Terahertz Conductivity within Colloidal CsPbBr3 Perovskite Nanocrystals: Remarkably High Carrier Mobilities and Large Diffusion Lengths.

Science.gov (United States)

Yettapu, Gurivi Reddy; Talukdar, Debnath; Sarkar, Sohini; Swarnkar, Abhishek; Nag, Angshuman; Ghosh, Prasenjit; Mandal, Pankaj

2016-08-10

Colloidal CsPbBr3 perovskite nanocrystals (NCs) have emerged as an excellent light emitting material in last one year. Using time domain and time-resolved THz spectroscopy and density functional theory based calculations, we establish 3-fold free carrier recombination mechanism, namely, nonradiative Auger, bimolecular electron-hole recombination, and inefficient trap-assisted recombination in 11 nm sized colloidal CsPbBr3 NCs. Our results confirm a negligible influence of surface defects in trapping charge carriers, which in turn results into desirable intrinsic transport properties, from the perspective of device applications, such as remarkably high carrier mobility (∼4500 cm(2) V(-1) s(-1)), large diffusion length (>9.2 μm), and high luminescence quantum yield (80%). Despite being solution processed and possessing a large surface to volume ratio, this combination of high carrier mobility and diffusion length, along with nearly ideal photoluminescence quantum yield, is unique compared to any other colloidal quantum dot system.

Diffusion as a function of guest molecule length and functionalization in flexible metal–organic frameworks

KAUST Repository

Zheng, B.; Wang, L. L.; Du, L.; Pan, Y.; Lai, Zhiping; Huang, Kuo-Wei; Du, H. L.

2016-01-01

Understanding guest diffusion in nanoporous host-guest systems is crucial in the efficient design of metal-organic frameworks (MOFs) for chemical separation and drug delivery applications. In this work, we investigated the effect of molecule length on the diffusion rate in the zeolitic imidazolate framework 8 (ZIF-8), trying to find a simple and straightforward variable to characterize the complicated guest diffusion. We found that, counter-intuitively, long guest molecules can diffuse as quickly as short molecules; the diffusion coefficient of ethyl acetate for example is of the same order of magnitude as ethane and ethanol, as excludes the existence of a simple relationship between molecule length and diffusion rate. This phenomenon is explained by a study of the contributions of intra- and inter-cage movement to overall transport. Steric confinement limits the degrees of freedom of long guest molecules, shortening their residence time and increasing the efficiency of radial diffusion. In contrast, shorter molecules meander within MOF cages, reducing transport. Furthermore, the energy barrier of inter-cage transport also does not exhibit a simple dependence on a guest molecule length, attributing to the effect of the type of functional group on diffusion. Guests over varying lengths were investigated by using theoretical methods, revealing that the guest diffusion in ZIF-8 depends on the number of contiguous carbon atoms in a molecule, rather than its overall length. Thus, we proposed simple criteria to predict arbitrary guest molecule diffusivity in ZIF-8 without time-consuming experimentation. © 2016 The Royal Society of Chemistry.

Diffusion as a function of guest molecule length and functionalization in flexible metal–organic frameworks

KAUST Repository

Zheng, B.

2016-05-11

Understanding guest diffusion in nanoporous host-guest systems is crucial in the efficient design of metal-organic frameworks (MOFs) for chemical separation and drug delivery applications. In this work, we investigated the effect of molecule length on the diffusion rate in the zeolitic imidazolate framework 8 (ZIF-8), trying to find a simple and straightforward variable to characterize the complicated guest diffusion. We found that, counter-intuitively, long guest molecules can diffuse as quickly as short molecules; the diffusion coefficient of ethyl acetate for example is of the same order of magnitude as ethane and ethanol, as excludes the existence of a simple relationship between molecule length and diffusion rate. This phenomenon is explained by a study of the contributions of intra- and inter-cage movement to overall transport. Steric confinement limits the degrees of freedom of long guest molecules, shortening their residence time and increasing the efficiency of radial diffusion. In contrast, shorter molecules meander within MOF cages, reducing transport. Furthermore, the energy barrier of inter-cage transport also does not exhibit a simple dependence on a guest molecule length, attributing to the effect of the type of functional group on diffusion. Guests over varying lengths were investigated by using theoretical methods, revealing that the guest diffusion in ZIF-8 depends on the number of contiguous carbon atoms in a molecule, rather than its overall length. Thus, we proposed simple criteria to predict arbitrary guest molecule diffusivity in ZIF-8 without time-consuming experimentation. © 2016 The Royal Society of Chemistry.

Parallel diffusion length on thermal neutrons in rod type lattices

International Nuclear Information System (INIS)

Ahmed, T.; Siddiqui, S.A.M.M.; Khan, A.M.

1981-11-01

Calculation of diffusion lengths of thermal neutrons in lead-water and aluminum water lattices in direction parallel to the rods are performed using one group diffusion equation together with Shevelev transport correction. The formalism is then applied to two practical cases, the Kawasaki (Hitachi) and the Douglas point (Candu) reactor lattices. Our results are in good agreement with the observed values. (author)

Minority carrier diffusion lengths and absorption coefficients in silicon sheet material

Science.gov (United States)

Dumas, K. A.; Swimm, R. T.

1980-01-01

Most of the methods which have been developed for the measurement of the minority carrier diffusion length of silicon wafers require that the material have either a Schottky or an ohmic contact. The surface photovoltage (SPV) technique is an exception. The SPV technique could, therefore, become a valuable diagnostic tool in connection with current efforts to develop low-cost processes for the production of solar cells. The technique depends on a knowledge of the optical absorption coefficient. The considered investigation is concerned with a reevaluation of the absorption coefficient as a function of silicon processing. A comparison of absorption coefficient values showed these values to be relatively consistent from sample to sample, and independent of the sample growth method.

Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

Directory of Open Access Journals (Sweden)

Saiful Islam

2008-01-01

Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

Diffusion as a Ruler: Modeling Kinesin Diffusion as a Length Sensor for Intraflagellar Transport.

Science.gov (United States)

Hendel, Nathan L; Thomson, Matthew; Marshall, Wallace F

2018-02-06

An important question in cell biology is whether cells are able to measure size, either whole cell size or organelle size. Perhaps cells have an internal chemical representation of size that can be used to precisely regulate growth, or perhaps size is just an accident that emerges due to constraint of nutrients. The eukaryotic flagellum is an ideal model for studying size sensing and control because its linear geometry makes it essentially one-dimensional, greatly simplifying mathematical modeling. The assembly of flagella is regulated by intraflagellar transport (IFT), in which kinesin motors carry cargo adaptors for flagellar proteins along the flagellum and then deposit them at the tip, lengthening the flagellum. The rate at which IFT motors are recruited to begin transport into the flagellum is anticorrelated with the flagellar length, implying some kind of communication between the base and the tip and possibly indicating that cells contain some mechanism for measuring flagellar length. Although it is possible to imagine many complex scenarios in which additional signaling molecules sense length and carry feedback signals to the cell body to control IFT, might the already-known components of the IFT system be sufficient to allow length dependence of IFT? Here we investigate a model in which the anterograde kinesin motors unbind after cargo delivery, diffuse back to the base, and are subsequently reused to power entry of new IFT trains into the flagellum. By mathematically modeling and simulating such a system, we are able to show that the diffusion time of the motors can in principle be sufficient to serve as a proxy for length measurement. We found that the diffusion model can not only achieve a stable steady-state length without the addition of any other signaling molecules or pathways, but also is able to produce the anticorrelation between length and IFT recruitment rate that has been observed in quantitative imaging studies. Copyright © 2017 Biophysical

The influence of the surface atomic structure on surface diffusion

International Nuclear Information System (INIS)

Ghaleb, Dominique

1984-03-01

This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

Diffusion length of positrons and positronium investigated using a positronbeam with longitudinal geometry

Science.gov (United States)

van Petegem, S.; Dauwe, C.; van Hoecke, T.; de Baerdemaeker, J.; Segers, D.

2004-09-01

Positronium emission from single crystalline Al2O3 , MgO and vitreous a-SiO2 surfaces was studied as a function of the positron implantation energy E by means of Doppler broadening spectroscopy and Compton-to-peak ratio analysis. When the Ge-detector is in-line with the positron beam, the emission of para-positronium yields a red-shifted fly-away peak with intensity IpPse . An analysis of IpPse versus E for Al2O3 and MgO where no Ps is formed in the bulk (fPs=0) results in positron diffusion lengths L+(Al2O3)=(18±1)nm and L+(MgO)=(14±1)nm , and efficiencies for the emission of Ps by picking up of a surface electron of fpu(Al2O3)=(0.28±0.2) and fpu(MgO)=(0.24±0.2) . For a-SiO2 the bulk Ps fraction is fPs(a-SiO2)=(0.72±0.01) , fpu(a-SiO2)=(0.12±0.01) and the diffusion lengths of positrons, para-positronium and ortho-positronium are L+(SiO2)=(8±2)nm , LpPs(SiO2)=(14.5±2)nm and LoPs(SiO2)=(11±2)=nm . Depending on the specimen-detector geometry the emission of Ps at low implantation energy may cause either an increase or a decrease of the width of the annihilation line shape at low implantation energies.

Theory and experiments on surface diffusion

Energy Technology Data Exchange (ETDEWEB)

Silvestri, W.L.

1998-11-01

The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

Determination of the Pt spin diffusion length by spin-pumping and spin Hall effect

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wei; Pearson, John E.; Hoffmann, Axel [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Vlaminck, Vincent [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Colegio de Ciencias e Ingenería, Universidad San Fransciso de Quito, Quito (Ecuador); Divan, Ralu [Center for Nanoscale Materials, Argonne National Laboratory, Illinois 60439 (United States); Bader, Samuel D. [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Center for Nanoscale Materials, Argonne National Laboratory, Illinois 60439 (United States)

2013-12-09

The spin diffusion length of Pt at room temperature and at 8 K is experimentally determined via spin pumping and spin Hall effect in permalloy/Pt bilayers. Voltages generated during excitation of ferromagnetic resonance from the inverse spin Hall effect and anisotropic magnetoresistance effect were investigated with a broadband approach. Varying the Pt layer thickness gives rise to an evolution of the voltage line shape due to the superposition of the above two effects. By studying the ratio of the two voltage components with the Pt layer thickness, the spin diffusion length of Pt can be directly extracted. We obtain a spin diffusion length of ∼1.2 nm at room temperature and ∼1.6 nm at 8 K.

SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

Directory of Open Access Journals (Sweden)

M. R. Monazzam

2006-10-01

Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

Single atom self-diffusion on nickel surfaces

International Nuclear Information System (INIS)

Tung, R.T.; Graham, W.R.

1980-01-01

Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

Surface diffusion studies by optical diffraction techniques

International Nuclear Information System (INIS)

Xiao, X.D.

1992-11-01

The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

Analysis of surface bond lengths reported for chemisorption on metal surfaces

Science.gov (United States)

Mitchell, K. A. R.

1985-01-01

A review is given of bond length information available from the techniques of surface crystallography (particularly with LEED, SEXAFS and photoelectron diffraction) for chemisorption on well-defined surfaces of metals (M). For adsorbed main-group atoms (X), measured X-M interatomic distances for 38 combinations of X and M have been assessed with a bond order-bond length relation in combination with the Schomaker-Stevenson approach for determining single-bond lengths. When the surface bond orders are fixed primarily by the valency of X, this approach appears to provide a simple framework for predicing X-M surface bond lengths. Further, in cases where agreement has been reached from different surface crystallographic techniques, this framework has the potential for assessing refinements to the surface bonding model (e.g. in determining the roles of the effective surface valency of M, and of coordinate bonding and supplementary π bonding between X and M). Preliminary comparisons of structural data are also given for molecular adsorption (CO and ethylidyne) and for the chemisorption of other metal atoms.

Estimation and calibration of the water isotope differential diffusion length in ice core records

NARCIS (Netherlands)

van der Wel, G.; Fischer, H.; Oerter, H.; Meyer, H.; Meijer, H. A. J.

2015-01-01

Palaeoclimatic information can be retrieved from the diffusion of the stable water isotope signal during firnification of snow. The diffusion length, a measure for the amount of diffusion a layer has experienced, depends on the firn temperature and the accumulation rate. We show that the estimation

Measurement of the diffusion length of thermal neutrons inside graphite

International Nuclear Information System (INIS)

Ertaud, A.; Beauge, R.; Fauquez, H.; De Laboulay, H.; Mercier, C.; Vautrey, L.

1948-11-01

The diffusion length of thermal neutrons inside a given industrial graphite is determined by measuring the neutron density inside a parallelepipedal piling up of graphite bricks (2.10 x 2.10 x 2.442 m). A 3.8 curies (Ra α → Be) source is placed inside the parallelepipedal block of graphite and thin manganese detectors are used. Corrections are added to the unweighted measurements to take into account the effects of the damping of supra-thermal neutrons in the measurement area. These corrections are experimentally deduced from the differential measurements made with a cadmium screen interposed between the source and the first plane of measurement. An error analysis completes the report. The diffusion length obtained is: L = 45.7 cm ± 0.3. The average density of the graphite used is 1.76 and the average apparent density of the piling up is 1.71. (J.S.)

Tracer surface diffusion on UO2

International Nuclear Information System (INIS)

Zhou, S.Y.; Olander, D.R.

1983-06-01

Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

Diffusion and surface alloying of gradient nanostructured metals

Directory of Open Access Journals (Sweden)

Zhenbo Wang

2017-03-01

Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

Determination of thermal neutrons diffusion length in graphite

International Nuclear Information System (INIS)

Garcia Fite, J.

1959-01-01

The diffusion length of thermal neutrons in graphite using the less possible quantity of material has been determined. The proceeding used was the measurement in a graphite pile which has a punctual source of rapid neutrons inside surrounded by a reflector medium (paraffin or water). The measurement was done in the following conditions: a) introducing an aluminium plate between both materials. b) Introducing a cadmium plate between both materials. (Author) 91 refs

Measurement of the diffusion length of thermal neutrons in the beryllium oxide

International Nuclear Information System (INIS)

Koechlin, J.C.; Martelly, J.; Duggal, V.P.

1955-01-01

The diffusion length of thermal neutrons in the beryllium oxide has been obtained while studying the spatial distribution of the neutrons in a massive parallelepiped of this matter placed before the thermal column of the reactor core of Saclay. The mean density of the beryllium oxide (BeO) is 2,95 gr/cm 3 , the mean density of the massif is 2,92 gr/cm 3 . The value of the diffusion length, deducted of the done measures, is: L = 32,7 ± 0,5 cm (likely gap). Some remarks are formulated about the influence of the spectral distribution of the neutrons flux used. (authors) [fr

Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

Directory of Open Access Journals (Sweden)

María I. Vázquez

2015-12-01

Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

Energy Technology Data Exchange (ETDEWEB)

Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

2014-09-15

An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

Modifying glass surfaces via internal diffusion

DEFF Research Database (Denmark)

Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

2010-01-01

leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

Diffusion length variation in 0.5- and 3-MeV-proton-irradiated, heteroepitaxial indium phosphide solar cells

Science.gov (United States)

Jain, Raj K.; Weinberg, Irving; Flood, Dennis J.

1993-01-01

Indium phosphide (InP) solar cells are more radiation resistant than gallium arsenide (GaAs) and silicon (Si) solar cells, and their growth by heteroepitaxy offers additional advantages leading to the development of light weight, mechanically strong, and cost-effective cells. Changes in heteroepitaxial InP cell efficiency under 0.5- and 3-MeV proton irradiations have been explained by the variation in the minority-carrier diffusion length. The base diffusion length versus proton fluence was calculated by simulating the cell performance. The diffusion length damage coefficient, K(sub L), was also plotted as a function of proton fluence.

Plasma diffusion in systems with disrupted magnetic surfaces

International Nuclear Information System (INIS)

Morozov, D.K.; Pogutse, O.P.

1982-01-01

Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

Measurement of neutron diffusion length in heavy concrete

International Nuclear Information System (INIS)

Krejci, D.

2007-04-01

Using an aluminium sampler filled with heavy concrete the neutron diffusion length was determined, measuring thermal and fast neutrons over the whole beam hole with various threshold detectors using gold samples. These calculations should describe the neutron distribution in the whole concrete shield of the reactor and contribute to the investigation of the activation of the concrete shield using reactor parameters like operating time, power and neutron flux. Instrumentation, activation and positioning of the samples in the beam hole of the TRIGA Mark II reactor are described. (nevyjel)

Reactive solid surface morphology variation via ionic diffusion.

Science.gov (United States)

Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

2012-08-14

In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

OpenAIRE

M. R. Monazzam

2006-01-01

Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

Effect of strain on surface diffusion and nucleation

DEFF Research Database (Denmark)

Brune, Harald; Bromann, Karsten; Röder, Holger

1995-01-01

The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

Measurement of diffusion length of thermal neutrons in concrete

International Nuclear Information System (INIS)

Moser, M.

2007-04-01

The diffusion length of neutrons with a medium energy < 0.025 eV in concrete were determined using 4π-β detector and gamma detectors. Then it was possible to determine how deep can neutrons penetrate diverse concrete construction parts in a reactor in operation, with this method the dismantling process of a reactor can be planned in terms of what parts can be removed without danger and what parts can be assumed still are activated. (nevyjel)

Diffusion Length Mapping for Dye-Sensitized Solar Cells

Directory of Open Access Journals (Sweden)

Lucio Cinà

2016-08-01

Full Text Available The diffusion length (L of photogenerated carriers in the nanoporous electrode is a key parameter that summarizes the collection efficiency behavior in dye-sensitized solar cells (DSCs. At present, there are few techniques able to spatially resolve L over the active area of the device. Most of them require contact patterning and, hence, are intrinsically destructive. Here, we present the first electron diffusion length mapping system for DSCs based on steady state incident photon to collected electron (IPCE conversion efficiency ( η I P C E analysis. The measurement is conducted by acquiring complete transmittance ( T DSC and η I P C E spectra from the photo electrode (PE and counter electrode (CE for each spatial point in a raster scan manner. L ( x , y is obtained by a least square fitting of the IPCE ratio spectrum ( I P C E R = η I P C E -CE η I P C E -PE . An advanced feature is the ability to acquire η I P C E spectra using low-intensity probe illumination under weakly-absorbed background light (625 nm with the device biased close to open circuit voltage. These homogeneous conditions permit the linearization of the free electron continuity equation and, hence, to obtain the collection efficiency expressions ( η COL-PE and η COL-CE . The influence of the parameter’s uncertainty has been quantified by a sensitivity study of L. The result has been validated by quantitatively comparing the average value of L map with the value estimated from electrochemical impedance spectroscopy (EIS.

Roles of binding energy and diffusion length of singlet and triplet excitons in organic heterojunction solar cells

International Nuclear Information System (INIS)

Narayan, Monishka Rita; Singh, Jai

2012-01-01

The influence of binding energy and diffusion length on the dissociation of excitons in organic solids is studied. The binding energy and excitonic Bohr radius of singlet and triplet excitons are calculated and compared using the dissociation energy of 0.3 eV, which is provided by the lowest unoccupied molecular orbital offset in heterojunction organic solar cells. A relation between the diffusion coefficient and diffusion length of singlet and triplet excitons is derived using the Foerster and Dexter transfer processes and are plotted as a function of the donor-acceptor separation. The diffusion length reduces nearly to a zero if the distance between donor and acceptor is increased to more than 1.5 nm. It is found that the donor-acceptor separation needs to be ≤ 1.5 nm for easy dissociation on singlet excitons leading to better conversion efficiency in heterojunction organic solar cells. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Roles of binding energy and diffusion length of singlet and triplet excitons in organic heterojunction solar cells

Energy Technology Data Exchange (ETDEWEB)

Narayan, Monishka Rita [Centre for Renewable Energy and Low Emission Technology, Charles Darwin University, Darwin, NT 0909 (Australia); Singh, Jai [School of Engineering and IT, Charles Darwin University, Darwin, NT 0909 (Australia)

2012-12-15

The influence of binding energy and diffusion length on the dissociation of excitons in organic solids is studied. The binding energy and excitonic Bohr radius of singlet and triplet excitons are calculated and compared using the dissociation energy of 0.3 eV, which is provided by the lowest unoccupied molecular orbital offset in heterojunction organic solar cells. A relation between the diffusion coefficient and diffusion length of singlet and triplet excitons is derived using the Foerster and Dexter transfer processes and are plotted as a function of the donor-acceptor separation. The diffusion length reduces nearly to a zero if the distance between donor and acceptor is increased to more than 1.5 nm. It is found that the donor-acceptor separation needs to be {<=} 1.5 nm for easy dissociation on singlet excitons leading to better conversion efficiency in heterojunction organic solar cells. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Hydrodynamic slip length as a surface property

Science.gov (United States)

Ramos-Alvarado, Bladimir; Kumar, Satish; Peterson, G. P.

