Badescu substantially underestimates diffuse plane-of-array (POA) irradiances when diffuse radiation is perfectly isotropic. In the empirical transposition models, the selection of empirical coefficients and land surface albedo can both result in uncertainty in the output. This study can be used as a guide for future development of physics-based transposition models.

  15. Diffusion in flexible pipes

    Energy Technology Data Exchange (ETDEWEB)

    Brogaard Kristensen, S.

    2000-06-01

    This report describes the work done on modelling and simulation of the complex diffusion of gas through the wall of a flexible pipe. The diffusion and thus the pressure in annulus depends strongly on the diffusion and solubility parameters of the gas-polymer system and on the degree of blocking of the outer surface of the inner liner due to pressure reinforcements. The report evaluates the basis modelling required to describe the complex geometries and flow patterns. Qualitatively results of temperature and concentration profiles are shown in the report. For the program to serve any modelling purpose in 'real life' the results need to be validated and possibly the model needs corrections. Hopefully, a full-scale test of a flexible pipe will provide the required temperatures and pressures in annulus to validate the models. (EHS)

  16. Subgrid models for mass and thermal diffusion in turbulent mixing

    International Nuclear Information System (INIS)

    Lim, H; Yu, Y; Glimm, J; Li, X-L; Sharp, D H

    2010-01-01

    We propose a new method for the large eddy simulation (LES) of turbulent mixing flows. The method yields convergent probability distribution functions (PDFs) for temperature and concentration and a chemical reaction rate when applied to reshocked Richtmyer-Meshkov (RM) unstable flows. Because such a mesh convergence is an unusual and perhaps original capability for LES of RM flows, we review previous validation studies of the principal components of the algorithm. The components are (i) a front tracking code, FronTier, to control numerical mass diffusion and (ii) dynamic subgrid scale (SGS) models to compensate for unresolved scales in the LES. We also review the relevant code comparison studies. We compare our results to a simple model based on 1D diffusion, taking place in the geometry defined statistically by the interface (the 50% isoconcentration surface between the two fluids). Several conclusions important to physics could be drawn from our study. We model chemical reactions with no closure approximations beyond those in the LES of the fluid variables itself, and as with dynamic SGS models, these closures contain no adjustable parameters. The chemical reaction rate is specified by the joint PDF for temperature and concentration. We observe a bimodal distribution for the PDF and we observe significant dependence on fluid transport parameters.

  17. Asymmetric diffusion model for oblique-incidence reflectometry

    Institute of Scientific and Technical Information of China (English)

    Yaqin Chen; Liji Cao; Liqun Sun

    2011-01-01

    A diffusion theory model induced by a line source distribution is presented for oblique-incidence reflectom-etry. By fitting to this asymmetric diffusion model, the absorption and reduced scattering coefficients μa and μ's of the turbid medium can both be determined with accuracy of 10% from the absolute profile of the diffuse reflectance in the incident plane at the negative position -1.5 transport mean free path (mfp') away from the incident point; particularly, μ's can be estimated from the data at positive positions within 0-1.0 mfp' with 10% accuracy. The method is verified by Monte Carlo simulations and experimentally tested on a phantom.%A diffusion theory model induced by a line source distribution is presented for oblique-incidence reflectometry.By fitting to this asymmetric diffusion model,the absorption and reduced scattering coefficients μa and μ's of the turbid medium can both be determined with accuracy of 10% from the absolute profile of the diffuse reflectance in the incident plane at the negative position -1.5 transport mean free path (mfp')away from the incident point;particularly,μ's can be estimated from the data at positive positions within 0-1.0 mfp' with 10% accuracy.The method is verified by Monte Carlo simulations and experimentally tested on a phantom.Knowledge about the optical properties,including the absorption coefficient (μa) and the reduced scattering coefficient (μ's =μs(1-g)),where μs is the scattering coefficient and g is the anisotropy factor of scattering,of biological tissues plays an important role for optical therapeutic and diagnostic techniques in medicine.

  18. Modeling 2D and 3D diffusion.

    Science.gov (United States)

    Saxton, Michael J

    2007-01-01

    Modeling obstructed diffusion is essential to the understanding of diffusion-mediated processes in the crowded cellular environment. Simple Monte Carlo techniques for modeling obstructed random walks are explained and related to Brownian dynamics and more complicated Monte Carlo methods. Random number generation is reviewed in the context of random walk simulations. Programming techniques and event-driven algorithms are discussed as ways to speed simulations.

  19. Asymptotic solutions of diffusion models for risk reserves

    Directory of Open Access Journals (Sweden)

    S. Shao

    2003-01-01

    Full Text Available We study a family of diffusion models for risk reserves which account for the investment income earned and for the inflation experienced on claim amounts. After we defined the process of the conditional probability of ruin over finite time and imposed the appropriate boundary conditions, classical results from the theory of diffusion processes turn the stochastic differential equation to a special class of initial and boundary value problems defined by a linear diffusion equation. Armed with asymptotic analysis and perturbation theory, we obtain the asymptotic solutions of the diffusion models (possibly degenerate governing the conditional probability of ruin over a finite time in terms of interest rate.

  20. Diffusion in crushed rock and in bentonite clay

    International Nuclear Information System (INIS)

    Olin, M.

    1994-04-01

    Diffusion theories for porous media with sorption are reviewed to serve as a basis for considering diffusion in simple systems like sand of crushed rock. A Fickian diffusion and linear sorption model is solved both by analytical Laplance transform and Green's function methods and by numerical methods, and then applied to small-scale experiments for Finnish low- and medium-level operating waste repositories. The main properties of bentonite are reviewed. The hydraulic conductivity of compacted bentonite is so low that the major transport mechanism is diffusion. A Fickian diffusion and linear sorption model is applied to bentonite. The main component of bentonite, montmorillonite, has a high ion-exchange capacity and thus, transport in bentonite consists of interactive chemical and diffusion phenomena. A chemical equilibrium model, CHEQ, is developed for ion-exchange reactions in bentonite water systems. CHEQ is applied to some bentonite experiments with success, especially for monovalent ions. The fitted log-binding constants for sodium exchange with potassium, magnesium, and calcium were 0.27, 1.50, and 2.10, respectively. A coupled chemical and diffusion model, CHEQDIFF, is developed to take account of diffusion in pore water, surface diffusion and ion-exchange reactions. The model is applied to the same experiments as CHEQ, and validation is partly successful. In the diffusion case, the above-mentioned values for binding constants are used. The apparent diffusion (both anions and cations) and surface diffusion (only for cations) constants used are 3.0*10 -11 m 2 /s and 6.0*10 -12 m 2 /s, respectively, but these values are questionable, as experimental results good enough for fitting are not available. (orig.). (74 refs., 27 figs., 12 tabs.)

  1. Radon progeny distribution in cylindrical diffusion chambers

    International Nuclear Information System (INIS)

    Pressyanov, Dobromir S.

    2008-01-01

    An algorithm to model the diffusion of radioactive decay chain atoms is presented. Exact mathematical solutions in cylindrical geometry are given. They are used to obtain expressions for the concentrations of 222 Rn progeny atoms in the volume and deposited on the wall surface in cylindrical diffusion chambers. The dependence of volume fractions of 222 Rn progeny and chamber sensitivity on the coefficient of diffusion of 222 Rn progeny atoms in air is modeled.

  2. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  3. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  4. Reflector modelization for neutronic diffusion and parameters identification

    International Nuclear Information System (INIS)

    Argaud, J.P.

    1993-04-01

    Physical parameters of neutronic diffusion equations can be adjusted to decrease calculations-measurements errors. The reflector being always difficult to modelize, we choose to elaborate a new reflector model and to use the parameters of this model as adjustment coefficients in the identification procedure. Using theoretical results, and also the physical behaviour of neutronic flux solutions, the reflector model consists then in its replacement by boundary conditions for the diffusion equations on the core only. This theoretical result of non-local operator relations leads then to some discrete approximations by taking into account the multiscaled behaviour, on the core-reflector interface, of neutronic diffusion solutions. The resulting model of this approach is then compared with previous reflector modelizations, and first results indicate that this new model gives the same representation of reflector for the core than previous. (author). 12 refs

  5. Parameter optimization for surface flux transport models

    Science.gov (United States)

    Whitbread, T.; Yeates, A. R.; Muñoz-Jaramillo, A.; Petrie, G. J. D.

    2017-11-01

    Accurate prediction of solar activity calls for precise calibration of solar cycle models. Consequently we aim to find optimal parameters for models which describe the physical processes on the solar surface, which in turn act as proxies for what occurs in the interior and provide source terms for coronal models. We use a genetic algorithm to optimize surface flux transport models using National Solar Observatory (NSO) magnetogram data for Solar Cycle 23. This is applied to both a 1D model that inserts new magnetic flux in the form of idealized bipolar magnetic regions, and also to a 2D model that assimilates specific shapes of real active regions. The genetic algorithm searches for parameter sets (meridional flow speed and profile, supergranular diffusivity, initial magnetic field, and radial decay time) that produce the best fit between observed and simulated butterfly diagrams, weighted by a latitude-dependent error structure which reflects uncertainty in observations. Due to the easily adaptable nature of the 2D model, the optimization process is repeated for Cycles 21, 22, and 24 in order to analyse cycle-to-cycle variation of the optimal solution. We find that the ranges and optimal solutions for the various regimes are in reasonable agreement with results from the literature, both theoretical and observational. The optimal meridional flow profiles for each regime are almost entirely within observational bounds determined by magnetic feature tracking, with the 2D model being able to accommodate the mean observed profile more successfully. Differences between models appear to be important in deciding values for the diffusive and decay terms. In like fashion, differences in the behaviours of different solar cycles lead to contrasts in parameters defining the meridional flow and initial field strength.

  6. Surface photovoltage measurements and finite element modeling of SAW devices.

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, Christine

    2012-03-01

    Over the course of a Summer 2011 internship with the MEMS department of Sandia National Laboratories, work was completed on two major projects. The first and main project of the summer involved taking surface photovoltage measurements for silicon samples, and using these measurements to determine surface recombination velocities and minority carrier diffusion lengths of the materials. The SPV method was used to fill gaps in the knowledge of material parameters that had not been determined successfully by other characterization methods. The second project involved creating a 2D finite element model of a surface acoustic wave device. A basic form of the model with the expected impedance response curve was completed, and the model is ready to be further developed for analysis of MEMS photonic resonator devices.

  7. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  8. Wind Power in Europe. A Simultaneous Innovation-Diffusion Model

    International Nuclear Information System (INIS)

    Soederholm, P.; Klaassen, G.

    2007-01-01

    The purpose of this paper is to provide a quantitative analysis of innovation and diffusion in the European wind power sector. We derive a simultaneous model of wind power innovation and diffusion, which combines a rational choice model of technological diffusion and a learning curve model of dynamic cost reductions. These models are estimated using pooled annual time series data for four European countries (Denmark, Germany, Spain and the United Kingdom) over the time period 1986-2000. The empirical results indicate that reductions in investment costs have been important determinants of increased diffusion of wind power, and these cost reductions can in turn be explained by learning activities and public R and D support. Feed-in tariffs also play an important role in the innovation and diffusion processes. The higher the feed-in price the higher, ceteris paribus, the rate of diffusion, and we present some preliminary empirical support for the notion that the impact on diffusion of a marginal increase in the feed-in tariff will differ depending on the support system used. High feed-in tariffs, though, also have a negative effect on cost reductions as they induce wind generators to choose high-cost sites and provide fewer incentives for cost cuts. This illustrates the importance of designing an efficient wind energy support system, which not only promotes diffusion but also provides continuous incentives for cost-reducing innovations

  9. Stochastic Modeling and Deterministic Limit of Catalytic Surface Processes

    DEFF Research Database (Denmark)

    Starke, Jens; Reichert, Christian; Eiswirth, Markus

    2007-01-01

    Three levels of modeling, microscopic, mesoscopic and macroscopic are discussed for the CO oxidation on low-index platinum single crystal surfaces. The introduced models on the microscopic and mesoscopic level are stochastic while the model on the macroscopic level is deterministic. It can......, such that in contrast to the microscopic model the spatial resolution is reduced. The derivation of deterministic limit equations is in correspondence with the successful description of experiments under low-pressure conditions by deterministic reaction-diffusion equations while for intermediate pressures phenomena...

  10. Diffusion of hydrous species in model basaltic melt

    Science.gov (United States)

    Zhang, Li; Guo, Xuan; Wang, Qinxia; Ding, Jiale; Ni, Huaiwei

    2017-10-01

    Water diffusion in Fe-free model basaltic melt with up to 2 wt% H2O was investigated at 1658-1846 K and 1 GPa in piston-cylinder apparatus using both hydration and diffusion couple techniques. Diffusion profiles measured by FTIR are consistent with a model in which both molecular H2O (H2Om) and hydroxyl (OH) contribute to water diffusion. OH diffusivity is roughly 13% of H2Om diffusivity, showing little dependence on temperature or water concentration. Water diffusion is dominated by the motion of OH until total H2O (H2Ot) concentration reaches 1 wt%. The dependence of apparent H2Ot diffusivity on H2Ot concentration appears to be overestimated by a previous study on MORB melt, but H2Ot diffusivity at 1 wt% H2Ot in basaltic melt is still greater than those in rhyolitic to andesitic melts. The appreciable contribution of OH to water diffusion in basaltic melt can be explained by enhanced mobility of OH, probably associated with the development of free hydroxyl bonded with network-modifying cations, as well as higher OH concentration. Calculation based on the Nernst-Einstein equation demonstrates that OH may serve as an effective charge carrier in hydrous basaltic melt, which could partly account for the previously observed strong influence of water on electrical conductivity of basaltic melt.

  11. Evaluation of different models to estimate the global solar radiation on inclined surface

    Science.gov (United States)

    Demain, C.; Journée, M.; Bertrand, C.

    2012-04-01

    Global and diffuse solar radiation intensities are, in general, measured on horizontal surfaces, whereas stationary solar conversion systems (both flat plate solar collector and solar photovoltaic) are mounted on inclined surface to maximize the amount of solar radiation incident on the collector surface. Consequently, the solar radiation incident measured on a tilted surface has to be determined by converting solar radiation from horizontal surface to tilted surface of interest. This study evaluates the performance of 14 models transposing 10 minutes, hourly and daily diffuse solar irradiation from horizontal to inclined surface. Solar radiation data from 8 months (April to November 2011) which include diverse atmospheric conditions and solar altitudes, measured on the roof of the radiation tower of the Royal Meteorological Institute of Belgium in Uccle (Longitude 4.35°, Latitude 50.79°) were used for validation purposes. The individual model performance is assessed by an inter-comparison between the calculated and measured solar global radiation on the south-oriented surface tilted at 50.79° using statistical methods. The relative performance of the different models under different sky conditions has been studied. Comparison of the statistical errors between the different radiation models in function of the clearness index shows that some models perform better under one type of sky condition. Putting together different models acting under different sky conditions can lead to a diminution of the statistical error between global measured solar radiation and global estimated solar radiation. As models described in this paper have been developed for hourly data inputs, statistical error indexes are minimum for hourly data and increase for 10 minutes and one day frequency data.

  12. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  13. Comparison of non-Gaussian and Gaussian diffusion models of diffusion weighted imaging of rectal cancer at 3.0 T MRI.

    Science.gov (United States)

    Zhang, Guangwen; Wang, Shuangshuang; Wen, Didi; Zhang, Jing; Wei, Xiaocheng; Ma, Wanling; Zhao, Weiwei; Wang, Mian; Wu, Guosheng; Zhang, Jinsong

    2016-12-09

    Water molecular diffusion in vivo tissue is much more complicated. We aimed to compare non-Gaussian diffusion models of diffusion-weighted imaging (DWI) including intra-voxel incoherent motion (IVIM), stretched-exponential model (SEM) and Gaussian diffusion model at 3.0 T MRI in patients with rectal cancer, and to determine the optimal model for investigating the water diffusion properties and characterization of rectal carcinoma. Fifty-nine consecutive patients with pathologically confirmed rectal adenocarcinoma underwent DWI with 16 b-values at a 3.0 T MRI system. DWI signals were fitted to the mono-exponential and non-Gaussian diffusion models (IVIM-mono, IVIM-bi and SEM) on primary tumor and adjacent normal rectal tissue. Parameters of standard apparent diffusion coefficient (ADC), slow- and fast-ADC, fraction of fast ADC (f), α value and distributed diffusion coefficient (DDC) were generated and compared between the tumor and normal tissues. The SEM exhibited the best fitting results of actual DWI signal in rectal cancer and the normal rectal wall (R 2  = 0.998, 0.999 respectively). The DDC achieved relatively high area under the curve (AUC = 0.980) in differentiating tumor from normal rectal wall. Non-Gaussian diffusion models could assess tissue properties more accurately than the ADC derived Gaussian diffusion model. SEM may be used as a potential optimal model for characterization of rectal cancer.

  14. Electrolyte diffusion in compacted montmorillonite engineered barriers

    International Nuclear Information System (INIS)

    Jahnke, F.M.; Radke, C.J.

    1985-09-01

    The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab

  15. Matrix diffusion model. In situ tests using natural analogues

    Energy Technology Data Exchange (ETDEWEB)

    Rasilainen, K. [VTT Energy, Espoo (Finland)

    1997-11-01

    Matrix diffusion is an important retarding and dispersing mechanism for substances carried by groundwater in fractured bedrock. Natural analogues provide, unlike laboratory or field experiments, a possibility to test the model of matrix diffusion in situ over long periods of time. This thesis documents quantitative model tests against in situ observations, done to support modelling of matrix diffusion in performance assessments of nuclear waste repositories. 98 refs. The thesis includes also eight previous publications by author.

  16. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  17. Modeling the microstructure of surface by applying BRDF function

    Science.gov (United States)

    Plachta, Kamil

    2017-06-01

    The paper presents the modeling of surface microstructure using a bidirectional reflectance distribution function. This function contains full information about the reflectance properties of the flat surfaces - it is possible to determine the share of the specular, directional and diffuse components in the reflected luminous stream. The software is based on the authorial algorithm that uses selected elements of this function models, which allows to determine the share of each component. Basing on obtained data, the surface microstructure of each material can be modeled, which allows to determine the properties of this materials. The concentrator directs the reflected solar radiation onto the photovoltaic surface, increasing, at the same time, the value of the incident luminous stream. The paper presents an analysis of selected materials that can be used to construct the solar concentrator system. The use of concentrator increases the power output of the photovoltaic system by up to 17% as compared to the standard solution.

  18. Influence of Diffusivity in Room on its Acoustic Response

    Directory of Open Access Journals (Sweden)

    D. Šumarac Pavlović

    2010-11-01

    Full Text Available Diffusivity is a geometrical feature of the room which is proportional to the dimension of relief on its interior surfaces. This paper presents the results of analysis which investigates the correlation between diffusivity in a room and parameters calculated from a recorded impulse response. The analysis was performed using a specially prepared physical model of a parallelepipedic room with different combinations of flat and diffusive interior surfaces.

  19. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  20. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  1. Moisture diffusivity in structure of random fractal fiber bed

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Fanglong, E-mail: zhufanglong_168@163.com [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); The Chinese People' s Armed Police Forces Academy, Langfan City (China); Zhou, Yu; Feng, Qianqian [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); Xia, Dehong [School of Mechanical Engineering, University of Science and Technology, Beijing (China)

    2013-11-08

    A theoretical expression related to effective moisture diffusivity to random fiber bed is derived by using fractal theory and considering both parallel and perpendicular channels to diffusion flow direction. In this Letter, macroporous structure of hydrophobic nonwoven material is investigated, and Knudsen diffusion and surface diffusion are neglected. The effective moisture diffusivity predicted by the present fractal model are compared with water vapor transfer rate (WVTR) experiment data and calculated values obtained from other theoretical models. This verifies the validity of the present fractal diffusivity of fibrous structural beds.

  2. Model analysis of the influence of gas diffusivity in soil on CO and H2 uptake

    International Nuclear Information System (INIS)

    Yonemura, S.; Yokozawa, M.; Kawashima, S.; Tsuruta, H.

    2000-01-01

    CO and H 2 uptake by soil was studied as a diffusion process. A diffusion model was used to determine how the surface fluxes (net deposition velocities) were controlled by in-situ microbial uptake rates and soil gas diffusivity calculated from the 3-phase system (solid, liquid, gas) in the soil. Analytical solutions of the diffusion model assuming vertical uniformity of soil properties showed that physical properties such as air-filled porosity and soil gas diffusivity were more important in the uptake process than in the emission process. To incorporate the distribution of in-situ microbial uptake, we used a 2-layer model incorporating 'a microbiologically inactive layer and an active layer' as suggested from experimental results. By numerical simulation using the 2-layer model, we estimated the effect of several factors on deposition velocities. The variations in soil gas diffusivity due to physical properties, i.e., soil moisture and air-filled porosity, as well as to the depth of the inactive layer and in-situ microbial uptake, were found to be important in controlling deposition velocities. This result shows that the diffusion process in soil is critically important for CO and H 2 uptake by soil, at least in soils with higher in-situ uptake rates and/or with large variation in soil moisture. Similar uptake rates and the difference in deposition velocity between CO and H 2 may be attributable to differences in CO and H 2 molecular diffusivity. The inactive layer is resistant to diffusion and creates uptake limits in CO and H 2 by soil. The coupling of high temperature and a thick inactive layer, common in arid soils, markedly lowers net CO deposition velocity. The temperature for maximum uptake of CO changes with depth of the inactive layer

  3. On one model problem for the reaction-diffusion-advection equation

    Science.gov (United States)

    Davydova, M. A.; Zakharova, S. A.; Levashova, N. T.

    2017-09-01

    The asymptotic behavior of the solution with boundary layers in the time-independent mathematical model of reaction-diffusion-advection arising when describing the distribution of greenhouse gases in the surface atmospheric layer is studied. On the basis of the asymptotic method of differential inequalities, the existence of a boundary-layer solution and its asymptotic Lyapunov stability as a steady-state solution of the corresponding parabolic problem is proven. One of the results of this work is the determination of the local domain of the attraction of a boundary-layer solution.

  4. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  5. Diffusion of water into SU-8 microcantilevers

    DEFF Research Database (Denmark)

    Liu, C.J.; Liu, Y.; Sokuler, M.

    2010-01-01

    We present a method to monitor the diffusion of liquid molecules in polymers. A microdrop of water is deposited by a piezoelectric drop generator onto the upper surface of a cantilever made of SU-8 based photoresist. In response, the cantilever bends in the opposite direction. We find...... sophisticated finite element model the diffusion coefficient of water in the SU-8 polymer can be determined quantitatively from the dynamics of cantilever bending....... that this bending is mainly caused by the diffusion of water into the cantilever and the consequent swelling of SU-8. Using a one-dimensional diffusion model and assuming a simple swelling law, we qualitatively model the bending of the cantilever during in and out diffusion of water in SU-8. With a more...

  6. Analysis of discrete reaction-diffusion equations for autocatalysis and continuum diffusion equations for transport

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chi-Jen [Iowa State Univ., Ames, IA (United States)

    2013-01-01

    In this thesis, we analyze both the spatiotemporal behavior of: (A) non-linear “reaction” models utilizing (discrete) reaction-diffusion equations; and (B) spatial transport problems on surfaces and in nanopores utilizing the relevant (continuum) diffusion or Fokker-Planck equations. Thus, there are some common themes in these studies, as they all involve partial differential equations or their discrete analogues which incorporate a description of diffusion-type processes. However, there are also some qualitative differences, as shall be discussed below.

  7. The EZ diffusion model provides a powerful test of simple empirical effects.

    Science.gov (United States)

    van Ravenzwaaij, Don; Donkin, Chris; Vandekerckhove, Joachim

    2017-04-01

    Over the last four decades, sequential accumulation models for choice response times have spread through cognitive psychology like wildfire. The most popular style of accumulator model is the diffusion model (Ratcliff Psychological Review, 85, 59-108, 1978), which has been shown to account for data from a wide range of paradigms, including perceptual discrimination, letter identification, lexical decision, recognition memory, and signal detection. Since its original inception, the model has become increasingly complex in order to account for subtle, but reliable, data patterns. The additional complexity of the diffusion model renders it a tool that is only for experts. In response, Wagenmakers et al. (Psychonomic Bulletin & Review, 14, 3-22, 2007) proposed that researchers could use a more basic version of the diffusion model, the EZ diffusion. Here, we simulate experimental effects on data generated from the full diffusion model and compare the power of the full diffusion model and EZ diffusion to detect those effects. We show that the EZ diffusion model, by virtue of its relative simplicity, will be sometimes better able to detect experimental effects than the data-generating full diffusion model.

  8. Turbulent eddy diffusion models in exposure assessment - Determination of the eddy diffusion coefficient.

    Science.gov (United States)

    Shao, Yuan; Ramachandran, Sandhya; Arnold, Susan; Ramachandran, Gurumurthy

    2017-03-01

    The use of the turbulent eddy diffusion model and its variants in exposure assessment is limited due to the lack of knowledge regarding the isotropic eddy diffusion coefficient, D T . But some studies have suggested a possible relationship between D T and the air changes per hour (ACH) through a room. The main goal of this study was to accurately estimate D T for a range of ACH values by minimizing the difference between the concentrations measured and predicted by eddy diffusion model. We constructed an experimental chamber with a spatial concentration gradient away from the contaminant source, and conducted 27 3-hr long experiments using toluene and acetone under different air flow conditions (0.43-2.89 ACHs). An eddy diffusion model accounting for chamber boundary, general ventilation, and advection was developed. A mathematical expression for the slope based on the geometrical parameters of the ventilation system was also derived. There is a strong linear relationship between D T and ACH, providing a surrogate parameter for estimating D T in real-life settings. For the first time, a mathematical expression for the relationship between D T and ACH has been derived that also corrects for non-ideal conditions, and the calculated value of the slope between these two parameters is very close to the experimentally determined value. The values of D T obtained from the experiments are generally consistent with values reported in the literature. They are also independent of averaging time of measurements, allowing for comparison of values obtained from different measurement settings. These findings make the use of turbulent eddy diffusion models for exposure assessment in workplace/indoor environments more practical.

  9. Weak diffusion limits of dynamic conditional correlation models

    DEFF Research Database (Denmark)

    Hafner, Christian M.; Laurent, Sebastien; Violante, Francesco

    The properties of dynamic conditional correlation (DCC) models are still not entirely understood. This paper fills one of the gaps by deriving weak diffusion limits of a modified version of the classical DCC model. The limiting system of stochastic differential equations is characterized...... by a diffusion matrix of reduced rank. The degeneracy is due to perfect collinearity between the innovations of the volatility and correlation dynamics. For the special case of constant conditional correlations, a non-degenerate diffusion limit can be obtained. Alternative sets of conditions are considered...

  10. SC lipid model membranes designed for studying impact of ceramide species on drug diffusion and permeation--part II: diffusion and permeation of model drugs.

    Science.gov (United States)

    Ochalek, M; Podhaisky, H; Ruettinger, H-H; Wohlrab, J; Neubert, R H H

    2012-10-01

    The barrier function of two quaternary stratum corneum (SC) lipid model membranes, which were previously characterized with regard to the lipid organization, was investigated based on diffusion studies of model drugs with varying lipophilicities. Diffusion experiments of a hydrophilic drug, urea, and more lipophilic drugs than urea (i.e. caffeine, diclofenac sodium) were conducted using Franz-type diffusion cells. The amount of permeated drug was analyzed using either HPLC or CE technique. The subjects of interest in the present study were the investigation of the influence of physicochemical properties of model drugs on their diffusion and permeation through SC lipid model membranes, as well as the study of the impact of the constituents of these artificial systems (particularly ceramide species) on their barrier properties. The diffusion through both SC lipid model membranes and the human SC of the most hydrophilic model drug, urea, was faster than the permeation of the more lipophilic drugs. The slowest rate of permeation through SC lipid systems occurred in the case of caffeine. The composition of SC lipid model membranes has a significant impact on their barrier function. Model drugs diffused and permeated faster through Membrane II (presence of Cer [EOS]). In terms of the barrier properties, Membrane II is much more similar to the human SC than Membrane I. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  12. Matrix Diffusion for Performance Assessment - Experimental Evidence, Modelling Assumptions and Open Issues

    Energy Technology Data Exchange (ETDEWEB)

    Jakob, A

    2004-07-01

    In this report a comprehensive overview on the matrix diffusion of solutes in fractured crystalline rocks is presented. Some examples from observations in crystalline bedrock are used to illustrate that matrix diffusion indeed acts on various length scales. Fickian diffusion is discussed in detail followed by some considerations on rock porosity. Due to the fact that the dual-porosity medium model is a very common and versatile method for describing solute transport in fractured porous media, the transport equations and the fundamental assumptions, approximations and simplifications are discussed in detail. There is a variety of geometrical aspects, processes and events which could influence matrix diffusion. The most important of these, such as, e.g., the effect of the flow-wetted fracture surface, channelling and the limited extent of the porous rock for matrix diffusion etc., are addressed. In a further section open issues and unresolved problems related to matrix diffusion are mentioned. Since matrix diffusion is one of the key retarding processes in geosphere transport of dissolved radionuclide species, matrix diffusion was consequently taken into account in past performance assessments of radioactive waste repositories in crystalline host rocks. Some issues regarding matrix diffusion are site-specific while others are independent of the specific situation of a planned repository for radioactive wastes. Eight different performance assessments from Finland, Sweden and Switzerland were considered with the aim of finding out how matrix diffusion was addressed, and whether a consistent picture emerges regarding the varying methodology of the different radioactive waste organisations. In the final section of the report some conclusions are drawn and an outlook is given. An extensive bibliography provides the reader with the key papers and reports related to matrix diffusion. (author)

  13. Use of upscaled elevation and surface roughness data in two-dimensional surface water models

    Science.gov (United States)

    Hughes, J.D.; Decker, J.D.; Langevin, C.D.

    2011-01-01

    In this paper, we present an approach that uses a combination of cell-block- and cell-face-averaging of high-resolution cell elevation and roughness data to upscale hydraulic parameters and accurately simulate surface water flow in relatively low-resolution numerical models. The method developed allows channelized features that preferentially connect large-scale grid cells at cell interfaces to be represented in models where these features are significantly smaller than the selected grid size. The developed upscaling approach has been implemented in a two-dimensional finite difference model that solves a diffusive wave approximation of the depth-integrated shallow surface water equations using preconditioned Newton–Krylov methods. Computational results are presented to show the effectiveness of the mixed cell-block and cell-face averaging upscaling approach in maintaining model accuracy, reducing model run-times, and how decreased grid resolution affects errors. Application examples demonstrate that sub-grid roughness coefficient variations have a larger effect on simulated error than sub-grid elevation variations.

  14. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  15. A consistent transported PDF model for treating differential molecular diffusion

    Science.gov (United States)

    Wang, Haifeng; Zhang, Pei

    2016-11-01

    Differential molecular diffusion is a fundamentally significant phenomenon in all multi-component turbulent reacting or non-reacting flows caused by the different rates of molecular diffusion of energy and species concentrations. In the transported probability density function (PDF) method, the differential molecular diffusion can be treated by using a mean drift model developed by McDermott and Pope. This model correctly accounts for the differential molecular diffusion in the scalar mean transport and yields a correct DNS limit of the scalar variance production. The model, however, misses the molecular diffusion term in the scalar variance transport equation, which yields an inconsistent prediction of the scalar variance in the transported PDF method. In this work, a new model is introduced to remedy this problem that can yield a consistent scalar variance prediction. The model formulation along with its numerical implementation is discussed, and the model validation is conducted in a turbulent mixing layer problem.

  16. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  17. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  18. Thick tissue diffusion model with binding to optimize topical staining in fluorescence breast cancer margin imaging

    Science.gov (United States)

    Xu, Xiaochun; Kang, Soyoung; Navarro-Comes, Eric; Wang, Yu; Liu, Jonathan T. C.; Tichauer, Kenneth M.

    2018-03-01

    Intraoperative tumor/surgical margin assessment is required to achieve higher tumor resection rate in breast-conserving surgery. Though current histology provides incomparable accuracy in margin assessment, thin tissue sectioning and the limited field of view of microscopy makes histology too time-consuming for intraoperative applications. If thick tissue, wide-field imaging can provide an acceptable assessment of tumor cells at the surface of resected tissues, an intraoperative protocol can be developed to guide the surgery and provide immediate feedback for surgeons. Topical staining of margins with cancer-targeted molecular imaging agents has the potential to provide the sensitivity needed to see microscopic cancer on a wide-field image; however, diffusion and nonspecific retention of imaging agents in thick tissue can significantly diminish tumor contrast with conventional methods. Here, we present a mathematical model to accurately simulate nonspecific retention, binding, and diffusion of imaging agents in thick tissue topical staining to guide and optimize future thick tissue staining and imaging protocol. In order to verify the accuracy and applicability of the model, diffusion profiles of cancer targeted and untargeted (control) nanoparticles at different staining times in A431 tumor xenografts were acquired for model comparison and tuning. The initial findings suggest the existence of nonspecific retention in the tissue, especially at the tissue surface. The simulator can be used to compare the effect of nonspecific retention, receptor binding and diffusion under various conditions (tissue type, imaging agent) and provides optimal staining and imaging protocols for targeted and control imaging agent.

  19. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  20. Diffusion in condensed matter methods, materials, models

    CERN Document Server

    Kärger, Jörg

    2005-01-01

    Diffusion as the process of particle transport due to stochastic movement is a phenomenon of crucial relevance for a large variety of processes and materials. This comprehensive, handbook- style survey of diffusion in condensed matter gives detailed insight into diffusion as the process of particle transport due to stochastic movement. Leading experts in the field describe in 23 chapters the different aspects of diffusion, covering microscopic and macroscopic experimental techniques and exemplary results for various classes of solids, liquids and interfaces as well as several theoretical concepts and models. Students and scientists in physics, chemistry, materials science, and biology will benefit from this detailed compilation.

  1. Anomalous diffusion in a lattice-gas wind-tree model

    International Nuclear Information System (INIS)

    Kong, X.P.; Cohen, E.G.D.

    1989-01-01

    Two new strictly deterministic lattice-gas automata derived from Ehrenfest's wind-tree model are studied. While in one model normal diffusion occurs, the other model exhibits abnormal diffusion in that the distribution function of the displacements of the wind particle is non-Gaussian, but its second moment, the mean-square displacement, is proportional to the time, so that a diffusion coefficient can be defined. A connection with the percolation problem and a self-avoiding random walk for the case in which the lattice is completely covered with trees is discussed

  2. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  3. Modeling diffuse phosphorus emissions to assist in best management practice designing

    Science.gov (United States)

    Kovacs, Adam; Zessner, Matthias; Honti, Mark; Clement, Adrienne

    2010-05-01

    A diffuse emission modeling tool has been developed, which is appropriate to support decision-making in watershed management. The PhosFate (Phosphorus Fate) tool allows planning best management practices (BMPs) in catchments and simulating their possible impacts on the phosphorus (P) loads. PhosFate is a simple fate model to calculate diffuse P emissions and their transport within a catchment. The model is a semi-empirical, catchment scale, distributed parameter and long-term (annual) average model. It has two main parts: (a) the emission and (b) the transport model. The main input data of the model are digital maps (elevation, soil types and landuse categories), statistical data (crop yields, animal numbers, fertilizer amounts and precipitation distribution) and point information (precipitation, meteorology, soil humus content, point source emissions and reservoir data). The emission model calculates the diffuse P emissions at their source. It computes the basic elements of the hydrology as well as the soil loss. The model determines the accumulated P surplus of the topsoil and distinguishes the dissolved and the particulate P forms. Emissions are calculated according to the different pathways (surface runoff, erosion and leaching). The main outputs are the spatial distribution (cell values) of the runoff components, the soil loss and the P emissions within the catchment. The transport model joins the independent cells based on the flow tree and it follows the further fate of emitted P from each cell to the catchment outlets. Surface runoff and P fluxes are accumulated along the tree and the field and in-stream retention of the particulate forms are computed. In case of base flow and subsurface P loads only the channel transport is taken into account due to the less known hydrogeological conditions. During the channel transport, point sources and reservoirs are also considered. Main results of the transport algorithm are the discharge, dissolved and sediment

  4. Modeling bioluminescent photon transport in tissue based on Radiosity-diffusion model

    Science.gov (United States)

    Sun, Li; Wang, Pu; Tian, Jie; Zhang, Bo; Han, Dong; Yang, Xin

    2010-03-01

    Bioluminescence tomography (BLT) is one of the most important non-invasive optical molecular imaging modalities. The model for the bioluminescent photon propagation plays a significant role in the bioluminescence tomography study. Due to the high computational efficiency, diffusion approximation (DA) is generally applied in the bioluminescence tomography. But the diffusion equation is valid only in highly scattering and weakly absorbing regions and fails in non-scattering or low-scattering tissues, such as a cyst in the breast, the cerebrospinal fluid (CSF) layer of the brain and synovial fluid layer in the joints. A hybrid Radiosity-diffusion model is proposed for dealing with the non-scattering regions within diffusing domains in this paper. This hybrid method incorporates a priori information of the geometry of non-scattering regions, which can be acquired by magnetic resonance imaging (MRI) or x-ray computed tomography (CT). Then the model is implemented using a finite element method (FEM) to ensure the high computational efficiency. Finally, we demonstrate that the method is comparable with Mont Carlo (MC) method which is regarded as a 'gold standard' for photon transportation simulation.

  5. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  6. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  7. Radon diffusion through multilayer earthen covers: models and simulations

    International Nuclear Information System (INIS)

    Mayer, D.W.; Oster, C.A.; Nelson, R.W.; Gee, G.W.

    1981-09-01

    A capability to model and analyze the fundamental interactions that influence the diffusion of radon gas through uranium mill tailings and cover systems has been investigated. The purpose of this study is to develop the theoretical basis for modeling radon diffusion and to develop an understanding of the fundamental interactions that influence radon diffusion. This study develops the theoretical basis for modeling radon diffusion in one, two and three dimensions. The theory has been incorporated into three computer models that are used to analyze several tailings and cover configurations. This report contains a discussion of the theoretical basis for modeling radon diffusion, a discussion of the computer models used to analyze uranium mill tailings and multilayered cover systems, and presents the results that have been obtained. The study has been conducted using a four-phase approach. The first phase develops the solution to the steady-state radon-diffusion equation in one-dimensieered barriers; disposal charge analysis; analysis of spent fuel policy implementation; spent f water. Field measurements and observations are reported for each site. Analytical data and field measurements are presented in tables and maps. Uranium concentrations in the sediments which were above detection limits ranged from 0.10 t 51.2 ppM. The mean of the logarithms of the uranium concentrations was 0.53. A group of high uranium concentrations occurs near the junctions of quadrangles AB, AC, BB, a 200 mK. In case 2), x-ray studies of isotopic phase separation in 3 He-- 4 He bcc solids were carried out by B. A. Fraass

  8. Macromolecular diffusion in crowded media beyond the hard-sphere model.

    Science.gov (United States)

    Blanco, Pablo M; Garcés, Josep Lluís; Madurga, Sergio; Mas, Francesc

    2018-04-25

    The effect of macromolecular crowding on diffusion beyond the hard-core sphere model is studied. A new coarse-grained model is presented, the Chain Entanglement Softened Potential (CESP) model, which takes into account the macromolecular flexibility and chain entanglement. The CESP model uses a shoulder-shaped interaction potential that is implemented in the Brownian Dynamics (BD) computations. The interaction potential contains only one parameter associated with the chain entanglement energetic cost (Ur). The hydrodynamic interactions are included in the BD computations via Tokuyama mean-field equations. The model is used to analyze the diffusion of a streptavidin protein among different sized dextran obstacles. For this system, Ur is obtained by fitting the streptavidin experimental long-time diffusion coefficient Dlongversus the macromolecular concentration for D50 (indicating their molecular weight in kg mol-1) dextran obstacles. The obtained Dlong values show better quantitative agreement with experiments than those obtained with hard-core spheres. Moreover, once parametrized, the CESP model is also able to quantitatively predict Dlong and the anomalous exponent (α) for streptavidin diffusion among D10, D400 and D700 dextran obstacles. Dlong, the short-time diffusion coefficient (Dshort) and α are obtained from the BD simulations by using a new empirical expression, able to describe the full temporal evolution of the diffusion coefficient.

  9. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  10. Diffusion models in metamorphic thermo chronology: philosophy and methods

    International Nuclear Information System (INIS)

    Munha, Jose Manuel; Tassinari, Colombo Celso Gaeta

    1999-01-01

    Understanding kinetics of diffusion is of major importance to the interpretation of isotopic ages in metamorphic rocks. This paper provides a review of concepts and methodologies involved on the various diffusion models that can be applied to radiogenic systems in cooling rocks. The central concept of closure temperature is critically discussed and quantitative estimates for the various diffusion models are evaluated, in order to illustrate the controlling factors and the limits of their practical application. (author)

  11. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  12. Preisach hysteresis model for non-linear 2D heat diffusion

    International Nuclear Information System (INIS)

    Jancskar, Ildiko; Ivanyi, Amalia

    2006-01-01

    This paper analyzes a non-linear heat diffusion process when the thermal diffusivity behaviour is a hysteretic function of the temperature. Modelling this temperature dependence, the discrete Preisach algorithm as general hysteresis model has been integrated into a non-linear multigrid solver. The hysteretic diffusion shows a heating-cooling asymmetry in character. The presented type of hysteresis speeds up the thermal processes in the modelled systems by a very interesting non-linear way

  13. Numerical model for atmospheric diffusion analysis and evaluation of effective dose for safety analysis

    International Nuclear Information System (INIS)

    Sada, Koichi; Michioka, Takenobu; Ichikawa, Yoichi; Komiyama, Sumito

    2009-01-01

    A numerical simulation method has been developed to predict atmospheric flow and stack gas diffusion, considering the buildings and complex terrain located near and relatively far from a stack, respectively. The turbulence closure technique was used for flow calculation, some calculation grids on the ground near a stack were treated as buildings, and stack gas diffusion was predicted using the Lagrangian particle model. The calculated flow and stack gas diffusion results were compared with those obtained by wind tunnel experiments under actual terrain containing buildings. Effective stack height was estimated by comparing the surface concentration along the plume axis with those under a flat-plate condition, and it was apparent that the effective stack heights estimated by calculations were almost the same as those obtained by the wind tunnel experiment. Then, the effective dose and relative concentration of stack gas were calculated using the effective stack heights obtained by a numerical model. Almost the same effective dose and relative concentration were obtained when compared with those using the effective stack height obtained by wind tunnel experiment. (author)

  14. Sorption kinetics of polycyclic aromatic hydrocarbons removal using granular activated carbon: Intraparticle diffusion coefficients

    International Nuclear Information System (INIS)

    Valderrama, C.; Gamisans, X.; Heras, X. de las; Farran, A.; Cortina, J.L.

    2008-01-01

    Granular activated carbon (GAC) was evaluated as a suitable sorbent for polycyclic aromatic hydrocarbons (PAHs) removal from aqueous solutions. For this purpose, kinetic measurements on the extraction of a family of six PAHs were taken. A morphology study was performed by means of a scanning electron microscopy (SEM) analysis of GAC samples. Analyses of the batch rate data for each PAH were carried out using two kinetic models: the homogenous particle diffusion model (HPDM) and the shell progressive model (SPM). The process was controlled by diffusion rate the solutes (PAHs) that penetrated the reacted layer at PAH concentrations in the range of 0.2-10 mg L -1 . The effective particle diffusion coefficients (D eff ) derived from the two models were determined from the batch rate data. The Weber and Morris intraparticle diffusion model made a double contribution to the surface and pore diffusivities in the sorption process. The D eff values derived from both the HPMD and SPM equations varied from 1.1 x 10 -13 to 6.0 x 10 -14 m 2 s -1 . The simplest model, the pore diffusion model, was applied first for data analysis. The model of the next level of complexity, the surface diffusion model, was applied in order to gain a deeper understanding of the diffusion process. This model is able to explain the data, and the apparent surface diffusivities are in the same order of magnitude as the values for the sorption of functionalized aromatic hydrocarbons (phenols and sulphonates) that are described in the literature

  15. Pricing Participating Products under a Generalized Jump-Diffusion Model

    Directory of Open Access Journals (Sweden)

    Tak Kuen Siu

    2008-01-01

    Full Text Available We propose a model for valuing participating life insurance products under a generalized jump-diffusion model with a Markov-switching compensator. It also nests a number of important and popular models in finance, including the classes of jump-diffusion models and Markovian regime-switching models. The Esscher transform is employed to determine an equivalent martingale measure. Simulation experiments are conducted to illustrate the practical implementation of the model and to highlight some features that can be obtained from our model.

  16. Quantum-corrected drift-diffusion models for transport in semiconductor devices

    International Nuclear Information System (INIS)

    De Falco, Carlo; Gatti, Emilio; Lacaita, Andrea L.; Sacco, Riccardo

    2005-01-01

    In this paper, we propose a unified framework for Quantum-corrected drift-diffusion (QCDD) models in nanoscale semiconductor device simulation. QCDD models are presented as a suitable generalization of the classical drift-diffusion (DD) system, each particular model being identified by the constitutive relation for the quantum-correction to the electric potential. We examine two special, and relevant, examples of QCDD models; the first one is the modified DD model named Schroedinger-Poisson-drift-diffusion, and the second one is the quantum-drift-diffusion (QDD) model. For the decoupled solution of the two models, we introduce a functional iteration technique that extends the classical Gummel algorithm widely used in the iterative solution of the DD system. We discuss the finite element discretization of the various differential subsystems, with special emphasis on their stability properties, and illustrate the performance of the proposed algorithms and models on the numerical simulation of nanoscale devices in two spatial dimensions

  17. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients: Validated and tested for the adsorption of 1-Octanol at a microscopic air-water interface and its dissolution into water.

    Science.gov (United States)

    Kinoshita, Koji; Parra, Elisa; Needham, David

    2017-02-15

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain "dead time" at initial measurement. These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the "micropipette interfacial area-expansion method" was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion controlled molecular adsorption at the air-water interfaces. To validate the new technique, the diffusion coefficient of 1-Octanol in water was investigated with existing models: the Ward Tordai model for the long time adsorption regime (1-100s), and the Langmuir and Frumkin adsorption isotherm models for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2±0.8×10 -6 cm 2 /s, showed excellent agreement with the result from an alternative method, "single microdroplet catching method", to measure the diffusion coefficient from diffusion-controlled microdroplet dissolution, 7.3±0.1×10 -6 cm 2 /s. These new techniques for determining adsorption and diffusion coefficients can apply for a range of surface active molecules, especially the less-characterized ionic surfactants, and biological compounds such as lipids, peptides, and proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Agent-based modelling of cholera diffusion

    NARCIS (Netherlands)

    Augustijn-Beckers, Petronella; Doldersum, Tom; Useya, Juliana; Augustijn, Dionysius C.M.

    2016-01-01

    This paper introduces a spatially explicit agent-based simulation model for micro-scale cholera diffusion. The model simulates both an environmental reservoir of naturally occurring V.cholerae bacteria and hyperinfectious V. cholerae. Objective of the research is to test if runoff from open refuse

  19. Flux-limited diffusion models in radiation hydrodynamics

    International Nuclear Information System (INIS)

    Pomraning, G.C.; Szilard, R.H.

    1993-01-01

    The authors discuss certain flux-limited diffusion theories which approximately describe radiative transfer in the presence of steep spatial gradients. A new formulation is presented which generalizes a flux-limited description currently in widespread use for large radiation hydrodynamic calculations. This new formation allows more than one Case discrete mode to be described by a flux-limited diffusion equation. Such behavior is not extant in existing formulations. Numerical results predicted by these flux-limited diffusion models are presented for radiation penetration into an initially cold halfspace. 37 refs., 5 figs

  20. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  1. Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

    Directory of Open Access Journals (Sweden)

    Xi Shao

    2016-03-01

    Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

  2. Localization of (photorespiration and CO2 re-assimilation in tomato leaves investigated with a reaction-diffusion model.

    Directory of Open Access Journals (Sweden)

    Herman N C Berghuijs

    Full Text Available The rate of photosynthesis depends on the CO2 partial pressure near Rubisco, Cc, which is commonly calculated by models using the overall mesophyll resistance. Such models do not explain the difference between the CO2 level in the intercellular air space and Cc mechanistically. This problem can be overcome by reaction-diffusion models for CO2 transport, production and fixation in leaves. However, most reaction-diffusion models are complex and unattractive for procedures that require a large number of runs, like parameter optimisation. This study provides a simpler reaction-diffusion model. It is parameterized by both leaf physiological and leaf anatomical data. The anatomical data consisted of the thickness of the cell wall, cytosol and stroma, and the area ratios of mesophyll exposed to the intercellular air space to leaf surfaces and exposed chloroplast to exposed mesophyll surfaces. The model was used directly to estimate photosynthetic parameters from a subset of the measured light and CO2 response curves; the remaining data were used for validation. The model predicted light and CO2 response curves reasonably well for 15 days old tomato (cv. Admiro leaves, if (photorespiratory CO2 release was assumed to take place in the inner cytosol or in the gaps between the chloroplasts. The model was also used to calculate the fraction of CO2 produced by (photorespiration that is re-assimilated in the stroma, and this fraction ranged from 56 to 76%. In future research, the model should be further validated to better understand how the re-assimilation of (photorespired CO2 is affected by environmental conditions and physiological parameters.

  3. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  4. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  5. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  6. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  7. Modeling and Analysis of Epidemic Diffusion within Small-World Network

    Directory of Open Access Journals (Sweden)

    Ming Liu

    2012-01-01

    Full Text Available To depict the rule of epidemic diffusion, two different models, the Susceptible-Exposure-Infected-Recovered-Susceptible (SEIRS model and the Susceptible-Exposure-Infected-Quarantine-Recovered-Susceptible (SEIQRS model, are proposed and analyzed within small-world network in this paper. Firstly, the epidemic diffusion models are constructed with mean-filed theory, and condition for the occurrence of disease diffusion is explored. Then, the existence and global stability of the disease-free equilibrium and the endemic equilibrium for these two complex epidemic systems are proved by differential equations knowledge and Routh-Hurwiz theory. At last, a numerical example which includes key parameters analysis and critical topic discussion is presented to test how well the proposed two models may be applied in practice. These works may provide some guidelines for decision makers when coping with epidemic diffusion controlling problems.