2016-02-01

Equilibrium and nonequilibrium molecular dynamics simulations were conducted in order to evaluate the hypothesis that the hydrodynamic slip length is a surface property. The system under investigation was water confined between two graphite layers to form nanochannels of different sizes (3-8 nm). The water-carbon interaction potential was calibrated by matching wettability experiments of graphitic-carbon surfaces free of airborne hydrocarbon contamination. Three equilibrium theories were used to calculate the hydrodynamic slip length. It was found that one of the recently reported equilibrium theories for the calculation of the slip length featured confinement effects, while the others resulted in calculations significantly hindered by the large margin of error observed between independent simulations. The hydrodynamic slip length was found to be channel-size independent using equilibrium calculations, i.e., suggesting a consistency with the definition of a surface property, for 5-nm channels and larger. The analysis of the individual trajectories of liquid particles revealed that the reason for observing confinement effects in 3-nm nanochannels is the high mobility of the bulk particles. Nonequilibrium calculations were not consistently affected by size but by noisiness in the smallest systems.

Diffusion effects on volume-selective NMR at small length scales

International Nuclear Information System (INIS)

Gaedke, Achim

2009-01-01

In this thesis, the interplay between diffusion and relaxation effects in spatially selective NMR experiments at short length scales is explored. This is especially relevant in the context of both conventional and mechanically detected MRI at (sub)micron resolution in biological specimens. Recent results on selectively excited very thin slices showed an in-slice-magnetization recovery orders of magnitude faster than the longitudinal relaxation time T1. However, those experiments were run on fully relaxed samples while MRI and especially mechanically detected NMR experiments are typically run in a periodic fashion with repetition times far below T1. The main purpose of this work therefore was to extend the study of the interplay between diffusion and longitudinal relaxation to periodic excitations. In some way, this is inverse phenomenon to the DESIRE (Diffusive Enhancement of SIgnal and REsolution) approach, proposed 1992 by Lauterbur. Experiments on periodically excited thin slices were carried out at a dedicated static field gradient cryomagnet with magnetic field gradients up to 180 T/m. In order to obtain plane slices, an appropriate isosurface of the gradient magnet had to be identified. It was found at a field of 3.8 T with a gradient of 73 T/m. In this field, slices down to a thickness of 3.2 μm could be excited. The detection of the NMR signal was done using FIDs instead of echoes as the excitation bandwidth of those thin slices is sufficiently small to observe FIDs which are usually considered to be elusive to detection in such strong static field gradients. A simulation toolbox based on the full Bloch-Torrey-equation was developed to describe the excitation and the formation of NMR signals under those unusual conditions as well as the interplay of diffusion and magnetization recovery. Both the experiments and the simulations indicate that diffusion effects lead to a strongly enhanced magnetization modulation signal also under periodic excitation

Chemical diffusion on solid surfaces. Final report

International Nuclear Information System (INIS)

Hudson, J.B.

1980-12-01

The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

International Nuclear Information System (INIS)

Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

2002-01-01

The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

Correlation of optical emission and turbulent length scale in a coaxial jet diffusion flame

OpenAIRE

松山, 新吾; Matsuyama, Shingo

2014-01-01

This article investigates the correlation between optical emission and turbulent length scale in a coaxial jet diffusion flame. To simulate the H2O emission from an H2/O2 diffusion flame, radiative transfer is calculated on flame data obtained by numerical simulation. H2O emission characteristics are examined for a one-dimensional opposed-flow diffusion flame. The results indicate that H2O emission intensity is linearly dependent on flame thickness. The simulation of H2O emission is then exte...

Diffusion length variation and proton damage coefficients for InP/In(x)Ga(1-x)As/GaAs solar cells

Science.gov (United States)

Jain, R. K.; Weinberg, I.; Flood, D. J.

1993-01-01

Indium phosphide solar cells are more radiation resistant than gallium arsenide and silicon solar cells, and their growth by heteroepitaxy offers additional advantages leading to the development of lighter, mechanically strong and cost-effective cells. Changes in heteroepitaxial InP cell efficiency under 0.5 and 3 MeV proton irradiations are explained by the variation in the minority-carrier diffusion length. The base diffusion length versus proton fluence is calculated by simulating the cell performance. The diffusion length damage coefficient K(L) is plotted as a function of proton fluence.

Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

International Nuclear Information System (INIS)

Ma, Z.; Whitley, R.D.; Wang, N.H.L.

1996-01-01

A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

Friction and diffusion dynamics of adsorbates at surfaces

NARCIS (Netherlands)

Fusco, C.

2005-01-01

A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

Magnetic field dependence of the magnon spin diffusion length in the magnetic insulator yttrium iron garnet

NARCIS (Netherlands)

Cornelissen, L. J.; van Wees, B. J.

2016-01-01

We investigated the effect of an external magnetic field on the diffusive spin transport by magnons in the magnetic insulator Y3Fe5O12, using a nonlocal magnon transport measurement geometry. We observed a decrease in magnon spin diffusion length lambda(m) for increasing field strengths, where

A diffuse radar scattering model from Martian surface rocks

Science.gov (United States)

Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

1987-01-01

Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

Direct measurement of Cu surface self-diffusion on a checked surface

International Nuclear Information System (INIS)

Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

1976-01-01

A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

Laser-induced desorption determinations of surface diffusion on Rh(111)

International Nuclear Information System (INIS)

Seebauer, E.G.; Schmidt, L.D.

1987-01-01

Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

International Nuclear Information System (INIS)

Cousty, J.P.

1981-12-01

In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

Stochastic models for surface diffusion of molecules

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2014-07-28

We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

Nonthermal Effects of Photon Illumination on Surface Diffusion

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

1998-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

Effects of Surface Dipole Lengths on Evaporation of Tiny Water Aggregation

International Nuclear Information System (INIS)

Wang Shen; Wan Rongzheng; Fang Haiping; Tu Yusong

2013-01-01

Using molecular dynamics simulation, we compared evaporation behavior of a tiny amount of water molecules adsorbed on solid surfaces with different dipole lengths, including surface dipole lengths of 1 fold, 2 folds, 4 folds, 6 folds and 8 folds of 0.14 nm and different charges from 0.1e to 0.9e. Surfaces with short dipole lengths (1-fold system) can always maintain hydrophobic character and the evaporation speeds are not influenced, whether the surface charges are enhanced or weakened; but when surface dipole lengths get to 8 folds, surfaces become more hydrophilic as the surface charge increases, and the evaporation speeds increase gradually and monotonically. By tuning dipole lengths from 1-fold to 8-fold systems, we confirmed non-monotonic variation of the evaporation flux (first increases, then decreases) in 4 fold system with charges (0.1e–0.7e), reported in our previous paper [S. Wang, et al., J. Phys. Chem. B 116 (2012) 13863], and also show the process from the enhancement of this unexpected non-monotonic variation to its vanishment with surface dipole lengths increasing. Herein, we demonstrated two key factors to influence the evaporation flux of a tiny amount of water molecules adsorbed on solid surfaces: the exposed surficial area of water aggregation from where the water molecules can evaporate directly and the attraction potential from the substrate hindering the evaporation. In addition, more interestingly, we showed extra steric effect of surface dipoles on further increase of evaporation flux for 2-folds, 4-folds, 6-folds and 8-folds systems with charges around larger than 0.7e. (The steric effect is first reported by parts of our authors [C. Wang, et al., Sci. Rep. 2 (2012) 358]). This study presents a complete physical picture of the influence of surface dipole lengths on the evaporation behavior of the adsorbed tiny amount of water. (condensed matter: structural, mechanical, and thermal properties)

Linear response theory of activated surface diffusion with interacting adsorbates

Energy Technology Data Exchange (ETDEWEB)

Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

2010-05-12

Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

Slip length measurement of confined air flow on three smooth surfaces.

Science.gov (United States)

Pan, Yunlu; Bhushan, Bharat; Maali, Abdelhamid

2013-04-02

An experimental measurement of the slip length of air flow close to three different solid surfaces is presented. The substrate was driven by a nanopositioner moving toward an oscillating glass sphere glued to an atomic force microscopy (AFM) cantilever. A large separation distance was used to get more effective data. The slip length value was obtained by analyzing the amplitude and phase data of the cantilever. The measurements show that the slip length does not depend on the oscillation amplitude of the cantilever. Because of the small difference among the slip lengths of the three surfaces, a simplified analysis method was used. The results show that on glass, graphite, and mica surfaces the slip lengths are 98, 234, and 110 nm, respectively.

Slip length crossover on a graphene surface

Energy Technology Data Exchange (ETDEWEB)

Liang, Zhi, E-mail: liangz3@rpi.edu [Rensselaer Nanotechnology Center, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Keblinski, Pawel, E-mail: keplip@rpi.edu [Rensselaer Nanotechnology Center, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Department of Materials Science and Engineering, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)

2015-04-07

Using equilibrium and non-equilibrium molecular dynamics simulations, we study the flow of argon fluid above the critical temperature in a planar nanochannel delimited by graphene walls. We observe that, as a function of pressure, the slip length first decreases due to the decreasing mean free path of gas molecules, reaches the minimum value when the pressure is close to the critical pressure, and then increases with further increase in pressure. We demonstrate that the slip length increase at high pressures is due to the fact that the viscosity of fluid increases much faster with pressure than the friction coefficient between the fluid and the graphene. This behavior is clearly exhibited in the case of graphene due to a very smooth potential landscape originating from a very high atomic density of graphene planes. By contrast, on surfaces with lower atomic density, such as an (100) Au surface, the slip length for high fluid pressures is essentially zero, regardless of the nature of interaction between fluid and the solid wall.

Radiation induced diffusion as a method to protect surface

International Nuclear Information System (INIS)

Baumvol, I.J.R.

1980-01-01

Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

Diffusion accessibility as a method for visualizing macromolecular surface geometry.

Science.gov (United States)

Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

2015-10-01

Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

Strongly extended diffusion length for the nonequilibrium magnons in Y3F e5O12 by photoexcitation

Science.gov (United States)

Wang, S. H.; Li, G.; Guo, E. J.; Zhao, Y.; Wang, J. Y.; Zou, L. K.; Yan, H.; Cai, J. W.; Zhang, Z. T.; Wang, M.; Tian, Y. Y.; Zheng, X. L.; Sun, J. R.; Jin, K. X.

2018-05-01

Y3F e5O12 (YIG) is known for its long magnon diffusion length. Although it has the known lowest damping rate, an even longer diffusion distance is still highly desired since it may lead to a much more efficient information transmission and processing. While most of previous works focused on the generation and detection of magnons in YIG, here we demonstrate how to depress the damping rate during the diffusion of magnon. By selectively exciting the spin state transition of the Fe ions in YIG, we successfully increase magnon diffusion length by one order of magnitude, i.e., from the previous reported ˜10 μm up to ˜156 μm (for the sample prepared by liquid phase epitaxy) and ˜180 μm (for the sample prepared by pulsed laser deposition) at room temperature. The diffusion length, determined by nonlocal geometry, is ˜30 μm for the magnons induced by visible light and above 150 μm for the laser of 980 nm. In addition to thermal gradient, light excitation affects the electron configuration of the F e3 + ion in YIG. Long-wavelength laser is more effective since it causes a transition of the F e3 + ions in Fe O6 octahedron from a high spin to a low spin state and thus causes a magnon softening which favors a long-distance diffusion. The present work paves the way toward an efficient tuning of magnon transport which is crucially important for magnon spintronics.

Turbulent jet diffusion flame length evolution with cross flows in a sub-pressure atmosphere

International Nuclear Information System (INIS)

Wang, Qiang; Hu, Longhua; Zhang, Xiaozheng; Zhang, Xiaolei; Lu, Shouxiang; Ding, Hang

2015-01-01

Highlights: • Quantifying turbulent jet diffusion flame length with cross flows. • Unique data revealed for a sub-atmospheric pressure. • Non-dimensional global correlation proposed for flame trajectory-line length. - Abstract: This paper investigates the evolution characteristics of turbulent jet diffusion flame (flame trajectory-line length, flame height in vertical jet direction) with increasing cross flows in a sub-pressure (64 kPa) atmosphere. The combined effect of cross flow and a special sub-pressure atmosphere condition is revealed, where no data is available in the literatures. Experiments are carried out with a wind tunnel built specially in Lhasa city (altitude: 3650 m; pressure: 64 kPa) and in Hefei city (altitude: 50 m; pressure: 100 kPa), using nozzles with diameter of 3 mm, 4 mm and 5 mm and propane as fuel. It is found that, as cross flow air speed increases from zero, the flame trajectory-line length firstly decreases and then becomes almost stable (for relative small nozzle, 3 mm in this study) or increases (for relative large nozzle, 4 mm and 5 mm in this study) beyond a transitional critical cross flow air speed in normal pressure, however decreases monotonically until being blown-out in the sub-pressure atmosphere. The flame height in jet direction decreases monotonically with cross air flow speed and then reaches a steady value in both pressures. For the transitional state of flame trajectory-line length with increasing cross air flow speed, the corresponding critical cross flow air speed is found to be proportional to the fuel jet velocity, meanwhile independent of nozzle diameter. Correlation models are proposed for the flame height in jet direction and the flame trajectory-line length for both ambient pressures, which are shown to be in good agreement with the experimental results.

Measurement of the diffusion length of thermal neutrons inside graphite; Mesure de la longueur de diffusion des neutrons thermiques dans le graphite

Energy Technology Data Exchange (ETDEWEB)

Ertaud, A; Beauge, R; Fauquez, H; De Laboulay, H; Mercier, C; Vautrey, L

1948-11-01

The diffusion length of thermal neutrons inside a given industrial graphite is determined by measuring the neutron density inside a parallelepipedal piling up of graphite bricks (2.10 x 2.10 x 2.442 m). A 3.8 curies (Ra {alpha} {yields} Be) source is placed inside the parallelepipedal block of graphite and thin manganese detectors are used. Corrections are added to the unweighted measurements to take into account the effects of the damping of supra-thermal neutrons in the measurement area. These corrections are experimentally deduced from the differential measurements made with a cadmium screen interposed between the source and the first plane of measurement. An error analysis completes the report. The diffusion length obtained is: L = 45.7 cm {+-} 0.3. The average density of the graphite used is 1.76 and the average apparent density of the piling up is 1.71. (J.S.)

Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

International Nuclear Information System (INIS)

Hou, W C; Hong, Franklin Chau-Nan

2009-01-01

This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

Improved longitudinal length accuracy of gross tumor volume delineation with diffusion weighted magnetic resonance imaging for esophageal squamous cell carcinoma

International Nuclear Information System (INIS)

Hou, Dong-Liang; Shi, Gao-Feng; Gao, Xian-Shu; Asaumi, Junichi; Li, Xue-Ying; Liu, Hui; Yao, Chen; Chang, Joe Y

2013-01-01

To analyze the longitudinal length accuracy of gross tumor volume (GTV) delineation with diffusion weighted magnetic resonance imaging for esophageal squamous cell carcinoma (SCC). Forty-two patients from December 2011 to June 2012 with esophageal SCC who underwent radical surgery were analyzed. Routine computed tomography (CT) scan, T2-weighted MRI and diffusion weighted magnetic resonance imaging (DWI) were employed before surgery. Diffusion-sensitive gradient b-values were taken at 400, 600, and 800 s/mm 2 . Gross tumor volumes (GTV) were delineated using CT, T2-weighted MRI and DWI on different b-value images. GTV longitude length measured using the imaging modalities listed above was compared with pathologic lesion length to determine the most accurate imaging modality. CMS Xio radiotherapy planning system was used to fuse DWI scans and CT images to investigate the possibility of delineating GTV on fused images. The differences between the GTV length according to CT, T2-weighted MRI and pathology were 3.63 ± 12.06 mm and 3.46 ± 11.41 mm, respectively. When the diffusion-sensitive gradient b-value was 400, 600, and 800 s/mm 2 , the differences between the GTV length using DWI and pathology were 0.73 ± 6.09 mm, -0.54 ± 6.03 mm and −1.58 ± 5.71 mm, respectively. DWI scans and CT images were fused accurately using the radiotherapy planning system. GTV margins were depicted clearly on fused images. DWI displays esophageal SCC lengths most precisely when compared with CT or regular MRI. DWI scans fused with CT images can be used to improve accuracy to delineate GTV in esophageal SCC

Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

Directory of Open Access Journals (Sweden)

Xi Shao

2016-03-01

Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

Palladium diffusion into bulk copper via the (100) surface

Energy Technology Data Exchange (ETDEWEB)

Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

2009-08-05

Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2016-08-15

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Science.gov (United States)

Naderi, Ebadollah; Ghaisas, S. V.

2016-08-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

International Nuclear Information System (INIS)

Naderi, Ebadollah; Ghaisas, S. V.

2016-01-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

Diffusion of particles adsorbed on reconstructive surface

Czech Academy of Sciences Publication Activity Database

Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

2005-01-01

Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

DEFF Research Database (Denmark)

Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

2012-01-01

This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

Semiconductor surface diffusion: Nonthermal effects of photon illumination

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

2000-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

Science.gov (United States)

Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

2017-06-01

Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

Turbulent flows over superhydrophobic surfaces with shear-dependent slip length

Science.gov (United States)

Khosh Aghdam, Sohrab; Seddighi, Mehdi; Ricco, Pierre

2015-11-01

Motivated by recent experimental evidence, shear-dependent slip length superhydrophobic surfaces are studied. Lyapunov stability analysis is applied in a 3D turbulent channel flow and extended to the shear-dependent slip-length case. The feedback law extracted is recognized for the first time to coincide with the constant-slip-length model widely used in simulations of hydrophobic surfaces. The condition for the slip parameters is found to be consistent with the experimental data and with values from DNS. The theoretical approach by Fukagata (PoF 18.5: 051703) is employed to model the drag-reduction effect engendered by the shear-dependent slip-length surfaces. The estimated drag-reduction values are in very good agreement with our DNS data. For slip parameters and flow conditions which are potentially realizable in the lab, the maximum computed drag reduction reaches 50%. The power spent by the turbulent flow on the walls is computed, thereby recognizing the hydrophobic surfaces as a passive-absorbing drag-reduction method, as opposed to geometrically-modifying techniques that do not consume energy, e.g. riblets, hence named passive-neutral. The flow is investigated by visualizations, statistical analysis of vorticity and strain rates, and quadrants of the Reynolds stresses. Part of this work was funded by Airbus Group. Simulations were performed on the ARCHER Supercomputer (UKTC Grant).

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1988-09-01

The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

Anomaly in the Chain Length Dependence of n-Alkane Diffusion in ZIF-4 Metal-Organic Frameworks.

Science.gov (United States)

Hwang, Seungtaik; Gopalan, Arun; Hovestadt, Maximilian; Piepenbreier, Frank; Chmelik, Christian; Hartmann, Martin; Snurr, Randall Q; Kärger, Jörg

2018-03-15

Molecular diffusion is commonly found to slow down with increasing molecular size. Deviations from this pattern occur in some host materials with pore sizes approaching the diameters of the guest molecules. A variety of theoretical models have been suggested to explain deviations from this pattern, but robust experimental data are scarcely available. Here, we present such data, obtained by monitoring the chain length dependence of the uptake of n- alkanes in the zeolitic imidazolate framework ZIF-4. A monotonic decrease in diffusivity from ethane to n- butane was observed, followed by an increase for n- pentane, and another decrease for n- hexane. This observation was confirmed by uptake measurements with n- butane/ n -pentane mixtures, which yield faster uptake of n- pentane. Further evidence is provided by the observation of overshooting effects, i.e., by transient n- pentane concentrations exceeding the (eventually attained) equilibrium value. Accompanying grand canonical Monte Carlo simulations reveal, for the larger n- alkanes, significant differences between the adsorbed and gas phase molecular configurations, indicating strong confinement effects within ZIF-4, which, with increasing chain length, may be expected to give rise to configurational shifts facilitating molecular propagation at particular chain lengths.

Anomaly in the Chain Length Dependence of n-Alkane Diffusion in ZIF-4 Metal-Organic Frameworks

Directory of Open Access Journals (Sweden)

Seungtaik Hwang

2018-03-01

Full Text Available Molecular diffusion is commonly found to slow down with increasing molecular size. Deviations from this pattern occur in some host materials with pore sizes approaching the diameters of the guest molecules. A variety of theoretical models have been suggested to explain deviations from this pattern, but robust experimental data are scarcely available. Here, we present such data, obtained by monitoring the chain length dependence of the uptake of n-alkanes in the zeolitic imidazolate framework ZIF-4. A monotonic decrease in diffusivity from ethane to n-butane was observed, followed by an increase for n-pentane, and another decrease for n-hexane. This observation was confirmed by uptake measurements with n-butane/n-pentane mixtures, which yield faster uptake of n-pentane. Further evidence is provided by the observation of overshooting effects, i.e., by transient n-pentane concentrations exceeding the (eventually attained equilibrium value. Accompanying grand canonical Monte Carlo simulations reveal, for the larger n-alkanes, significant differences between the adsorbed and gas phase molecular configurations, indicating strong confinement effects within ZIF-4, which, with increasing chain length, may be expected to give rise to configurational shifts facilitating molecular propagation at particular chain lengths.

Measurement of the diffusion length of thermal neutrons in the beryllium oxide; Mesure de la longueur de diffusion des neutrons thermiques dans l'oxyde de beryllium

Energy Technology Data Exchange (ETDEWEB)

Koechlin, J C; Martelly, J; Duggal, V P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1955-07-01

The diffusion length of thermal neutrons in the beryllium oxide has been obtained while studying the spatial distribution of the neutrons in a massive parallelepiped of this matter placed before the thermal column of the reactor core of Saclay. The mean density of the beryllium oxide (BeO) is 2,95 gr/cm{sup 3}, the mean density of the massif is 2,92 gr/cm{sup 3}. The value of the diffusion length, deducted of the done measures, is: L = 32,7 {+-} 0,5 cm (likely gap). Some remarks are formulated about the influence of the spectral distribution of the neutrons flux used. (authors) [French] La longueur de diffusion des neutrons thermiques dans l'oxyde de beryllium a ete obtenue en etudiant la repartition spatiale des neutrons dans un massif parallelepipedique de cette matiere placee devant la colonne thermique de la Pile de Saclay. La densite moyenne de l'oxyde de beryllium (BeO) est de 2,95 gr/cm{sup 3}, la densite moyenne du massif de 2,92 gr/cm{sup 3}. La valeur de la longueur de diffusion, deduite des mesures effectuees est: L 32,7 {+-} 0,5 cm (ecart probable). Des remarques sont formulees quant a l'influence de la repartition spectrale du flux de neutrons utilise. (auteurs)

Bulk-mediated surface diffusion: non-Markovian desorption dynamics

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

2005-01-01

Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

Energy Technology Data Exchange (ETDEWEB)

Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

1988-03-31

In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

Diffusion of N adatoms on the Fe(100) surface

DEFF Research Database (Denmark)

Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

2000-01-01

The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

International Nuclear Information System (INIS)

Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

2016-01-01

Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

Dynamics of Phenanthrenequinone on Carbon Nano-Onion Surfaces Probed by Quasielastic Neutron Scattering

International Nuclear Information System (INIS)

Mamontov, Eugene; Brown, Gilbert M.; Overbury, Steven H.; Mavila Chathoth, Suresh

2012-01-01

We used quasielastic neutron scattering (QENS) to study the dynamics of phenanthrenequinone (PQ) on the surface of onion-like carbon (OLC), or so called carbon onions, as a function of surface coverage and temperature. For both the high- and low-coverage samples, we observed two diffusion processes; a faster process and nearly an order of magnitude slower process. On the high-coverage surface, the slow diffusion process is of long-range translational character, whereas the fast diffusion process is spatially localized on the length scale of ∼ 4.7. On the low-coverage surface, both diffusion processes are spatially localized; on the same length scale of ∼ 4.7 for the fast diffusion and a somewhat larger length scale for the slow diffusion. Arrhenius temperature dependence is observed except for the long-range diffusion on the high-coverage surface. We attribute the fast diffusion process to the generic localized in-cage dynamics of PQ molecules, and the slow diffusion process to the long-range translational dynamics of PQ molecules, which, depending on the coverage, may be either spatially restricted, or long-range. On the low-coverage surface, uniform surface coverage is not attained, and the PQ molecules experience the effect of spatial constraints on their long-range translational dynamics. Unexpectedly, the dynamics of PQ molecules on OLC as a function of temperature and surface coverage bears qualitative resemblance to the dynamics of water molecules on oxide surfaces, including practically temperature-independent residence times for the low-coverage surface. The dynamics features that we observed may be universal across different classes of surface adsorbates.

Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

Science.gov (United States)

Lee, Myoung-Jae; Jung, Young-Dae

2017-02-01

The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

Cholesterol enhances surface water diffusion of phospholipid bilayers

Energy Technology Data Exchange (ETDEWEB)

Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

2014-12-14

Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

International Nuclear Information System (INIS)

Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

2016-01-01

The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

Measuring Charge Carrier Diffusion in Coupled Colloidal Quantum Dot Solids

KAUST Repository

Zhitomirsky, David

2013-06-25

Colloidal quantum dots (CQDs) are attractive materials for inexpensive, room-temperature-, and solution-processed optoelectronic devices. A high carrier diffusion length is desirable for many CQD device applications. In this work we develop two new experimental methods to investigate charge carrier diffusion in coupled CQD solids under charge-neutral, i.e., undepleted, conditions. The methods take advantage of the quantum-size-effect tunability of our materials, utilizing a smaller-bandgap population of quantum dots as a reporter system. We develop analytical models of diffusion in 1D and 3D structures that allow direct extraction of diffusion length from convenient parametric plots and purely optical measurements. We measure several CQD solids fabricated using a number of distinct methods and having significantly different doping and surface ligand treatments. We find that CQD materials recently reported to achieve a certified power conversion efficiency of 7% with hybrid organic-inorganic passivation have a diffusion length of 80 ± 10 nm. The model further allows us to extract the lifetime, trap density, mobility, and diffusion coefficient independently in each material system. This work will facilitate further progress in extending the diffusion length, ultimately leading to high-quality CQD solid semiconducting materials and improved CQD optoelectronic devices, including CQD solar cells. © 2013 American Chemical Society.

MAGNETIC QUENCHING OF TURBULENT DIFFUSIVITY: RECONCILING MIXING-LENGTH THEORY ESTIMATES WITH KINEMATIC DYNAMO MODELS OF THE SOLAR CYCLE

International Nuclear Information System (INIS)

Munoz-Jaramillo, Andres; Martens, Petrus C. H.; Nandy, Dibyendu

2011-01-01

The turbulent magnetic diffusivity in the solar convection zone is one of the most poorly constrained ingredients of mean-field dynamo models. This lack of constraint has previously led to controversy regarding the most appropriate set of parameters, as different assumptions on the value of turbulent diffusivity lead to radically different solar cycle predictions. Typically, the dynamo community uses double-step diffusivity profiles characterized by low values of diffusivity in the bulk of the convection zone. However, these low diffusivity values are not consistent with theoretical estimates based on mixing-length theory, which suggest much higher values for turbulent diffusivity. To make matters worse, kinematic dynamo simulations cannot yield sustainable magnetic cycles using these theoretical estimates. In this work, we show that magnetic cycles become viable if we combine the theoretically estimated diffusivity profile with magnetic quenching of the diffusivity. Furthermore, we find that the main features of this solution can be reproduced by a dynamo simulation using a prescribed (kinematic) diffusivity profile that is based on the spatiotemporal geometric average of the dynamically quenched diffusivity. This bridges the gap between dynamically quenched and kinematic dynamo models, supporting their usage as viable tools for understanding the solar magnetic cycle.

Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

Science.gov (United States)

Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

2017-07-01

Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

Classically exact surface diffusion constants at arbitrary temperature

International Nuclear Information System (INIS)

Voter, A.F.; Cohen, J.M.

1989-01-01

An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

International Nuclear Information System (INIS)

Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

1997-01-01

The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

Science.gov (United States)

Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

2014-05-01

Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

Science.gov (United States)

Hatakeyama, S.; Horiuchi, W.; Kohama, A.

2018-05-01

The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

Effective slip lengths for flows over surfaces with nanobubbles: the effects of finite slip

International Nuclear Information System (INIS)

Hendy, S C; Lund, N J

2009-01-01

We consider effective slip lengths for flows of simple liquids over surfaces contaminated by gaseous nanobubbles. In particular, we examine whether the effects of finite slip over the liquid-bubble interface are important in limiting effective slip lengths over such surfaces. Using an expression that interpolates between the perfect slip and finite slip regimes for flow over bubbles, we conclude that for the bubble dimensions and coverages typically reported in the literature the effects of finite slip are secondary, reducing effective slip lengths by only 10%. Further, we find that nanobubbles do not significantly increase slip lengths beyond those reported for bare hydrophobic surfaces.

The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

International Nuclear Information System (INIS)

Durakanoglu, S.

2004-01-01

Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

Science.gov (United States)

Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

Science.gov (United States)

Chu, Khim Hoong

2017-11-09

Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

International Nuclear Information System (INIS)

Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

2007-01-01

Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

Jump rates for surface diffusion of large molecules from first principles

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2015-04-21

We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

Surface sealing using self-assembled monolayers and its effect on metal diffusion in porous low-k dielectrics studied using monoenergetic positron beams

International Nuclear Information System (INIS)

Uedono, Akira; Armini, Silvia; Zhang, Yu; Kakizaki, Takeaki; Krause-Rehberg, Reinhard; Anwand, Wolfgang; Wagner, Andreas

2016-01-01

Graphical abstract: - Highlights: • Pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the low-k film. • For the sample without the SAM sealing process, metal atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. Almost all pore interiors were covered by those metals. • For the sample damaged by a plasma etch treatment before the SAM sealing process, self-assembled molecules diffused into the OSG film, and they were preferentially trapped by larger pores. - Abstract: Surface sealing effects on the diffusion of metal atoms in porous organosilicate glass (OSG) films were studied by monoenergetic positron beams. For a Cu(5 nm)/MnN(3 nm)/OSG(130 nm) sample fabricated with pore stuffing, C_4F_8 plasma etch, unstuffing, and a self-assembled monolayer (SAM) sealing process, it was found that pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the OSG film. For the sample without the SAM sealing process, metal (Cu and Mn) atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. As a result, almost all pore interiors were covered with those metals. For the sample damaged by an Ar/C_4F_8 plasma etch treatment before the SAM sealing process, SAMs diffused into the OSG film, and they were preferentially trapped by larger pores. The cubic pore side length in these pores containing self-assembled molecules was estimated to be 0.7 nm. Through this work, we have demonstrated that monoenergetic positron beams are a powerful tool for characterizing capped porous films and the trapping of atoms and molecules by pores.

New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

DEFF Research Database (Denmark)

Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

2017-01-01

Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

International Nuclear Information System (INIS)

Ionescu, M.

1977-01-01

An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

Science.gov (United States)

Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

2015-05-21

Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

Coupling between diffusion and orientation of pentacene molecules on an organic surface.

Science.gov (United States)

Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

2016-04-01

The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

Investigation of ion diffusion towards plasmonic surfaces

International Nuclear Information System (INIS)

Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

2013-01-01

Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

On the diffusion and self-trapping of surface dimers

Science.gov (United States)

Kappus, W.

1982-03-01

The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

Energy Technology Data Exchange (ETDEWEB)

Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

1996-11-01

The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

DEFF Research Database (Denmark)

Hjelt, T.; Vattulainen, Ilpo Tapio

2000-01-01

stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

Convergence of surface diffusion parameters with model crystal size

Science.gov (United States)

Cohen, Jennifer M.; Voter, Arthur F.

1994-07-01

A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

Diffusion of particles on a fluctuating surface

Czech Academy of Sciences Publication Activity Database

Tarasenko, Alexander; Jastrabík, Lubomír

2011-01-01

Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

Collisional diffusion in a torus with imperfect magnetic surfaces

International Nuclear Information System (INIS)

White, R.B.

1983-03-01

A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

Past surface temperatures at the NorthGRIP drill site from the difference in firn diffusion of water isotopes

DEFF Research Database (Denmark)

Simonsen, Sebastian Bjerregaard; Johnsen, S. J.; Popp, T. J.

2011-01-01

A new ice core paleothermometer is introduced based on the temperature dependent diffusion of the stable water isotopes in the firn. A new parameter called differential diffusion length is defined as the difference between the diffusion length of the two stable water isotopologues 2H1H16O and 1H218......O. A model treatment of the diffusion process of the firn and the ice is presented along with a method of retrieving the diffusion signal from the ice core record of water isotopes using spectral methods. The model shows how the diffusion process is highly dependent on the inter-annual variations...... warmer than observed in other ice core based temperature reconstructions. The mechanisms behind this behaviour are not fully understood. The method shows the need of an expansion of high resolution stable water isotope datasets from ice cores. However, the new ice core paleothermometer presented here...

Molecular diffusion of stable water isotopes in polar firn as a proxy for past temperatures

Science.gov (United States)

Holme, Christian; Gkinis, Vasileios; Vinther, Bo M.

2018-03-01

Polar precipitation archived in ice caps contains information on past temperature conditions. Such information can be retrieved by measuring the water isotopic signals of δ18O and δD in ice cores. These signals have been attenuated during densification due to molecular diffusion in the firn column, where the magnitude of the diffusion is isotopologue specific and temperature dependent. By utilizing the differential diffusion signal, dual isotope measurements of δ18O and δD enable multiple temperature reconstruction techniques. This study assesses how well six different methods can be used to reconstruct past surface temperatures from the diffusion-based temperature proxies. Two of the methods are based on the single diffusion lengths of δ18O and δD , three of the methods employ the differential diffusion signal, while the last uses the ratio between the single diffusion lengths. All techniques are tested on synthetic data in order to evaluate their accuracy and precision. We perform a benchmark test to thirteen high resolution Holocene data sets from Greenland and Antarctica, which represent a broad range of mean annual surface temperatures and accumulation rates. Based on the benchmark test, we comment on the accuracy and precision of the methods. Both the benchmark test and the synthetic data test demonstrate that the most precise reconstructions are obtained when using the single isotope diffusion lengths, with precisions of approximately 1.0 °C . In the benchmark test, the single isotope diffusion lengths are also found to reconstruct consistent temperatures with a root-mean-square-deviation of 0.7 °C . The techniques employing the differential diffusion signals are more uncertain, where the most precise method has a precision of 1.9 °C . The diffusion length ratio method is the least precise with a precision of 13.7 °C . The absolute temperature estimates from this method are also shown to be highly sensitive to the choice of fractionation factor

Assessing Telomere Length Using Surface Enhanced Raman Scattering

Science.gov (United States)

Zong, Shenfei; Wang, Zhuyuan; Chen, Hui; Cui, Yiping

2014-11-01

Telomere length can provide valuable insight into telomeres and telomerase related diseases, including cancer. Here, we present a brand-new optical telomere length measurement protocol using surface enhanced Raman scattering (SERS). In this protocol, two single strand DNA are used as SERS probes. They are labeled with two different Raman molecules and can specifically hybridize with telomeres and centromere, respectively. First, genome DNA is extracted from cells. Then the telomere and centromere SERS probes are added into the genome DNA. After hybridization with genome DNA, excess SERS probes are removed by magnetic capturing nanoparticles. Finally, the genome DNA with SERS probes attached is dropped onto a SERS substrate and subjected to SERS measurement. Longer telomeres result in more attached telomere probes, thus a stronger SERS signal. Consequently, SERS signal can be used as an indicator of telomere length. Centromere is used as the inner control. By calibrating the SERS intensity of telomere probe with that of the centromere probe, SERS based telomere measurement is realized. This protocol does not require polymerase chain reaction (PCR) or electrophoresis procedures, which greatly simplifies the detection process. We anticipate that this easy-operation and cost-effective protocol is a fine alternative for the assessment of telomere length.

Plateau diffusion coefficient for arbitrary flux surface geometry

International Nuclear Information System (INIS)

Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

1981-03-01

A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

A new approach to the problem of bulk-mediated surface diffusion.

Science.gov (United States)

Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

2015-08-28

This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Tang Jianfeng

2011-01-01

The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

DEFF Research Database (Denmark)

Johannesson, Björn

2008-01-01

Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

Science.gov (United States)

M. C. Sagis, Leonard

2001-03-01

In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

Dimer-flipping-assisted diffusion on a Si(001) surface

International Nuclear Information System (INIS)

Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

2000-01-01

The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

Spin-diffusion lengths in metals and alloys, and spin-flipping at metal/metal interfaces: an experimentalist's critical review

International Nuclear Information System (INIS)

Bass, Jack; Pratt, William P Jr

2007-01-01

In magnetoresistance (MR) studies of magnetic multilayers composed of combinations of ferromagnetic (F) and non-magnetic (N) metals, the magnetic moment (or related 'spin') of each conduction electron plays a crucial role, supplementary to that of its charge. While initial analyses of MR in such multilayers assumed that the direction of the spin of each electron stayed fixed as the electron transited the multilayer, we now know that this is true only in a certain limit. Generally, the spins 'flip' in a distance characteristic of the metal, its purity, and the temperature. They can also flip at F/N or N1/N2 interfaces. In this review we describe how to measure the lengths over which electron moments flip in pure metals and alloys, and the probability of spin-flipping at metallic interfaces. Spin-flipping within metals is described by a spin-diffusion length, l sf M , where the metal M F or N. Spin-diffusion lengths are the characteristic lengths in the current-perpendicular-to-plane (CPP) and lateral non-local (LNL) geometries that we focus upon in this review. In certain simple cases, l sf N sets the distance over which the CPP-MR and LNL-MR decrease as the N-layer thickness (CPP-MR) or N-film length (LNL) increases, and l sf F does the same for increase of the CPP-MR with increasing F-layer thickness. Spin-flipping at M1/M2 interfaces can be described by a parameter, δ M1/M2 , which determines the spin-flipping probability, P = 1-exp(-δ). Increasing δ M1/M2 usually decreases the MR. We list measured values of these parameters and discuss the limitations on their determinations. (topical review)

Surface tension of droplets and Tolman lengths of real substances and mixtures from density functional theory

Science.gov (United States)

Rehner, Philipp; Gross, Joachim

2018-04-01

The curvature dependence of interfacial properties has been discussed extensively over the last decades. After Tolman published his work on the effect of droplet size on surface tension, where he introduced the interfacial property now known as Tolman length, several studies were performed with varying results. In recent years, however, some consensus has been reached about the sign and magnitude of the Tolman length of simple model fluids. In this work, we re-examine Tolman's equation and how it relates the Tolman length to the surface tension and we apply non-local classical density functional theory (DFT) based on the perturbed chain statistical associating fluid theory (PC-SAFT) to characterize the curvature dependence of the surface tension of real fluids as well as mixtures. In order to obtain a simple expression for the surface tension, we use a first-order expansion of the Tolman length as a function of droplet radius Rs, as δ(Rs) = δ0 + δ1/Rs, and subsequently expand Tolman's integral equation for the surface tension, whereby a second-order expansion is found to give excellent agreement with the DFT result. The radius-dependence of the surface tension of increasingly non-spherical substances is studied for n-alkanes, up to icosane. The infinite diameter Tolman length is approximately δ0 = -0.38 Å at low temperatures. For more strongly non-spherical substances and for temperatures approaching the critical point, however, the infinite diameter Tolman lengths δ0 turn positive. For mixtures, even if they contain similar molecules, the extrapolated Tolman length behaves strongly non-ideal, implying a qualitative change of the curvature behavior of the surface tension of the mixture.

Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

Energy Technology Data Exchange (ETDEWEB)

Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

1976-08-01

The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

Nitrogen diffusion in near-surface range of ion doped molybdenum

CERN Document Server

Zamalin, E Y

2001-01-01

The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

KAUST Repository

Chroneos, Alexander I.

2012-01-26

In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Direct measurement of sub-Debye-length attraction between oppositely charged surfaces.