  8. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  9. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  10. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  11. Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

    International Nuclear Information System (INIS)

    Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

    1976-01-01

    Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

  12. Improved age-diffusion model for low-energy electron transport in solids. I. Theory

    International Nuclear Information System (INIS)

    Devooght, J.; Dubus, A.; Dehaes, J.C.

    1987-01-01

    We have developed in this paper a semianalytical electron transport model designed for parametric studies of secondary-electron emission induced by low-energy electrons (keV range) and by fast light ions (100 keV range). The primary-particle transport is assumed to be known and to give rise to an internal electron source. The importance of the nearly isotropic elastic scattering in the secondary-electron energy range (50 eV) and the slowing-down process strongly reduce the influence of the anisotropy of the internal electron source, and the internal electron flux is nearly isotropic as is evidenced by the experimental results. The differential energy behavior of the inelastic scattering kernel is very complicated and the real kernel is replaced by a synthetic scattering kernel of which parameters are obtained by energy and angle moments conservation. Through a P 1 approximation and the use of the synthetic scattering kernel, the Boltzmann equation is approximated by a diffusion--slowing-down equation for the isotropic part of the internal electron flux. The energy-dependent partial reflection boundary condition reduces to a Neumann-Dirichlet boundary condition. An analytical expression for the Green's function of the diffusion--slowing-down equation with the surface boundary condition is obtained by means of approximations close to the age-diffusion theory and the model allows for transient conditions. Independently from the ''improved age-diffusion'' model, a correction formula is developed in order to take into account the backscattering of primary electrons for an incident-electron problem

  13. Ion-exchange equilibria and diffusion in engineered backfill

    International Nuclear Information System (INIS)

    Soudek, A.; Jahnke, F.M.; Radke, C.J.

    1984-01-01

    Engineered backfill can add confidence to confinement times of high-level nuclear waste stored in geologic media. This paper discusses the design and operation of a unique radial-flow diffusion cell to determine ion migration rates in backfill material under realistic repository conditions. New experimental results were reported for diffusion of CsCl in a background of NaCl into compacted bentonite and bentonite/quartz mixtures. Representation of the measured diffusion rates by the traditional, homogeneous porous-medium model significantly underestimates cesium penetration distances into the backfill. Surface diffusion is suggested as an additional mechanism by which cations transport in swollen montmorillonite; the surface diffusion coefficients for cesium is determined to be approximately 10 -7 cm 2 /s. An electrostatic site-binding model is developed for ion-exchange equilibria on montmorillonite clay. The effect of pH, ionic strength, and specific adsorption are evaluated and compared favorably to new, experimental exchange isotherms measured on disaggregated clay. The electrostatic site-binding model permits a prediction of the influence of backfill compaction on K/sub d/ values. We find that for strongly adsorbing cations, compactions has little effect. However, anions exhibit significant Donnan exclusion with clay compaction. 40 references, 12 figures

  14. Water diffusion in clays with added organic surfactants

    International Nuclear Information System (INIS)

    Pineda-Pinon, J; Mendoza-Lopez, M L; Manzano-RamIrez, A; Perez-Robles, J F; Vega-Duran, J T

    2007-01-01

    Tensoactive agents may decrease water absorption in clay products like adobes. They modify the characteristics of the surface of clay particles. Characterization of water diffusion through the pores of modified clays is important to apply appropriate surface modifiers and to improve their performance. We established a simple model for water diffusion in test samples of defined dimensions to estimate real physical parameters and their effect on water absorption. Adsorption mechanisms are examined based on experimental results. The fitting of the experimental data to the model provides a deep understanding of water adsorption in chemically modified clays. A better agreement between the model and the experimental data is achieved for complex molecules

  15. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  16. Time-Dependent Diffusion MRI in Cancer: Tissue Modeling and Applications

    Directory of Open Access Journals (Sweden)

    Olivier Reynaud

    2017-11-01

    Full Text Available In diffusion weighted imaging (DWI, the apparent diffusion coefficient (ADC has been recognized as a useful and sensitive surrogate for cell density, paving the way for non-invasive tumor staging, and characterization of treatment efficacy in cancer. However, microstructural parameters, such as cell size, density and/or compartmental diffusivities affect diffusion in various fashions, making of conventional DWI a sensitive but non-specific probe into changes happening at cellular level. Alternatively, tissue complexity can be probed and quantified using the time dependence of diffusion metrics, sometimes also referred to as temporal diffusion spectroscopy when only using oscillating diffusion gradients. Time-dependent diffusion (TDD is emerging as a strong candidate for specific and non-invasive tumor characterization. Despite the lack of a general analytical solution for all diffusion times/frequencies, TDD can be probed in various regimes where systems simplify in order to extract relevant information about tissue microstructure. The fundamentals of TDD are first reviewed (a in the short time regime, disentangling structural and diffusive tissue properties, and (b near the tortuosity limit, assuming weakly heterogeneous media near infinitely long diffusion times. Focusing on cell bodies (as opposed to neuronal tracts, a simple but realistic model for intracellular diffusion can offer precious insight on diffusion inside biological systems, at all times. Based on this approach, the main three geometrical models implemented so far (IMPULSED, POMACE, VERDICT are reviewed. Their suitability to quantify cell size, intra- and extracellular spaces (ICS and ECS and diffusivities are assessed. The proper modeling of tissue membrane permeability—hardly a newcomer in the field, but lacking applications—and its impact on microstructural estimates are also considered. After discussing general issues with tissue modeling and microstructural parameter

  17. Time-dependent diffusion MRI in cancer: tissue modeling and applications

    Science.gov (United States)

    Reynaud, Olivier

    2017-11-01

    In diffusion weighted imaging (DWI), the apparent diffusion coefficient has been recognized as a useful and sensitive surrogate for cell density, paving the way for non-invasive tumor staging, and characterization of treatment efficacy in cancer. However, microstructural parameters, such as cell size, density and/or compartmental diffusivities affect diffusion in various fashions, making of conventional DWI a sensitive but non-specific probe into changes happening at cellular level. Alternatively, tissue complexity can be probed and quantified using the time dependence of diffusion metrics, sometimes also referred to as temporal diffusion spectroscopy when only using oscillating diffusion gradients. Time-dependent diffusion (TDD) is emerging as a strong candidate for specific and non-invasive tumor characterization. Despite the lack of a general analytical solution for all diffusion times / frequencies, TDD can be probed in various regimes where systems simplify in order to extract relevant information about tissue microstructure. The fundamentals of TDD are first reviewed (a) in the short time regime, disentangling structural and diffusive tissue properties, and (b) near the tortuosity limit, assuming weakly heterogeneous media near infinitely long diffusion times. Focusing on cell bodies (as opposed to neuronal tracts), a simple but realistic model for intracellular diffusion can offer precious insight on diffusion inside biological systems, at all times. Based on this approach, the main three geometrical models implemented so far (IMPULSED, POMACE, VERDICT) are reviewed. Their suitability to quantify cell size, intra- and extracellular spaces (ICS and ECS) and diffusivities are assessed. The proper modeling of tissue membrane permeability – hardly a newcomer in the field, but lacking applications - and its impact on microstructural estimates are also considered. After discussing general issues with tissue modeling and microstructural parameter estimation (i

  18. Hydrogen Diffusion and H{sub 2}S Corrosion in Steel

    Energy Technology Data Exchange (ETDEWEB)

    Haugstveit, Bjarte Erlend

    2001-01-01

    The electrochemical permeation technique introduced by Devanathan and Stachurski has been used to measure the effective diffusivity of hydrogen in steel in a H{sub 2}S-saturated aqueous environment. The linear polarization resistance (LPR) method has been used to measure the corrosion rate. The effective diffusion coefficient of hydrogen has been found to be in the range of 1*10-12 to 7*10-11, depending on the environmental conditions. The corrosion film was identified as mackinawite, and it affected the permeation process of hydrogen. The results supported the assumption that the diffusion process can be described by a three layer model and indicated that the model could be reduced to a two layer model in the cases of iron and steel. A model aimed to describe the reaction pathway of hydrogen through the surface film and into the steel is proposed. The corrosion film influenced the corrosion rate, and it was least protective against corrosion at pH 6.5. Corrosion rates were in the range of 0.2-1 mm/year. The corrosion rate was increased significantly at pH 3.5, but the effect of the surface film was stronger and overshadowed the pH effect at the higher pH values. Increased flow velocity also lead to increased corrosion rate, but this effect was less significant compared to the effect of pH and the surface film. DEG decreased the corrosion rate. The uncertainty in the diffusion measurements was mainly due to the assumption of a constant sub-surface concentration of atomic hydrogen, which was not fulfilled. A method less dependent on constant surface conditions would probably yield better estimates of the effective diffusivity. The uncertainty in the corrosion measurements was mainly due to the uncertainty in the value of the Stern-Geary constant. The qualitative assumptions based on the results in this thesis are assumed to be valid. A test section designed for this thesis was tested and was found successful in corrosion rate measurements, but proved to be

  19. Surface chemistry of first wall materials - From fundamental data to modeling

    International Nuclear Information System (INIS)

    Linsmeier, Ch.; Reinelt, M.; Schmid, K.

    2011-01-01

    The application of different materials at the first wall of fusion devices, like beryllium, carbon, and tungsten in the case of ITER, unavoidably leads to the formation of compounds. These compounds are created dynamically during operation and depend on the local parameters like surface temperature, incoming particle energies and species. In dedicated, well-defined laboratory experiments, using mainly X-ray photoelectron spectroscopy and Rutherford backscattering analysis for qualitative and quantitative chemical surface analysis, the parameter space in relevant element combinations are investigated. These studies lead to a deep understanding of the reaction mechanisms under the applied conditions and to a quantitative description of reaction and diffusion processes. These data can be parameterized and integrated into a modeling approach which combines dynamic surface chemistry with the modeling of the transport in the plasma. Two different approaches for surface reaction modeling are compared and benchmarked with experimental data.

  20. Thermal diffusivity effect in opto-thermal skin measurements

    International Nuclear Information System (INIS)

    Xiao, P; Imhof, R E; Cui, Y; Ciortea, L I; Berg, E P

    2010-01-01

    We present our latest study on the thermal diffusivity effect in opto-thermal skin measurements. We discuss how thermal diffusivity affects the shape of opto-thermal signal, and how to measure thermal diffusivity in opto-thermal measurements of arbitrary sample surfaces. We also present a mathematical model for a thermally gradient material, and its corresponding opto-thermal signal. Finally, we show some of our latest experimental results of this thermal diffusivity effect study.

  1. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  2. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  3. What Can the Diffusion Model Tell Us About Prospective Memory?

    Science.gov (United States)

    Horn, Sebastian S.; Bayen, Ute J.; Smith, Rebekah E.

    2011-01-01

    Cognitive process models, such as Ratcliff’s (1978) diffusion model, are useful tools for examining cost- or interference effects in event-based prospective memory (PM). The diffusion model includes several parameters that provide insight into how and why ongoing-task performance may be affected by a PM task and is ideally suited to analyze performance because both reaction time and accuracy are taken into account. Separate analyses of these measures can easily yield misleading interpretations in cases of speed-accuracy tradeoffs. The diffusion model allows us to measure possible criterion shifts and is thus an important methodological improvement over standard analyses. Performance in an ongoing lexical decision task (Smith, 2003) was analyzed with the diffusion model. The results suggest that criterion shifts play an important role when a PM task is added, but do not fully explain the cost effect on RT. PMID:21443332

  4. Discrete random walk models for space-time fractional diffusion

    International Nuclear Information System (INIS)

    Gorenflo, Rudolf; Mainardi, Francesco; Moretti, Daniele; Pagnini, Gianni; Paradisi, Paolo

    2002-01-01

    A physical-mathematical approach to anomalous diffusion may be based on generalized diffusion equations (containing derivatives of fractional order in space or/and time) and related random walk models. By space-time fractional diffusion equation we mean an evolution equation obtained from the standard linear diffusion equation by replacing the second-order space derivative with a Riesz-Feller derivative of order α is part of (0,2] and skewness θ (moduleθ≤{α,2-α}), and the first-order time derivative with a Caputo derivative of order β is part of (0,1]. Such evolution equation implies for the flux a fractional Fick's law which accounts for spatial and temporal non-locality. The fundamental solution (for the Cauchy problem) of the fractional diffusion equation can be interpreted as a probability density evolving in time of a peculiar self-similar stochastic process that we view as a generalized diffusion process. By adopting appropriate finite-difference schemes of solution, we generate models of random walk discrete in space and time suitable for simulating random variables whose spatial probability density evolves in time according to this fractional diffusion equation

  5. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  6. Multi-species counter-current diffusion model for etching depleted uranium oxide in NF3, RF glow discharge

    International Nuclear Information System (INIS)

    Saber, H.H.; El-Genk, M.S.

    1999-01-01

    Results of recent experiments investigating the decontamination of depleted UO 2 using NF 3 gas, RF gloss discharge, showed that etching rate decreased monotonically with immersion time to the end point. In addition to the formation of non-volatile reaction products on UO 2 surface, the accumulation of UF 6 in the sheath contributed to the decrease in etch rate with immersion time. To investigate the latter, a transient, multi-species, counter-current diffusion model for UO 2 etching is developed. Model results indicated that, depending on gas pressure and absorbed power, the diffusion coefficient of F in the sheath decreased at the end point by ∼15%. At 17.0 Pa and 200 W, the mole fraction of F at UO 2 surface decreased rapidly with immersion time to 61% and 86% of its initial value, after one and two characteristic etch time, respectively, it became almost zero at the end point, reached after 4--5 characteristic etch times

  7. Differences in Gaussian diffusion tensor imaging and non-Gaussian diffusion kurtosis imaging model-based estimates of diffusion tensor invariants in the human brain.

    Science.gov (United States)

    Lanzafame, S; Giannelli, M; Garaci, F; Floris, R; Duggento, A; Guerrisi, M; Toschi, N

    2016-05-01

    An increasing number of studies have aimed to compare diffusion tensor imaging (DTI)-related parameters [e.g., mean diffusivity (MD), fractional anisotropy (FA), radial diffusivity (RD), and axial diffusivity (AD)] to complementary new indexes [e.g., mean kurtosis (MK)/radial kurtosis (RK)/axial kurtosis (AK)] derived through diffusion kurtosis imaging (DKI) in terms of their discriminative potential about tissue disease-related microstructural alterations. Given that the DTI and DKI models provide conceptually and quantitatively different estimates of the diffusion tensor, which can also depend on fitting routine, the aim of this study was to investigate model- and algorithm-dependent differences in MD/FA/RD/AD and anisotropy mode (MO) estimates in diffusion-weighted imaging of human brain white matter. The authors employed (a) data collected from 33 healthy subjects (20-59 yr, F: 15, M: 18) within the Human Connectome Project (HCP) on a customized 3 T scanner, and (b) data from 34 healthy subjects (26-61 yr, F: 5, M: 29) acquired on a clinical 3 T scanner. The DTI model was fitted to b-value =0 and b-value =1000 s/mm(2) data while the DKI model was fitted to data comprising b-value =0, 1000 and 3000/2500 s/mm(2) [for dataset (a)/(b), respectively] through nonlinear and weighted linear least squares algorithms. In addition to MK/RK/AK maps, MD/FA/MO/RD/AD maps were estimated from both models and both algorithms. Using tract-based spatial statistics, the authors tested the null hypothesis of zero difference between the two MD/FA/MO/RD/AD estimates in brain white matter for both datasets and both algorithms. DKI-derived MD/FA/RD/AD and MO estimates were significantly higher and lower, respectively, than corresponding DTI-derived estimates. All voxelwise differences extended over most of the white matter skeleton. Fractional differences between the two estimates [(DKI - DTI)/DTI] of most invariants were seen to vary with the invariant value itself as well as with MK

  8. Size dependent diffusive parameters and tensorial diffusion equations in neutronic models for optically small nuclear systems

    International Nuclear Information System (INIS)

    Premuda, F.

    1983-01-01

    Two lines in improved neutron diffusion theory extending the efficiency of finite-difference diffusion codes to the field of optically small systems, are here reviewed. The firs involves the nodal solution for tensorial diffusion equation in slab geometry and tensorial formulation in parallelepiped and cylindrical gemometry; the dependence of critical eigenvalue from small slab thicknesses is also analitically investigated and finally a regularized tensorial diffusion equation is derived for slab. The other line refer to diffusion models formally unchanged with respect to the classical one, but where new size-dependent RTGB definitions for diffusion parameters are adopted, requiring that they allow to reproduce, in diffusion approach, the terms of neutron transport global balance; the trascendental equation for the buckling, arising in slab, sphere and parallelepiped geometry from the above requirement, are reported and the sizedependence of the new diffusion coefficient and extrapolated end point is investigated

  9. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  10. Numerical modelling of needle-grid electrodes for negative surface corona charging system

    International Nuclear Information System (INIS)

    Zhuang, Y; Chen, G; Rotaru, M

    2011-01-01

    Surface potential decay measurement is a simple and low cost tool to examine electrical properties of insulation materials. During the corona charging stage, a needle-grid electrodes system is often used to achieve uniform charge distribution on the surface of the sample. In this paper, a model using COMSOL Multiphysics has been developed to simulate the gas discharge. A well-known hydrodynamic drift-diffusion model was used. The model consists of a set of continuity equations accounting for the movement, generation and loss of charge carriers (electrons, positive and negative ions) coupled with Poisson's equation to take into account the effect of space and surface charges on the electric field. Four models with the grid electrode in different positions and several mesh sizes are compared with a model that only has the needle electrode. The results for impulse current and surface charge density on the sample clearly show the effect of the extra grid electrode with various positions.

  11. Diffusion tensor magnetic resonance imaging driven growth modeling for radiotherapy target definition in glioblastoma.

    Science.gov (United States)

    Jensen, Morten B; Guldberg, Trine L; Harbøll, Anja; Lukacova, Slávka; Kallehauge, Jesper F

    2017-11-01

    The clinical target volume (CTV) in radiotherapy is routinely based on gadolinium contrast enhanced T1 weighted (T1w + Gd) and T2 weighted fluid attenuated inversion recovery (T2w FLAIR) magnetic resonance imaging (MRI) sequences which have been shown to over- or underestimate the microscopic tumor cell spread. Gliomas favor spread along the white matter fiber tracts. Tumor growth models incorporating the MRI diffusion tensors (DTI) allow to account more consistently for the glioma growth. The aim of the study was to investigate the potential of a DTI driven growth model to improve target definition in glioblastoma (GBM). Eleven GBM patients were scanned using T1w, T2w FLAIR, T1w + Gd and DTI. The brain was segmented into white matter, gray matter and cerebrospinal fluid. The Fisher-Kolmogorov growth model was used assuming uniform proliferation and a difference in white and gray matter diffusion of a ratio of 10. The tensor directionality was tested using an anisotropy weighting parameter set to zero (γ0) and twenty (γ20). The volumetric comparison was performed using Hausdorff distance, Dice similarity coefficient (DSC) and surface area. The median of the standard CTV (CTVstandard) was 180 cm 3 . The median surface area of CTVstandard was 211 cm 2 . The median surface area of respective CTV γ0 and CTV γ20 significantly increased to 338 and 376 cm 2 , respectively. The Hausdorff distance was greater than zero and significantly increased for both CTV γ0 and CTV γ20 with respective median of 18.7 and 25.2 mm. The DSC for both CTV γ0 and CTV γ20 were significantly below one with respective median of 0.74 and 0.72, which means that 74 and 72% of CTVstandard were included in CTV γ0 and CTV γ20, respectively. DTI driven growth models result in CTVs with a significantly increased surface area, a significantly increased Hausdorff distance and decreased overlap between the standard and model derived volume.

  12. Anomalous Transport of Cosmic Rays in a Nonlinear Diffusion Model

    Energy Technology Data Exchange (ETDEWEB)

    Litvinenko, Yuri E. [Department of Mathematics, University of Waikato, P. B. 3105, Hamilton 3240 (New Zealand); Fichtner, Horst; Walter, Dominik [Institut für Theoretische Physik IV, Ruhr-Universität Bochum, Universitätsstrasse 150, D-44780 Bochum (Germany)

    2017-05-20

    We investigate analytically and numerically the transport of cosmic rays following their escape from a shock or another localized acceleration site. Observed cosmic-ray distributions in the vicinity of heliospheric and astrophysical shocks imply that anomalous, superdiffusive transport plays a role in the evolution of the energetic particles. Several authors have quantitatively described the anomalous diffusion scalings, implied by the data, by solutions of a formal transport equation with fractional derivatives. Yet the physical basis of the fractional diffusion model remains uncertain. We explore an alternative model of the cosmic-ray transport: a nonlinear diffusion equation that follows from a self-consistent treatment of the resonantly interacting cosmic-ray particles and their self-generated turbulence. The nonlinear model naturally leads to superdiffusive scalings. In the presence of convection, the model yields a power-law dependence of the particle density on the distance upstream of the shock. Although the results do not refute the use of a fractional advection–diffusion equation, they indicate a viable alternative to explain the anomalous diffusion scalings of cosmic-ray particles.

  13. Mathematical modelling of the influenced of diffusion rate on macro nutrient availability in paddy field

    Science.gov (United States)

    Renny; Supriyanto

    2018-04-01

    Nutrition is the chemical compounds that needed by the organism for the growth process. In plants, nutrients are organic or inorganic compounds that are absorbed from the roots of the soil. It consist of macro and micro nutrient. Macro nutrients are nutrition that needed by plants in large quantities, such as, nitrogen, calcium, pottacium, magnesium, and sulfur. The total soil nutrient is the difference between the input nutrient and the output nutrients. Input nutrients are nutrient that derived from the decomposition of organic substances. Meanwhile, the output nutrient consists of the nutrients that absorbed by plant roots (uptake), the evaporated nutrients (volatilized) and leached nutrients. The nutrient transport can be done through diffusion process. The diffusion process is essential in removing the nutrient from one place to the root surface. It will cause the rate of absorption of nutrient by the roots will be greater. Nutrient concept in paddy filed can be represented into a mathematical modelling, by making compartment models. The rate of concentration change in the compartment model forms a system of homogeneous linear differential equations. In this research, we will use Laplaces transformation to solve the compartment model and determined the dynamics of macro nutrition due to diffusion process.

  14. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  15. Nuclear diffuseness as a degree of freedom

    Science.gov (United States)

    Myers, W. D.; ŚwiaŢecki, W. J.

    1998-12-01

    The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Süssmann width b.

  16. Nuclear diffuseness as a degree of freedom

    International Nuclear Information System (INIS)

    Myers, W.D.; Swiatecki, W.J.

    1998-01-01

    The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Suessmann width b. copyright 1998 The American Physical Society

  17. A fractional motion diffusion model for grading pediatric brain tumors.

    Science.gov (United States)

    Karaman, M Muge; Wang, He; Sui, Yi; Engelhard, Herbert H; Li, Yuhua; Zhou, Xiaohong Joe

    2016-01-01

    To demonstrate the feasibility of a novel fractional motion (FM) diffusion model for distinguishing low- versus high-grade pediatric brain tumors; and to investigate its possible advantage over apparent diffusion coefficient (ADC) and/or a previously reported continuous-time random-walk (CTRW) diffusion model. With approval from the institutional review board and written informed consents from the legal guardians of all participating patients, this study involved 70 children with histopathologically-proven brain tumors (30 low-grade and 40 high-grade). Multi- b -value diffusion images were acquired and analyzed using the FM, CTRW, and mono-exponential diffusion models. The FM parameters, D fm , φ , ψ (non-Gaussian diffusion statistical measures), and the CTRW parameters, D m , α , β (non-Gaussian temporal and spatial diffusion heterogeneity measures) were compared between the low- and high-grade tumor groups by using a Mann-Whitney-Wilcoxon U test. The performance of the FM model for differentiating between low- and high-grade tumors was evaluated and compared with that of the CTRW and the mono-exponential models using a receiver operating characteristic (ROC) analysis. The FM parameters were significantly lower ( p  < 0.0001) in the high-grade ( D fm : 0.81 ± 0.26, φ : 1.40 ± 0.10, ψ : 0.42 ± 0.11) than in the low-grade ( D fm : 1.52 ± 0.52, φ : 1.64 ± 0.13, ψ : 0.67 ± 0.13) tumor groups. The ROC analysis showed that the FM parameters offered better specificity (88% versus 73%), sensitivity (90% versus 82%), accuracy (88% versus 78%), and area under the curve (AUC, 93% versus 80%) in discriminating tumor malignancy compared to the conventional ADC. The performance of the FM model was similar to that of the CTRW model. Similar to the CTRW model, the FM model can improve differentiation between low- and high-grade pediatric brain tumors over ADC.