Science.gov (United States)

Kampf, Nir; Ben-Yaakov, Dan; Andelman, David; Safran, S A; Klein, Jacob

2009-09-11

Using a surface force balance with fast video analysis, we have measured directly the attractive forces between oppositely charged solid surfaces (charge densities sigma(+), sigma(-)) across water over the entire range of interaction, in particular, at surface separations D below the Debye screening length lambda(S). At very low salt concentration we find a long-ranged attraction between the surfaces (onset ca. 100 nm), whose variation at Dsurface charge asymmetry (sigma(+) not equal to |sigma(-)|).

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

OpenAIRE

Li, Xiaofan; Nie, Qing

2009-01-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

Transient enhanced diffusion in preamorphized silicon: the role of the surface

Science.gov (United States)

Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

1999-01-01

Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

Diffusion of zinc into an unpassivated surface of indium phosphide

International Nuclear Information System (INIS)

Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

1989-01-01

Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

The effect of the cation alkyl chain length on density and diffusion in dialkylpyrrolidinium bis(mandelato)borate ionic liquids.

Science.gov (United States)

Filippov, Andrei; Taher, Mamoun; Shah, Faiz Ullah; Glavatskih, Sergei; Antzutkin, Oleg N

2014-12-28

The physicochemical properties of ionic liquids are strongly affected by the selective combination of the cations and anions comprising the ionic liquid. In particular, the length of the alkyl chains of ions has a clear influence on the ionic liquid's performance. In this paper, we study the self-diffusion of ions in a series of halogen-free boron-based ionic liquids (hf-BILs) containing bis(mandelato)borate anions and dialkylpyrrolidinium cations with long alkyl chains CnH2n+1 with n from 4 to 14 within a temperature range of 293-373 K. It was found that the hf-BILs with n = 4-7 have very similar diffusion coefficients, while hf-BILs with n = 10-14 exhibit two liquid sub-phases in almost the entire temperature range studied (293-353 K). Both liquid sub-phases differ in their diffusion coefficients, while values of the slower diffusion coefficients are close to those of hf-BILs with shorter alkyl chains. To explain the particular dependence of diffusion on the alkyl chain length, we examined the densities of the hf-BILs studied here. It was shown that the dependence of the density on the number of CH2 groups in long alkyl chains of cations can be accurately described using a "mosaic type" model, where regions of long alkyl chains of cations (named 'aliphatic' regions) and the residual chemical moieties in both cations and anions (named 'ionic' regions) give additive contributions. Changes in density due to an increase in temperature and the number of CH2 groups in the long alkyl chains of cations are determined predominantly by changes in the free volume of the 'ionic' regions, while 'aliphatic' regions are already highly compressed by van der Waals forces, which results in only infinitesimal changes in their free volumes with temperature.

Diffusion effects on volume-selective NMR at small length scales; Diffusionseffekte in volumenselektiver NMR auf kleinen Laengenskalen

Energy Technology Data Exchange (ETDEWEB)

Gaedke, Achim

2009-01-21

In this thesis, the interplay between diffusion and relaxation effects in spatially selective NMR experiments at short length scales is explored. This is especially relevant in the context of both conventional and mechanically detected MRI at (sub)micron resolution in biological specimens. Recent results on selectively excited very thin slices showed an in-slice-magnetization recovery orders of magnitude faster than the longitudinal relaxation time T1. However, those experiments were run on fully relaxed samples while MRI and especially mechanically detected NMR experiments are typically run in a periodic fashion with repetition times far below T1. The main purpose of this work therefore was to extend the study of the interplay between diffusion and longitudinal relaxation to periodic excitations. In some way, this is inverse phenomenon to the DESIRE (Diffusive Enhancement of SIgnal and REsolution) approach, proposed 1992 by Lauterbur. Experiments on periodically excited thin slices were carried out at a dedicated static field gradient cryomagnet with magnetic field gradients up to 180 T/m. In order to obtain plane slices, an appropriate isosurface of the gradient magnet had to be identified. It was found at a field of 3.8 T with a gradient of 73 T/m. In this field, slices down to a thickness of 3.2 {mu}m could be excited. The detection of the NMR signal was done using FIDs instead of echoes as the excitation bandwidth of those thin slices is sufficiently small to observe FIDs which are usually considered to be elusive to detection in such strong static field gradients. A simulation toolbox based on the full Bloch-Torrey-equation was developed to describe the excitation and the formation of NMR signals under those unusual conditions as well as the interplay of diffusion and magnetization recovery. Both the experiments and the simulations indicate that diffusion effects lead to a strongly enhanced magnetization modulation signal also under periodic excitation

Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

DEFF Research Database (Denmark)

Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

2009-01-01

form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

Directory of Open Access Journals (Sweden)

Szajnar J.

2014-10-01

Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

Surface modifications by field induced diffusion.

Directory of Open Access Journals (Sweden)

Martin Olsen

Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

Science.gov (United States)

Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

2018-02-01

Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

Dynamics of an optically confined nanoparticle diffusing normal to a surface.

Science.gov (United States)

Schein, Perry; O'Dell, Dakota; Erickson, David

2016-06-01

Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

Energy Technology Data Exchange (ETDEWEB)

Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

2016-05-15

Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

Extraction of minority carrier diffusion length of MWIR Type-II superlattice nBp detector

Science.gov (United States)

Taghipour, Zahra; Kazemi, Alireza; Myers, Stephen; Wijewarnasuriya, Priyalal; Mathews, Sen; Steenbergen, Elizabeth H.; Morath, Christian; Cowan, Vincent M.; Ariyawansa, Gamini; Scheihing, John; Krishna, Sanjay

2017-08-01

We present a model for the spectral external quantum efficiency (EQE) to extract the minority carrier diffusion length (Ln) of a unipolar nBp InAs/GaSb Type-II superlattice (T2SL) mid-wave infrared (MWIR) detector. The detector consists of a 4 μm thick p-doped 10ML InAs/10ML GaSb SL absorber with a 50% cut-off wavelength of 5 μm at 80 K and zero bias. The n-type doped InAs/AlSb SL barrier in the structure was included to reduce the GR dark current. By fitting the experimentally measured EQE data to the theoretically calculated QE based on the solution of the drift-diffusion equation, the p-type absorber was found the have Ln = 10 +/- 0.5 μm at 80K, and Ln = 12 +/- 0.5 μm at 120K and 150K. We performed the absorption coefficient measurement at different temperatures of interest. Also, we estimated the reduced background concentration and the built-in potential by utilizing a capacitance-voltage measurement technique. We used time-resolved-photoluminescence (TRPL) to determine the lifetime at 80K. With the result of the model and the lifetime measurement, we calculated the diffusion coefficient and the mobility in the T2SL detector at various temperatures. Also, we studied the behavior of different dark current mechanisms by fitting the experimentally measured and simulated dark current density under different operating temperatures and biases.

Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

International Nuclear Information System (INIS)

Ferrieri, R.A.; Wolf, A.P.

1984-01-01

A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

DEFF Research Database (Denmark)

Mejlbro, Leif

1996-01-01

Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

Science.gov (United States)

Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

2018-02-01

The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

Systematic homogenization and self-consistent flux and pin power reconstruction for nodal diffusion methods. 1: Diffusion equation-based theory

International Nuclear Information System (INIS)

Zhang, H.; Rizwan-uddin; Dorning, J.J.

1995-01-01

A diffusion equation-based systematic homogenization theory and a self-consistent dehomogenization theory for fuel assemblies have been developed for use with coarse-mesh nodal diffusion calculations of light water reactors. The theoretical development is based on a multiple-scales asymptotic expansion carried out through second order in a small parameter, the ratio of the average diffusion length to the reactor characteristic dimension. By starting from the neutron diffusion equation for a three-dimensional heterogeneous medium and introducing two spatial scales, the development systematically yields an assembly-homogenized global diffusion equation with self-consistent expressions for the assembly-homogenized diffusion tensor elements and cross sections and assembly-surface-flux discontinuity factors. The rector eigenvalue 1/k eff is shown to be obtained to the second order in the small parameter, and the heterogeneous diffusion theory flux is shown to be obtained to leading order in that parameter. The latter of these two results provides a natural procedure for the reconstruction of the local fluxes and the determination of pin powers, even though homogenized assemblies are used in the global nodal diffusion calculation

Studies of ionic diffusion in crystalline rock

International Nuclear Information System (INIS)

Ohlsson, Yvonne

2001-01-01

Matrix diffusion is of great importance in delaying radionuclides escaping from a deep geologic repository, on their way to the biosphere. There are, however, poorly understood mechanisms related to transport in pores with charged pore surfaces. Ions are affected by this charge and may be repelled or attracted by it. The rate of transport may be reduced, or even enhanced, as a result of this. Transport of ions is studied by traditional diffusion experiments, but mainly by a faster electrical conductivity method. With this method the pore connectivity, the formation factor variability and its relation to the porosity, as well as the surface conductivity are investigated. The method is compared. with traditional diffusion experiments, and an in-situ application is suggested and qualitatively tested. Furthermore, surface diffusion is studied by evaluating literature data and recently developed diffusion models. The pore connectivity reached to a depth of at least 15 cm in the rocks studied. The formation factor did not generally decrease with increasing sample length. It was also found that not only cations in the free pore water add to the electrical conductivity, but also at least part of those sorbed to the pore surfaces of the minerals. This surface conductivity influences the determination of the formation factor in low ionic strength pore waters, and was also found to be a function of the formation factor. It was furthermore dependent on the type of ion at the surface, giving for example a higher conductivity for Na + than for Cs + . It is not fully understood which part of the sorbed ions that are mobile. A simple model was developed assigning the mobile ions to the diffuse layer, and this model explained experimental data for diffusion of Cs + in clay well. This is contradicted by surface conductivity measurements that have shown that most mobile ions are found behind the Stern layer. The in-situ formation factor determination method seems promising. The most

Theoretical and computational studies of entangled rod-coil block copolymer diffusion

Science.gov (United States)

Wang, Muzhou; Alexander-Katz, Alfredo; Olsen, B. D.

2012-02-01

Despite continued interest in the thermodynamics of rod-coil block copolymers for functional nanostructured materials in organic electronics and biomaterials, relatively few studies have investigated the dynamics of these systems which are important for understanding diffusion, mechanics, and self-assembly kinetics. Here, the diffusion of coil-rod-coil block copolymers through entangled melts is simulated using the Kremer-Grest molecular dynamics model, demonstrating that the mismatch between the curvature of the rod and coil blocks results in dramatically slower reptation through the entanglement tube. For rod lengths near the tube diameter, this hindered diffusion is explained by a local curvature-dependent free energy penalty produced by the curvature mismatch, resulting in a rough energy surface as the rod moves along the tube contour. Compared to coil homopolymers which reptate freely along the tube, rod-coil block copolymers undergo an activated diffusion process which is considerably slower as the rod length increases. For large rods, diffusion of the rod through the tube only occurs when the coil blocks occupy straight entanglement tubes, which requires ``arm retraction'' as the dominant relaxation mechanism.

Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

Energy Technology Data Exchange (ETDEWEB)

Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

2017-02-01

Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

Science.gov (United States)

Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

2015-01-01

We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

Directory of Open Access Journals (Sweden)

Muhammad Qasim

2013-01-01

Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

Science.gov (United States)

Zhan, Hanyu; Voelz, David G.

2016-12-01

The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

DEFF Research Database (Denmark)

Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

2015-01-01

We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

Quantitative theory of channeling particle diffusion in transverse energy in the presence of nuclear scattering and direct evaluation of dechanneling length

Energy Technology Data Exchange (ETDEWEB)

Tikhomirov, Victor V. [Belarusian State University, Institute for Nuclear Problems, Minsk (Belarus)

2017-07-15

A refined equation for channeling particle diffusion in transverse energy taking into consideration large-angle scattering by nuclei is suggested. This equation is reduced to the Sturm-Liouville problem, allowing one to reveal both the origin and the limitations of the dechanneling length notion. The values of the latter are evaluated for both positively and negatively charged particles of various energies. New features of the dechanneling dynamics of positively charged particles are also revealed. First, it is demonstrated that the dechanneling length notion is completely inapplicable for their nuclear dechanneling process. Second, the effective electron dechanneling length of positively charged particle varies more than twice converging to a constant asymptotic value only at the depth exceeding the latter. (orig.)

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

International Nuclear Information System (INIS)

Olin, M.; Valkiainen, M.; Aalto, H.

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

Energy Technology Data Exchange (ETDEWEB)

Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

The effect of step thickness on the surface diffusion of a Pt adatom

International Nuclear Information System (INIS)

Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

2009-01-01

The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

Energy Technology Data Exchange (ETDEWEB)

Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

2014-12-15

Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

Energy Technology Data Exchange (ETDEWEB)

Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

2012-06-08

Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

Science.gov (United States)

Skoch, Gary J.

2002-01-01

Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

Correlation between minority carrier diffusion length and microstructure in a-Si:H thin films

International Nuclear Information System (INIS)

Conte, G.; Fameli, G.; Nobile, G.; Rubino, A.; Terzini, E.; Villani, F.

1993-01-01

The aim of this work is to investigate the opto-electronic properties of amorphous hydrogenated silicon (a-Si:H). The deposition temperature was used as a driving force to modify the morphology and bonded hydrogen distribution. The influence of the hydrogen microstructure on the carrier m-t products was examined. The m-t products, for both carriers, were evaluated from the diffusion length measurement, by using the Steady State Photocarrier Grating (SSPG) technique, and from the photoconductivity in the steady state condition (SSPC). The m-t products were correlated with the defect density and Fermi level position. The effects of the defect density on the Fermi level position were examined within the framework of a defect pool model in order to justify the consistency of the results

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Chen Shuguang

2010-01-01

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

Energy Technology Data Exchange (ETDEWEB)

Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

2007-02-21

During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

PbCl2-tuned inorganic cubic CsPbBr3(Cl) perovskite solar cells with enhanced electron lifetime, diffusion length and photovoltaic performance

Science.gov (United States)

Li, Bo; Zhang, Yanan; Zhang, Luyuan; Yin, Longwei

2017-08-01

Inorganic CsPbBr3 perovskite is arousing great interest following after organic-inorganic hybrid halide perovskites, and is found as a good candidate for photovoltaic devices for its prominent photoelectric property and stability. Herein, we for the first time report on PbCl2-tuned inorganic Cl-doped CsPbBr3(Cl) perovskite solar cells with adjustable crystal structure and Cl doping for enhanced carrier lifetime, extraction rate and photovoltaic performance. The effect of PbCl2 on the morphologies, structures, optical, and photovoltaic performance of CsPbBr3 perovskite solar cells is investigated systemically. Compared with orthorhombic CsPbBr3, cubic CsPbBr3 demonstrates a significant improvement for electron lifetime (from 6.7 ns to 12.3 ns) and diffusion length (from 69 nm to 197 nm), as well as the enhanced electron extraction rate from CsPbBr3 to TiO2. More importantly, Cl doping benefits the further enhancement of carrier lifetime (14.3 ns) and diffusion length (208 nm). The Cl doped cubic CsPbBr3(Cl) perovskite solar cell exhibits a Jsc of 8.47 mA cm-2 and a PCE of 6.21%, superior to that of pure orthorhombic CsPbBr3 (6.22 mA cm-2 and 3.78%). The improvement of photovoltaic performance can be attributed to enhanced carrier lifetime, diffusion length and extraction rates, as well as suppressed nonradiative recombination.

Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

International Nuclear Information System (INIS)

Luniakov, Yu V

2013-01-01

A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

Simulating the Effect of Modulated Tool-Path Chip Breaking On Surface Texture and Chip Length

Energy Technology Data Exchange (ETDEWEB)

Smith, K.S.; McFarland, J.T.; Tursky, D. A.; Assaid, T. S.; Barkman, W. E.; Babelay, Jr., E. F.

2010-04-30

One method for creating broken chips in turning processes involves oscillating the cutting tool in the feed direction utilizing the CNC machine axes. The University of North Carolina at Charlotte and the Y-12 National Security Complex have developed and are refining a method to reliably control surface finish and chip length based on a particular machine's dynamic performance. Using computer simulations it is possible to combine the motion of the machine axes with the geometry of the cutting tool to predict the surface characteristics and map the surface texture for a wide range of oscillation parameters. These data allow the selection of oscillation parameters to simultaneously ensure broken chips and acceptable surface characteristics. This paper describes the machine dynamic testing and characterization activities as well as the computational method used for evaluating and predicting chip length and surface texture.

Condensation on superhydrophobic surfaces: the role of local energy barriers and structure length scale.

Science.gov (United States)

Enright, Ryan; Miljkovic, Nenad; Al-Obeidi, Ahmed; Thompson, Carl V; Wang, Evelyn N

2012-10-09

Water condensation on surfaces is a ubiquitous phase-change process that plays a crucial role in nature and across a range of industrial applications, including energy production, desalination, and environmental control. Nanotechnology has created opportunities to manipulate this process through the precise control of surface structure and chemistry, thus enabling the biomimicry of natural surfaces, such as the leaves of certain plant species, to realize superhydrophobic condensation. However, this "bottom-up" wetting process is inadequately described using typical global thermodynamic analyses and remains poorly understood. In this work, we elucidate, through imaging experiments on surfaces with structure length scales ranging from 100 nm to 10 μm and wetting physics, how local energy barriers are essential to understand non-equilibrium condensed droplet morphologies and demonstrate that overcoming these barriers via nucleation-mediated droplet-droplet interactions leads to the emergence of wetting states not predicted by scale-invariant global thermodynamic analysis. This mechanistic understanding offers insight into the role of surface-structure length scale, provides a quantitative basis for designing surfaces optimized for condensation in engineered systems, and promises insight into ice formation on surfaces that initiates with the condensation of subcooled water.

Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

International Nuclear Information System (INIS)

Goddard, P.J.

1989-01-01

The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

International Nuclear Information System (INIS)

Livadiotis, George

2007-01-01

The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

International Nuclear Information System (INIS)

Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

2012-01-01

The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

2005-01-01

We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

Science.gov (United States)

Kapranov, Sergey V.; Kouzaev, Guennadi A.

2018-01-01

Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

The application of slip length models to larger textures in turbulent flows over superhydrophobic surfaces

Science.gov (United States)

Fairhall, Chris; Garcia-Mayoral, Ricardo

2017-11-01

We present results from direct numerical simulations of turbulent flows over superhydrophobic surfaces. We assess the validity of simulations where the surface is modelled as homogeneous slip lengths, comparing them to simulations where the surface texture is resolved. Our results show that once the coherent flow induced by the texture is removed from the velocity fields, the remaining flow sees the surface as homogeneous. We then investigate how the overlying turbulence is modified by the presence of surface texture. For small textures, we show that turbulence is shifted closer to the wall due to the presence of slip, but otherwise remains essentially unmodified. For larger textures, the texture interacts with the turbulent lengthscales, thereby modifying the overlying turbulence. We also show that the saturation of the effect of the spanwise slip length (Fukagata et al. 2006, Busse & Sandham 2012, Seo & Mani 2016), which is drag increasing, is caused by the impermeability imposed at the surface. This work was supported by the Engineering and Physical Sciences Research Council.

The small FOXP1 isoform predominantly expressed in activated B cell-like diffuse large B-cell lymphoma and full-length FOXP1 exert similar oncogenic and transcriptional activity in human B cells.

Science.gov (United States)

van Keimpema, Martine; Grüneberg, Leonie J; Schilder-Tol, Esther J M; Oud, Monique E C M; Beuling, Esther A; Hensbergen, Paul J; de Jong, Johann; Pals, Steven T; Spaargaren, Marcel

2017-03-01

The forkhead transcription factor FOXP1 is generally regarded as an oncogene in activated B cell-like diffuse large B-cell lymphoma. Previous studies have suggested that a small isoform of FOXP1 rather than full-length FOXP1, may possess this oncogenic activity. Corroborating those studies, we herein show that activated B cell-like diffuse large B-cell lymphoma cell lines and primary activated B cell-like diffuse large B-cell lymphoma cells predominantly express a small FOXP1 isoform, and that the 5'-end of the Foxp1 gene is a common insertion site in murine lymphomas in leukemia virus- and transposon-mediated insertional mutagenesis screens. By combined mass spectrometry, (quantative) reverse transcription polymerase chain reaction/sequencing, and small interfering ribonucleic acid-mediated gene silencing, we determined that the small FOXP1 isoform predominantly expressed in activated B cell-like diffuse large B-cell lymphoma lacks the N-terminal 100 amino acids of full-length FOXP1. Aberrant overexpression of this FOXP1 isoform (ΔN100) in primary human B cells revealed its oncogenic capacity; it repressed apoptosis and plasma cell differentiation. However, no difference in potency was found between this small FOXP1 isoform and full-length FOXP1. Furthermore, overexpression of full-length FOXP1 or this small FOXP1 isoform in primary B cells and diffuse large B-cell lymphoma cell lines resulted in similar gene regulation. Taken together, our data indicate that this small FOXP1 isoform and full-length FOXP1 have comparable oncogenic and transcriptional activity in human B cells, suggesting that aberrant expression or overexpression of FOXP1, irrespective of the specific isoform, contributes to lymphomagenesis. These novel insights further enhance the value of FOXP1 for the diagnostics, prognostics, and treatment of diffuse large B-cell lymphoma patients. Copyright© Ferrata Storti Foundation.