  18. Effects of anisotropies in turbulent magnetic diffusion in mean-field solar dynamo models

    Energy Technology Data Exchange (ETDEWEB)

    Pipin, V. V. [Institute of Solar-Terrestrial Physics, Russian Academy of Sciences, Irkutsk 664033 (Russian Federation); Kosovichev, A. G. [Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305 (United States)

    2014-04-10

    We study how anisotropies of turbulent diffusion affect the evolution of large-scale magnetic fields and the dynamo process on the Sun. The effect of anisotropy is calculated in a mean-field magnetohydrodynamics framework assuming that triple correlations provide relaxation to the turbulent electromotive force (so-called the 'minimal τ-approximation'). We examine two types of mean-field dynamo models: the well-known benchmark flux-transport model and a distributed-dynamo model with a subsurface rotational shear layer. For both models, we investigate effects of the double- and triple-cell meridional circulation, recently suggested by helioseismology and numerical simulations. To characterize the anisotropy effects, we introduce a parameter of anisotropy as a ratio of the radial and horizontal intensities of turbulent mixing. It is found that the anisotropy affects the distribution of magnetic fields inside the convection zone. The concentration of the magnetic flux near the bottom and top boundaries of the convection zone is greater when the anisotropy is stronger. It is shown that the critical dynamo number and the dynamo period approach to constant values for large values of the anisotropy parameter. The anisotropy reduces the overlap of toroidal magnetic fields generated in subsequent dynamo cycles, in the time-latitude 'butterfly' diagram. If we assume that sunspots are formed in the vicinity of the subsurface shear layer, then the distributed dynamo model with the anisotropic diffusivity satisfies the observational constraints from helioseismology and is consistent with the value of effective turbulent diffusion estimated from the dynamics of surface magnetic fields.

  19. A reaction-diffusion model of CO2 influx into an oocyte

    Science.gov (United States)

    Somersalo, Erkki; Occhipinti, Rossana; Boron, Walter F.; Calvetti, Daniela

    2012-01-01

    We have developed and implemented a novel mathematical model for simulating transients in surface pH (pHS) and intracellular pH (pHi) caused by the influx of carbon dioxide (CO2) into a Xenopus oocyte. These transients are important tools for studying gas channels. We assume that the oocyte is a sphere surrounded by a thin layer of unstirred fluid, the extracellular unconvected fluid (EUF), which is in turn surrounded by the well-stirred bulk extracellular fluid (BECF) that represents an infinite reservoir for all solutes. Here, we assume that the oocyte plasma membrane is permeable only to CO2. In both the EUF and intracellular space, solute concentrations can change because of diffusion and reactions. The reactions are the slow equilibration of the CO2 hydration-dehydration reactions and competing equilibria among carbonic acid (H2CO3)/bicarbonate ( HCO3-) and a multitude of non-CO2/HCO3- buffers. Mathematically, the model is described by a coupled system of reaction-diffusion equations that—assuming spherical radial symmetry—we solved using the method of lines with appropriate stiff solvers. In agreement with experimental data (Musa-Aziz et al, PNAS 2009, 106:5406–5411), the model predicts that exposing the cell to extracellular 1.5% CO2/10 mM HCO3- (pH 7.50) causes pHi to fall and pHS to rise rapidly to a peak and then decay. Moreover, the model provides insights into the competition between diffusion and reaction processes when we change the width of the EUF, membrane permeability to CO2, native extra-and intracellular carbonic anhydrase-like activities, the non-CO2/HCO3- (intrinsic) intracellular buffering power, or mobility of intrinsic intracellular buffers. PMID:22728674

  20. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  1. Mechanisms underlying anomalous diffusion in the plasma membrane.

    Science.gov (United States)

    Krapf, Diego

    2015-01-01

    The plasma membrane is a complex fluid where lipids and proteins undergo diffusive motion critical to biochemical reactions. Through quantitative imaging analyses such as single-particle tracking, it is observed that diffusion in the cell membrane is usually anomalous in the sense that the mean squared displacement is not linear with time. This chapter describes the different models that are employed to describe anomalous diffusion, paying special attention to the experimental evidence that supports these models in the plasma membrane. We review models based on anticorrelated displacements, such as fractional Brownian motion and obstructed diffusion, and nonstationary models such as continuous time random walks. We also emphasize evidence for the formation of distinct compartments that transiently form on the cell surface. Finally, we overview heterogeneous diffusion processes in the plasma membrane, which have recently attracted considerable interest. Copyright © 2015. Published by Elsevier Inc.

  2. Modeling intragranular diffusion in low-connectivity granular media

    Science.gov (United States)

    Ewing, Robert P.; Liu, Chongxuan; Hu, Qinhong

    2012-03-01

    Characterizing the diffusive exchange of solutes between bulk water in an aquifer and water in the intragranular pores of the solid phase is still challenging despite decades of study. Many disparities between observation and theory could be attributed to low connectivity of the intragranular pores. The presence of low connectivity indicates that a useful conceptual framework is percolation theory. The present study was initiated to develop a percolation-based finite difference (FD) model, and to test it rigorously against both random walk (RW) simulations of diffusion starting from nonequilibrium, and data on Borden sand published by Ball and Roberts (1991a,b) and subsequently reanalyzed by Haggerty and Gorelick (1995) using a multirate mass transfer (MRMT) approach. The percolation-theoretical model is simple and readily incorporated into existing FD models. The FD model closely matches the RW results using only a single fitting parameter, across a wide range of pore connectivities. Simulation of the Borden sand experiment without pore connectivity effects reproduced the MRMT analysis, but including low pore connectivity effects improved the fit. Overall, the theory and simulation results show that low intragranular pore connectivity can produce diffusive behavior that appears as if the solute had undergone slow sorption, despite the absence of any sorption process, thereby explaining some hitherto confusing aspects of intragranular diffusion.

  3. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  4. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  5. Adsorption and diffusion of hydrogen in Zircaloy-4

    International Nuclear Information System (INIS)

    Torres, E.; Desquines, J.; Baietto, M.C.; Coret, M.; Wehling, F.; Blat-Yrieix, M.; Ambard, A.

    2015-01-01

    Hydrogen in zirconium alloys is considered in many nuclear safety issues. Below 500 Celsius degrees, rather limited knowledge is available on the combined hydrogen adsorption at the sample surface and diffusion in the metal. A modeling of hydrogen gaseous charging has been established starting with a set of relevant laws and parameters derived from open literature. Simulating the hydrogen charging process requires simultaneous analysis of gaseous surface adsorption, hydrogen solid-solution diffusion and precipitation, when exceeding the material solubility limit. The modeling has been extended to reproduce the solid-gas exchange. Gaseous charging experiments have been performed at 420 C. degrees on Stress Relieved Annealed (SRA) Zircaloy-4 cladding samples to validate the model. The sample hydrogen content has been systematically measured after charging and compared to the calculated value thus providing a validation of the adsorption modeling. Complementary tests have been carried out on Recrystallized Annealed (RXA) Zircaloy-4 rods to characterize the combined diffusion and adsorption process. The hydrogen concentration distribution has been characterized using an inverse technique based on destructive analyses of the samples. This additional set of data was relevant for the validation of the hydrogen combined adsorption/diffusion modeling up to 420 C. degrees. (authors)

  6. Recent advances in modelling diffuse radiation

    Energy Technology Data Exchange (ETDEWEB)

    Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, Univ. of South Australia, Mawson Lakes, SA (Australia)

    2008-07-01

    Boland et al (2001) developed a validated model for Australian conditions, using a logistic function instead of piecewise linear or simple nonlinear functions. Recently, Jacovides et al (2006) have verified that this model performs well for locations in Cyprus. Their analysis includes using moving average techniques to demonstrate the form of the relationship, which corresponds well to a logistic relationship. We have made significant advances in both the intuitive and theoretical justification of the use of the logistic function. In the theoretical development of the model utilising advanced non-parametric statistical methods. We have also constructed a method of identifying values that are likely to be erroneous. Using quadratic programming, we can eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. Additionally, this is a first step in identifying the means for developing a generic model for estimating diffuse from global and other predictors (see Boland and Ridley 2007). Our more recent investigations focus on examining the effects of adding additional explanatory variables to enhance the predictability of the model. Examples for Australian and other locations will be presented. (orig.)

  7. Finite-elements modeling of radiant heat transfers between mobile surfaces; Modelisation par elements finis de transferts radiatifs entre surfaces mobiles

    Energy Technology Data Exchange (ETDEWEB)

    Daurelle, J V; Cadene, V; Occelli, R [Universite de Provence, 13 - Marseille (France)

    1997-12-31

    In the numerical modeling of thermal industrial problems, radiant heat transfers remain difficult to take into account and require important computer memory and long computing time. These difficulties are enhanced when radiant heat transfers are coupled with finite-elements diffusive heat transfers because finite-elements architecture is complex and requires a lot of memory. In the case of radiant heat transfers along mobile boundaries, the methods must be optimized. The model described in this paper concerns the radiant heat transfers between diffuse grey surfaces. These transfers are coupled with conduction transfers in the limits of the diffusive opaque domain. 2-D and 3-D geometries are analyzed and two configurations of mobile boundaries are considered. In the first configuration, the boundary follows the deformation of the mesh, while in the second, the boundary moves along the fixed mesh. Matter displacement is taken into account in the term of transport of the energy equation, and an appropriate variation of the thermophysical properties of the transition elements between the opaque and transparent media is used. After a description of the introduction of radiative limit conditions in a finite-elements thermal model, the original methods used to optimize calculation time are explained. Two examples of application illustrate the approach used. The first concerns the modeling of radiant heat transfers between fuel rods during a reactor cooling accident, and the second concerns the study of heat transfers inside the air-gap of an electric motor. The method of identification of the mobile surface on the fixed mesh is described. (J.S.) 12 refs.

  8. Finite-elements modeling of radiant heat transfers between mobile surfaces; Modelisation par elements finis de transferts radiatifs entre surfaces mobiles

    Energy Technology Data Exchange (ETDEWEB)

    Daurelle, J.V.; Cadene, V.; Occelli, R. [Universite de Provence, 13 - Marseille (France)

    1996-12-31

    In the numerical modeling of thermal industrial problems, radiant heat transfers remain difficult to take into account and require important computer memory and long computing time. These difficulties are enhanced when radiant heat transfers are coupled with finite-elements diffusive heat transfers because finite-elements architecture is complex and requires a lot of memory. In the case of radiant heat transfers along mobile boundaries, the methods must be optimized. The model described in this paper concerns the radiant heat transfers between diffuse grey surfaces. These transfers are coupled with conduction transfers in the limits of the diffusive opaque domain. 2-D and 3-D geometries are analyzed and two configurations of mobile boundaries are considered. In the first configuration, the boundary follows the deformation of the mesh, while in the second, the boundary moves along the fixed mesh. Matter displacement is taken into account in the term of transport of the energy equation, and an appropriate variation of the thermophysical properties of the transition elements between the opaque and transparent media is used. After a description of the introduction of radiative limit conditions in a finite-elements thermal model, the original methods used to optimize calculation time are explained. Two examples of application illustrate the approach used. The first concerns the modeling of radiant heat transfers between fuel rods during a reactor cooling accident, and the second concerns the study of heat transfers inside the air-gap of an electric motor. The method of identification of the mobile surface on the fixed mesh is described. (J.S.) 12 refs.

  9. Estimating the horizontal diffuse solar radiation over the Central Anatolia Region of Turkey

    International Nuclear Information System (INIS)

    Aras, Haydar; Balli, Ozgur; Hepbasli, Arif

    2006-01-01

    The main objective of the present study is to develop new hybrid models to predict the monthly average daily diffuse solar radiation on a horizontal surface over Turkey's Central Anatolia Region (CAR), which covers the 12 provinces (Afyon, Ankara, Cankiri, Corum, Eskisehir, Kayseri, Kirsehir, Konya, Nevsehir, Nigde, Sivas and Yozgat), as an example. The models proposed by many investigators to estimate the diffuse solar radiation were reviewed. Although the global solar radiation and sunshine duration have been measured by the Turkish State Meteorological Service (DMI) over all the country since 1964, the diffuse solar radiation has not been measured. The twelve new hybrid models for estimating the monthly average daily diffuse solar radiation on a horizontal surface in the CAR were validated, and thus, the most accurate model was selected for guiding future projects

  10. Stochastic diffusion models for substitutable technological innovations

    NARCIS (Netherlands)

    Wang, L.; Hu, B.; Yu, X.

    2004-01-01

    Based on the analysis of firms' stochastic adoption behaviour, this paper first points out the necessity to build more practical stochastic models. And then, stochastic evolutionary models are built for substitutable innovation diffusion system. Finally, through the computer simulation of the

  11. A strongly nonlinear reaction-diffusion model for a deterministic diffusive epidemic

    International Nuclear Information System (INIS)

    Kirane, M.; Kouachi, S.

    1992-10-01

    In the present paper the mathematical validity of a model on the spread of an infectious disease is proved. This model was proposed by Bailey. The mathematical validity is proved by means of a positivity, uniqueness and existence theorem. In spite of the apparent simplicity of the problem, the solution requires a delicate set of techniques. It seems very difficult to extend these techniques to a model in more than one dimension without imposing conditions on the diffusivities. (author). 7 refs

  12. Modeling Simple Driving Tasks with a One-Boundary Diffusion Model

    Science.gov (United States)

    Ratcliff, Roger; Strayer, David

    2014-01-01

    A one-boundary diffusion model was applied to the data from two experiments in which subjects were performing a simple simulated driving task. In the first experiment, the same subjects were tested on two driving tasks using a PC-based driving simulator and the psychomotor vigilance test (PVT). The diffusion model fit the response time (RT) distributions for each task and individual subject well. Model parameters were found to correlate across tasks which suggests common component processes were being tapped in the three tasks. The model was also fit to a distracted driving experiment of Cooper and Strayer (2008). Results showed that distraction altered performance by affecting the rate of evidence accumulation (drift rate) and/or increasing the boundary settings. This provides an interpretation of cognitive distraction whereby conversing on a cell phone diverts attention from the normal accumulation of information in the driving environment. PMID:24297620

  13. Radiative heat exchange between surfaces

    International Nuclear Information System (INIS)

    Yener, Y.; Yuncu, H.

    1987-01-01

    The geometrical features of radiative heat exchange between surfaces are discussed first by developing various radiation shape factor relations. The governing equations for enclosures with diffusely emitting and diffusely reflecting surfaces, as well as the equations for enclosures with gray surfaces having specular component of reflectivity are introduced next. Finally, a simplified model for enclosures with isothermal surfaces under the assumption of uniform radiosity over the surfaces is discussed, and various working relations for different conditions are presented

  14. Modelling of multicomponent diffusion in a two-phase oxide-metal corium pool by a diffuse interface method

    International Nuclear Information System (INIS)

    Cardon, Clement

    2016-01-01

    This Ph.D. topic is focused on the modelling of stratification kinetics for an oxide-metal corium pool (U-O-Zr-steel system) in terms of multicomponent and multiphase diffusion. This work is part of a larger research effort for the development of a detailed corium pool modelling based on a CFD approach for thermal hydraulics. The overall goal is to improve the understanding of the involved phenomena and obtain closure laws for integral macroscopic models. The phase-field method coupled with an energy functional using the CALPHAD method appears to be relevant for this purpose. In a first part, we have developed a diffuse interface model in order to describe the diffusion process in the U-O system. This model has been coupled with a CALPHAD thermodynamic database and its parameterization has been developed with, in particular, an up-scaling procedure related to the interface thickness. Then, within the framework of a modelling for the U-O-Zr ternary system, we have proposed a generalization of the diffuse interface model through an assumption of local equilibrium for redox mechanisms. A particular attention was paid to the model analysis by 1D numerical simulations with a special focus on the steady state composition profiles. Finally we have applied this model to the U-O-Zr-Fe system. For that purpose, we have considered a configuration close to small-scale experimental tests of oxide-metal corium pool stratification. (author) [fr

  15. Diffusion mechanisms of strontium, cesium and cobalt in compacted sodium bentonite

    International Nuclear Information System (INIS)

    Muurinen, A.; Rantanen, J.; Penttilae-Hiltunen, P.

    1986-01-01

    For a porous water-saturated material where diffusion in the porewater, sorption on the solid material and diffusion of the sorbed ions (surface diffusion) occur, a diffusion equation can be derived where the apparent diffusivity includes two terms. One represents diffusion in the pore-water, the other surface diffusion. In this research diffusion mechanisms were studied. The apparent diffusivities of strontium, cesium and cobalt in compacted sodium bentonite were measured by a non-steady state method. The sorption factors were adjusted using different sodium chloride solutions, groundwater and addition of EDTA for saturation of the bentonite samples. The corresponding sorption factors were measured by a batch method. The results suggest that cations diffuse also while being sorbed. A combined pore diffusion-surface diffusion model has been used to explain the transport and the corresponding diffusivities have been evaluated. The surface diffusivities (D/sub s/) of Sr and Cs were 8-9 x 10 -12 m 2 /s and 4-7 x 10 -13 m 2 /s respectively. The pore diffusivity epsilon D/sub p/ of Cs was 3.5 x 10 -11 m 2 /s which has been used also for Sr. The sorption mechanisms of Co seems to be different from that of Sr or Cs and the results allow no specific conclusions of the diffusion mechanisms of Co. The apparent diffusivity of Co ranged from 2 x 10 -14 to 7 x 10 -14 m 2 /s. The anionic Co-EDTA seems to follow some other diffusion mechanism than the cations

  16. Simulation study of temperature-dependent diffusion behaviors of Ag/Ag(001) at low substrate temperature

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Danyun; Mo, Yunjie [State Key Laboratory of Optoelectronic Materials and Technologies, School of Electronics and Information Technology, Sun Yat-sen University, Guangzhou, 510275 (China); Feng, Xiaofang [State Key Laboratory of Optoelectronic Materials and Technologies, School of Physics, Sun Yat-sen University, Guangzhou, 510275 (China); He, Yingyou [State Key Laboratory of Optoelectronic Materials and Technologies, School of Electronics and Information Technology, Sun Yat-sen University, Guangzhou, 510275 (China); Jiang, Shaoji, E-mail: stsjsj@mail.sysu.edu.cn [State Key Laboratory of Optoelectronic Materials and Technologies, School of Physics, Sun Yat-sen University, Guangzhou, 510275 (China)

    2017-06-01

    Highlights: • The model of combinations of nearest-neighbor atoms of adatom was built to calculate the diffusion barrier of every configuration for Ag/Ag(001). • The complete potential energy curve of a specific diffusion path on the surface was worked out with the help of elementary diffusion behaviors. • The non-monotonic relation between the surface roughness and the substrate temperature (decreasing from 300 K to 100 K) was demonstrated. • A theoretical explanation of diffusion mechanism for the non-monotonic variation of roughness at low substrate temperature was presented. - Abstract: In this study, a model based on the First Principles calculations and Kinetic Monte Carlo simulation were established to study the growth characteristic of Ag thin film at low substrate temperature. On the basis of the interaction between the adatom and nearest-neighbor atoms, some simplifications and assumptions were made to categorize the diffusion behaviors of Ag adatoms on Ag(001). Then the barriers of all possible diffusion behaviors were calculated using the Climbing Image Nudged Elastic Band method (CI-NEB). Based on the Arrhenius formula, the morphology variation, which is attributed to the surface diffusion behaviors during the growth, was simulated with a temperature-dependent KMC model. With this model, a non-monotonic relation between the surface roughness and the substrate temperature (decreasing from 300 K to 100 K) were discovered. The analysis of the temperature dependence on diffusion behaviors presents a theoretical explanation of diffusion mechanism for the non-monotonic variation of roughness at low substrate temperature.

  17. Simulation study of temperature-dependent diffusion behaviors of Ag/Ag(001) at low substrate temperature

    International Nuclear Information System (INIS)

    Cai, Danyun; Mo, Yunjie; Feng, Xiaofang; He, Yingyou; Jiang, Shaoji

    2017-01-01

    Highlights: • The model of combinations of nearest-neighbor atoms of adatom was built to calculate the diffusion barrier of every configuration for Ag/Ag(001). • The complete potential energy curve of a specific diffusion path on the surface was worked out with the help of elementary diffusion behaviors. • The non-monotonic relation between the surface roughness and the substrate temperature (decreasing from 300 K to 100 K) was demonstrated. • A theoretical explanation of diffusion mechanism for the non-monotonic variation of roughness at low substrate temperature was presented. - Abstract: In this study, a model based on the First Principles calculations and Kinetic Monte Carlo simulation were established to study the growth characteristic of Ag thin film at low substrate temperature. On the basis of the interaction between the adatom and nearest-neighbor atoms, some simplifications and assumptions were made to categorize the diffusion behaviors of Ag adatoms on Ag(001). Then the barriers of all possible diffusion behaviors were calculated using the Climbing Image Nudged Elastic Band method (CI-NEB). Based on the Arrhenius formula, the morphology variation, which is attributed to the surface diffusion behaviors during the growth, was simulated with a temperature-dependent KMC model. With this model, a non-monotonic relation between the surface roughness and the substrate temperature (decreasing from 300 K to 100 K) were discovered. The analysis of the temperature dependence on diffusion behaviors presents a theoretical explanation of diffusion mechanism for the non-monotonic variation of roughness at low substrate temperature.

  18. Computing diffuse fraction of global horizontal solar radiation: A model comparison.

    Science.gov (United States)

    Dervishi, Sokol; Mahdavi, Ardeshir

    2012-06-01

    For simulation-based prediction of buildings' energy use or expected gains from building-integrated solar energy systems, information on both direct and diffuse component of solar radiation is necessary. Available measured data are, however, typically restricted to global horizontal irradiance. There have been thus many efforts in the past to develop algorithms for the derivation of the diffuse fraction of solar irradiance. In this context, the present paper compares eight models for estimating diffuse fraction of irradiance based on a database of measured irradiance from Vienna, Austria. These models generally involve mathematical formulations with multiple coefficients whose values are typically valid for a specific location. Subsequent to a first comparison of these eight models, three better performing models were selected for a more detailed analysis. Thereby, the coefficients of the models were modified to account for Vienna data. The results suggest that some models can provide relatively reliable estimations of the diffuse fractions of the global irradiance. The calibration procedure could only slightly improve the models' performance.

  19. Modelling and simulation of diffusive processes methods and applications

    CERN Document Server

    Basu, SK

    2014-01-01

    This book addresses the key issues in the modeling and simulation of diffusive processes from a wide spectrum of different applications across a broad range of disciplines. Features: discusses diffusion and molecular transport in living cells and suspended sediment in open channels; examines the modeling of peristaltic transport of nanofluids, and isotachophoretic separation of ionic samples in microfluidics; reviews thermal characterization of non-homogeneous media and scale-dependent porous dispersion resulting from velocity fluctuations; describes the modeling of nitrogen fate and transport

  20. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  1. Integrating Models of Diffusion and Behavior to Predict Innovation Adoption, Maintenance, and Social Diffusion.

    Science.gov (United States)

    Smith, Rachel A; Kim, Youllee; Zhu, Xun; Doudou, Dimi Théodore; Sternberg, Eleanore D; Thomas, Matthew B

    2018-01-01

    This study documents an investigation into the adoption and diffusion of eave tubes, a novel mosquito vector control, during a large-scale scientific field trial in West Africa. The diffusion of innovations (DOI) and the integrated model of behavior (IMB) were integrated (i.e., innovation attributes with attitudes and social pressures with norms) to predict participants' (N = 329) diffusion intentions. The findings showed that positive attitudes about the innovation's attributes were a consistent positive predictor of diffusion intentions: adopting it, maintaining it, and talking with others about it. As expected by the DOI and the IMB, the social pressure created by a descriptive norm positively predicted intentions to adopt and maintain the innovation. Drawing upon sharing research, we argued that the descriptive norm may dampen future talk about the innovation, because it may no longer be seen as a novel, useful topic to discuss. As predicted, the results showed that as the descriptive norm increased, the intention to talk about the innovation decreased. These results provide broad support for integrating the DOI and the IMB to predict diffusion and for efforts to draw on other research to understand motivations for social diffusion.

  2. A Diffusion Model for Two-sided Service Systems

    Science.gov (United States)

    Homma, Koichi; Yano, Koujin; Funabashi, Motohisa

    A diffusion model is proposed for two-sided service systems. ‘Two-sided’ refers to the existence of an economic network effect between two different and interrelated groups, e.g., card holders and merchants in an electronic money service. The service benefit for a member of one side depends on the number and quality of the members on the other side. A mathematical model by J. H. Rohlfs explains the network (or bandwagon) effect of communications services. In Rohlfs' model, only the users' group exists and the model is one-sided. This paper extends Rohlfs' model to a two-sided model. We propose, first, a micro model that explains individual behavior in regard to service subscription of both sides and a computational method that drives the proposed model. Second, we develop macro models with two diffusion-rate variables by simplifying the micro model. As a case study, we apply the models to an electronic money service and discuss the simulation results and actual statistics.

  3. Experimental Methods and Development of Models on Diffusion of Nuclides onto Rocks

    International Nuclear Information System (INIS)

    Park, Chung-Kyun; Lee, Jae-Kwang; Baik, Min-Hoon

    2007-01-01

    In the context of nuclear waste repositories, the rock matrix can act as a barrier against radionuclide migration and matrix diffusion can be an important mechanism for delaying the arrival times to the biosphere. It takes a growing interest whether matrix diffusion is an important retarding and dispersing transport mechanism for solutes carried by groundwater in fractured porous media. It can retard solutes by spreading them from the flowing groundwater into the diluting reservoir of the interconnected pore space of the rock matrix, and providing an increased surface for sorption processes. Diffusion experiments has been carried in crystalline rocks to determine the diffusivities of some radionuclides either by through-diffusion cells or in-diffusion setups. We'd like to compare the experimental methods and their functions according to sorption properties of species

  4. A novel model of photothermal diffusion (PTD) for polymer nano-composite semiconducting of thin circular plate

    Science.gov (United States)

    Lotfy, Kh.