Fractional Diffusion Equations and Anomalous Diffusion

Science.gov (United States)

Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

2018-01-01

Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

International Nuclear Information System (INIS)

Kim, Sung Hoon

2001-01-01

Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO ₂ (110)

Energy Technology Data Exchange (ETDEWEB)

Goldman, Nir; Browning, Nigel D.

2011-06-16

Gold clusters on rutile TiO₂ are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO₂(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

International Nuclear Information System (INIS)

Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

Novel exchange mechanisms in the surface diffusion of oxides

International Nuclear Information System (INIS)

Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

2004-01-01

We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

Tyre contact length on dry and wet road surfaces measured by three-axial accelerometer

Science.gov (United States)

Matilainen, Mika; Tuononen, Ari

2015-02-01

We determined the tyre contact length on dry and wet roads by measuring the accelerations of the inner liner with a three-axial accelerometer. The influence of the tyre pressure, driving velocity, and tread depth on the contact length was studied in both types of road surface conditions. On dry asphalt the contact length was almost constant, regardless of the driving velocity. On wet asphalt the presence of water could be detected even at low driving velocities (e.g. 20 km/h for a worn tyre) as the contact length began to decrease from that found in the dry asphalt situation. In addition to improving the performance of active safety systems and driver warning systems, the contact length information could be beneficial for classifying and studying the aquaplaning behaviour of tyres.

Mean field diffusion models for precipitation in crystalline GaAs including surface tension and bulk stresses

Energy Technology Data Exchange (ETDEWEB)

Dreyer, Wolfgang [Weierstrass-Institut fuer Angewandte Analysis und Stochastik (WIAS) im Forschungsverbund Berlin e.V. (Germany); Kimmerle, Sven-Joachim [Humboldt-Univ. Berlin (Germany). Dept. of Mathematics

2009-07-01

Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first class of models treats the diffusion-controlled regime of interface motion, while the second class is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. We consider homogenised models, where different length scales of the experimental situation have been exploited in order to simplify the equations. These homogenised models generalise the well-known Lifshitz-Slyozov-Wagner model for Ostwald ripening. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

Science.gov (United States)

Ku, Bon Ki; Kulkarni, Pramod

2012-05-01

We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

Oxidative Corrosion of the UO ₂ (001) Surface by Nonclassical Diffusion

Energy Technology Data Exchange (ETDEWEB)

Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

2017-11-07

Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

Surface morphology of homoepitaxial GaN grown on non- and semipolar GaN substrates

Energy Technology Data Exchange (ETDEWEB)

Wernicke, Tim; Ploch, Simon [Institute of Solid State Physics, Technische Universitaet Berlin, Hardenbergstr. 36, 10623 Berlin (Germany); Hoffmann, Veit; Knauer, Arne; Weyers, Markus [Ferdinand-Braun-Institut, Leibniz Institut fuer Hoechstfrequenztechnik, Gustav-Kirchhoff-Str. 4, 12489 Berlin (Germany); Kneissl, Michael [Institute of Solid State Physics, Technische Universitaet Berlin, Hardenbergstr. 36, 10623 Berlin (Germany); Ferdinand-Braun-Institut, Leibniz Institut fuer Hoechstfrequenztechnik, Gustav-Kirchhoff-Str. 4, 12489 Berlin (Germany)

2011-03-15

GaN layers on bulk m-plane, (11 anti 22), (10 anti 12) and (10 anti 11) GaN substrates were grown by metal organic vapor phase epitaxy. XRD rocking curves have a FWHM of less than 150'', indicating excellent crystalline quality. However in many cases surface morphology exhibits hillocks with a height of 1-2 {mu}m and a lateral extension of 50-200 {mu}m whereas a smooth surface would be desirable for optoelectronic devices. The influence of growth parameters on the surface morphology was studied. The goal was, to constrain the material redistribution, that is necessary to form large hillocks. This was achieved by lowering the adatom diffusion length by a reduction of temperature and an increased reactor pressure. In the case of the (10 anti 11) and (10 anti 12) semipolar planes a reduction of the adatom diffusion length leads to a reduction of hillock density, hillock size and a smoother surface between hillocks. However, the m-plane surface does not react to a reduction of adatom mobility. Even at 890 C and 400 mbar rectangular pyramids cover the surface. In contrast to the other planes, the (11 anti 22) becomes instable, when the adatom diffusion length is reduced. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

Science.gov (United States)

Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

2016-04-01

Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

Application of Displacement Height and Surface Roughness Length to Determination Boundary Layer Development Length over Stepped Spillway

Directory of Open Access Journals (Sweden)

Xiangju Cheng

2014-12-01

Full Text Available One of the most uncertain parameters in stepped spillway design is the length (from the crest of boundary layer development. The normal velocity profiles responding to the steps as bed roughness are investigated in the developing non-aerated flow region. A detailed analysis of the logarithmic vertical velocity profiles on stepped spillways is conducted through experimental data to verify the computational code and numerical experiments to expand the data available. To determine development length, the hydraulic roughness and displacement thickness, along with the shear velocity, are needed. This includes determining displacement height d and surface roughness length z0 and the relationship of d and z0 to the step geometry. The results show that the hydraulic roughness height ks is the primary factor on which d and z0 depend. In different step height, step width, discharge and intake Froude number, the relations d/ks = 0.22–0.27, z0/ks = 0.06–0.1 and d/z0 = 2.2–4 result in a good estimate. Using the computational code and numerical experiments, air inception will occur over stepped spillway flow as long as the Bauer-defined boundary layer thickness is between 0.72 and 0.79.

Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

Science.gov (United States)

O'Neill, Kelly C; Lee, Young Jin

2018-05-01

The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

Minority carrier diffusion length extraction in Cu2ZnSn(Se,S)4 solar cells

Science.gov (United States)

Gokmen, Tayfun; Gunawan, Oki; Mitzi, David B.

2013-09-01

We report measurement of minority carrier diffusion length (Ld) for high performance Cu2ZnSn(S,Se)4 (CZTSSe) solar cells in comparison with analogous Cu(In,Ga)(S,Se)2 (CIGSSe) devices. Our Ld extraction method involves performing systematic measurements of the internal quantum efficiency combined with separate capacitance-voltage measurement. This method also enables the measurement of the absorption coefficient of the absorber material as a function of wavelength in a finished device. The extracted values of Ld for CZTSSe samples are at least factor of 2 smaller than those for CIGSSe samples. Combined with minority carrier lifetime (τ) data measured by time-resolved photoluminescence, we deduce the minority carrier mobility (μe), which is also relatively low for the CZTSSe samples.

Cleaning of diffusion bonding surface by argon ion bombardment treatment

International Nuclear Information System (INIS)

Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

2003-01-01

The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

International Nuclear Information System (INIS)

Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

2014-01-01

The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

Energy Technology Data Exchange (ETDEWEB)

Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

2010-05-03

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

Directory of Open Access Journals (Sweden)

N. Tsukahara

2012-01-01

Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

'LTE-diffusion approximation' for arc calculations

International Nuclear Information System (INIS)

Lowke, J J; Tanaka, M

2006-01-01

This paper proposes the use of the 'LTE-diffusion approximation' for predicting the properties of electric arcs. Under this approximation, local thermodynamic equilibrium (LTE) is assumed, with a particular mesh size near the electrodes chosen to be equal to the 'diffusion length', based on D e /W, where D e is the electron diffusion coefficient and W is the electron drift velocity. This approximation overcomes the problem that the equilibrium electrical conductivity in the arc near the electrodes is almost zero, which makes accurate calculations using LTE impossible in the limit of small mesh size, as then voltages would tend towards infinity. Use of the LTE-diffusion approximation for a 200 A arc with a thermionic cathode gives predictions of total arc voltage, electrode temperatures, arc temperatures and radial profiles of heat flux density and current density at the anode that are in approximate agreement with more accurate calculations which include an account of the diffusion of electric charges to the electrodes, and also with experimental results. Calculations, which include diffusion of charges, agree with experimental results of current and heat flux density as a function of radius if the Milne boundary condition is used at the anode surface rather than imposing zero charge density at the anode

First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

2014-01-01

Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

Diffusion-limited mixing by incompressible flows

Science.gov (United States)

Miles, Christopher J.; Doering, Charles R.

2018-05-01

Incompressible flows can be effective mixers by appropriately advecting a passive tracer to produce small filamentation length scales. In addition, diffusion is generally perceived as beneficial to mixing due to its ability to homogenize a passive tracer. However we provide numerical evidence that, in cases where advection and diffusion are both actively present, diffusion may produce negative effects by limiting the mixing effectiveness of incompressible optimal flows. This limitation appears to be due to the presence of a limiting length scale given by a generalised Batchelor length (Batchelor 1959 J. Fluid Mech. 5 113–33). This length scale limitation may in turn affect long-term mixing rates. More specifically, we consider local-in-time flow optimisation under energy and enstrophy flow constraints with the objective of maximising the mixing rate. We observe that, for enstrophy-bounded optimal flows, the strength of diffusion may not impact the long-term mixing rate. For energy-constrained optimal flows, however, an increase in the strength of diffusion can decrease the mixing rate. We provide analytical lower bounds on mixing rates and length scales achievable under related constraints (point-wise bounded speed and rate-of-strain) by extending the work of Lin et al (2011 J. Fluid Mech. 675 465–76) and Poon (1996 Commun. PDE 21 521–39).

Self-diffusion on copper surfaces

DEFF Research Database (Denmark)

Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

1991-01-01

The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

Measurement of molecular length of self-assembled monolayer probed by localized surface plasmon resonance

Science.gov (United States)

Ito, Juri; Kajikawa, Kotaro

2016-02-01

We propose a method to measure the variation of the molecular length of self-assembled monolayers (SAMs) when it is exposed to solutions at different pH conditions. The surface immobilized gold nanospheres (SIGNs) shows strong absorption peak at the wavelengths of 600-800 nm when p-polarized light is illuminated. The peak wavelength depends on the length of the gap distance between the SIGNs and the substrate. The gap is supported by the SAM molecules. According to the analytical calculation based on multiple expansion, the relation between the peak wavelength of the SIGN structures and the gap distance is calculated, to evaluate the molecular length of the SAM through the optical absorption spectroscopy for the SIGN structures. The molecular length of the SIGN structure was measured in air, water, acidic, and basic solutions. It was found that the molecular lengths are longer in acidic solutions.

Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

Czech Academy of Sciences Publication Activity Database

Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

2008-01-01

Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

Non-rigid registration of breast surfaces using the laplace and diffusion equations

Directory of Open Access Journals (Sweden)

Ou Jao J

2010-02-01

Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

International Nuclear Information System (INIS)

Strubelj, Luka; Tiselj, Izrok

2008-01-01

Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

NARCIS (Netherlands)

Schoots, Koen

2007-01-01

This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

Determination of thermal neutrons diffusion length in graphite; Determinacion de la Longitud de Difusion de los Neutrones Termicos en Grafito

Energy Technology Data Exchange (ETDEWEB)

Garcia Fite, J

1959-07-01

The diffusion length of thermal neutrons in graphite using the less possible quantity of material has been determined. The proceeding used was the measurement in a graphite pile which has a punctual source of rapid neutrons inside surrounded by a reflector medium (paraffin or water). The measurement was done in the following conditions: a) introducing an aluminium plate between both materials. b) Introducing a cadmium plate between both materials. (Author) 91 refs.

Telomere length and advanced diffusion MRI as biomarkers for repetitive mild traumatic brain injury in adolescent rats

Directory of Open Access Journals (Sweden)

David K. Wright

Full Text Available Mild traumatic brain injuries (mTBI are of worldwide concern in adolescents of both sexes, and repeated mTBI (RmTBI may have serious long-term neurological consequences. As such, the study of RmTBI and discovery of objective biomarkers that can help guide medical decisions is an important undertaking. Diffusion-weighted MRI (DWI, which provides markers of axonal injury, and telomere length (TL are two clinically relevant biomarkers that have been implicated in a number of neurological conditions, and may also be affected by RmTBI. Therefore, this study utilized the lateral impact injury model of RmTBI to investigate changes in diffusion MRI and TL, and how these changes relate to each other. Adolescent male and female rats received either three mTBIs or three sham injuries. The first injury was given on postnatal day 30 (P30, with the repeated injuries separated by four days each. Seven days after the final injury, a sample of ear tissue was collected for TL analysis. Rats were then euthanized and whole brains were collected and fixated for MRI analyses that included diffusion and high-resolution structural sequences. Compared to the sham-injured group, RmTBI rats had significantly shorter TL at seven days post-injury. Analysis of advanced DWI measures found that RmTBI rats had abnormalities in the corpus callosum and cortex at seven days post-injury. Notably, many of the DWI changes were correlated with TL. These findings demonstrate that TL and DWI measurements are changed by RmTBI and may represent clinically applicable biomarkers for this. Keywords: Biomarker, Concussion, Track weighted imaging, Animal model, Diffusion tensor imaging, MRI

A model for diffuse and global irradiation on horizontal surface

International Nuclear Information System (INIS)

Jain, P.C.

1984-01-01

The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

Science.gov (United States)

Cox, Trevor John

Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

DEFF Research Database (Denmark)

Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

2002-01-01

We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

A multi-resolution analysis of lidar-DTMs to identify geomorphic processes from characteristic topographic length scales

Science.gov (United States)

Sangireddy, H.; Passalacqua, P.; Stark, C. P.

2013-12-01

processes. Also, we explore the variability in hillslope length scales as a function of hillslope diffusivity coefficients and critical shear stress in natural landscapes and show that we can infer signatures of dominant geomorphic processes by analyzing characteristic topographic length scales present in topography. References: Beven, K. and Kirkby, M. J.: A physically based variable contributing area model of basin hydrology, Hydrol. Sci. Bull., 24, 43-69, 1979 Howard, A. D. (1994). A detachment-limited model of drainage basin evolution.Water resources research, 30(7), 2261-2285. Passalacqua, P., Do Trung, T., Foufoula Georgiou, E., Sapiro, G., & Dietrich, W. E. (2010). A geometric framework for channel network extraction from lidar: Nonlinear diffusion and geodesic paths. Journal of Geophysical. Research: Earth Surface (2003-2012), 115(F1). Sangireddy, H., Passalacqua, P., Stark, C.P.(2012). Multi-resolution estimation of lidar-DTM surface flow metrics to identify characteristic topographic length scales, EP13C-0859: AGU Fall meeting 2012. Stark, C. P., & Stark, G. J. (2001). A channelization model of landscape evolution. American Journal of Science, 301(4-5), 486-512. Tucker, G. E., Catani, F., Rinaldo, A., & Bras, R. L. (2001). Statistical analysis of drainage density from digital terrain data. Geomorphology, 36(3), 187-202.

Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

International Nuclear Information System (INIS)

Melkior, T.; Motellier, S.; Yahiaoui, S.

2005-01-01

Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

Directory of Open Access Journals (Sweden)

Yan-Zi Yu

2015-01-01

Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

Transport and diffusion on crystalline surfaces under external forces

International Nuclear Information System (INIS)

Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

2005-01-01

We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

Directory of Open Access Journals (Sweden)

Ivan E Collier

Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

International Nuclear Information System (INIS)

Vree, C; Mayr, S G

2010-01-01

The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

Fossil rocks of slow earthquake detected by thermal diffusion length

Science.gov (United States)

Hashimoto, Yoshitaka; Morita, Kiyohiko; Okubo, Makoto; Hamada, Yohei; Lin, Weiren; Hirose, Takehiro; Kitamura, Manami

2016-04-01

Fault motion has been estimated by diffusion pattern of frictional heating recorded in geology (e.g., Fulton et al., 2012). The same record in deeper subduction plate interface can be observed from micro-faults in an exhumed accretionary complex. In this study, we focused on a micro-fault within the Cretaceous Shimanto Belt, SW Japan to estimate fault motion from the frictional heating diffusion pattern. A carbonaceous material concentrated layer (CMCL) with ~2m of thickness is observed in study area. Some micro-faults cut the CMCL. Thickness of a fault is about 3.7mm. Injection veins and dilatant fractures were observed in thin sections, suggesting that the high fluid pressure was existed. Samples with 10cm long were collected to measure distribution of vitrinite reflectance (Ro) as a function of distance from the center of micro-fault. Ro of host rock was ~1.0%. Diffusion pattern was detected decreasing in Ro from ~1.2%-~1.1%. Characteristic diffusion distance is ~4-~9cm. We conducted grid search to find the optimal frictional heat generation per unit area per second (Q (J/m^2/s), the product of friction coefficient, normal stress and slip velocity) and slip duration (t(s)) to fit the diffusion pattern. Thermal diffusivity (0.98*10^8m^2/s) and thermal conductivity (2.0 w/mK) were measured. In the result, 2000-2500J/m^2/s of Q and 63000-126000s of t were estimated. Moment magnitudes (M0) of slow earthquakes (slow EQs) follow a scaling law with slip duration and its dimension is different from that for normal earthquakes (normal EQ) (Ide et al., 2007). The slip duration estimated in this study (~10^4-~10^5s) consistent with 4-5 of M0, never fit to the scaling law for normal EQ. Heat generation can be inverted from 4-5 of M0, corresponding with ~10^8-~10^11J, which is consistent with rupture area of 10^5-10^8m2 in this study. The comparisons in heat generation and slip duration between geological measurements and geophysical remote observations give us the

Diffusion length variation in photovoltaic cells with Bridgman-grown CuInSe2 substrates

International Nuclear Information System (INIS)

Champness, C.H.

2007-01-01

In a group of CuInSe 2 -CdS-ZnO photovoltaic cells, where the absorber was a layer cut from Bridgman-grown p-type CuInSe 2 ingots, electron diffusion lengths at room temperature (L n ) were estimated by the photocurrent-capacitance method. Dark capacitance measurements were also made on the same cells against reverse bias and from Mott-Schottky plots, slope concentrations p MS were determined at a reverse bias of 1.5 V. In a plot of L n against p MS , it was found that, despite much scatter in the experimental points, there was an apparent trend of L n decreasing by about an order of magnitude with increase of p MS from 10 16 to 10 17 cm -3 . Detailed proposals were then made to explain this trend. These were reduction of lifetime via Shockley-Read trapping with mobility decrease by impurity scattering, shunt resistance lowering by light and optical penetration depth reduction at shorter illumination wavelengths

Spin diffusion in disordered organic semiconductors

Science.gov (United States)

Li, Ling; Gao, Nan; Lu, Nianduan; Liu, Ming; Bässler, Heinz

2015-12-01

An analytical theory for spin diffusion in disordered organic semiconductors is derived. It is based on percolation theory and variable range hopping in a disordered energy landscape with a Gaussian density of states. It describes universally the dependence of the spin diffusion on temperature, carrier density, material disorder, magnetic field, and electric field at the arbitrary magnitude of the Hubbard energy of charge pairs. It is found that, compared to the spin transport carried by carriers hopping, the spin exchange will hinder the spin diffusion process at low carrier density, even under the condition of a weak electric field. Importantly, under the influence of a bias voltage, anomalous spreading of the spin packet will lead to an abnormal temperature dependence of the spin diffusion coefficient and diffusion length. This explains the recent experimental data for spin diffusion length observed in Alq3.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2015-01-15

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Science.gov (United States)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

International Nuclear Information System (INIS)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

Science.gov (United States)

Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

2014-08-21

The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

International Nuclear Information System (INIS)

Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

1979-01-01

Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

Science.gov (United States)

Boisvert, Ghyslain

Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

Science.gov (United States)

Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

2018-05-01

Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

Energy Technology Data Exchange (ETDEWEB)

Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

1996-01-12

The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

International Nuclear Information System (INIS)

Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

1976-01-01

Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

International Nuclear Information System (INIS)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-01-01

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

Energy Technology Data Exchange (ETDEWEB)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-12-14

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

DEFF Research Database (Denmark)

Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

1996-01-01

and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

Propagation of intense laser radiation through a diffusion flame of burning oil

Science.gov (United States)

Gvozdev, S. V.; Glova, A. F.; Dubrovskii, V. Yu; Durmanov, S. T.; Krasyukov, A. G.; Lysikov, A. Yu; Smirnov, G. V.; Pleshkov, V. M.

2015-06-01

We report the results of measuring the absorption coefficient of radiation from a cw ytterbium fibre single-mode laser with the power up to 1.5 kW by a diffusion flame of oil, burning in the atmosphere air at normal pressure on a free surface. For the constant length (30 mm) and width (30 mm) of the flame and the distance 10 mm between the laser beam axis and the oil surface the dependence of the absorption coefficient, averaged over the flame length, on the mean radiation intensity (varied from 4.5 × 103 to 1.2 × 106 W cm-2) entering the flame is obtained. The qualitative explanation of nonmonotonic behaviour of the absorption coefficient versus the intensity is presented.

Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

Directory of Open Access Journals (Sweden)

Sorenson Donna J

2009-12-01

Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

Temperature dependence of diffuse satellites in Ti–(50 − x)Pd–xFe (14 ⩽ x ⩽ 20 (at.%)) alloys

International Nuclear Information System (INIS)

Todai, Mitsuharu; Fukuda, Takashi; Kakeshita, Tomoyuki

2014-01-01

Highlights: • Diffuse satellites of Ti–(50 − x)Pd–xFe alloys have been investigated. • Diffuse satellites appear at g B2 + 〈ζζ ¯ 0〉 * below T min . • The peak position of diffuse satellites at T min agree with the length of the nesting vector. • The present result implies that the nesting effect of Fermi surface originates diffuse satellites in Ti–(50 − x)Pd–xFe alloys. - Abstract: Diffuse satellites appearing in electron diffraction pattern of shape memory Ti–(50 − x)Pd–xFe (14, 16, 18, 19 and 20, in at.%) alloys have been investigated. The satellites appear in each alloy below T min , where its electrical resistivity shows a local minimum. The positions of satellites are g B2 + 〈ζ ζ ¯ 0〉 * , where g B2 is a reciprocal lattice vector of the B2-phase. The value of ζ is smaller than 1/5 at T min for all the alloys; it increases with decreasing temperature and decreases with increasing iron content. The value of ζ at T min agrees with the length of the nesting vector previously calculated by the present authors. This result implies that Fermi surface nesting is the origin of diffuse satellites in Ti–(50 − x)Pd–xFe alloys

Determination of space charge region width and diffusion length in Cu(In,Ga)(S,Se)2 absorber from solar cell spectral characteristic

International Nuclear Information System (INIS)

Tivanov, M.; Mazanik, A.; Drozdov, N.; Zaretskaya, E.

2010-01-01

Full text : The space-charge region width and diffusion length of minority charge carriers in the base region (Cu(In,Ga)(S,Se) 2 absorber) are the most important parameters of the solar cell. These parameters determine the efficiency of a solar cell therefore the problem of their control is essential. In this work it is present simple non-destructive method of extracting the parameters of Cu(In,Ga)(S,Se) 2 -based solar cell (space-charge region width and diffusion length of minority charge carriers in Cu(In,Ga)(S,Se) 2 absorber) from the analysis of solar cell spectral photoresponse. The method is based on one-dimensional model of a solar cell and on the change of in-depth distribution of the photogenerated carriers in the solar cell and, hence, on the change of its photoresponse with the wave-length variation. The following assumptions are accepted: the reflection of charge carriers from a back contact and the ''drawing'' field in the quasi-neutral area of the absorber layers are absent, window and buffer layers are transparent in the analyzed part of photoresponse spectrum, the injection level of minority charge carriers is low, the recombination losses at the metallurgical p-n-junction interface of the studied photosensitive structure linearly depend on the photocurrent density. For the calculation it is necessary to obtain the following set of the experimental data: the spectral density of incident radiation, the spectral dependence of photocurrent or photovoltage of the studied photosensitive structure, the spectral dependences of optical absorption coefficient and reflectance.

Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

Science.gov (United States)

Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

2017-01-01

The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

Influence of the Debye length on the interaction of a small molecule-modified Au nanoparticle with a surface-bound bioreceptor.

Science.gov (United States)

Bukar, Natalia; Zhao, Sandy Shuo; Charbonneau, David M; Pelletier, Joelle N; Masson, Jean-Francois

2014-05-18

We report that a shorter Debye length and, as a consequence, decreased colloidal stability are required for the molecular interaction of folic acid-modified Au nanoparticles (Au NPs) to occur on a surface-bound receptor, human dihydrofolate reductase (hDHFR). The interaction measured using surface plasmon resonance (SPR) sensing was optimal in a phosphate buffer at pH 6 and ionic strength exceeding 300 mM. Under these conditions, the aggregation constant of the Au NPs was approximately 10(4) M(-1) s(-1) and the Debye length was below 1 nm, on the same length scale as the size of the folate anion (approximately 0.8 nm). Longer Debye lengths led to poorer SPR responses, revealing a reduced affinity of the folic acid-modified Au NPs for hDHFR. While high colloidal stability of Au NPs is desired in most applications, these conditions may hinder molecular interactions due to Debye lengths exceeding the size of the ligand and thus preventing close interactions with the surface-bound molecular receptor.

Rapid diffusion of molybdenum trace contamination in silicon

International Nuclear Information System (INIS)

Tobin, S.P.; Greenwald, A.C.; Wolfson, R.G.; Meier, D.L.; Drevinsky, P.J.

1985-01-01

Molybdenum contamination has been detected in silicon epitaxial layers and substrate wafers after processing in any one of several epitaxial silicon reactors. Greatly reduced minority carrier diffusion lengths and lifetimes are consistent with Mo concentrations measured by DLTS in the 10 12 and 10 13 cm -3 ranges. Depth profiling of diffusion length and the Mo deep level show much greater penetration than expected from previous reports of Mo as a slow diffuser. The data indicate a lower limit of 10 -8 cm 2 /sec for the diffusion coefficient of Mo in silicon at 1200 0 C, consistent with high diffusivities measured for other transition metals

Aggregation behavior and intermicellar interactions of cationic Gemini surfactants: Effects of alkyl chain, spacer lengths and temperature

International Nuclear Information System (INIS)

Hajy Alimohammadi, Marjan; Javadian, Soheila; Gharibi, Hussein; Tehrani-Bagha, Ali reza; Alavijeh, Mohammad Rashidi; Kakaei, Karim

2012-01-01

Graphical abstract: Highlights: → Enthalpy-entropy compensation relation was found between and for gemini surfactants. → The intermicellar interaction parameters are influenced with increasing the lengths of the tail and the spacer of gemini surfactants. → Increasing temperature decreases the intermicellar interaction parameters. → The changes in micellar surface charge density, and phase transition between spherical and rod geometries explain the data. - Abstract: The aggregation behavior of the cationic Gemini surfactants C m H 2m+1 N(CH 3 ) 2 (CH 2 ) S (CH 3 ) 2 N C m H 2m+1 ,2Br - with m = 12, 14 and s = 2, 4 were studied by performing surface tension, electrical conductivity, pulsed field gradient nuclear magnetic resonance (PFG-NMR), and cyclic voltammetry (CV) measurements over the temperature range 298 K to 323 K. The critical micelle concentration (CMC), surface excess (Γ max ), mean molecular surface area (A min ), degree of counter ion dissociation (α), and the thermodynamic parameters of micellization were determined from the surface tension and conductance data. An enthalpy-entropy compensation effect was observed and all the plots of enthalpy-entropy compensation exhibit excellent linearity. The micellar self-diffusion coefficients (D m ) and intermicellar interaction parameters (k d ) were obtained from the PFG-NMR and CV measurements. These results are discussed in terms of the intermicellar interactions, the effects of the chain and spacer lengths on the micellar surface charge density, and the phase transition between spherical and rod geometries. The intermicellar interaction parameters were found to decrease slightly with increasing temperature for 14-4-14, which suggests that the micellar surface charge density decreases with increasing temperature. The mean values of the hydrodynamic radius, R h , and the aggregation number, N agg , of the Gemini surfactants'm-4-m micelles were calculated from the micellar self-diffusion coefficient

Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

Science.gov (United States)

Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

2011-01-01

Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

Science.gov (United States)

Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

2018-01-01

Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

Science.gov (United States)

Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

2017-01-01

Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

International Nuclear Information System (INIS)

Lou, D.C.; Solberg, J.K.; Borvik, T.

2009-01-01

This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

Surface-Assisted Dynamic Search Processes.

Science.gov (United States)

Shin, Jaeoh; Kolomeisky, Anatoly B

2018-03-01

Many chemical and biological systems exhibit intermittent search phenomena when participating particles alternate between dynamic regimes with different dimensionalities. Here we investigate theoretically a dynamic search process of finding a small target on a two-dimensional surface starting from a bulk solution, which is an example of such an intermittent search process. Both continuum and discrete-state stochastic descriptions are developed. It is found that depending on the scanning length λ, which describes the area visited by the reacting molecule during one search cycle, the system can exhibit three different search regimes: (i) For small λ values, the reactant finds the target mostly via three-dimensional bulk diffusion; (ii) for large λ values, the reactant molecule associates to the target mostly via surface diffusion; and (iii) for intermediate λ values, the reactant reaches the target via a combination of three-dimensional and two-dimensional search cycles. Our analysis also shows that the mean search times have different scalings as a function of the size of the surface segment depending on the nature of the dynamic search regime. Search dynamics are also sensitive to the position of the target for large scanning lengths. In addition, it is argued that the continuum description underestimates mean search times and does not always correctly describe the most optimal conditions for the surface-assisted dynamic processes. The importance of our findings for real natural systems is discussed.

Roughness Length of Water Vapor over Land Surfaces and Its Influence on Latent Heat Flux

Directory of Open Access Journals (Sweden)

Sang-Jong Park

2010-01-01

Full Text Available Latent heat flux at the surface is largely dependent on the roughness length for water vapor (z0q. The determination of z0q is still uncertain because of its multifaceted characteristics of surface properties, atmospheric conditions and insufficient observations. In this study, observed values from the Fluxes Over Snow Surface II field experiment (FLOSS-II from November 2002 to March 2003 were utilized to estimate z0q over various land surfaces: bare soil, snow, and senescent grass. The present results indicate that the estimated z0q over bare soil is much smaller than the roughness length of momentum (z0m; thus, the ratio z0m/z0q is larger than those of previous studies by a factor of 20 - 150 for the available flow regime of the roughness Reynolds number, Re* > 0.1. On the snow surface, the ratio is comparable to a previous estimation for the rough flow (Re* > 1, but smaller by a factor of 10 - 50 as the flow became smooth (Re* < 1. Using the estimated ratio, an optimal regression equation of z0m/z0q is determined as a function of Re* for each surface type. The present parameterization of the ratio is found to greatly reduce biases of latent heat flux estimation compared with that estimated by the conventional method, suggesting the usefulness of current parameterization for numerical modeling.

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

NARCIS (Netherlands)

Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

Energy Technology Data Exchange (ETDEWEB)

Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

2013-12-14

The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

International Nuclear Information System (INIS)

Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

2014-01-01

Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

International Nuclear Information System (INIS)

Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

2009-01-01

Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

Propagation of intense laser radiation through a diffusion flame of burning oil

International Nuclear Information System (INIS)

Gvozdev, S V; Glova, A F; Dubrovskii, V Yu; Durmanov, S T; Krasyukov, A G; Lysikov, A Yu; Smirnov, G V; Pleshkov, V M

2015-01-01

We report the results of measuring the absorption coefficient of radiation from a cw ytterbium fibre single-mode laser with the power up to 1.5 kW by a diffusion flame of oil, burning in the atmosphere air at normal pressure on a free surface. For the constant length (30 mm) and width (30 mm) of the flame and the distance 10 mm between the laser beam axis and the oil surface the dependence of the absorption coefficient, averaged over the flame length, on the mean radiation intensity (varied from 4.5 × 10 3 to 1.2 × 10 6 W cm -2 ) entering the flame is obtained. The qualitative explanation of nonmonotonic behaviour of the absorption coefficient versus the intensity is presented. (laser applications and other topics in quantum electronics)

Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

DEFF Research Database (Denmark)

Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

1999-01-01

in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

Modeling diffuse sources of surface water contamination with plant protection products

Science.gov (United States)

Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

2015-04-01

Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

Science.gov (United States)

Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

2017-12-01

This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

Bending of marble with intrinsic length scales: a gradient theory with surface energy and size effects

International Nuclear Information System (INIS)

Vardoulakis, I.; Kourkoulis, S.K.; Exadaktylos, G.

1998-01-01

A gradient bending theory is developed based on a strain energy function that includes the classical Bernoulli-Euler term, the shape correction term (microstructural length scale) introduced by Timoshenko, and a term associated with surface energy (micromaterial length scale) accounting for the bending moment gradient effect. It is shown that the last term is capable to interpret the size effect in three-point bending (3PB), namely the decrease of the failure load with decreasing beam length for the same aspect ratio. This theory is used to describe the mechanical behaviour of Dionysos-Pentelikon marble in 3PB. Series of tests with prismatic marble beams of the same aperture but with different lengths were conducted and it was concluded that the present theory predicts well the size effect. (orig.)

Growth morphologies of crystal surfaces

Science.gov (United States)

Xiao, Rong-Fu; Alexander, J. Iwan D.; Rosenberger, Franz

1991-03-01

We have expanded our earlier Monte Carlo model [Phys. Rev. A 38, 2447 (1988); J. Crystal Growth 100, 313 (1990)] to three dimensions and included reevaporation after accommodation and growth on dislocation-induced steps. We found again that, for a given set of growth parameters, the critical size, beyond which a crystal cannot retain its macroscopically faceted shape, scales linearly with the mean free path in the vapor. However, the three-dimensional (3D) the systems show increased shape stability compared to corresponding 2D cases. Extrapolation of the model results to mean-free-path conditions used in morphological stability experiments leads to order-of-magnitude agreement of the predicted critical size with experimental findings. The stability region for macroscopically smooth (faceted) surfaces in the parameter space of temperature and supersaturation depends on both the surface and bulk diffusion. While surface diffusion is seen to smooth the growth morphology on the scale of the surface diffusion length, bulk diffusion is always destabilizing. The atomic surface roughness increases with increase in growth temperature and supersaturation. That is, the tendency of surface kinetics anisotropies to stabilize the growth shape is reduced through thermal and kinetic roughening. It is also found that the solid-on-solid assumption, which can be advantageously used at low temperatures and supersaturations, is insufficient to describe the growth dynamics of atomically rough interfaces where bulk diffusion governs the process. For surfaces with an emerging screw dislocation, we find that the spiral growth mechanism dominates at low temperatures and supersaturations. The polygonization of a growth spiral decreases with increasing temperature or supersaturation. When the mean free path in the nutrient is comparable to the lattice constant, the combined effect of bulk and surface diffusion reduces the terrace width of a growth spiral in its center region. At elevated

A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

Science.gov (United States)

Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

2014-02-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

Effect of 1.5 MeV electron irradiation on β-Ga2O3 carrier lifetime and diffusion length

Science.gov (United States)

Lee, Jonathan; Flitsiyan, Elena; Chernyak, Leonid; Yang, Jiancheng; Ren, Fan; Pearton, Stephen J.; Meyler, Boris; Salzman, Y. Joseph

2018-02-01

The influence of 1.5 MeV electron irradiation on minority transport properties of Si doped β-Ga2O3 vertical Schottky rectifiers was observed for fluences up to 1.43 × 1016 cm-2. The Electron Beam-Induced Current technique was used to determine the minority hole diffusion length as a function of temperature for each irradiation dose. This revealed activation energies related to shallow donors at 40.9 meV and radiation-induced defects with energies at 18.1 and 13.6 meV. Time-resolved cathodoluminescence measurements showed an ultrafast 210 ps decay lifetime and reduction in carrier lifetime with increased irradiation.

First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

International Nuclear Information System (INIS)

Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

2014-01-01

We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

Charged plate in asymmetric electrolytes: One-loop renormalization of surface charge density and Debye length due to ionic correlations.

Science.gov (United States)

Ding, Mingnan; Lu, Bing-Sui; Xing, Xiangjun

2016-10-01

Self-consistent field theory (SCFT) is used to study the mean potential near a charged plate inside a m:-n electrolyte. A perturbation series is developed in terms of g=4πκb, where band1/κ are Bjerrum length and bare Debye length, respectively. To the zeroth order, we obtain the nonlinear Poisson-Boltzmann theory. For asymmetric electrolytes (m≠n), the first order (one-loop) correction to mean potential contains a secular term, which indicates the breakdown of the regular perturbation method. Using a renormalizaton group transformation, we remove the secular term and obtain a globally well-behaved one-loop approximation with a renormalized Debye length and a renormalized surface charge density. Furthermore, we find that if the counterions are multivalent, the surface charge density is renormalized substantially downwards and may undergo a change of sign, if the bare surface charge density is sufficiently large. Our results agrees with large MC simulation even when the density of electrolytes is relatively high.

Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

International Nuclear Information System (INIS)

Seddeek, M.A.; Abdelmeguid, M.S.

2006-01-01

The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

Oxygen transport in waterlogged soils, Part II. Diffusion coefficients

International Nuclear Information System (INIS)

Obando Moncayo, F.H.

2004-01-01

Several equations are available for Oxygen Transport in Waterlogged Soils and have been used for soils and plants. All of them are some form of first Fick's law as given by dQ = - DA(dc/dx)/dt. This equation illustrates some important aspects of aeration in waterlogged soils; first, D is a property of the medium and the gas, and is affected by temperature T. Likewise, the amount of diffusing substance dQ in dt is a direct function of the cross sectional area A and inversely proportional to the distance x. In fact, increasing the water content of air-dry soil, drastically decreases A and creates a further resistance for the flow of oxygen through water films around root plants, soil micro organisms and soil aggregates. The solid phase is also limiting the cross-section of surface of the free gaseous diffusion and the length and tortuosity of diffusion path in soil. In most of cases, soil gas porosity and tortuosity of soil voids are expressed in the equations of diffusion as a broad 'diffusion coefficient' (apparent coefficient diffusion). The process of soil respiration is complicated, involves many parameters, and is difficult to realistically quantify. With regard to the oxygen supply, it is convenient to distinguish macro and micro models, and hence, the flux of oxygen is assumed to have two steps. The first step is related to oxygen diffusion from the atmosphere and the air-filled porosity. The second step is related to the oxygen diffusion through water-films in and around plant roots, soil micro organisms and aggregates. Because of these models we obtain coefficients of macro or micro diffusion, rates of macro or micro diffusion, etc. In the macro diffusion process oxygen is transferred in the soil profile, mainly from the soil surface to a certain depth of the root zone, while micro diffusion deals with the flux over very short distances. Both processes, macro and micro diffusion are highly influenced by soil water content. Of course, if water is added to

Argon Diffusion Measured in Rhyolite Melt at 100 MPa

Science.gov (United States)

Weldon, N.; Edwards, P. M.; Watkins, J. M.; Lesher, C. E.

2016-12-01

Argon diffusivity (D_{Ar} ) controls the rate and length scale of argon exchange between melt and gas phases and is used as a parameter to model noble gas fractionation during magma degassing. D_{Ar} may also be useful in geochronology to estimate the distribution of excess (non-radiogenic) atmospheric argon in lavas. Our measurements of D_{Ar} in molten anhydrous rhyolite near 1000 °C and 100 MPa add to the existing dataset. Using a rapid-quench cold seal pressure apparatus we exposed cylindrical charges drilled from a Miocene rhyolite flow near Buck Mtn., CA to a pure argon atmosphere resulting in a gradually lengthening argon concentration gradient between the saturated surface and the argon poor interior. Argon concentration was measured by electron microprobe along radial transects from the center to the surface of bisected samples. D_{Ar} was calculated for each transect by fitting relative argon concentration (as a function of distance from the surface) to Green's function (given each experiment's specific temperature, pressure and runtime). Variability (σ = 1.202{μm }^{2} /s) was smaller than in previous studies, but still greater than what is likely due to analytical or experimental uncertainty. We observed a symmetric geometric bias in the distribution of argon in our samples, possibly related to advective redistribution of argon accompanying the deformation of cylindrical charges into spheroids driven by surface tension. Average diffusivity, D_{Ar} = 4.791{μm }^{2} /s, is close to the predicted value, D_{Ar} = {μm }^{2} /s ( σ_{ \\bar{x} } = 1.576 {μm }^{2} /s), suggesting that Behrens and Zhang's (2001) empirical model is valid for anhydrous rhyolite melts to relatively higher temperatures and lower pressures. Behrens, H. and Y. Zhang (2001). "Ar diffusion in hydrous silicic melts: implications for volatile diffusion mechanisms and fractionation." Earth and Planetary Science Letters 192: 363-376.