    2018-05-01

    In this article, theoretical discussions for a novel mathematical-physical Photothermal diffusion (PTD) model in the generalized thermoelasticity theory with photothermal processes and chemical action are introduced. The mean idea of this model depends on the interaction between quasi-particles (plasma waves) that depends on the kind of the used materials, the mechanical forces acting on the surface, the generalized thermo and mass diffusion (due to coupling of temperature fields with thermal waves and chemical potential) and the elastic waves. The one dimensional Laplace transforms is used to obtain the exact solution for some physical and chemical quantities for a thin circular plate of a semiconducting polymer nanocomposite such as silicon (Si). New variables are deduced and discussed. The obtained results of the physical quantities are presented analytically and illustrated graphically with some important applications.

  5. Accelerated diffusion controlled creep of polycrystalline materials. Communication 1. Model of diffusion controlled creep acceleration

    International Nuclear Information System (INIS)

    Smirnova, E.S.; Chuvil'deev, V.N.

    1998-01-01

    The model is suggested which describes the influence of large-angle grain boundary migration on a diffusion controlled creep rate in polycrystalline materials (Coble creep). The model is based on the concept about changing the value of migrating boundary free volume when introducing dislocations distributed over the grain bulk into this boundary. Expressions are obtained to calculate the grain boundary diffusion coefficient under conditions of boundary migration and the parameter, which characterized the value of Coble creep acceleration. A comparison is made between calculated and experimental data for Cd, Co and Fe

  6. Random variability in mesoscale wind observations and implications for diffusion models

    Energy Technology Data Exchange (ETDEWEB)

    Hanna, S.R. [Sigma Research Corp., Concord, MA (United States)

    1994-12-31

    The investigation reported in this paper grew out of a preliminary analysis of methods by which regional air quality models such as the Regional Oxidant Model account for horizontal transport and diffusion. It was discovered that there is a variety of often inconsistent methods used to parameterize horizontal diffusion at meso- and regional scales, and the time seemed ripe to review and compare and contrast these schemes. This paper provides a brief overview of the major issues that were uncovered and lists a few specific examples of the technical approaches that are used. Subsequent sections cover the basic physics of horizontal diffusion, the characteristics of observed wind fields, and methods of parameterizing horizontal diffusion in air quality models.

  7. The development of radioactivity diffusion model in global ocean

    International Nuclear Information System (INIS)

    Nakano, M.; Watanabe, H.; Katagiri, H.

    2000-01-01

    The radioactivity diffusion model in global ocean has been developing in order to assess the long-term behavior of radioactive materials for discharge from nuclear facility. The model system consists of two parts. One is to calculate current velocity; and the other is for particle chasing. Both systems are executed by Macintosh personal computer. A lot of techniques to estimate ocean current velocity were investigated in geophysical field. The robust diagnosis model advocated by Sarmiento and Bryan was applied to build the numerical calculation system for getting the current velocity field in global scale. The latitudinal and longitudinal lattices were 2 degrees each and the number of vertical layer was 15. The movement of radioactive materials by current and diffusion were calculated using the particle chasing system. The above-mentioned current velocity field and the initial particle positions at will were read by the system. The movement of a particle was calculated using the interpolated current data step by step. The diffusion of a particle was calculated by random walk method. The model was verified by using the fallout data from atmospheric nuclear test. Yearly and latitudinal fallout data was adopted from UNSCEAR1977. The calculation result was compared with the observation data that includes total amount and vertical profile of Cs-137 and Pu-239,240 in the North Pacific Ocean. The result of the verification was agreed with the following general knowledge. Though the fallout amount between 40N and 50N was the biggest in the world, the amount in the seawater between 40N and 50N was smaller than that in south of 40N because of horizontal transportation, which carried water from north to south. As for vertical profile, Cs-137 could be accurately calculated except the surface layer. However the observation peak of Pu-239,240 existed deeper than the calculation peak. This model could calculate the vertical profile of Cs-137 because most of Cs exists as dissolved

  8. Investigation into diffusion induced plastic deformation behavior in hollow lithium ion battery electrode revealed by analytical model and atomistic simulation

    International Nuclear Information System (INIS)

    Li, Jia; Fang, Qihong; Wu, Hong; Liu, Youwen; Wen, Pihua

    2015-01-01

    Highlights: • Diffusion induced stress is established. • Yield stress is dependent upon concentration. • Plastic deformation induced stress lowers tensile stress. • Plastic deformation suppresses crack nucleation. • Plastic deformation occurs not only at lithiated phase but also at electrode interior. - Abstract: This paper is theoretically suggested to describe diffusion induced stress in the elastoplastic hollow spherical silicon electrode for plastic deformation using both analytical model and molecular simulation. Based on the plastic deformation and the yield criterion, we develop this model accounting for the lithium-ion diffusion effect in hollow electrode, focusing on the concentration and stress distributions undergoing lithium-ion insertion. The results show that the two ways, applied compressive stress to inner surface or limited inner surface with higher concentration using biological membranes maintaining concentration difference, lead to the compressive stress induced by the lithium-ion diffusion effect. Hollow spherical electrode reduces effectively diffusion induced stress through controlling and tuning electrode parameters to obtain the reasonably low yield strength. According to MD simulations, plastic deformation phenomenon not only occurs at interface layer of lithiated phase, but also penetrates at electrode interior owning to confinement imposed by lithiated phase. These criteria that radial and hoop stresses reduce dramatically when plastic deformation occurs near the end faces of hollow electrode, may help guide development of new materials for lithium-ion batteries with enhanced mechanical durability, by means of reasonable designing yield strength to maintain mechanical stress below fracture strength, thereby increasing battery life.

  9. Dense-gas dispersion advection-diffusion model

    International Nuclear Information System (INIS)

    Ermak, D.L.

    1992-07-01

    A dense-gas version of the ADPIC particle-in-cell, advection- diffusion model was developed to simulate the atmospheric dispersion of denser-than-air releases. In developing the model, it was assumed that the dense-gas effects could be described in terms of the vertically-averaged thermodynamic properties and the local height of the cloud. The dense-gas effects were treated as a perturbation to the ambient thermodynamic properties (density and temperature), ground level heat flux, turbulence level (diffusivity), and windfield (gravity flow) within the local region of the dense-gas cloud. These perturbations were calculated from conservation of energy and conservation of momentum principles along with the ideal gas law equation of state for a mixture of gases. ADPIC, which is generally run in conjunction with a mass-conserving wind flow model to provide the advection field, contains all the dense-gas modifications within it. This feature provides the versatility of coupling the new dense-gas ADPIC with alternative wind flow models. The new dense-gas ADPIC has been used to simulate the atmospheric dispersion of ground-level, colder-than-ambient, denser-than-air releases and has compared favorably with the results of field-scale experiments

  10. Modelling uncertainties in the diffusion-advection equation for radon transport in soil using interval arithmetic.

    Science.gov (United States)

    Chakraverty, S; Sahoo, B K; Rao, T D; Karunakar, P; Sapra, B K

    2018-02-01

    Modelling radon transport in the earth crust is a useful tool to investigate the changes in the geo-physical processes prior to earthquake event. Radon transport is modeled generally through the deterministic advection-diffusion equation. However, in order to determine the magnitudes of parameters governing these processes from experimental measurements, it is necessary to investigate the role of uncertainties in these parameters. Present paper investigates this aspect by combining the concept of interval uncertainties in transport parameters such as soil diffusivity, advection velocity etc, occurring in the radon transport equation as applied to soil matrix. The predictions made with interval arithmetic have been compared and discussed with the results of classical deterministic model. The practical applicability of the model is demonstrated through a case study involving radon flux measurements at the soil surface with an accumulator deployed in steady-state mode. It is possible to detect the presence of very low levels of advection processes by applying uncertainty bounds on the variations in the observed concentration data in the accumulator. The results are further discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. An extended fractal growth regime in the diffusion limited aggregation including edge diffusion

    Directory of Open Access Journals (Sweden)

    Aritra Ghosh

    2016-01-01

    Full Text Available We have investigated on-lattice diffusion limited aggregation (DLA involving edge diffusion and compared the results with the standard DLA model. For both cases, we observe the existence of a crossover from the fractal to the compact regime as a function of sticking coefficient. However, our modified DLA model including edge diffusion shows an extended fractal growth regime like an earlier theoretical result using realistic growth models and physical parameters [Zhang et al., Phys. Rev. Lett. 73 (1994 1829]. While the results of Zhang et al. showed the existence of the extended fractal growth regime only on triangular but not on square lattices, we find its existence on the square lattice. There is experimental evidence of this growth regime on a square lattice. The standard DLA model cannot characterize fractal morphology as the fractal dimension (Hausdorff dimension, DH is insensitive to morphology. It also predicts DH = DP (the perimeter dimension. For the usual fractal structures, observed in growth experiments on surfaces, the perimeter dimension can differ significantly (DH ≠ DP depending on the morphology. Our modified DLA model shows minor sensitivity to this difference.

  12. A DOUBLE-RING ALGORITHM FOR MODELING SOLAR ACTIVE REGIONS: UNIFYING KINEMATIC DYNAMO MODELS AND SURFACE FLUX-TRANSPORT SIMULATIONS

    International Nuclear Information System (INIS)

    Munoz-Jaramillo, Andres; Martens, Petrus C. H.; Nandy, Dibyendu; Yeates, Anthony R.

    2010-01-01

    The emergence of tilted bipolar active regions (ARs) and the dispersal of their flux, mediated via processes such as diffusion, differential rotation, and meridional circulation, is believed to be responsible for the reversal of the Sun's polar field. This process (commonly known as the Babcock-Leighton mechanism) is usually modeled as a near-surface, spatially distributed α-effect in kinematic mean-field dynamo models. However, this formulation leads to a relationship between polar field strength and meridional flow speed which is opposite to that suggested by physical insight and predicted by surface flux-transport simulations. With this in mind, we present an improved double-ring algorithm for modeling the Babcock-Leighton mechanism based on AR eruption, within the framework of an axisymmetric dynamo model. Using surface flux-transport simulations, we first show that an axisymmetric formulation-which is usually invoked in kinematic dynamo models-can reasonably approximate the surface flux dynamics. Finally, we demonstrate that our treatment of the Babcock-Leighton mechanism through double-ring eruption leads to an inverse relationship between polar field strength and meridional flow speed as expected, reconciling the discrepancy between surface flux-transport simulations and kinematic dynamo models.

  13. An innovation diffusion model for new mobile technologies acceptance

    Directory of Open Access Journals (Sweden)

    Barkoczia Nadi

    2017-01-01

    Full Text Available This paper aims to approach the diffusion model developed in 1960 by Frank Bass has been utilized to study the distribution of different types of new products and services. The Bass Model helps by describing the process in which new products are adopted in a market. This model is a useful tool for predicting the first purchase of an innovative product for which there are competing alternatives on the market. It also provides the innovator with information regarding the size of customers and the adoption time for the product. The second part of the paper is dedicated to a monographic study of specific conceptual correlations between the diffusion of technology and marketing management that emphasizes technological uncertainty and market uncertainty as major risks to innovative projects. In the final section, the results of empirical research conducted in Baia-Mare, Romania will be presented in a way that uses diffusion Bass model to estimate the adoption period for new mobile technologies.

  14. Design Method for Channel Diffusers of Centrifugal Compressors

    Directory of Open Access Journals (Sweden)

    Mykola Kalinkevych

    2013-01-01

    Full Text Available The design method for channel diffusers of centrifugal compressors, which is based on the solving of the inverse problem of gas dynamics, is presented in the paper. The concept of the design is to provide high pressure recovery of the diffuser by assuming the preseparation condition of the boundary layer along one of the channel surfaces. The channel diffuser was designed with the use of developed method to replace the vaned diffuser of the centrifugal compressor model stage. The numerical simulation of the diffusers was implemented by means of CFD software. Obtained gas dynamic characteristics of the designed diffuser were compared to the base vaned diffuser of the compressor stage.

  15. Surface migration in sorption processes

    International Nuclear Information System (INIS)

    Rasmuson, A.; Neretnieks, J.

    1983-03-01

    Diffusion rates of sorbing chemical species in granites and clays are in several experiments within the KBS study, higher than can be explained by pore diffusion only. One possible additional transport mechanism is transport of of sorbed molecules/ions along the intrapore surfaces. As a first step a literature investigation on on solid surfaces has been conducted. A lot of experimental evidence of the mobility of the sorbed molecules has been gathered through the years, particulary for metal surfaces and chemical engineering systems. For clays however, there are only a few articles, and for granites none. Two types of surface migration models have been proposed in the litterature: i) Surface flow as a result of a gradient in spreading pressure. ii) Surface diffusion as a result of a gradient in concentration. The surface flow model has only been applied to gaseous systems. However, it should be equally applicable to liquid systems. The models i) and ii) are conceptually very different. However, the resulting expressions for surface flux are complicated and it will not be an easy task to distinguish between them. There seem to be three ways of discriminating between the transport mechanisms: a) Temperature dependence. b) Concentration dependence. c) Order of magnitude. (Forf)

  16. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  17. MODEL OF THE TOKAMAK EDGE DENSITY PEDESTAL INCLUDING DIFFUSIVE NEUTRALS

    International Nuclear Information System (INIS)

    BURRELL, K.H.

    2003-01-01

    OAK-B135 Several previous analytic models of the tokamak edge density pedestal have been based on diffusive transport of plasma plus free-streaming of neutrals. This latter neutral model includes only the effect of ionization and neglects charge exchange. The present work models the edge density pedestal using diffusive transport for both the plasma and the neutrals. In contrast to the free-streaming model, a diffusion model for the neutrals includes the effect of both charge exchange and ionization and is valid when charge exchange is the dominant interaction. Surprisingly, the functional forms for the electron and neutral density profiles from the present calculation are identical to the results of the previous analytic models. There are some differences in the detailed definition of various parameters in the solution. For experimentally relevant cases where ionization and charge exchange rate are comparable, both models predict approximately the same width for the edge density pedestal

  18. Fractional Heat Conduction Models and Thermal Diffusivity Determination

    Directory of Open Access Journals (Sweden)

    Monika Žecová

    2015-01-01

    Full Text Available The contribution deals with the fractional heat conduction models and their use for determining thermal diffusivity. A brief historical overview of the authors who have dealt with the heat conduction equation is described in the introduction of the paper. The one-dimensional heat conduction models with using integer- and fractional-order derivatives are listed. Analytical and numerical methods of solution of the heat conduction models with using integer- and fractional-order derivatives are described. Individual methods have been implemented in MATLAB and the examples of simulations are listed. The proposal and experimental verification of the methods for determining thermal diffusivity using half-order derivative of temperature by time are listed at the conclusion of the paper.

  19. Modelling of composition and stress profiles in low temperature surface engineered stainless steel

    DEFF Research Database (Denmark)

    Jespersen, Freja Nygaard; Hattel, Jesper Henri; Somers, Marcel A. J.

    2015-01-01

    temperature, time and gas composition is a prerequisite for targeted process optimization. A realistic model to simulate the developing case has to take the following influences on composition and stress into account: - a concentration dependent diffusion coefficient - trapping of nitrogen by chromium atoms...... stresses are introduced in the developing case, arising from the volume expansion that accompanies the dissolution of high interstitial contents in expanded austenite. Modelling of the composition and stress profiles developing during low temperature surface engineering from the processing parameters...... - the effect of residual stress on diffusive flux - the effect of residual stress on solubility of interstitials - plastic accommodation of residual stress. The effect of all these contributions on composition and stress profiles will be addressed....

  20. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  1. Liver fibrosis: stretched exponential model outperforms mono-exponential and bi-exponential models of diffusion-weighted MRI.

    Science.gov (United States)

    Seo, Nieun; Chung, Yong Eun; Park, Yung Nyun; Kim, Eunju; Hwang, Jinwoo; Kim, Myeong-Jin

    2018-07-01

    To compare the ability of diffusion-weighted imaging (DWI) parameters acquired from three different models for the diagnosis of hepatic fibrosis (HF). Ninety-five patients underwent DWI using nine b values at 3 T magnetic resonance. The hepatic apparent diffusion coefficient (ADC) from a mono-exponential model, the true diffusion coefficient (D t ), pseudo-diffusion coefficient (D p ) and perfusion fraction (f) from a biexponential model, and the distributed diffusion coefficient (DDC) and intravoxel heterogeneity index (α) from a stretched exponential model were compared with the pathological HF stage. For the stretched exponential model, parameters were also obtained using a dataset of six b values (DDC # , α # ). The diagnostic performances of the parameters for HF staging were evaluated with Obuchowski measures and receiver operating characteristics (ROC) analysis. The measurement variability of DWI parameters was evaluated using the coefficient of variation (CoV). Diagnostic accuracy for HF staging was highest for DDC # (Obuchowski measures, 0.770 ± 0.03), and it was significantly higher than that of ADC (0.597 ± 0.05, p bi-exponential DWI model • Acquisition of six b values is sufficient to obtain accurate DDC and α.

  2. The modeling method of diffusion of radio activated materials in clay waste disposals

    International Nuclear Information System (INIS)

    Saberi, Reza; Sepanloo, Kamran; Alinejad, Majid; Mozaffari, Ali

    2017-01-01

    New nuclear power plants are necessary to meet today's and future challenges of energy supply. Nuclear power is the only large-scale energy source that takes full responsibility for all its wastes. Nuclear wastes are particularly hazardous and hard to manage relative to different toxic industrial wastes. Three methods are presented and analysed to model the diffusion of the waste from the waste disposal to the bottom surface. For this purpose three software programmes such as ABAQUS, Matlab coding, Geostudio and ArcGIS have been applied.

  3. Surface Complexation Modeling in Variable Charge Soils: Charge Characterization by Potentiometric Titration

    Directory of Open Access Journals (Sweden)

    Giuliano Marchi

    2015-10-01

    Full Text Available ABSTRACT Intrinsic equilibrium constants of 17 representative Brazilian Oxisols were estimated from potentiometric titration measuring the adsorption of H+ and OH− on amphoteric surfaces in suspensions of varying ionic strength. Equilibrium constants were fitted to two surface complexation models: diffuse layer and constant capacitance. The former was fitted by calculating total site concentration from curve fitting estimates and pH-extrapolation of the intrinsic equilibrium constants to the PZNPC (hand calculation, considering one and two reactive sites, and by the FITEQL software. The latter was fitted only by FITEQL, with one reactive site. Soil chemical and physical properties were correlated to the intrinsic equilibrium constants. Both surface complexation models satisfactorily fit our experimental data, but for results at low ionic strength, optimization did not converge in FITEQL. Data were incorporated in Visual MINTEQ and they provide a modeling system that can predict protonation-dissociation reactions in the soil surface under changing environmental conditions.

  4. Technological diffusion in the Ramsey model

    Czech Academy of Sciences Publication Activity Database

    Duczynski, Petr

    2002-01-01

    Roč. 1, č. 3 (2002), s. 243-250 ISSN 1607-0704 Institutional research plan: CEZ:AV0Z7085904 Keywords : neoclassical growth model * technological diffusion Subject RIV: AH - Economics http://www.ijbe.org/table%20of%20content/pdf/vol1-3/06.pdf

  5. A mathematical model in charactering chloride diffusivity in unsaturated cementitious material

    NARCIS (Netherlands)

    Zhang, Y.; Ye, G.; Pecur, I.B.; Baricevic, A.; Stirmer, N; Bjegovic, D.

    2017-01-01

    In this paper, a new analytic model for predicting chloride diffusivity in unsaturated cementitious materials is developed based on conductivity theory and Nernst-Einstein equation. The model specifies that chloride diffusivity in unsaturated cementitious materials can be mathematically described as

  6. Realistic multisite lattice-gas modeling and KMC simulation of catalytic surface reactions: Kinetics and multiscale spatial behavior for CO-oxidation on metal (1 0 0) surfaces

    Science.gov (United States)

    Liu, Da-Jiang; Evans, James W.

    2013-12-01

    A realistic molecular-level description of catalytic reactions on single-crystal metal surfaces can be provided by stochastic multisite lattice-gas (msLG) models. This approach has general applicability, although in this report, we will focus on the example of CO-oxidation on the unreconstructed fcc metal (1 0 0) or M(1 0 0) surfaces of common catalyst metals M = Pd, Rh, Pt and Ir (i.e., avoiding regimes where Pt and Ir reconstruct). These models can capture the thermodynamics and kinetics of adsorbed layers for the individual reactants species, such as CO/M(1 0 0) and O/M(1 0 0), as well as the interaction and reaction between different reactant species in mixed adlayers, such as (CO + O)/M(1 0 0). The msLG models allow population of any of hollow, bridge, and top sites. This enables a more flexible and realistic description of adsorption and adlayer ordering, as well as of reaction configurations and configuration-dependent barriers. Adspecies adsorption and interaction energies, as well as barriers for various processes, constitute key model input. The choice of these energies is guided by experimental observations, as well as by extensive Density Functional Theory analysis. Model behavior is assessed via Kinetic Monte Carlo (KMC) simulation. We also address the simulation challenges and theoretical ramifications associated with very rapid diffusion and local equilibration of reactant adspecies such as CO. These msLG models are applied to describe adsorption, ordering, and temperature programmed desorption (TPD) for individual CO/M(1 0 0) and O/M(1 0 0) reactant adlayers. In addition, they are also applied to predict mixed (CO + O)/M(1 0 0) adlayer structure on the nanoscale, the complete bifurcation diagram for reactive steady-states under continuous flow conditions, temperature programmed reaction (TPR) spectra, and titration reactions for the CO-oxidation reaction. Extensive and reasonably successful comparison of model predictions is made with experimental

  7. Diffusion Influenced Adsorption Kinetics.

    Science.gov (United States)

    Miura, Toshiaki; Seki, Kazuhiko

    2015-08-27

    When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

  8. Information diffusion, Facebook clusters, and the simplicial model of social aggregation: a computational simulation of simplicial diffusers for community health interventions.

    Science.gov (United States)

    Kee, Kerk F; Sparks, Lisa; Struppa, Daniele C; Mannucci, Mirco A; Damiano, Alberto

    2016-01-01

    By integrating the simplicial model of social aggregation with existing research on opinion leadership and diffusion networks, this article introduces the constructs of simplicial diffusers (mathematically defined as nodes embedded in simplexes; a simplex is a socially bonded cluster) and simplicial diffusing sets (mathematically defined as minimal covers of a simplicial complex; a simplicial complex is a social aggregation in which socially bonded clusters are embedded) to propose a strategic approach for information diffusion of cancer screenings as a health intervention on Facebook for community cancer prevention and control. This approach is novel in its incorporation of interpersonally bonded clusters, culturally distinct subgroups, and different united social entities that coexist within a larger community into a computational simulation to select sets of simplicial diffusers with the highest degree of information diffusion for health intervention dissemination. The unique contributions of the article also include seven propositions and five algorithmic steps for computationally modeling the simplicial model with Facebook data.

  9. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  10. Modelling of diffusion from equilibrium diffraction fluctuations in ordered phases

    International Nuclear Information System (INIS)

    Arapaki, E.; Argyrakis, P.; Tringides, M.C.

    2008-01-01

    Measurements of the collective diffusion coefficient D c at equilibrium are difficult because they are based on monitoring low amplitude concentration fluctuations generated spontaneously, that are difficult to measure experimentally. A new experimental method has been recently used to measure time-dependent correlation functions from the diffraction intensity fluctuations and was applied to measure thermal step fluctuations. The method has not been applied yet to measure superstructure intensity fluctuations in surface overlayers and to extract D c . With Monte Carlo simulations we study equilibrium fluctuations in Ising lattice gas models with nearest neighbor attractive and repulsive interactions. The extracted diffusion coefficients are compared to the ones obtained from equilibrium methods. The new results are in good agreement with the results from the other methods, i.e., D c decreases monotonically with coverage Θ for attractive interactions and increases monotonically with Θ for repulsive interactions. Even the absolute value of D c agrees well with the results obtained with the probe area method. These results confirm that this diffraction based method is a novel, reliable way to measure D c especially within the ordered region of the phase diagram when the superstructure spot has large intensity

  11. On Diffusive Climatological Models.

    Science.gov (United States)

    Griffel, D. H.; Drazin, P. G.

    1981-11-01

    A simple, zonally and annually averaged, energy-balance climatological model with diffusive heat transport and nonlinear albedo feedback is solved numerically. Some parameters of the model are varied, one by one, to find the resultant effects on the steady solution representing the climate. In particular, the outward radiation flux, the insulation distribution and the albedo parameterization are varied. We have found an accurate yet simple analytic expression for the mean annual insolation as a function of latitude and the obliquity of the Earth's rotation axis; this has enabled us to consider the effects of the oscillation of the obliquity. We have used a continuous albedo function which fits the observed values; it considerably reduces the sensitivity of the model. Climatic cycles, calculated by solving the time-dependent equation when parameters change slowly and periodically, are compared qualitatively with paleoclimatic records.

  12. Spin-diffusions and diffusive molecular dynamics

    Science.gov (United States)

    Farmer, Brittan; Luskin, Mitchell; Plecháč, Petr; Simpson, Gideon

    2017-12-01

    Metastable configurations in condensed matter typically fluctuate about local energy minima at the femtosecond time scale before transitioning between local minima after nanoseconds or microseconds. This vast scale separation limits the applicability of classical molecular dynamics (MD) methods and has spurned the development of a host of approximate algorithms. One recently proposed method is diffusive MD which aims at integrating a system of ordinary differential equations describing the likelihood of occupancy by one of two species, in the case of a binary alloy, while quasistatically evolving the locations of the atoms. While diffusive MD has shown itself to be efficient and provide agreement with observations, it is fundamentally a model, with unclear connections to classical MD. In this work, we formulate a spin-diffusion stochastic process and show how it can be connected to diffusive MD. The spin-diffusion model couples a classical overdamped Langevin equation to a kinetic Monte Carlo model for exchange amongst the species of a binary alloy. Under suitable assumptions and approximations, spin-diffusion can be shown to lead to diffusive MD type models. The key assumptions and approximations include a well-defined time scale separation, a choice of spin-exchange rates, a low temperature approximation, and a mean field type approximation. We derive several models from different assumptions and show their relationship to diffusive MD. Differences and similarities amongst the models are explored in a simple test problem.

  13. Modeling the oxygen diffusion of nanocomposite-based food packaging films.

    Science.gov (United States)

    Bhunia, Kanishka; Dhawan, Sumeet; Sablani, Shyam S

    2012-07-01

    Polymer-layered silicate nanocomposites have been shown to improve the gas barrier properties of food packaging polymers. This study developed a computer simulation model using the commercial software, COMSOL Multiphysics to analyze changes in oxygen barrier properties in terms of relative diffusivity, as influenced by configuration and structural parameters that include volume fraction (φ), aspect ratio (α), intercalation width (W), and orientation angle (θ) of nanoparticles. The simulation was performed at different φ (1%, 3%, 5%, and 7%), α (50, 100, 500, and 1000), and W (1, 3, 5, and 7 nm). The θ value was varied from 0° to 85°. Results show that diffusivity decreases with increasing volume fraction, but beyond φ = 5% and α = 500, diffusivity remained almost constant at W values of 1 and 3 nm. Higher relative diffusivity coincided with increasing W and decreasing α value for the same volume fraction of nanoparticles. Diffusivity increased as the rotational angle increased, gradually diminishing the influence of nanoparticles. Diffusivity increased drastically as θ changed from 15° to 30° (relative increment in relative diffusivity was almost 3.5 times). Nanoparticles with exfoliation configuration exhibited better oxygen barrier properties compared to intercalation. The finite element model developed in this study provides insight into oxygen barrier properties for nanocomposite with a wide range of structural parameters. This model can be used to design and manufacture an ideal nanocomposite-based food packaging film with improved gas barrier properties for industrial applications. The model will assist in designing nanocomposite polymeric structures of desired gas barrier properties for food packaging applications. In addition, this study will be helpful in formulating a combination of nanoparticle structural parameters for designing nanocomposite membranes with selective permeability for the industrial applications including membrane

  14. When mechanism matters: Bayesian forecasting using models of ecological diffusion

    Science.gov (United States)

    Hefley, Trevor J.; Hooten, Mevin B.; Russell, Robin E.; Walsh, Daniel P.; Powell, James A.

    2017-01-01

    Ecological diffusion is a theory that can be used to understand and forecast spatio-temporal processes such as dispersal, invasion, and the spread of disease. Hierarchical Bayesian modelling provides a framework to make statistical inference and probabilistic forecasts, using mechanistic ecological models. To illustrate, we show how hierarchical Bayesian models of ecological diffusion can be implemented for large data sets that are distributed densely across space and time. The hierarchical Bayesian approach is used to understand and forecast the growth and geographic spread in the prevalence of chronic wasting disease in white-tailed deer (Odocoileus virginianus). We compare statistical inference and forecasts from our hierarchical Bayesian model to phenomenological regression-based methods that are commonly used to analyse spatial occurrence data. The mechanistic statistical model based on ecological diffusion led to important ecological insights, obviated a commonly ignored type of collinearity, and was the most accurate method for forecasting.

  15. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  16. Diffusion time scales and accretion in the sun

    International Nuclear Information System (INIS)

    Michaud, G.

    1977-01-01

    It is thought that surface abundances in the Sun could be due largely to accretion either of comets or grains, and it has been suggested that if surface convection zones were smaller than is usually indicated by model calculations, accretion would be especially important. Unless the zone immediately below the surface convection zone is sufficiently stable for diffusion to be important, other transport processes, such as turbulence and meridional circulation, more efficient than diffusion, will tend to homogenise the Sun. Diffusion is the slowest of the transport processes and will become important when other transport processes become inoperative. Using diffusion theory the minimum mass of the convection zone can be determined in order that transport processes at the bottom of the zone are not to influence abundances in the convection zone. If diffusion time scales are shorter than the life of the star (Sun) diffusion will modify the abundances in the convection zone. The mass in the convection zone for which diffusion time scales are equal to the life of the star on the main sequence then determines the minimum mass in the convection zone that justifies neglect of transport processes at the bottom of the convection zone. It is calculated here that, for the Sun, this mass is between 3 x 10 -3 and 10 -2 solar mass, and a general explosion is derived for the diffusion time scale as a function of the mass of the convection zone. (U.K.)

  17. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  18. Prediction Of Abrasive And Diffusive Tool Wear Mechanisms In Machining

    Science.gov (United States)

    Rizzuti, S.; Umbrello, D.

    2011-01-01

    Tool wear prediction is regarded as very important task in order to maximize tool performance, minimize cutting costs and improve the quality of workpiece in cutting. In this research work, an experimental campaign was carried out at the varying of cutting conditions with the aim to measure both crater and flank tool wear, during machining of an AISI 1045 with an uncoated carbide tool P40. Parallel a FEM-based analysis was developed in order to study the tool wear mechanisms, taking also into account the influence of the cutting conditions and the temperature reached on the tool surfaces. The results show that, when the temperature of the tool rake surface is lower than the activation temperature of the diffusive phenomenon, the wear rate can be estimated applying an abrasive model. In contrast, in the tool area where the temperature is higher than the diffusive activation temperature, the wear rate can be evaluated applying a diffusive model. Finally, for a temperature ranges within the above cited values an adopted abrasive-diffusive wear model furnished the possibility to correctly evaluate the tool wear phenomena.

  19. Modeling information diffusion in time-varying community networks

    Science.gov (United States)

    Cui, Xuelian; Zhao, Narisa

    2017-12-01

    Social networks are rarely static, and they typically have time-varying network topologies. A great number of studies have modeled temporal networks and explored social contagion processes within these models; however, few of these studies have considered community structure variations. In this paper, we present a study of how the time-varying property of a modular structure influences the information dissemination. First, we propose a continuous-time Markov model of information diffusion where two parameters, mobility rate and community attractiveness, are introduced to address the time-varying nature of the community structure. The basic reproduction number is derived, and the accuracy of this model is evaluated by comparing the simulation and theoretical results. Furthermore, numerical results illustrate that generally both the mobility rate and community attractiveness significantly promote the information diffusion process, especially in the initial outbreak stage. Moreover, the strength of this promotion effect is much stronger when the modularity is higher. Counterintuitively, it is found that when all communities have the same attractiveness, social mobility no longer accelerates the diffusion process. In addition, we show that the local spreading in the advantage group has been greatly enhanced due to the agglomeration effect caused by the social mobility and community attractiveness difference, which thus increases the global spreading.

  20. Diffusion theory model for optimization calculations of cold neutron sources

    International Nuclear Information System (INIS)

    Azmy, Y.Y.

    1987-01-01

    Cold neutron sources are becoming increasingly important and common experimental facilities made available at many research reactors around the world due to the high utility of cold neutrons in scattering experiments. The authors describe a simple two-group diffusion model of an infinite slab LD 2 cold source. The simplicity of the model permits to obtain an analytical solution from which one can deduce the reason for the optimum thickness based solely on diffusion-type phenomena. Also, a second more sophisticated model is described and the results compared to a deterministic transport calculation. The good (particularly qualitative) agreement between the results suggests that diffusion theory methods can be used in parametric and optimization studies to avoid the generally more expensive transport calculations

  1. MHD diffuser model test program

    Energy Technology Data Exchange (ETDEWEB)

    Idzorek, J J

    1976-07-01

    Experimental results of the aerodynamic performance of seven candidate diffusers are presented to assist in determining their suitability for joining an MHD channel to a steam generator at minimum spacing. The three dimensional diffusers varied in area ratio from 2 to 3.8 and wall half angle from 2 to 5 degrees. The program consisted of five phases: (1) tailoring a diffuser inlet nozzle to a 15 percent blockage; (2) comparison of isolated diffusers at enthalpy ratios 0.5 to 1.0 with respect to separation characteristics and pressure recovery coefficients; (3) recording the optimum diffuser exit flow distribution; (4) recording the internal flow distribution within the steam generator when attached to the diffuser; and (5) observing isolated diffuser exhaust dynamic characteristics. The 2 and 2-1/3 degree half angle rectangular diffusers showed recovery coefficients equal to 0.48 with no evidence of flow separation or instability. Diffusion at angles greater than these produced flow instabilities and with angles greater than 3 degrees random flow separation and reattachment.

  2. MHD diffuser model test program

    International Nuclear Information System (INIS)

    Idzorek, J.J.

    1976-07-01

    Experimental results of the aerodynamic performance of seven candidate diffusers are presented to assist in determining their suitability for joining an MHD channel to a steam generator at minimum spacing. The three dimensional diffusers varied in area ratio from 2 to 3.8 and wall half angle from 2 to 5 degrees. The program consisted of five phases: (1) tailoring a diffuser inlet nozzle to a 15 percent blockage; (2) comparison of isolated diffusers at enthalpy ratios 0.5 to 1.0 with respect to separation characteristics and pressure recovery coefficients; (3) recording the optimum diffuser exit flow distribution; (4) recording the internal flow distribution within the steam generator when attached to the diffuser; and (5) observing isolated diffuser exhaust dynamic characteristics. The 2 and 2-1/3 degree half angle rectangular diffusers showed recovery coefficients equal to 0.48 with no evidence of flow separation or instability. Diffusion at angles greater than these produced flow instabilities and with angles greater than 3 degrees random flow separation and reattachment

  3. Kinetic model for hydroxyapatite precipitation on human enamel surface by electrolytic deposition

    International Nuclear Information System (INIS)

    Lei Caixia; Liao Yingmin; Feng Zude

    2009-01-01

    The electrolytic deposition (ELD) of hydroxyapatite (HAP) coating on human enamel surface for different loading times at varied temperatures (ranging from 37 deg. C to 85 deg. C) and varied current densities (ranging from 0.05 mA cm -2 to 10 mA cm -2 ) was investigated in this study. Thin film x-ray diffraction, Fourier transform infrared and micro-Raman spectra analysis, as well as an environmental scanning electron microscope, were used to characterize the coating. The results showed that only the HAP phase occurred on the enamel surface after ELD experiments. The contents of HAP deposits on the enamel surface linearly changed proportional to the square root of the loading time, which was in good agreement with the kinetic model of ELD of HAP coating based on one-dimensional diffusion. The induction periods were observed on all the regression lines, and the rate of the HAP coating formation on enamel showed a linear relationship with the current density. It was implied that the diffusion process was the rate-determining step in the ELD of the HAP coating on human enamel.

  4. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    International Nuclear Information System (INIS)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-01-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.

  5. The modeling method of diffusion of radio activated materials in clay waste disposals

    Energy Technology Data Exchange (ETDEWEB)

    Saberi, Reza; Sepanloo, Kamran [NSTRI, Tehran (Iran, Islamic Republic of); Alinejad, Majid [Engineering Research Institute of Natural Hazard, Isfahan (Iran, Islamic Republic of); Mozaffari, Ali [KNT Univ. of Technology, Tehran (Iran, Islamic Republic of)

    2017-02-15

    New nuclear power plants are necessary to meet today's and future challenges of energy supply. Nuclear power is the only large-scale energy source that takes full responsibility for all its wastes. Nuclear wastes are particularly hazardous and hard to manage relative to different toxic industrial wastes. Three methods are presented and analysed to model the diffusion of the waste from the waste disposal to the bottom surface. For this purpose three software programmes such as ABAQUS, Matlab coding, Geostudio and ArcGIS have been applied.

  6. Agent-based Modeling Automated: Data-driven Generation of Innovation Diffusion Models

    NARCIS (Netherlands)

    Jensen, T.; Chappin, E.J.L.

    2016-01-01

    Simulation modeling is useful to gain insights into driving mechanisms of diffusion of innovations. This study aims to introduce automation to make identification of such mechanisms with agent-based simulation modeling less costly in time and labor. We present a novel automation procedure in which

  7. Laser spot detection based on reaction diffusion

    Czech Academy of Sciences Publication Activity Database

    Vázquez-Otero, Alejandro; Khikhlukha, Danila; Solano-Altamirano, J. M.; Dormido, R.; Duro, N.

    2016-01-01

    Roč. 16, č. 3 (2016), s. 1-11, č. článku 315. ISSN 1424-8220 R&D Projects: GA MŠk EF15_008/0000162 Grant - others:ELI Beamlines(XE) CZ.02.1.01/0.0/0.0/15_008/0000162 Institutional support: RVO:68378271 Keywords : laser spot detection * laser beam detection * reaction diffusion models * Fitzhugh-Nagumo model * reaction diffusion computation * Turing patterns Subject RIV: BL - Plasma and Gas Discharge Physics OBOR OECD: Fluids and plasma physics (including surface physics) Impact factor: 2.677, year: 2016

  8. A model for self-diffusion of guanidinium-based ionic liquids: a molecular simulation study.

    Science.gov (United States)

    Klähn, Marco; Seduraman, Abirami; Wu, Ping

    2008-11-06

    We propose a novel self-diffusion model for ionic liquids on an atomic level of detail. The model is derived from molecular dynamics simulations of guanidinium-based ionic liquids (GILs) as a model case. The simulations are based on an empirical molecular mechanical force field, which has been developed in our preceding work, and it relies on the charge distribution in the actual liquid. The simulated GILs consist of acyclic and cyclic cations that were paired with nitrate and perchlorate anions. Self-diffusion coefficients are calculated at different temperatures from which diffusive activation energies between 32-40 kJ/mol are derived. Vaporization enthalpies between 174-212 kJ/mol are calculated, and their strong connection with diffusive activation energies is demonstrated. An observed formation of cavities in GILs of up to 6.5% of the total volume does not facilitate self-diffusion. Instead, the diffusion of ions is found to be determined primarily by interactions with their immediate environment via electrostatic attraction between cation hydrogen and anion oxygen atoms. The calculated average time between single diffusive transitions varies between 58-107 ps and determines the speed of diffusion, in contrast to diffusive displacement distances, which were found to be similar in all simulated GILs. All simulations indicate that ions diffuse by using a brachiation type of movement: a diffusive transition is initiated by cleaving close contacts to a coordinated counterion, after which the ion diffuses only about 2 A until new close contacts are formed with another counterion in its vicinity. The proposed diffusion model links all calculated energetic and dynamic properties of GILs consistently and explains their molecular origin. The validity of the model is confirmed by providing an explanation for the variation of measured ratios of self-diffusion coefficients of cations and paired anions over a wide range of values, encompassing various ionic liquid classes

  9. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  10. The effects of diffusion in hot subdwarf progenitors from the common envelope channel

    Science.gov (United States)

    Byrne, Conor M.; Jeffery, C. Simon; Tout, Christopher A.; Hu, Haili

    2018-04-01

    Diffusion of elements in the atmosphere and envelope of a star can drastically alter its surface composition, leading to extreme chemical peculiarities. We consider the case of hot subdwarfs, where surface helium abundances range from practically zero to almost 100 percent. Since hot subdwarfs can form via a number of different evolution channels, a key question concerns how the formation mechanism is connected to the present surface chemistry. A sequence of extreme horizontal branch star models was generated by producing post-common envelope stars from red giants. Evolution was computed with MESA from envelope ejection up to core-helium ignition. Surface abundances were calculated at the zero-age horizontal branch for models with and without diffusion. A number of simulations also included radiative levitation. The goal was to study surface chemistry during evolution from cool giant to hot subdwarf and determine when the characteristic subdwarf surface is established. Only stars leaving the giant branch close to core-helium ignition become hydrogen-rich subdwarfs at the zero-age horizontal branch. Diffusion, including radiative levitation, depletes the initial surface helium in all cases. All subdwarf models rapidly become more depleted than observations allow. Surface abundances of other elements follow observed trends in general, but not in detail. Additional physics is required.

  11. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  12. Modeling and experiments for the time-dependent diffusion coefficient during methane desorption from coal

    Science.gov (United States)

    Cheng-Wu, Li; Hong-Lai, Xue; Cheng, Guan; Wen-biao, Liu

    2018-04-01

    Statistical analysis shows that in the coal matrix, the diffusion coefficient for methane is time-varying, and its integral satisfies the formula μt κ /(1 + β κ ). Therefore, a so-called dynamic diffusion coefficient model (DDC model) is developed. To verify the suitability and accuracy of the DDC model, a series of gas diffusion experiments were conducted using coal particles of different sizes. The results show that the experimental data can be accurately described by the DDC and bidisperse models, but the fit to the DDC model is slightly better. For all coal samples, as time increases, the effective diffusion coefficient first shows a sudden drop, followed by a gradual decrease before stabilizing at longer times. The effective diffusion coefficient has a negative relationship with the size of the coal particle. Finally, the relationship between the constants of the DDC model and the effective diffusion coefficient is discussed. The constant α (μ/R 2 ) denotes the effective coefficient at the initial time, and the constants κ and β control the attenuation characteristic of the effective diffusion coefficient.

  13. Modelling of Diffuse Failure and Fluidization in geo materials and Geo structures

    International Nuclear Information System (INIS)

    Pastor, M.

    2013-01-01

    Failure of geo structures is caused by changes in effective stresses induced by external loads (earthquakes, for instance), change in the pore pressures (rain), in the geometry (erosion), or in materials properties (chemical attack, degradation, weathering). Landslides can by analysed as the failure of a geo structure, the slope. There exist many alternative classifications of landslides can be analyzed as the failure of a geo structure, the slope. There exist many alternative classifications of landslides, but we will consider here a simple classification into slides and flows. In the case of slides, the failure consists on the movement of a part of the slope with deformations which concentrate in a narrow zone, the failure surface. This can be idealized as localized failure, and it is typical of over consolidated or dense materials exhibiting softening. On the other hand, flows are made of fluidized materials, flowing in a fluid like manner. This mechanism of failure is known as diffuse failure, and has received much less attention by researchers. Modelling of diffuse failure of slopes is complex, because there appear difficulties in the mathematical, constitutive and numerical models, which have to account for a phase transition. This work deals with modeling, and we will present here some tools recently developed by the author and the group to which he belongs. (Author)

  14. Global stability and pattern formation in a nonlocal diffusive Lotka-Volterra competition model

    Science.gov (United States)

    Ni, Wenjie; Shi, Junping; Wang, Mingxin

    2018-06-01

    A diffusive Lotka-Volterra competition model with nonlocal intraspecific and interspecific competition between species is formulated and analyzed. The nonlocal competition strength is assumed to be determined by a diffusion kernel function to model the movement pattern of the biological species. It is shown that when there is no nonlocal intraspecific competition, the dynamics properties of nonlocal diffusive competition problem are similar to those of classical diffusive Lotka-Volterra competition model regardless of the strength of nonlocal interspecific competition. Global stability of nonnegative constant equilibria are proved using Lyapunov or upper-lower solution methods. On the other hand, strong nonlocal intraspecific competition increases the system spatiotemporal dynamic complexity. For the weak competition case, the nonlocal diffusive competition model may possess nonconstant positive equilibria for some suitably large nonlocal intraspecific competition coefficients.

  15. Pattern Formation in Predator-Prey Model with Delay and Cross Diffusion

    Directory of Open Access Journals (Sweden)

    Xinze Lian

    2013-01-01

    Full Text Available We consider the effect of time delay and cross diffusion on the dynamics of a modified Leslie-Gower predator-prey model incorporating a prey refuge. Based on the stability analysis, we demonstrate that delayed feedback may generate Hopf and Turing instability under some conditions, resulting in spatial patterns. One of the most interesting findings is that the model exhibits complex pattern replication: the model dynamics exhibits a delay and diffusion controlled formation growth not only to spots, stripes, and holes, but also to spiral pattern self-replication. The results indicate that time delay and cross diffusion play important roles in pattern formation.

  16. A Nonlinear Diffusion Equation-Based Model for Ultrasound Speckle Noise Removal

    Science.gov (United States)

    Zhou, Zhenyu; Guo, Zhichang; Zhang, Dazhi; Wu, Boying

    2018-04-01

    Ultrasound images are contaminated by speckle noise, which brings difficulties in further image analysis and clinical diagnosis. In this paper, we address this problem in the view of nonlinear diffusion equation theories. We develop a nonlinear diffusion equation-based model by taking into account not only the gradient information of the image, but also the information of the gray levels of the image. By utilizing the region indicator as the variable exponent, we can adaptively control the diffusion type which alternates between the Perona-Malik diffusion and the Charbonnier diffusion according to the image gray levels. Furthermore, we analyze the proposed model with respect to the theoretical and numerical properties. Experiments show that the proposed method achieves much better speckle suppression and edge preservation when compared with the traditional despeckling methods, especially in the low gray level and low-contrast regions.

  17. Experimental validation of a model for diffusion-controlled absorption of organic compounds in the trachea

    Energy Technology Data Exchange (ETDEWEB)

    Gerde, P. [National Inst. for Working Life, Solna (Sweden); Muggenburg, B.A.; Thornton-Manning, J.R. [and others

    1995-12-01

    Most chemically induced lung cancer originates in the epithelial cells in the airways. Common conceptions are that chemicals deposited on the airway surface are rapidly absorbed through mucous membranes, limited primarily by the rate of blood perfusion in the mucosa. It is also commonly thought that for chemicals to induce toxicity at the site of entry, they must be either rapidly reactive, readily metabolizable, or especially toxic to the tissues at the site of entry. For highly lipophilic toxicants, there is a third option. Our mathematical model predicts that as lipophilicity increases, chemicals partition more readily into the cellular lipid membranes and diffuse more slowly through the tissues. Therefore, absorption of very lipophilic compounds will be almost entirely limited by the rate of diffusion through the epithelium rather than by perfusion of the capillary bed in the subepithelium. We have reported on a preliminary model for absorption through mucous membranes of any substance with a lipid/aqueous partition coefficient larger than one. The purpose of this work was to experimentally validate the model in Beagle dogs. This validated model on toxicant absorption in the airway mucosa will improve risk assessment of inhaled

  18. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  19. Diffusion trajectory of self-propagating innovations interacting with institutions-incorporation of multi-factors learning function to model PV diffusion in Japan

    International Nuclear Information System (INIS)

    Nagamatsu, Akira; Watanabe, Chihiro; Shum, Kwok L.

    2006-01-01

    This paper first proposes a modeling framework to study diffusion of innovations which exhibit strong interaction with the institution systems across which they diffuse. A unique character of such generic innovation is that specific applications are continually developed during its diffusion. This self-propagation in continual applications generation, which is dependent upon the cumulative installed base of the technological innovation, can be modeled to lead to a dynamic changing carrying capacity in an otherwise simple logistic diffusion curve. The cumulative installed base is dependent upon the price of technology and the cost learning dynamics. This paper utilizes a multi-factors learning function to represent such learning dynamics. Empirical estimates from our model are compared with those from other logistics curve formulations and are shown to better fit the annual PV production data during the past quarter century in the case of Japan. The very fact that the potential of this class of innovation can be leveraged only if it interacts closely with the institution highlights the importance of institutional determinants of adoption and diffusion of such innovations like PV. We therefore attempt to put forward an institutional framework, based on viewing PV as a technology platform, to consider PV diffusion beyond mathematical and empirical modeling. Some future research directions are also proposed. (author)

  20. Gaussian and Affine Approximation of Stochastic Diffusion Models for Interest and Mortality Rates

    Directory of Open Access Journals (Sweden)

    Marcus C. Christiansen

    2013-10-01

    Full Text Available In the actuarial literature, it has become common practice to model future capital returns and mortality rates stochastically in order to capture market risk and forecasting risk. Although interest rates often should and mortality rates always have to be non-negative, many authors use stochastic diffusion models with an affine drift term and additive noise. As a result, the diffusion process is Gaussian and, thus, analytically tractable, but negative values occur with positive probability. The argument is that the class of Gaussian diffusions would be a good approximation of the real future development. We challenge that reasoning and study the asymptotics of diffusion processes with affine drift and a general noise term with corresponding diffusion processes with an affine drift term and an affine noise term or additive noise. Our study helps to quantify the error that is made by approximating diffusive interest and mortality rate models with Gaussian diffusions and affine diffusions. In particular, we discuss forward interest and forward mortality rates and the error that approximations cause on the valuation of life insurance claims.

  1. Multi-scale diffuse interface modeling of multi-component two-phase flow with partial miscibility

    Science.gov (United States)

    Kou, Jisheng; Sun, Shuyu

    2016-08-01

    In this paper, we introduce a diffuse interface model to simulate multi-component two-phase flow with partial miscibility based on a realistic equation of state (e.g. Peng-Robinson equation of state). Because of partial miscibility, thermodynamic relations are used to model not only interfacial properties but also bulk properties, including density, composition, pressure, and realistic viscosity. As far as we know, this effort is the first time to use diffuse interface modeling based on equation of state for modeling of multi-component two-phase flow with partial miscibility. In numerical simulation, the key issue is to resolve the high contrast of scales from the microscopic interface composition to macroscale bulk fluid motion since the interface has a nanoscale thickness only. To efficiently solve this challenging problem, we develop a multi-scale simulation method. At the microscopic scale, we deduce a reduced interfacial equation under reasonable assumptions, and then we propose a formulation of capillary pressure, which is consistent with macroscale flow equations. Moreover, we show that Young-Laplace equation is an approximation of this capillarity formulation, and this formulation is also consistent with the concept of Tolman length, which is a correction of Young-Laplace equation. At the macroscopical scale, the interfaces are treated as discontinuous surfaces separating two phases of fluids. Our approach differs from conventional sharp-interface two-phase flow model in that we use the capillary pressure directly instead of a combination of surface tension and Young-Laplace equation because capillarity can be calculated from our proposed capillarity formulation. A compatible condition is also derived for the pressure in flow equations. Furthermore, based on the proposed capillarity formulation, we design an efficient numerical method for directly computing the capillary pressure between two fluids composed of multiple components. Finally, numerical tests

  2. Multi-scale diffuse interface modeling of multi-component two-phase flow with partial miscibility

    KAUST Repository

    Kou, Jisheng

    2016-05-10

    In this paper, we introduce a diffuse interface model to simulate multi-component two-phase flow with partial miscibility based on a realistic equation of state (e.g. Peng-Robinson equation of state). Because of partial miscibility, thermodynamic relations are used to model not only interfacial properties but also bulk properties, including density, composition, pressure, and realistic viscosity. As far as we know, this effort is the first time to use diffuse interface modeling based on equation of state for modeling of multi-component two-phase flow with partial miscibility. In numerical simulation, the key issue is to resolve the high contrast of scales from the microscopic interface composition to macroscale bulk fluid motion since the interface has a nanoscale thickness only. To efficiently solve this challenging problem, we develop a multi-scale simulation method. At the microscopic scale, we deduce a reduced interfacial equation under reasonable assumptions, and then we propose a formulation of capillary pressure, which is consistent with macroscale flow equations. Moreover, we show that Young-Laplace equation is an approximation of this capillarity formulation, and this formulation is also consistent with the concept of Tolman length, which is a correction of Young-Laplace equation. At the macroscopical scale, the interfaces are treated as discontinuous surfaces separating two phases of fluids. Our approach differs from conventional sharp-interface two-phase flow model in that we use the capillary pressure directly instead of a combination of surface tension and Young-Laplace equation because capillarity can be calculated from our proposed capillarity formulation. A compatible condition is also derived for the pressure in flow equations. Furthermore, based on the proposed capillarity formulation, we design an efficient numerical method for directly computing the capillary pressure between two fluids composed of multiple components. Finally, numerical tests

  3. Diffusive component of the vertical flux of particulate organic carbon in the north polar Atlantic

    Directory of Open Access Journals (Sweden)

    Małgorzata Stramska

    2006-12-01

    Full Text Available The diffusive component of the vertical flux of particulate organiccarbon (POC from the surface ocean layer has been estimatedusing a combination of the mixed layer model and ocean colordata from the SeaWiFS satellite. The calculations were carriedout for an example location in the north polar Atlantic centeredat 75°N and 0°E for the time period of 1998-2004.The satellite estimates of surface POC derived using a regional ocean coloralgorithm were applied as an input to the model driven by localsurface heat and momentum fluxes. For each year of the examinedperiod, the diffusive POC flux was estimated at 200-m depth fromApril through December. The highest flux is generally observedin the late fall as a result of increased heat loss and convectionalmixing of surface waters. A relatively high diffusive POC fluxis also observed in early spring, when surface waters are weaklystratified. In addition, the model results demonstrate significantinterannual variability. The highest diffusive POC flux occurredin 1999 (about 4500 mg m-2 over the 9-month period. In 1998 and 2002 the estimated flux was about two orders of magnitudelower. The interannual variability of the diffusive POC fluxis associated with mixed layer dynamics and underscores the importanceof atmospheric forcing for POC export from the surface layerto the ocean's interior.

  4. Diffusion and sorption properties of radionuclides in compacted bentonite

    Energy Technology Data Exchange (ETDEWEB)

    Yu Ji-Wei; Neretnieks, I. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Chemical Engineering and Technology

    1997-07-01

    In this report, recent studies on sorption and diffusion of radionuclides in compacted bentonite have been reviewed. The sorption distribution coefficient and diffusion coefficient data obtained from experiments in the literature have been compiled. Based on these experimental data and the report SKB-TR--91-16 (Brandberg and Skagius, 1991), this report proposes a set of sorption distribution coefficient and diffusion coefficient values for modelling purpose for safety analysis of nuclear waste repositories. The variability and uncertainty of the diffusivity data span somewhat more than an order or magnitude up and down. Most of the nuclides have an effective diffusivity in around 10{sup -10} m{sup 2}/s. Ion exclusion effects are observed for C, Cl and for Tc in oxidizing waters. Effective diffusivities are nearly tow orders of magnitude lower for these elements and of the order of 10{sup -12} m{sup 2}/s. Surface diffusion effects are found for Cs, Ni, Pa, Pb, Ra, Sn, Sr and Zr. Effective diffusivities for these elements are of the order of 10{sup -8} m{sup 2}/s. The surface diffusion effect should decrease in saline waters which is seen for Cs and Sr where there are data available. It is also deemed that Ra will have this effect because of its similarity with Sr. The other nuclides should also show this decrease but no data is available. Sorption and diffusion mechanisms in compacted bentonite are discussed in the report. In highly compacted bentonite, sorption and hence its distribution coefficient is not well defined, and a pore diffusion coefficient or a surface diffusion coefficient is not well defined either. Therefore, an apparent diffusion coefficient and a total concentration gradient should be more relevant in describing the diffusion process in compacted bentonite. 99 refs.

  5. Anomalous diffusion in a symbolic model

    International Nuclear Information System (INIS)

    Ribeiro, H V; Lenzi, E K; Mendes, R S; Santoro, P A

    2011-01-01

    In this work, we investigate some statistical properties of symbolic sequences generated by a numerical procedure in which the symbols are repeated following the power-law probability density. In this analysis, we consider that the sum of n symbols represents the position of a particle in erratic movement. This approach reveals a rich diffusive scenario characterized by non-Gaussian distribution and, depending on the power-law exponent or the procedure used to build the walker, we may have superdiffusion, subdiffusion or usual diffusion. Additionally, we use the continuous-time random walk framework to compare the analytic results with the numerical data, thereby finding good agreement. Because of its simplicity and flexibility, this model can be a candidate for describing real systems governed by power-law probability densities.

  6. Turing instability for a competitor-competitor-mutualist model with nonlinear cross-diffusion effects

    International Nuclear Information System (INIS)

    Wen, Zijuan; Fu, Shengmao

    2016-01-01

    This paper deals with a strongly coupled reaction-diffusion system modeling a competitor-competitor-mutualist three-species model with diffusion, self-diffusion and nonlinear cross-diffusion and subject to Neumann boundary conditions. First, we establish the persistence of a corresponding reaction-diffusion system without self- and cross-diffusion. Second, the global asymptotic stability of the unique positive equilibrium for weakly coupled PDE system is established by using a comparison method. Moreover, under certain conditions about the intra- and inter-species effects, we prove that the uniform positive steady state is linearly unstable for the cross-diffusion system when one of the cross-diffusions is large enough. The results indicate that Turing instability can be driven solely from strong diffusion effect of the first species (or the second species or the third species) due to the pressure of the second species (or the first species).

  7. The brush model - a new approach to numerical modeling of matrix diffusion in fractured clay stone

    International Nuclear Information System (INIS)

    Lege, T.; Shao, H.

    1998-01-01

    A special approach for numerical modeling of contaminant transport in fractured clay stone is presented. The rock matrix and the fractures are simulated with individual formulations for FE grids and transport, coupled into a single model. The capacity of the rock matrix to take up contaminants is taken into consideration with a discrete simulation of matrix diffusion. Thus, the natural process of retardation due to matrix diffusion can be better simulated than by a standard introduction of an empirical parameter into the transport equation. Transport in groundwater in fractured clay stone can be simulated using a model called a 'brush model'. The 'brush handle' is discretized by 2-D finite elements. Advective-dispersive transport in groundwater in the fractures is assumed. The contaminant diffuses into 1D finite elements perpendicular to the fractures, i.e., the 'bristles of the brush'. The conclusion is drawn that matrix diffusion is an important property of fractured clay stone for contaminant retardation. (author)

  8. Diffusion properties of a guiding center plasma in a model electrostatic turbulence

    International Nuclear Information System (INIS)

    Pettini, M.; Vulpiani, A.; Misguich, J.H.; Balescu, R.; De Leener, M.; Orban, J.

    1986-01-01

    Numerical simulations have been performed to calculate the diffusion coefficient of several hundreds of charged particles across a strong magnetic field B, due to a known spectrum of electrostatic fluctuations. The results have been compared with the turbulent diffusion theory proposed by Misguich et al. The equation of motion is solved with a model electrostatic potential. This potential is also the Hamiltonian of this chaotic non-autonomous system: positive Lyapunov exponents are found in qualitative agreement with theoretical predictions. The absolute diffusion coefficients found in two different models exhibit a transition between two scaling regions: a classical scaling at low amplitudes (D ∼ E 2 /B 2 ), and a Bohm scaling at higher amplitudes (D ∼ E/B), in agreement with the predictions for these models. The value of the diffusion coefficient obtained in the isotropic model shows a satisfactory agreement with the theory. The study of the relative diffusion of initially close particles yields a clear quantitative confirmation of the clump effect and of the validity of the theoretical treatment of such nonlinearities. (26 fig, 20 refs)

  9. Two dimensional finite element modelling for dynamic water diffusion through stratum corneum.

    Science.gov (United States)

    Xiao, Perry; Imhof, Robert E

    2012-10-01

    Solvents penetration through in vivo human stratum corneum (SC) has always been an interesting research area for trans-dermal drug delivery studies, and the importance of intercellular routes (diffuse in between corneocytes) and transcellular routes (diffuse through corneocytes) during diffusion is often debatable. In this paper, we have developed a two dimensional finite element model to simulate the dynamic water diffusion through the SC. It is based on the brick-and-mortar model, with brick represents corneocytes and mortar represents lipids, respectively. It simulates the dynamic water diffusion process through the SC from pre-defined initial conditions and boundary conditions. Although the simulation is based on water diffusions, the principles can also be applied to the diffusions of other topical applied substances. The simulation results show that both intercellular routes and transcellular routes are important for water diffusion. Although intercellular routes have higher flux rates, most of the water still diffuse through transcellular routes because of the high cross area ratio of corneocytes and lipids. The diffusion water flux, or trans-epidermal water loss (TEWL), is reversely proportional to corneocyte size, i.e. the larger the corneocyte size, the lower the TEWL, and vice versa. There is also an effect of the SC thickness, external air conditions and diffusion coefficients on the water diffusion through SC on the resulting TEWL. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  11. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  12. Preliminary Hybrid Modeling of the Panama Canal: Operations and Salinity Diffusion

    Directory of Open Access Journals (Sweden)

    Luis Rabelo

    2012-01-01

    Full Text Available This paper deals with the initial modeling of water salinity and its diffusion into the lakes during lock operation on the Panama Canal. A hybrid operational model was implemented using the AnyLogic software simulation environment. This was accomplished by generating an operational discrete-event simulation model and a continuous simulation model based on differential equations, which modeled the salinity diffusion in the lakes. This paper presents that unique application and includes the effective integration of lock operations and its impact on the environment.

  13. Soft tissue deformation modelling through neural dynamics-based reaction-diffusion mechanics.

    Science.gov (United States)

    Zhang, Jinao; Zhong, Yongmin; Gu, Chengfan

    2018-05-30

    Soft tissue deformation modelling forms the basis of development of surgical simulation, surgical planning and robotic-assisted minimally invasive surgery. This paper presents a new methodology for modelling of soft tissue deformation based on reaction-diffusion mechanics via neural dynamics. The potential energy stored in soft tissues due to a mechanical load to deform tissues away from their rest state is treated as the equivalent transmembrane potential energy, and it is distributed in the tissue masses in the manner of reaction-diffusion propagation of nonlinear electrical waves. The reaction-diffusion propagation of mechanical potential energy and nonrigid mechanics of motion are combined to model soft tissue deformation and its dynamics, both of which are further formulated as the dynamics of cellular neural networks to achieve real-time computational performance. The proposed methodology is implemented with a haptic device for interactive soft tissue deformation with force feedback. Experimental results demonstrate that the proposed methodology exhibits nonlinear force-displacement relationship for nonlinear soft tissue deformation. Homogeneous, anisotropic and heterogeneous soft tissue material properties can be modelled through the inherent physical properties of mass points. Graphical abstract Soft tissue deformation modelling with haptic feedback via neural dynamics-based reaction-diffusion mechanics.

  14. Radiosity diffusion model in 3D

    Science.gov (United States)

    Riley, Jason D.; Arridge, Simon R.; Chrysanthou, Yiorgos; Dehghani, Hamid; Hillman, Elizabeth M. C.; Schweiger, Martin

    2001-11-01

    We present the Radiosity-Diffusion model in three dimensions(3D), as an extension to previous work in 2D. It is a method for handling non-scattering spaces in optically participating media. We present the extension of the model to 3D including an extension to the model to cope with increased complexity of the 3D domain. We show that in 3D more careful consideration must be given to the issues of meshing and visibility to model the transport of light within reasonable computational bounds. We demonstrate the model to be comparable to Monte-Carlo simulations for selected geometries, and show preliminary results of comparisons to measured time-resolved data acquired on resin phantoms.

  15. Adsorption and diffusion of H and NH{sub x} as key steps of the NH{sub x} dehydrogenation reaction at the V{sub 2}O{sub 5} (010) surface

    Energy Technology Data Exchange (ETDEWEB)

    Gruber, Mathis; Hermann, Klaus [Fritz-Haber-Institut der MPG, und Sfb 546, Berlin (Germany)

    2009-07-01

    Various selective oxidation reactions as the selective catalytic reduction (SCR) of NO{sub x} or the ammoxidation of propane/propene to acrylonitrile are processed on vanadium based metal-oxide catalysts in the presence of ammonia. In the reactions the intermediates NH{sub 2}, NH{sub 3}, and NH{sub 4} are involved indicating that the adsorption and dehydrogenation of NH{sub x}, x < 4, are important steps. We have performed theoretical studies of corresponding reaction steps where the catalyst is simulated by a finite section of the V{sub 2}O{sub 5} (010) surface. The calculations apply density-functional theory combined with clusters modeling the adsorbate system. The substrate lowers corresponding dehydrogenation energies considerably compared with values for the gas phase reaction. However, the lowering is too small to make dehydrogenation of NH{sub 3} likely to happen. Our results on the role of oxygen vacancies for the dehydrogenation indicate that such surface defects become important for the reaction. Besides the energetics also the diffusion at the surface influences the reaction. A nudged elastic band (NEB) routine has been implemented to evaluate diffusion paths and barriers. Hydrogen diffusion on the surface will be discussed and additional examples for NH{sub x} diffusion will be shown. Based on these results possible reaction scenarios for the dehydrogenation reaction will be presented.

  16. Two-state random walk model of lattice diffusion - 1. Self-correlation function

    International Nuclear Information System (INIS)

    Balakrishnan, V.; Venkataraman, G.

    1981-01-01

    Diffusion with interruptions (arising from localized oscillations, or traps, or mixing between jump diffusion and fluid-like diffusion, etc.) is a very general phenomenon. Its manifestations range from superionic conductance to the behaviour of hydrogen in metals. Based on a continuous-time random walk approach, we present a comprehensive two-state random walk model for the diffusion of a particle on a lattice, incorporating arbitrary holding-time distributions for both localized residence at the sites and inter-site flights, and also the correct first-waiting-time distributions. A synthesis is thus achieved of the two extremes of jump diffusion (zero flight time) and fluid-like diffusion (zero residence time). Various earlier models emerge as special cases of our theory. Among the noteworthy results obtained are: closed-form solutions (in d dimensions, and with arbitrary directional bias) for temporarily uncorrelated jump diffusion and for the fluid diffusion counterpart; a compact, general formula for the mean square displacement; the effects of a continuous spectrum of time scales in the holding-time distributions, etc. The dynamic mobility and the structure factor for 'oscillatory diffusion' are taken up in part 2. (author)

  17. Diffusion archeology for diffusion progression history reconstruction.

    Science.gov (United States)

    Sefer, Emre; Kingsford, Carl

    2016-11-01

    Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring - perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial diffusion data. Here, we tackle the problem of reconstructing a diffusion history from one or more snapshots of the diffusion state. This ability can be invaluable to learn when certain computer nodes are infected or which people are the initial disease spreaders to control future diffusions. We formulate this problem over discrete-time SEIRS-type diffusion models in terms of maximum likelihood. We design methods that are based on submodularity and a novel prize-collecting dominating-set vertex cover (PCDSVC) relaxation that can identify likely diffusion steps with some provable performance guarantees. Our methods are the first to be able to reconstruct complete diffusion histories accurately in real and simulated situations. As a special case, they can also identify the initial spreaders better than the existing methods for that problem. Our results for both meme and contaminant diffusion show that the partial diffusion data problem can be overcome with proper modeling and methods, and that hidden temporal characteristics of diffusion can be predicted from limited data.

  18. Microstructural changes in ischemic cortical gray matter predicted by a model of diffusion-weighted MRI.

    Science.gov (United States)

    Vestergaard-Poulsen, Peter; Hansen, Brian; Ostergaard, Leif; Jakobsen, Rikke

    2007-09-01

    To understand the diffusion attenuated MR signal from normal and ischemic brain tissue in order to extract structural and physiological information using mathematical modeling, taking into account the transverse relaxation rates in gray matter. We fit our diffusion model to the diffusion-weighted MR signal obtained from cortical gray matter in healthy subjects. Our model includes variable volume fractions, intracellular restriction effects, and exchange between compartments in addition to individual diffusion coefficients and transverse relaxation rates for each compartment. A global optimum was found from a wide range of parameter permutations using cluster computing. We also present simulations of cell swelling and changes of exchange rate and intracellular diffusion as possible cellular mechanisms in ischemia. Our model estimates an extracellular volume fraction of 0.19 in accordance with the accepted value from histology. The absolute apparent diffusion coefficient obtained from the model was similar to that of experiments. The model and the experimental results indicate significant differences in diffusion and transverse relaxation between the tissue compartments and slow water exchange. Our model reproduces the signal changes observed in ischemia via physiologically credible mechanisms. Our modeling suggests that transverse relaxation has a profound influence on the diffusion attenuated MR signal. Our simulations indicate cell swelling as the primary cause of the diffusion changes seen in the acute phase of brain ischemia. (c) 2007 Wiley-Liss, Inc.

  19. Active colloidal propulsion over a crystalline surface

    Science.gov (United States)

    Choudhury, Udit; Straube, Arthur V.; Fischer, Peer; Gibbs, John G.; Höfling, Felix

    2017-12-01

    We study both experimentally and theoretically the dynamics of chemically self-propelled Janus colloids moving atop a two-dimensional crystalline surface. The surface is a hexagonally close-packed monolayer of colloidal particles of the same size as the mobile one. The dynamics of the self-propelled colloid reflects the competition between hindered diffusion due to the periodic surface and enhanced diffusion due to active motion. Which contribution dominates depends on the propulsion strength, which can be systematically tuned by changing the concentration of a chemical fuel. The mean-square displacements (MSDs) obtained from the experiment exhibit enhanced diffusion at long lag times. Our experimental data are consistent with a Langevin model for the effectively two-dimensional translational motion of an active Brownian particle in a periodic potential, combining the confining effects of gravity and the crystalline surface with the free rotational diffusion of the colloid. Approximate analytical predictions are made for the MSD describing the crossover from free Brownian motion at short times to active diffusion at long times. The results are in semi-quantitative agreement with numerical results of a refined Langevin model that treats translational and rotational degrees of freedom on the same footing.

  20. Effects on atmospheric diffusion of meterological processes in coastal zones

    International Nuclear Information System (INIS)

    Raynor, G.S.

    1977-01-01

    Meteorological processes in coastal zones differ from those inland because of the surface discontinuity between land and water. The difference in heating between the two surfaces gives rise to sea or lake breeze circulations which can transport pollutants in nongradient directions and recirculate them over source areas. The step change in surface characteristics at the land-water interface also causes formation of internal boundary layers having different transport velocities and diffusion rates than unmodified air upwind or above the boundary. These features require a more extensive measurement program and more versatile diffusion models than at inland sites

  1. Implementation of 5-layer thermal diffusion scheme in weather research and forecasting model with Intel Many Integrated Cores

    Science.gov (United States)

    Huang, Melin; Huang, Bormin; Huang, Allen H.

    2014-10-01

    For weather forecasting and research, the Weather Research and Forecasting (WRF) model has been developed, consisting of several components such as dynamic solvers and physical simulation modules. WRF includes several Land- Surface Models (LSMs). The LSMs use atmospheric information, the radiative and precipitation forcing from the surface layer scheme, the radiation scheme, and the microphysics/convective scheme all together with the land's state variables and land-surface properties, to provide heat and moisture fluxes over land and sea-ice points. The WRF 5-layer thermal diffusion simulation is an LSM based on the MM5 5-layer soil temperature model with an energy budget that includes radiation, sensible, and latent heat flux. The WRF LSMs are very suitable for massively parallel computation as there are no interactions among horizontal grid points. The features, efficient parallelization and vectorization essentials, of Intel Many Integrated Core (MIC) architecture allow us to optimize this WRF 5-layer thermal diffusion scheme. In this work, we present the results of the computing performance on this scheme with Intel MIC architecture. Our results show that the MIC-based optimization improved the performance of the first version of multi-threaded code on Xeon Phi 5110P by a factor of 2.1x. Accordingly, the same CPU-based optimizations improved the performance on Intel Xeon E5- 2603 by a factor of 1.6x as compared to the first version of multi-threaded code.

  2. Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

    2016-09-15

    Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

  3. Modeling Replenishment of Ultrathin Liquid Perfluoro polyether Z Films on Solid Surfaces Using Monte Carlo Simulation

    International Nuclear Information System (INIS)

    Mayeed, M.S.; Kato, T.

    2014-01-01

    Applying the reptation algorithm to a simplified perfluoro polyether Z off-lattice polymer model an NVT Monte Carlo simulation has been performed. Bulk condition has been simulated first to compare the average radius of gyration with the bulk experimental results. Then the model is tested for its ability to describe dynamics. After this, it is applied to observe the replenishment of nano scale ultrathin liquid films on solid flat carbon surfaces. The replenishment rate for trenches of different widths (8, 12, and 16 nms for several molecular weights) between two films of perfluoro polyether Z from the Monte Carlo simulation is compared to that obtained solving the diffusion equation using the experimental diffusion coefficients of Ma et al. (1999), with room condition in both cases. Replenishment per Monte Carlo cycle seems to be a constant multiple of replenishment per second at least up to 2 nm replenished film thickness of the trenches over the carbon surface. Considerable good agreement has been achieved here between the experimental results and the dynamics of molecules using reptation moves in the ultrathin liquid films on solid surfaces.

  4. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  5. Core surface flow modelling from high-resolution secular variation

    DEFF Research Database (Denmark)

    Holme, R.; Olsen, Nils

    2006-01-01

    -flux hypothesis, but the spectrum of the SV implies that a conclusive test of frozen-flux is not possible. We parametrize the effects of diffusion as an expected misfit in the flow prediction due to departure from the frozen-flux hypothesis; at low spherical harmonic degrees, this contribution dominates...... the expected departure of the SV predictions from flow to the observed SV, while at high degrees the SV model uncertainty is dominant. We construct fine-scale core surface flows to model the SV. Flow non-uniqueness is a serious problem because the flows are sufficiently small scale to allow flow around non......-series of magnetic data and better parametrization of the external magnetic field....

  6. Surface Complexation Modeling in Variable Charge Soils: Prediction of Cadmium Adsorption

    Directory of Open Access Journals (Sweden)

    Giuliano Marchi

    2015-10-01

    Full Text Available ABSTRACT Intrinsic equilibrium constants for 22 representative Brazilian Oxisols were estimated from a cadmium adsorption experiment. Equilibrium constants were fitted to two surface complexation models: diffuse layer and constant capacitance. Intrinsic equilibrium constants were optimized by FITEQL and by hand calculation using Visual MINTEQ in sweep mode, and Excel spreadsheets. Data from both models were incorporated into Visual MINTEQ. Constants estimated by FITEQL and incorporated in Visual MINTEQ software failed to predict observed data accurately. However, FITEQL raw output data rendered good results when predicted values were directly compared with observed values, instead of incorporating the estimated constants into Visual MINTEQ. Intrinsic equilibrium constants optimized by hand calculation and incorporated in Visual MINTEQ reliably predicted Cd adsorption reactions on soil surfaces under changing environmental conditions.

  7. Theoretical model estimation of guest diffusion in Metal-Organic Frameworks (MOFs)

    KAUST Repository

    Zheng, Bin

    2015-08-11

    Characterizing molecule diffusion in nanoporous matrices is critical to understanding the novel chemical and physical properties of metal-organic frameworks (MOFs). In this paper, we developed a theoretical model to fastly and accurately compute the diffusion rate of guest molecules in a zeolitic imidazolate framework-8 (ZIF-8). The ideal gas or equilibrium solution diffusion model was modified to contain the effect of periodical media via introducing the possibility of guests passing through the framework gate. The only input in our model is the energy barrier of guests passing through the MOF’s gate. Molecular dynamics (MD) methods were employed to gather the guest density profile, which then was used to deduce the energy barrier values. This produced reliable results that require a simulation time of 5 picoseconds, which is much shorter when using pure MD methods (in the billisecond scale) . Also, we used density functional theory (DFT) methods to obtain the energy profile of guests passing through gates, as this does not require specification of a force field for the MOF degrees of freedom. In the DFT calculation, we only considered one gate of MOFs each time; as this greatly reduced the computational cost. Based on the obtained energy barrier values we computed the diffusion rate of alkane and alcohol in ZIF-8 using our model, which was in good agreement with experimental test results and the calculation values from standard MD model. Our model shows the advantage of obtaining accurate diffusion rates for guests in MOFs for a lower computational cost and shorter calculation time. Thus, our analytic model calculation is especially attractive for high-throughput computational screening of the dynamic performance of guests in a framework.

  8. Diffusing diffusivity: Rotational diffusion in two and three dimensions

    Science.gov (United States)

    Jain, Rohit; Sebastian, K. L.

    2017-06-01

    We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

  9. Diffusion in energy materials: Governing dynamics from atomistic modelling

    Science.gov (United States)

    Parfitt, D.; Kordatos, A.; Filippatos, P. P.; Chroneos, A.

    2017-09-01

    Understanding diffusion in energy materials is critical to optimising the performance of solid oxide fuel cells (SOFCs) and batteries both of which are of great technological interest as they offer high efficiency for cleaner energy conversion and storage. In the present review, we highlight the insights offered by atomistic modelling of the ionic diffusion mechanisms in SOFCs and batteries and how the growing predictive capability of high-throughput modelling, together with our new ability to control compositions and microstructures, will produce advanced materials that are designed rather than chosen for a given application. The first part of the review focuses on the oxygen diffusion mechanisms in cathode and electrolyte materials for SOFCs and in particular, doped ceria and perovskite-related phases with anisotropic structures. The second part focuses on disordered oxides and two-dimensional materials as these are very promising systems for battery applications.

  10. Evaluation of the Thermodynamic Models for the Thermal Diffusion Factor

    DEFF Research Database (Denmark)

    Gonzalez-Bagnoli, Mariana G.; Shapiro, Alexander; Stenby, Erling Halfdan

    2003-01-01

    Over the years, several thermodynamic models for the thermal diffusion factors for binary mixtures have been proposed. The goal of this paper is to test some of these models in combination with different equations of state. We tested the following models: those proposed by Rutherford and Drickamer...... we applied different thermodynamic models, such as the Soave-Redlich-Kwong and the Peng-Robinson equations of state. The necessity to try different thermo-dynamic models is caused by the high sensitivity of the thermal diffusion factors to the values of the partial molar properties. Two different...... corrections for the determination of the partial molar volumes have been implemented; the Peneloux correction and the correction based on the principle of corresponding states....

  11. Hopf bifurcation in a delayed reaction-diffusion-advection population model

    Science.gov (United States)

    Chen, Shanshan; Lou, Yuan; Wei, Junjie

    2018-04-01

    In this paper, we investigate a reaction-diffusion-advection model with time delay effect. The stability/instability of the spatially nonhomogeneous positive steady state and the associated Hopf bifurcation are investigated when the given parameter of the model is near the principle eigenvalue of an elliptic operator. Our results imply that time delay can make the spatially nonhomogeneous positive steady state unstable for a reaction-diffusion-advection model, and the model can exhibit oscillatory pattern through Hopf bifurcation. The effect of advection on Hopf bifurcation values is also considered, and our results suggest that Hopf bifurcation is more likely to occur when the advection rate increases.

  12. Turbulent diffusion modelling for windflow and dispersion analysis

    International Nuclear Information System (INIS)

    Bartzis, J.G.

    1988-01-01

    The need for simple but reliable models for turbulent diffusion for windflow and atmospheric dispersion analysis is a necessity today if one takes into consideration the relatively high demand in computer time and costs for such an analysis, arising mainly from the often large solution domains needed, the terrain complexity and the transient nature of the phenomena. In the accident consequence assessment often there is a need for a relatively large number of cases to be analysed increasing further the computer time and costs. Within the framework of searching for relatively simple and universal eddy viscosity/diffusivity models, a new three dimensional non isotropic model is proposed applicable to any domain complexity and any atmospheric stability conditions. The model utilizes the transport equation for turbulent kinetic energy but introduces a new approach in effective length scale estimation based on the flow global characteristics and local atmospheric stability. The model is discussed in detail and predictions are given for flow field and boundary layer thickness. The results are compared with experimental data with satisfactory results

  13. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  14. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  15. Physical modeling of emergency emission in the atmosphere (experimental investigation of Lagrangian turbulence characteristics in the surface and boundary layer of the atmosphere)

    International Nuclear Information System (INIS)

    Garger, E.K.

    2013-01-01

    Results of diffusion experiments simulating emergency emission in the surface and boundary layers of the atmosphere are presented. Interpretation of measurements in the surface layer of the atmosphere had been conducted on the basis of the Lagrangian similarity hypothesis., Results of measurements in the boundary layer of the atmosphere are interpreted with use of the homogeneous turbulence theory. Regimes of turbulent diffusion from land and low sources of admixtures predicted by the Lagrangian similarity hypothesis for various conditions of thermal stratification in the surface layer of the atmosphere are experimentally confirmed. Universal empirical constants for these regimes are received that allows to use their in practice. Calculation diffusion parameters and concentrations of an admixture from various sources in the surface layer of the atmosphere by model is presented. Results of calculation on this model are compared to independent measurements of mass concentration of a admixture in horizontal and vertical planes. Results of simultaneous measurements Eulerian and Lagrangian turbulence characteristics for various diffusion times in the boundary layer of the atmosphere have allowed to estimate turbulence time scales in Lagrangian variables for conditions close to neutral thermal stratification. The monograph is intended for scientists and students engaged in the field of meteorology, physics of the atmosphere and pollution air control, services of radiation and ecological safety

  16. Kinetic model for hydroxyapatite precipitation on human enamel surface by electrolytic deposition

    Energy Technology Data Exchange (ETDEWEB)

    Lei Caixia; Liao Yingmin; Feng Zude, E-mail: zdfeng@xmu.edu.c [College of Materials, Xiamen University, Xiamen 361005 (China)

    2009-06-15

    The electrolytic deposition (ELD) of hydroxyapatite (HAP) coating on human enamel surface for different loading times at varied temperatures (ranging from 37 deg. C to 85 deg. C) and varied current densities (ranging from 0.05 mA cm{sup -2} to 10 mA cm{sup -2}) was investigated in this study. Thin film x-ray diffraction, Fourier transform infrared and micro-Raman spectra analysis, as well as an environmental scanning electron microscope, were used to characterize the coating. The results showed that only the HAP phase occurred on the enamel surface after ELD experiments. The contents of HAP deposits on the enamel surface linearly changed proportional to the square root of the loading time, which was in good agreement with the kinetic model of ELD of HAP coating based on one-dimensional diffusion. The induction periods were observed on all the regression lines, and the rate of the HAP coating formation on enamel showed a linear relationship with the current density. It was implied that the diffusion process was the rate-determining step in the ELD of the HAP coating on human enamel.

  17. Nuclear interaction potential in a folded-Yukawa model with diffuse densities

    International Nuclear Information System (INIS)

    Randrup, J.

    1975-09-01

    The folded-Yukawa model for the nuclear interaction potential is generalized to diffuse density distributions which are generated by folding a Yukawa function into sharp generating distributions. The effect of a finite density diffuseness or of a finite interaction range is studied. The Proximity Formula corresponding to the generalized model is derived and numerical comparison is made with the exact results. (8 figures)

  18. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  19. Diffusion in a tokamak with helical magnetic cells

    International Nuclear Information System (INIS)

    Wakatani, Masahiro

    1975-05-01

    In a tokamak with helical magnetic cells produced by a resonant helical magnetic field, diffusion in the collisional regime is studied. The diffusion coefficient is greatly enhanced near the resonant surface even for a weak helical magnetic field. A theoretical model for disruptive instabilities based on the enhanced transport due to helical magnetic cells is discussed. This may explain experiments of the tokamak with resonant helical fields qualitatively. (author)

  20. Surface characteristics modeling and performance evaluation of urban building materials using LiDAR data.

    Science.gov (United States)

    Li, Xiaolu; Liang, Yu

    2015-05-20

    Analysis of light detection and ranging (LiDAR) intensity data to extract surface features is of great interest in remote sensing research. One potential application of LiDAR intensity data is target classification. A new bidirectional reflectance distribution function (BRDF) model is derived for target characterization of rough and smooth surfaces. Based on the geometry of our coaxial full-waveform LiDAR system, the integration method is improved through coordinate transformation to establish the relationship between the BRDF model and intensity data of LiDAR. A series of experiments using typical urban building materials are implemented to validate the proposed BRDF model and integration method. The fitting results show that three parameters extracted from the proposed BRDF model can distinguish the urban building materials from perspectives of roughness, specular reflectance, and diffuse reflectance. A comprehensive analysis of these parameters will help characterize surface features in a physically rigorous manner.

  1. Modeling Diffusion and Buoyancy-Driven Convection with Application to Geological CO2 Storage

    KAUST Repository

    Allen, Rebecca

    2015-04-01

    ABSTRACT Modeling Diffusion and Buoyancy-Driven Convection with Application to Geological CO2 Storage Rebecca Allen Geological CO2 storage is an engineering feat that has been undertaken around the world for more than two decades, thus accurate modeling of flow and transport behavior is of practical importance. Diffusive and convective transport are relevant processes for buoyancy-driven convection of CO2 into underlying fluid, a scenario that has received the attention of numerous modeling studies. While most studies focus on Darcy-scale modeling of this scenario, relatively little work exists at the pore-scale. In this work, properties evaluated at the pore-scale are used to investigate the transport behavior modeled at the Darcy-scale. We compute permeability and two different forms of tortuosity, namely hydraulic and diffusive. By generating various pore ge- ometries, we find hydraulic and diffusive tortuosity can be quantitatively different in the same pore geometry by up to a factor of ten. As such, we emphasize that these tortuosities should not be used interchangeably. We find pore geometries that are characterized by anisotropic permeability can also exhibit anisotropic diffusive tortuosity. This finding has important implications for buoyancy-driven convection modeling; when representing the geological formation with an anisotropic permeabil- ity, it is more realistic to also account for an anisotropic diffusivity. By implementing a non-dimensional model that includes both a vertically and horizontally orientated 5 Rayleigh number, we interpret our findings according to the combined effect of the anisotropy from permeability and diffusive tortuosity. In particular, we observe the Rayleigh ratio may either dampen or enhance the diffusing front, and our simulation data is used to express the time of convective onset as a function of the Rayleigh ratio. Also, we implement a lattice Boltzmann model for thermal convective flows, which we treat as an analog for

  2. Modelling thermal radiation in buoyant turbulent diffusion flames

    Science.gov (United States)

    Consalvi, J. L.; Demarco, R.; Fuentes, A.

    2012-10-01

    This work focuses on the numerical modelling of radiative heat transfer in laboratory-scale buoyant turbulent diffusion flames. Spectral gas and soot radiation is modelled by using the Full-Spectrum Correlated-k (FSCK) method. Turbulence-Radiation Interactions (TRI) are taken into account by considering the Optically-Thin Fluctuation Approximation (OTFA), the resulting time-averaged Radiative Transfer Equation (RTE) being solved by the Finite Volume Method (FVM). Emission TRIs and the mean absorption coefficient are then closed by using a presumed probability density function (pdf) of the mixture fraction. The mean gas flow field is modelled by the Favre-averaged Navier-Stokes (FANS) equation set closed by a buoyancy-modified k-ɛ model with algebraic stress/flux models (ASM/AFM), the Steady Laminar Flamelet (SLF) model coupled with a presumed pdf approach to account for Turbulence-Chemistry Interactions, and an acetylene-based semi-empirical two-equation soot model. Two sets of experimental pool fire data are used for validation: propane pool fires 0.3 m in diameter with Heat Release Rates (HRR) of 15, 22 and 37 kW and methane pool fires 0.38 m in diameter with HRRs of 34 and 176 kW. Predicted flame structures, radiant fractions, and radiative heat fluxes on surrounding surfaces are found in satisfactory agreement with available experimental data across all the flames. In addition further computations indicate that, for the present flames, the gray approximation can be applied for soot with a minor influence on the results, resulting in a substantial gain in Computer Processing Unit (CPU) time when the FSCK is used to treat gas radiation.

  3. Concentration polarization, surface currents, and bulk advection in a microchannel

    DEFF Research Database (Denmark)

    Nielsen, Christoffer Peder; Bruus, Henrik

    2014-01-01

    . A remarkable outcome of the investigations is the discovery of strong couplings between bulk advection and the surface current; without a surface current, bulk advection is strongly suppressed. The numerical simulations are supplemented by analytical models valid in the long channel limit as well...... as in the limit of negligible surface charge. By including the effects of diffusion and advection in the diffuse part of the electric double layers, we extend a recently published analytical model of overlimiting current due to surface conduction....

  4. Simple Brownian diffusion an introduction to the standard theoretical models

    CERN Document Server

    Gillespie, Daniel T

    2013-01-01

    Brownian diffusion, the motion of large molecules in a sea of very many much smaller molecules, is topical because it is one of the ways in which biologically important molecules move about inside living cells. This book presents the mathematical physics that underlies the four simplest models of Brownian diffusion.

  5. Estimation of grain boundary diffusivity in near-α titanium polycrystals

    International Nuclear Information System (INIS)

    Brockman, Robert A.; Pilchak, Adam L.; John Porter, W.; John, Reji

    2011-01-01

    The role of enhanced grain boundary diffusivity in high-temperature diffusion of interstitial elements through metals is widely recognized but poorly characterized in most materials. This paper summarizes an effort to estimate grain boundary diffusivity of oxygen in a near-α titanium alloy, Ti-6Al-2Sn-4Zr-2Mo-0.1Si, by explicitly incorporating microstructure obtained from electron backscatter diffraction into an analytical model. Attention is focused on near-surface diffusion behavior contributing to the rapid ingress of oxygen and possible crack initiation in high-temperature environments.

  6. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  7. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  8. Incorporating Embedded Microporous Layers into Topologically Equivalent Pore Network Models for Oxygen Diffusivity Calculations in Polymer Electrolyte Membrane Fuel Cell Gas Diffusion Layers

    International Nuclear Information System (INIS)

    Fazeli, Mohammadreza; Hinebaugh, James; Bazylak, Aimy

    2016-01-01

    Highlights: • Pore network model for modeling PEMFC MPL-coated GDL effective diffusivity. • Bilayered GDL (substrate and MPL) is modeled with a hybrid network of block MPL elements combined with discrete substrate pores. • Diffusivities of MPL-coated GDLs agree with analytical solutions. - Abstract: In this work, a voxel-based methodology is introduced for the hybridization of a pore network with interspersed nano-porous material elements allowing pore network based oxygen diffusivity calculations in a 3D image of a polymer electrolyte membrane (PEM) fuel cell gas diffusion layer (GDL) with an embedded microporous layer (MPL). The composite GDL is modeled by combining a hybrid network of block MPL elements with prescribed bulk material properties and a topologically equivalent network of larger discrete pores and throats that are directly derived from the 3D image of the GDL substrate. This hybrid network was incorporated into a pore network model, and effective diffusivity predictions of GDL materials with MPL coatings were obtained. Stochastically generated numerical models of carbon paper substrates with and without MPLs were used, and the pore space was directly extracted from this realistic geometry as the input for the pore network model. The effective diffusion coefficient of MPL-coated GDL materials was predicted from 3D images in a pore network modeling environment without resolving the nano-scale structure of the MPL. This method is particularly useful due to the disparate length scales that are involved when attempting to capture pore-scale transport in the GDL. Validation was performed by comparing our predicted diffusivity values to analytical predictions, and excellent agreement was observed. Upon conducting a mesh sensitivity study, it was determined that an MPL element size of 7 μm provided sufficiently high resolution for accurately describing the MPL nano-structure.

  9. Continuum modelling of silicon diffusion in indium gallium arsenide

    Science.gov (United States)

    Aldridge, Henry Lee, Jr.

    A possible method to overcome the physical limitations experienced by continued transistor scaling and continue improvements in performance and power consumption is integration of III-V semiconductors as alternative channel materials for logic devices. Indium Gallium Arsenide (InGaAs) is such a material from the III-V semiconductor family, which exhibit superior electron mobilities and injection velocities than that of silicon. In order for InGaAs integration to be realized, contact resistances must be minimized through maximizing activation of dopants in this material. Additionally, redistribution of dopants during processing must be clearly understood and ultimately controlled at the nanometer-scale. In this work, the activation and diffusion behavior of silicon, a prominent n-type dopant in InGaAs, has been characterized and subsequently modelled using the Florida Object Oriented Process and Device Simulator (FLOOPS). In contrast to previous reports, silicon exhibits non-negligible diffusion in InGaAs, even for smaller thermal budget rapid thermal anneals (RTAs). Its diffusion is heavily concentration-dependent, with broadening "shoulder-like" profiles when doping levels exceed 1-3x1019cm -3, for both ion-implanted and Molecular Beam Epitaxy (MBE)-grown cases. Likewise a max net-activation value of ˜1.7x1019cm -3 is consistently reached with enough thermal processing, regardless of doping method. In line with experimental results and several ab-initio calculation results, rapid concentration-dependent diffusion of Si in InGaAs and the upper limits of its activation is believed to be governed by cation vacancies that serve as compensating defects in heavily n-type regions of InGaAs. These results are ultimately in line with an amphoteric defect model, where the activation limits of dopants are an intrinsic limitation of the material, rather than governed by individual dopant species or their methods of incorporation. As a result a Fermi level dependent point

  10. Diffusion in higher dimensional SYK model with complex fermions

    Science.gov (United States)

    Cai, Wenhe; Ge, Xian-Hui; Yang, Guo-Hong

    2018-01-01

    We construct a new higher dimensional SYK model with complex fermions on bipartite lattices. As an extension of the original zero-dimensional SYK model, we focus on the one-dimension case, and similar Hamiltonian can be obtained in higher dimensions. This model has a conserved U(1) fermion number Q and a conjugate chemical potential μ. We evaluate the thermal and charge diffusion constants via large q expansion at low temperature limit. The results show that the diffusivity depends on the ratio of free Majorana fermions to Majorana fermions with SYK interactions. The transport properties and the butterfly velocity are accordingly calculated at low temperature. The specific heat and the thermal conductivity are proportional to the temperature. The electrical resistivity also has a linear temperature dependence term.

  11. Technology diffusion in energy-economy models: The case of Danish vintage models

    DEFF Research Database (Denmark)

    Klinge Jacobsen, Henrik

    2000-01-01

    the costs of greenhouse gas mitigation. This paper examines the effect on aggregate energy efficiency of using technological vintage models to describe technology diffusion. The focus is on short- to medium-term issues. Three different models of Danish energy supply and demand are used to illustrate...

  12. Modeling experimental stable isotope results from CO2 adsorption and diffusion experiments

    Science.gov (United States)

    Larson, T. E.

    2012-12-01

    steadily increased and became constant after two pore volumes of CO2 flushed through the column. Carbon and oxygen isotope values of the front of the peak (first pore volume) are 2‰ and 5‰ lower than the injected CO2 values, respectively. These results are fit very well using a mass transfer model that only includes binary diffusion between CO2 and helium that account for isotope substitution in the reduced mass coefficient. In contrast to these diffusion-dominated systems, CO2 break through curves from the illite packed column show strong adsorption effects that include a +180‰ increase in the carbon isotope ratio at the front of the peak followed by a 20‰ decrease. Up to 20 pore volumes of CO2 were flushed through the column before the carbon and oxygen isotope values stabilized to their starting values. These adsorption effects cannot be modeled using mass isotope effects alone, and instead must include additional parameters such as volume effects. These results demonstrate the importance of understanding the isotopic effects of CO2 in different substrates, and potentially offers a tracer tool that can be used to quantify surface area, transport distance, and surface reactivity of CO2. Additional applications may include more affectively determining transfer rates of CO2 across low permeability zones.

  13. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  14. Computation of diffusion coefficients for waters of Gauthami Godavari estuary using one-dimensional advection-diffusion model

    Digital Repository Service at National Institute of Oceanography (India)

    Jyothi, D.; Murty, T.V.R.; Sarma, V.V.; Rao, D.P.

    conditions. As the pollutant load on the estuary increases, the. water quality may deteriorate rapidly and therefore the scientific interests are centered on the analysis of water quality. The pollutants will be subjected to a number of physical, chemical... study we have applied one-dimensional advection-diffusion model for the waters of Gauthami Godavari estuary to determine the axial diffusion coefficients and thereby to predict the impact assessment. The study area (Fig. 1) is the lower most 32 km...

  15. Evaporation rates and surface profiles on heterogeneous surfaces with mass transfer and surface reaction

    Energy Technology Data Exchange (ETDEWEB)

    Flytzani-Stephanopoulos, M; Schmidt, L D

    1979-01-01

    Simple models incorporating surface reaction and diffusion of volatile products through a boundary layer are developed to calculate effective rates of evaporation and local surface profiles on surfaces having active and inactive regions. The coupling between surface heterogeneities with respect to a particular reaction and external mass transfer may provide a mechanism for the surface rearrangement and metal loss encountered in several catalytic systems of practical interest. Calculated transport rates for the volatilization of platinum in oxidizing environments and the rearrangement of this metal during the ammonia oxidation reaction agree well with published experimental data.

  16. Stalled-Flow and Head-Loss Model for Diffuser Pumps

    Science.gov (United States)

    Meng, S. Y.

    1984-01-01

    Modeling procedure approximates inlet transition zone (blade leading edge to blade throat) of diffuser pump as two-dimensional cascade, properties of which are well known. Model applied to stators as well as rotors. Procedure much faster than previous methods.

  17. Epidemic model for information diffusion in web forums: experiments in marketing exchange and political dialog.

    Science.gov (United States)

    Woo, Jiyoung; Chen, Hsinchun

    2016-01-01

    As social media has become more prevalent, its influence on business, politics, and society has become significant. Due to easy access and interaction between large numbers of users, information diffuses in an epidemic style on the web. Understanding the mechanisms of information diffusion through these new publication methods is important for political and marketing purposes. Among social media, web forums, where people in online communities disseminate and receive information, provide a good environment for examining information diffusion. In this paper, we model topic diffusion in web forums using the epidemiology model, the susceptible-infected-recovered (SIR) model, frequently used in previous research to analyze both disease outbreaks and knowledge diffusion. The model was evaluated on a large longitudinal dataset from the web forum of a major retail company and from a general political discussion forum. The fitting results showed that the SIR model is a plausible model to describe the diffusion process of a topic. This research shows that epidemic models can expand their application areas to topic discussion on the web, particularly social media such as web forums.

  18. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  19. Analytically solvable models of reaction-diffusion systems

    Energy Technology Data Exchange (ETDEWEB)

    Zemskov, E P; Kassner, K [Institut fuer Theoretische Physik, Otto-von-Guericke-Universitaet, Universitaetsplatz 2, 39106 Magdeburg (Germany)

    2004-05-01

    We consider a class of analytically solvable models of reaction-diffusion systems. An analytical treatment is possible because the nonlinear reaction term is approximated by a piecewise linear function. As particular examples we choose front and pulse solutions to illustrate the matching procedure in the one-dimensional case.

  20. Tracer diffusion in compacted, water-saturated bentonite

    International Nuclear Information System (INIS)

    Bourg, Ian C.; Sposito, Garrison; Bourg, Alain C.M.

    2005-01-01

    Compacted Na-bentonite clay barriers, widely used in the isolation of solid-waste landfills and other contaminated sites, have been proposed for a similar use in the disposal of high-level radioactive waste. Molecular diffusion through the pore space in these barriers plays a key role in their performance, thus motivating recent measurements of the apparent diffusion coefficient tensor of water tracers in compacted, water-saturated Na-bentonites. In the present study, we introduce a conceptual model in which the pore space of water-saturated bentonite is divided into 'macropore' and 'interlayer nanopore' compartments. With this model we determine quantitatively the relative contributions of pore-network geometry (expressed as a geometric factor) and of the diffusive behavior of water molecules near montmorillonite basal surfaces(expressed as a contrastivity factor) to the apparent diffusion coefficient tensor. Our model predicts, in agreement with experiment, that the mean principal value of the apparent diffusion coefficient tensor follows a single relationship when plotted against the partial montmorillonite dry density (mass of montmorillonite per combined volume of montmorillonite and pore space). Using a single fitted parameter, the mean principal geometric factor, our model successfully describes this relationship for a broad range of bentonite-water system, from dilute gel to highly-compacted bentonite with 80 percent of its pore water in interlayer nanopores