Diffusion Influenced Adsorption Kinetics.

Science.gov (United States)

Miura, Toshiaki; Seki, Kazuhiko

2015-08-27

When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

How to measure atomic diffusion processes in the sub-nanometer range

International Nuclear Information System (INIS)

Schmidt, H.; Gupta, M.; Gutberlet, T.; Stahn, J.; Bruns, M.

2008-01-01

Self-diffusion of the atomic constituents in the solid state is a fundamental transport process that controls various materials properties. With established methods of diffusivity determination it is only possible to measure diffusion processes on a length scale down to 10 nm at corresponding diffusivities of 10 -23 m 2 s -1 . However, for complex materials like amorphous or nano-structured solids the given values are often not sufficient for a proper characterization. Consequently, it is necessary to detect diffusion length well below 1 nm. Here, we present the method of neutron reflectometry on isotope multilayers. For two model systems, an amorphous semiconductor and an amorphous metallic alloy, the efficiency of this method is demonstrated to detect minimum diffusion lengths of only 0.6-0.7 nm. It is further shown that diffusivities can be derived which are more than two orders of magnitude lower than those obtainable with conventional methods. Prospects of this method in order to solve actual kinetic problems in materials science are given

Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

Energy Technology Data Exchange (ETDEWEB)

Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

2014-02-28

A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

Diffraction and diffusion in room acoustics

DEFF Research Database (Denmark)

Rindel, Jens Holger; Rasmussen, Birgit

1996-01-01

Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

Spin drift and spin diffusion currents in semiconductors

Energy Technology Data Exchange (ETDEWEB)

Idrish Miah, M [Nanoscale Science and Technology Centre and School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia)], E-mail: m.miah@griffith.edu.au

2008-09-15

On the basis of a spin drift-diffusion model, we show how the spin current is composed and find that spin drift and spin diffusion contribute additively to the spin current, where the spin diffusion current decreases with electric field while the spin drift current increases, demonstrating that the extension of the spin diffusion length by a strong field does not result in a significant increase in spin current in semiconductors owing to the competing effect of the electric field on diffusion. We also find that there is a spin drift-diffusion crossover field for a process in which the drift and diffusion contribute equally to the spin current, which suggests a possible method of identifying whether the process for a given electric field is in the spin drift or spin diffusion regime. Spin drift-diffusion crossover fields for GaAs are calculated and are found to be quite small. We derive the relations between intrinsic spin diffusion length and the spin drift-diffusion crossover field of a semiconductor for different electron statistical regimes. The findings resulting from this investigation might be important for semiconductor spintronics.

Spin drift and spin diffusion currents in semiconductors

Directory of Open Access Journals (Sweden)

M Idrish Miah

2008-01-01

Full Text Available On the basis of a spin drift-diffusion model, we show how the spin current is composed and find that spin drift and spin diffusion contribute additively to the spin current, where the spin diffusion current decreases with electric field while the spin drift current increases, demonstrating that the extension of the spin diffusion length by a strong field does not result in a significant increase in spin current in semiconductors owing to the competing effect of the electric field on diffusion. We also find that there is a spin drift-diffusion crossover field for a process in which the drift and diffusion contribute equally to the spin current, which suggests a possible method of identifying whether the process for a given electric field is in the spin drift or spin diffusion regime. Spin drift-diffusion crossover fields for GaAs are calculated and are found to be quite small. We derive the relations between intrinsic spin diffusion length and the spin drift-diffusion crossover field of a semiconductor for different electron statistical regimes. The findings resulting from this investigation might be important for semiconductor spintronics.

Spin drift and spin diffusion currents in semiconductors

International Nuclear Information System (INIS)

Idrish Miah, M

2008-01-01

On the basis of a spin drift-diffusion model, we show how the spin current is composed and find that spin drift and spin diffusion contribute additively to the spin current, where the spin diffusion current decreases with electric field while the spin drift current increases, demonstrating that the extension of the spin diffusion length by a strong field does not result in a significant increase in spin current in semiconductors owing to the competing effect of the electric field on diffusion. We also find that there is a spin drift-diffusion crossover field for a process in which the drift and diffusion contribute equally to the spin current, which suggests a possible method of identifying whether the process for a given electric field is in the spin drift or spin diffusion regime. Spin drift-diffusion crossover fields for GaAs are calculated and are found to be quite small. We derive the relations between intrinsic spin diffusion length and the spin drift-diffusion crossover field of a semiconductor for different electron statistical regimes. The findings resulting from this investigation might be important for semiconductor spintronics.

Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

International Nuclear Information System (INIS)

El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

2010-01-01

The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

Science.gov (United States)

1992-11-01

is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

Permeability estimation from NMR diffusion measurements in reservoir rocks.

Science.gov (United States)

Balzarini, M; Brancolini, A; Gossenberg, P

1998-01-01

It is well known that in restricted geometries, such as in porous media, the apparent diffusion coefficient (D) of the fluid depends on the observation time. From the time dependence of D, interesting information can be derived to characterise geometrical features of the porous media that are relevant in oil industry applications. In particular, the permeability can be related to the surface-to-volume ratio (S/V), estimated from the short time behaviour of D(t), and to the connectivity of the pore space, which is probed by the long time behaviour of D(t). The stimulated spin-echo pulse sequence, with pulsed magnetic field gradients, has been used to measure the diffusion coefficients on various homogeneous and heterogeneous sandstone samples. It is shown that the petrophysical parameters obtained by our measurements are in good agreement with those yielded by conventional laboratory techniques (gas permeability and electrical conductivity). Although the diffusing time is limited by T1, eventually preventing an observation of the real asymptotic behaviour, and the surface-to-volume ratio measured by nuclear magnetic resonance is different from the value obtained by BET because of the different length scales probed, the measurement remains reliable and low-time consuming.

A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

Science.gov (United States)

Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

2014-01-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

Propagation of intense laser radiation through a diffusion flame of burning oil

Energy Technology Data Exchange (ETDEWEB)

Gvozdev, S V; Glova, A F; Dubrovskii, V Yu; Durmanov, S T; Krasyukov, A G; Lysikov, A Yu; Smirnov, G V; Pleshkov, V M [State Research Center of Russian Federation ' Troitsk Institute for Innovation and Fusion Research' , Troitsk, Moscow Region (Russian Federation)

2015-06-30

We report the results of measuring the absorption coefficient of radiation from a cw ytterbium fibre single-mode laser with the power up to 1.5 kW by a diffusion flame of oil, burning in the atmosphere air at normal pressure on a free surface. For the constant length (30 mm) and width (30 mm) of the flame and the distance 10 mm between the laser beam axis and the oil surface the dependence of the absorption coefficient, averaged over the flame length, on the mean radiation intensity (varied from 4.5 × 10{sup 3} to 1.2 × 10{sup 6} W cm{sup -2}) entering the flame is obtained. The qualitative explanation of nonmonotonic behaviour of the absorption coefficient versus the intensity is presented. (laser applications and other topics in quantum electronics)

Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

Energy Technology Data Exchange (ETDEWEB)

Lawrenz, M.

2007-10-30

In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

Control of in vivo disposition and immunogenicity of polymeric micelles by adjusting poly(sarcosine) chain lengths on surface

Science.gov (United States)

Kurihara, Kensuke; Ueda, Motoki; Hara, Isao; Ozeki, Eiichi; Togashi, Kaori; Kimura, Shunsaku

2017-07-01

Four kinds of A3B-type amphiphilic polydepsipeptides, (poly(sarcosine))3- b-poly( l-lactic acid) (the degree of polymerization of poly(sarcosine) are 10, 33, 55, and 85; S10 3 , S33 3 , S55 3 , and S85 3 ) were synthesized to prepare core-shell type polymeric micelles. Their in vivo dispositions and stimulations to trigger immune system to produce IgM upon multiple administrations to mice were examined. With increasing poly(sarcosine) chain lengths, the hydrophilic shell became thicker and the surface density at the most outer surface decreased on the basis of dynamic and static light scattering measurements. These two physical elements of polymeric micelles elicited opposite effects on the immune response in light of the chain length therefore to show an optimized poly(sarcosine) chain length existing between 33mer and 55mer to suppress the accelerated blood clearance phenomenon associated with polymeric micelles.

Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

International Nuclear Information System (INIS)

Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

2016-01-01

We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

Analysis of the land surface heterogeneity and its impact on atmospheric variables and the aerodynamic and thermodynamic roughness lengths

NARCIS (Netherlands)

Ma, Y.M.; Menenti, M.; Feddes, R.A.; Wang, J.M.

2008-01-01

The land surface heterogeneity has a very significant impact on atmospheric variables (air temperature T-a, wind speed u, and humidity q), the aerodynamic roughness length z(0m), thermodynamic roughness length z(0h), and the excess resistance to heat transfer kB(-1). First, in this study the land

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

Science.gov (United States)

Li, Xiaofan; Nie, Qing

2009-07-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

Critical role of surface chemical modifications induced by length shortening on multi-walled carbon nanotubes-induced toxicity

Directory of Open Access Journals (Sweden)

Bussy Cyrill

2012-11-01

Full Text Available Abstract Given the increasing use of carbon nanotubes (CNT in composite materials and their possible expansion to new areas such as nanomedicine which will both lead to higher human exposure, a better understanding of their potential to cause adverse effects on human health is needed. Like other nanomaterials, the biological reactivity and toxicity of CNT were shown to depend on various physicochemical characteristics, and length has been suggested to play a critical role. We therefore designed a comprehensive study that aimed at comparing the effects on murine macrophages of two samples of multi-walled CNT (MWCNT specifically synthesized following a similar production process (aerosol-assisted CVD, and used a soft ultrasonic treatment in water to modify the length of one of them. We showed that modification of the length of MWCNT leads, unavoidably, to accompanying structural (i.e. defects and chemical (i.e. oxidation modifications that affect both surface and residual catalyst iron nanoparticle content of CNT. The biological response of murine macrophages to the two different MWCNT samples was evaluated in terms of cell viability, pro-inflammatory cytokines secretion and oxidative stress. We showed that structural defects and oxidation both induced by the length reduction process are at least as responsible as the length reduction itself for the enhanced pro-inflammatory and pro-oxidative response observed with short (oxidized compared to long (pristine MWCNT. In conclusion, our results stress that surface properties should be considered, alongside the length, as essential parameters in CNT-induced inflammation, especially when dealing with a safe design of CNT, for application in nanomedicine for example.

A Monte Carlo study of radon detection in cylindrical diffusion chambers

Energy Technology Data Exchange (ETDEWEB)

Rickards, Jorge, E-mail: rickards@fisica.unam.m [Instituto de Fisica, Universidad Nacional Autonoma de Mexico, Circuito de la Investigacion Cientifica, Ciudad Universitaria, Delegacion Coyoacan, 04520 Mexico, D.F. (Mexico); Golzarri, Jose-Ignacio, E-mail: golzarri@fisica.unam.m [Instituto de Fisica, Universidad Nacional Autonoma de Mexico, Circuito de la Investigacion Cientifica, Ciudad Universitaria, Delegacion Coyoacan, 04520 Mexico, D.F. (Mexico); Espinosa, Guillermo, E-mail: espinosa@fisica.unam.m [Instituto de Fisica, Universidad Nacional Autonoma de Mexico, Circuito de la Investigacion Cientifica, Ciudad Universitaria, Delegacion Coyoacan, 04520 Mexico, D.F. (Mexico)

2010-05-15

The functioning of radon diffusion chambers was studied using the Monte Carlo code RAMMX developed here. The alpha particles from radon are assumed randomly produced in the volume of the cylinder, and those from the progeny are assumed to originate randomly at the cylindrical surface. The energy spectrum, the distribution of incident angles, and the distribution of path lengths of the alpha particles on the detector were obtained. These quantities vary depending on input parameters such as initial alpha particle energy, radius and depth of the diffusion chamber, detector size and atmospheric pressure. The calculated energy spectrum for both {sup 222}Rn and {sup 220}Rn was compared with experiment, permitting the identification of each peak and its origin, and a better understanding of radon monitoring. Three aspects not considered in previous calculations are progeny alphas coming from surfaces of the monitor, taking into account the atmospheric pressure, and including the isotope {sup 220}Rn.

Exploiting broad-area surface emitting lasers to manifest the path-length distributions of finite-potential quantum billiards.

Science.gov (United States)

Yu, Y T; Tuan, P H; Chang, K C; Hsieh, Y H; Huang, K F; Chen, Y F

2016-01-11

Broad-area vertical-cavity surface-emitting lasers (VCSELs) with different cavity sizes are experimentally exploited to manifest the influence of the finite confinement strength on the path-length distribution of quantum billiards. The subthreshold emission spectra of VCSELs are measured to obtain the path-length distributions by using the Fourier transform. It is verified that the number of the resonant peaks in the path-length distribution decreases with decreasing the confinement strength. Theoretical analyses for finite-potential quantum billiards are numerically performed to confirm that the mesoscopic phenomena of quantum billiards with finite confinement strength can be analogously revealed by using broad-area VCSELs.

First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

International Nuclear Information System (INIS)

Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

2014-01-01

First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

Directory of Open Access Journals (Sweden)

N. Javid Rouzi

2009-04-01

Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

Diffusion transport of nanoparticles at nanochannel boundaries

International Nuclear Information System (INIS)

Mahadevan, T. S.; Milosevic, M.; Kojic, M.; Hussain, F.; Kojic, N.; Serda, R.; Ferrari, M.; Ziemys, A.

2013-01-01

The manipulation of matter at the nanoscale has unleashed a great potential for engineering biomedical drug carriers, but the transport of nanoparticles (NPs) under nanoscale confinement is still poorly understood. Using colloidal physics to describe NP interactions, we have computationally studied the passive transport of NPs using experimentally relevant conditions from bulk into a nanochannel of 60–90 nm height. NP size, channel height, and the Debye length are comparable so that changes in nanoscale dimensions may induce substantial changes in NP transport kinetics. We show that subtle changes in nanochannel dimensions may alter the energy barrier by about six orders of magnitude resulting in different NP penetration depths and diffusion mechanisms: ballistic, first-order and quasi zero-order transport regimes. The analysis of NP diffusion by continuum methods reveals that apparent diffusivity is reduced by decreasing channel size. The continuum finite element (FE) numerical method reproduced the colloidal model results only when surface interactions were accounted for. These results give a new insight into NP passive transport at the boundaries of nanoconfined domains, and have implications on the design of nanoscale fluidics and NP systems for biomedical and engineering applications.

Diffusion bonding

International Nuclear Information System (INIS)

Anderson, R.C.

1976-01-01

A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

PEGylation on mixed monolayer gold nanoparticles: Effect of grafting density, chain length, and surface curvature.

Science.gov (United States)

Lin, Jiaqi; Zhang, Heng; Morovati, Vahid; Dargazany, Roozbeh

2017-10-15

PEGylation on nanoparticles (NPs) is widely used to prevent aggregation and to mask NPs from the fast clearance system in the body. Understanding the molecular details of the PEG layer could facilitate rational design of PEGylated NPs that maximize their solubility and stealth ability without significantly compromising the targeting efficiency and cellular uptake. Here, we use molecular dynamics (MD) simulation to understand the structural and dynamic the PEG coating of mixed monolayer gold NPs. Specifically, we modeled gold NPs with PEG grafting densities ranging from 0-2.76chain/nm 2 , chain length with 0-10 PEG monomers, NP core diameter from 5nm to 500nm. It is found that the area accessed by individual PEG chains gradually transits from a "mushroom" to a "brush" conformation as NP surface curvature become flatter, whereas such a transition is not evident on small NPs when grafting density increases. It is shown that moderate grafting density (∼1.0chain/nm 2 ) and short chain length are sufficient enough to prevent NPs from aggregating in an aqueous medium. The effect of grafting density on solubility is also validated by dynamic light scattering measurements of PEGylated 5nm gold NPs. With respect to the shielding ability, simulations predict that increase either grafting density, chain length, or NP diameter will reduce the accessibility of the protected content to a certain size molecule. Interestingly, reducing NP surface curvature is estimated to be most effective in promoting shielding ability. For shielding against small molecules, increasing PEG grafting density is more effective than increasing chain length. A simple model that includes these three investigated parameters is developed based on the simulations to roughly estimate the shielding ability of the PEG layer with respect to molecules of different sizes. The findings can help expand our current understanding of the PEG layer and guide rational design of PEGylated gold NPs for a particular

Advection and diffusion in random media implications for sea surface temperature anomalies

CERN Document Server

Piterbarg, Leonid I

1997-01-01

The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

Effective attenuation lengths for quantitative determination of surface composition by Auger-electron spectroscopy and X-ray photoelectron spectroscopy

International Nuclear Information System (INIS)

Jablonski, A.; Powell, C.J.

2017-01-01

Highlights: • Effective attenuation lengths (EALs) for determination of surface composition by XPS. • Considerable difference from EALs used for overlayer thickness measurements. • New analytical algorithms for calculating the effective attenuation length. - Abstract: The effective attenuation length (EAL) is normally used in place of the inelastic mean free path (IMFP) to account for elastic-scattering effects when describing the attenuation of Auger electrons and photoelectrons from a planar substrate by an overlayer film. An EAL for quantitative determination of surface composition by Auger-electron spectroscopy (AES) or X-ray photoelectron spectroscopy (XPS) is similarly useful to account for elastic-scattering effects on the signal intensities. We calculated these EALs for four elemental solids (Si, Cu, Ag, and Au) and for energies between 160 eV and 1.4 keV. The XPS calculations were made for two instrumental configurations while the AES calculations were made from the XPS formalism after “switching off” the XPS anisotropy. The EALs for quantitative determination of surface composition by AES and XPS were weak functions of emission angle for emission angles between 0 and 50°. The ratios of the average values of these EALs to the corresponding IMFPs could be fitted to a second-order function of the single-scattering albedo, a convenient measure of the strength of elastic-scattering effects. EALs for quantitative determination of surface composition by AES and XPS for other materials can be simply found from this relationship.

Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

Energy Technology Data Exchange (ETDEWEB)

Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

2016-09-15

Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

Incorporating photon recycling into the analytical drift-diffusion model of high efficiency solar cells

Energy Technology Data Exchange (ETDEWEB)

Lumb, Matthew P. [The George Washington University, 2121 I Street NW, Washington, DC 20037 (United States); Naval Research Laboratory, Washington, DC 20375 (United States); Steiner, Myles A.; Geisz, John F. [National Renewable Energy Laboratory, Golden, Colorado 80401 (United States); Walters, Robert J. [Naval Research Laboratory, Washington, DC 20375 (United States)

2014-11-21

The analytical drift-diffusion formalism is able to accurately simulate a wide range of solar cell architectures and was recently extended to include those with back surface reflectors. However, as solar cells approach the limits of material quality, photon recycling effects become increasingly important in predicting the behavior of these cells. In particular, the minority carrier diffusion length is significantly affected by the photon recycling, with consequences for the solar cell performance. In this paper, we outline an approach to account for photon recycling in the analytical Hovel model and compare analytical model predictions to GaAs-based experimental devices operating close to the fundamental efficiency limit.

Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

Energy Technology Data Exchange (ETDEWEB)

Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

2013-09-30

Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo₂C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo₂C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft² at a feed pressure of only 20 psig. The highest H₂/N₂ selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo₂C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo₂C catalyst layers. We have fabricated a Mo₂C/V composite membrane that in pure gas testing delivered a H₂ flux of 238 SCFH/ft² at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft².psi. However, during testing of a Mo₂C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft².psi was obtained which was stable during the entire test, meeting the permeance associated with

First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Wu, M H; Liu, X H; Gu, J F; Jin, Z H

2013-01-01

Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

Effects of Nanowire Length and Surface Roughness on the Electrochemical Sensor Properties of Nafion-Free, Vertically Aligned Pt Nanowire Array Electrodes

Directory of Open Access Journals (Sweden)

Zhiyang Li

2015-09-01

Full Text Available In this paper, vertically aligned Pt nanowire arrays (PtNWA with different lengths and surface roughnesses were fabricated and their electrochemical performance toward hydrogen peroxide (H2O2 detection was studied. The nanowire arrays were synthesized by electroplating Pt in nanopores of anodic aluminum oxide (AAO template. Different parameters, such as current density and deposition time, were precisely controlled to synthesize nanowires with different surface roughnesses and various lengths from 3 μm to 12 μm. The PtNWA electrodes showed better performance than the conventional electrodes modified by Pt nanowires randomly dispersed on the electrode surface. The results indicate that both the length and surface roughness can affect the sensing performance of vertically aligned Pt nanowire array electrodes. Generally, longer nanowires with rougher surfaces showed better electrochemical sensing performance. The 12 μm rough surface PtNWA presented the largest sensitivity (654 μA·mM−1·cm−2 among all the nanowires studied, and showed a limit of detection of 2.4 μM. The 12 μm rough surface PtNWA electrode also showed good anti-interference property from chemicals that are typically present in the biological samples such as ascorbic, uric acid, citric acid, and glucose. The sensing performance in real samples (river water was tested and good recovery was observed. These Nafion-free, vertically aligned Pt nanowires with surface roughness control show great promise as versatile electrochemical sensors and biosensors.

Models of diffuse solar radiation

Energy Technology Data Exchange (ETDEWEB)

Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)

2008-04-15

For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1989-01-01

Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-08-15

Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

Label-free monitoring of diffusion in microfluidics

DEFF Research Database (Denmark)

Sørensen, Kristian Tølbøl; Kristensen, Anders

2017-01-01

Label-free, real-time detection of concentration gradients is demonstrated in a microfluidic H-filter, using an integrated photonic crystal slab sensor to monitor sample refractive index with spatial resolution. The recorded diffusion profiles reveal root-mean-square diffusion lengths for non...

Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

Science.gov (United States)

Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

2016-03-01

Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

Nonlinear optical susceptibilities in the diffusion modified AlxGa1-xN/GaN single quantum well

Science.gov (United States)

Das, T.; Panda, S.; Panda, B. K.

2018-05-01

Under thermal treatment of the post growth AlGaN/GaN single quantum well, the diffusion of Al and Ga atoms across the interface is expected to form the diffusion modified quantum well with diffusion length as a quantitative parameter for diffusion. The modification of confining potential and position-dependent effective mass in the quantum well due to diffusion is calculated taking the Fick's law. The built-in electric field which arises from spontaneous and piezoelectric polarizations in the wurtzite structure is included in the effective mass equation. The electronic states are calculated from the effective mass equation using the finite difference method for several diffusion lengths. Since the effective well width decreases with increasing diffusion length, the energy levels increase with it. The intersubband energy spacing in the conduction band decreases with diffusion length due to built-in electric field and reduction of effective well width. The linear susceptibility for first-order and the nonlinear second-order and third-order susceptibilities are calculated using the compact density matrix approach taking only two levels. The calculated susceptibilities are red shifted with increase in diffusion lengths due to decrease in intersubband energy spacing.

Ambipolar diffusion regulated collapse of filaments threaded by perpendicular magnetic fields

Science.gov (United States)

Burge, C. A.; Van Loo, S.; Falle, S. A. E. G.; Hartquist, T. W.

2016-11-01

Context. In giant molecular clouds (GMCs), the fractional ionisation is low enough that the neutral and charged particles are weakly coupled. A consequence of this is that the magnetic flux redistributes within the cloud, allowing an initially magnetically supported region to collapse. Aims: We aim to elucidate the effects of ambipolar diffusion on the evolution of infinitely long filaments and the effect of decaying turbulence on that evolution. Methods: First, in ideal magnetohydrodynamics (MHD), a two-dimensional cylinder of an isothermal magnetised plasma with initially uniform density was allowed to evolve to an equilibrium state. Then, the response of the filament to ambipolar diffusion was followed using an adaptive mesh refinement multifluid MHD code. Various ambipolar resistivities were chosen to reflect different ratios of Jeans length to ambipolar diffusion length scale. To study the effect of turbulence on the ambipolar diffusion rate, we perturbed the equilibrium filament with a turbulent velocity field quantified by a rms sonic Mach number, Mrms, of 10, 3 or 1. Results: We numerically reproduce the density profiles for filaments that are in magnetohydrostatic and pressure equilibrium with their surroundings obtained in a published model and show that these equilibria are dynamically stable. If the effect of ambipolar diffusion is considered, these filaments lose magnetic support initiating cloud collapse. The filaments do not lose magnetic flux. Rather the magnetic flux is redistributed within the filament from the dense centre towards the diffuse envelope. The rate of the collapse is inversely proportional to the fractional ionisation and two gravitationally-driven ambipolar diffusion regimes for the collapse are observed as predicted in a published model. For high values of the ionisation coefficient, that is X ≥ 10-7, the gas is strongly coupled to the magnetic field and the Jeans length is larger than the ambipolar diffusion length scale. Then

Electrostatic turbulence with finite parallel correlation length and radial electric field generation

International Nuclear Information System (INIS)

Vlad, M.; Spineanu, F.; Misguich, J.H.; Balescu, R.

2001-01-01

Particle diffusion in a given electrostatic turbulence with a finite correlation length along the confining magnetic field is studied in the test particle approach. An anomalous diffusion regime of amplified diffusion coefficients is found in the conditions when particle trapping in the structure of the stochastic potential is effective. The auto-generated radial electric field is calculated. (author)

Quantitative estimation of Holocene surface salinity variation in the Black Sea using dinoflagellate cyst process length

DEFF Research Database (Denmark)

Mertens, Kenneth Neil; Bradley, Lee R.; Takano, Yoshihito

2012-01-01

Reconstruction of salinity in the Holocene Black Sea has been an ongoing debate over the past four decades. Here we calibrate summer surface water salinity in the Black Sea, Sea of Azov and Caspian Sea with the process length of the dinoflagellate cyst Lingulodinium machaerophorum. We then apply ...

Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

Energy Technology Data Exchange (ETDEWEB)

Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

2014-07-28

Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

RHEED studies of the nucleation, growth, and mobility of Ag atoms on the Si(111)7 x 7 surface

International Nuclear Information System (INIS)

Roos, K.R.

1993-07-01

The low temperature and flux dependent growth of ultrathin Ag films on the Si(111)7x7 surface is studied with Reflection High-Energy Electron Diffraction (RHEED). The grazing incidence geometry of RHEED allows for an incident molecular beam normal to the surface, and makes it an ideal surface probe for studying ultrathin film growth in real time. Short-lived oscillations in the diffracted intensity are observed during Ag deposition at 150 K, indicating quasi-layer-by-layer growth mediated by adatom mobility. When the 150 K growth is performed over a wide range of deposition rates F, the peak intensity is observed to scale, i.e. I(Ft) depends only on the total amount deposited, which implies thermally activated diffusion is absent at 150 K. Scaling is not obeyed at higher temperatures (T≥473 K) for the growth of the √3x√3 R30 degrees (√3) superstructure. Testing for scaling of the diffracted intensity constitutes a new experimental method which can be applied generally to determine if thermal diffusion is active at a particular temperature. Scaling is consistent with a constant diffusion length R 0 , independent of substrate temperature and deposition rate. The presence of a non-thermal diffusion mechanism (responsible for the constant diffusion length R 0 ) is confirmed by monitoring the flux dependence of the √3 superstructure growth during deposition at T≥473 K. At these temperatures the total diffusion length R is given by R=R 0 +(4Dt) 1/2 , where (4Dt) 1/2 is the thermal component. A non-zero intercept R 0 is found by plotting the peak intensity I p 1/2 (a measure of the average domain size) vs. deposition rate F -1/2 (F -1 is proportional to the available diffusion time.) From the FWHM of a low coverage (0.2 ML) √3 spot, an estimation of 50 angstrom is made for a lower bound of the magnitude of R 0

Surface-immobilized hydrogel patterns on length scales from micrometer to nanometer

Science.gov (United States)

Zeira, Assaf

The present work concentrates on the study of pattern generation and transfer processes of monolayer covered surfaces, deriving from the basic working concept of Constructive Lithography. As an advancement of constructive lithography, we developed a direct, one-step printing (contact electrochemical printing, CEP) and replication (contact electrochemical replication, CER) of hydrophilic organic monolayer patterns surrounded by a hydrophobic monolayer background. In addition, we present a process of transfer of metal between two contacting solid surfaces to predefined monolayer template pattern sites (contact electrochemical transfer, CET). This thesis shows that CEP, CER, and CET may be implemented under a variety of different experimental conditions, regardless of whether the initial "master" pattern was created by a parallel (fast) or serial (slow) patterning process. CEP and CER also posses the unique attractive property that each replica may equally function as master stamp in the fabrication of additional replicas. Moreover, due to a mechanism of selfcorrection patterned surfaces produced these process are often free of defects that the initial "master" stamp may had. We finally show that the electrochemical patterning of OTS monolayers on silicon can be further extended to flexible polymeric substrate materials as well as to a variety of chemical manipulations, allowing the fabrication of tridimensional (3D) composite structures made on the basis of readily available OTS compound. The results obtained suggest that such contact electrochemical processes could be used to rapidly generate multiple copies of surface patterns spanning variable length scales, this basic approach being applicable to rigid as well as flexible substrate materials.

Research of Innovation Diffusion on Industrial Networks

Directory of Open Access Journals (Sweden)

Yongtai Chen

2014-01-01

Full Text Available The real value of innovation consists in its diffusion on industrial network. The factors which affect the diffusion of innovation on industrial network are the topology of industrial network and rules of diffusion. Industrial network is a complex network which has scale-free and small-world characters; its structure has some affection on threshold, length of path, enterprise’s status, and information share of innovation diffusion. Based on the cost and attitude to risk of technical innovation, we present the “avalanche” diffusing model of technical innovation on industrial network.

Unified heat kernel regression for diffusion, kernel smoothing and wavelets on manifolds and its application to mandible growth modeling in CT images.

Science.gov (United States)

Chung, Moo K; Qiu, Anqi; Seo, Seongho; Vorperian, Houri K

2015-05-01

We present a novel kernel regression framework for smoothing scalar surface data using the Laplace-Beltrami eigenfunctions. Starting with the heat kernel constructed from the eigenfunctions, we formulate a new bivariate kernel regression framework as a weighted eigenfunction expansion with the heat kernel as the weights. The new kernel method is mathematically equivalent to isotropic heat diffusion, kernel smoothing and recently popular diffusion wavelets. The numerical implementation is validated on a unit sphere using spherical harmonics. As an illustration, the method is applied to characterize the localized growth pattern of mandible surfaces obtained in CT images between ages 0 and 20 by regressing the length of displacement vectors with respect to a surface template. Copyright © 2015 Elsevier B.V. All rights reserved.

Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

International Nuclear Information System (INIS)

Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

2010-01-01

Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

Exciton diffusion coefficient measurement in ZnO nanowires under electron beam irradiation

Science.gov (United States)

Donatini, Fabrice; Pernot, Julien

2018-03-01

In semiconductor nanowires (NWs) the exciton diffusion coefficient can be determined using a scanning electron microscope fitted with a cathodoluminescence system. High spatial and temporal resolution cathodoluminescence experiments are needed to measure independently the exciton diffusion length and lifetime in single NWs. However, both diffusion length and lifetime can be affected by the electron beam bombardment during observation and measurement. Thus, in this work the exciton lifetime in a ZnO NW is measured versus the electron beam dose (EBD) via a time-resolved cathodoluminescence experiment with a temporal resolution of 50 ps. The behavior of the measured exciton lifetime is consistent with our recent work on the EBD dependence of the exciton diffusion length in similar NWs investigated under comparable SEM conditions. Combining the two results, the exciton diffusion coefficient in ZnO is determined at room temperature and is found constant over the full span of EBD.

Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

Science.gov (United States)

Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

2018-01-01

Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

Electrical and optical characterization of surface passivation in GaAs nanowires.

Science.gov (United States)

Chang, Chia-Chi; Chi, Chun-Yung; Yao, Maoqing; Huang, Ningfeng; Chen, Chun-Chung; Theiss, Jesse; Bushmaker, Adam W; Lalumondiere, Stephen; Yeh, Ting-Wei; Povinelli, Michelle L; Zhou, Chongwu; Dapkus, P Daniel; Cronin, Stephen B

2012-09-12

We report a systematic study of carrier dynamics in Al(x)Ga(1-x)As-passivated GaAs nanowires. With passivation, the minority carrier diffusion length (L(diff)) increases from 30 to 180 nm, as measured by electron beam induced current (EBIC) mapping, and the photoluminescence (PL) lifetime increases from sub-60 ps to 1.3 ns. A 48-fold enhancement in the continuous-wave PL intensity is observed on the same individual nanowire with and without the Al(x)Ga(1-x)As passivation layer, indicating a significant reduction in surface recombination. These results indicate that, in passivated nanowires, the minority carrier lifetime is not limited by twin stacking faults. From the PL lifetime and minority carrier diffusion length, we estimate the surface recombination velocity (SRV) to range from 1.7 × 10(3) to 1.1 × 10(4) cm·s(-1), and the minority carrier mobility μ is estimated to lie in the range from 10.3 to 67.5 cm(2) V(-1) s(-1) for the passivated nanowires.

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

Energy Technology Data Exchange (ETDEWEB)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

Science.gov (United States)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Effective Debye length in closed nanoscopic systems: a competition between two length scales.

Science.gov (United States)

Tessier, Frédéric; Slater, Gary W

2006-02-01

The Poisson-Boltzmann equation (PBE) is widely employed in fields where the thermal motion of free ions is relevant, in particular in situations involving electrolytes in the vicinity of charged surfaces. The applications of this non-linear differential equation usually concern open systems (in osmotic equilibrium with an electrolyte reservoir, a semi-grand canonical ensemble), while solutions for closed systems (where the number of ions is fixed, a canonical ensemble) are either not appropriately distinguished from the former or are dismissed as a numerical calculation exercise. We consider herein the PBE for a confined, symmetric, univalent electrolyte and quantify how, in addition to the Debye length, its solution also depends on a second length scale, which embodies the contribution of ions by the surface (which may be significant in high surface-to-volume ratio micro- or nanofluidic capillaries). We thus establish that there are four distinct regimes for such systems, corresponding to the limits of the two parameters. We also show how the PBE in this case can be formulated in a familiar way by simply replacing the traditional Debye length by an effective Debye length, the value of which is obtained numerically from conservation conditions. But we also show that a simple expression for the value of the effective Debye length, obtained within a crude approximation, remains accurate even as the system size is reduced to nanoscopic dimensions, and well beyond the validity range typically associated with the solution of the PBE.

Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

DEFF Research Database (Denmark)

Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

2017-01-01

) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

Acoustic profilometry of interphases in epoxy due to segregation and diffusion using Brillouin microscopy

Energy Technology Data Exchange (ETDEWEB)

Mueller, U; Bactavatchalou, R; Baller, J; Philipp, M; Sanctuary, R; Zielinski, B; Krueger, J K [Laboratoire de Physique des Materiaux, Universite du Luxembourg, 162A, Avenue de la Faiencerie, L-1115 Luxembourg (Luxembourg); Alnot, P; Possart, W [Laboratoire Europeen de Recherche Universitaire Saarland-Lorraine (Germany)], E-mail: mail@tauron.de

2008-02-15

Reactive network forming polymer systems like epoxies are of huge technological interest because of their adhesive properties based on specific interactions with a large variety of materials. These specific interactions alter the morphology of the epoxy within areas determined by the correlation length of these interactions. The changed morphology leads to interphases with altered (mechanical) properties. Besides these surface-induced interphases, bulk interphases do occur due to segregation, crystallization, diffusion, etc. A new experimental technique to characterize such mechanical interphases is {mu}-Brillouin spectroscopy ({mu}-BS). With {mu}-BS, we studied interphases and their formation in epoxies due to segregation of the constituent components and due to selective diffusion of one component. In the latter case, we will demonstrate the influence of changing the boundary conditions of the diffusion process on the shape of the interphase.

Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

Science.gov (United States)

Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

2012-09-24

We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

Electrolyte diffusion in compacted montmorillonite engineered barriers

International Nuclear Information System (INIS)

Jahnke, F.M.; Radke, C.J.

1985-09-01

The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab

Surface-structure dependence of healing radiation-damage mechanism in nanoporous tungsten

Science.gov (United States)

Duan, Guohua; Li, Xiangyan; Sun, Jingjing; Hao, Congyu; Xu, Yichun; Zhang, Yange; Liu, Wei; Liu, C. S.

2018-01-01

Under nuclear fusion environments, displacement damage in tungsten (W) is usually caused by neutrons irradiation through producing large quantities of vacancies (Vs) and self-interstitial atoms (SIAs). These defects not only affect the mechanical properties of W, but also act as the trap sites for implanted hydrogen isotopes and helium. Nano-porous (NP) W with a high fraction of free surfaces has been developed to mitigate the radiation damage. However, the mechanism of the surface reducing defects accumulation is not well understood. By using multi-scale simulation methods, we investigated the interaction of the SIA and V with different surfaces on across length and time scales. We found that, at a typical operation temperature of 1000 K, surface (1 1 0) preferentially heals radiation damage of W compared with surface (1 0 0) and boundary (3 1 0). On surface (1 1 0), the diffusion barrier for the SIA is only 0.68 eV. The annihilation of the SIA-V happens via the coupled motion of the V segregation towards the surface from the bulk and the two-dimensional diffusion of the SIA on the surface. Such mechanism makes the surface (1 1 0) owe better healing capability. On surface (1 0 0), the diffusion energy barrier for the SIA is 2.48 eV, higher than the diffusion energy barrier of the V in bulk. The annihilation of the SIA-V occurs via the V segregation and recombination. The SIA was found to migrate one-dimensionally along a boundary (3 1 0) with a barrier of 0.21 eV, leading to a lower healing efficiency in the boundary. This study suggested that the on-surface process plays an important role in healing radiation damage of NP W in addition to surface-enhanced diffusion and annihilation near the surface. A certain surface structure renders nano-structured W more radiation-tolerant.

Fractional diffusion equations and anomalous diffusion

CERN Document Server

Evangelista, Luiz Roberto

2018-01-01

Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

International Nuclear Information System (INIS)

Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

2015-01-01

Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

OpenAIRE

Bläckberg, Lisa

2014-01-01

This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

A nonlinear equation for ionic diffusion in a strong binary electrolyte

Science.gov (United States)

Ghosal, Sandip; Chen, Zhen

2010-01-01

The problem of the one-dimensional electro-diffusion of ions in a strong binary electrolyte is considered. The mathematical description, known as the Poisson–Nernst–Planck (PNP) system, consists of a diffusion equation for each species augmented by transport owing to a self-consistent electrostatic field determined by the Poisson equation. This description is also relevant to other important problems in physics, such as electron and hole diffusion across semiconductor junctions and the diffusion of ions in plasmas. If concentrations do not vary appreciably over distances of the order of the Debye length, the Poisson equation can be replaced by the condition of local charge neutrality first introduced by Planck. It can then be shown that both species diffuse at the same rate with a common diffusivity that is intermediate between that of the slow and fast species (ambipolar diffusion). Here, we derive a more general theory by exploiting the ratio of the Debye length to a characteristic length scale as a small asymptotic parameter. It is shown that the concentration of either species may be described by a nonlinear partial differential equation that provides a better approximation than the classical linear equation for ambipolar diffusion, but reduces to it in the appropriate limit. PMID:21818176

Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

International Nuclear Information System (INIS)

Posadillo, R.; Lopez Luque, R.

2009-01-01

The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

2014-01-01

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-09-15

Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

Surface mobilities on solid materials

International Nuclear Information System (INIS)

Binh, V.T.

1983-01-01

This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

Centimetre-scale electron diffusion in photoactive organic heterostructures

Science.gov (United States)

Burlingame, Quinn; Coburn, Caleb; Che, Xiaozhou; Panda, Anurag; Qu, Yue; Forrest, Stephen R.

2018-02-01

The unique properties of organic semiconductors, such as flexibility and lightness, are increasingly important for information displays, lighting and energy generation. But organics suffer from both static and dynamic disorder, and this can lead to variable-range carrier hopping, which results in notoriously poor electrical properties, with low electron and hole mobilities and correspondingly short charge-diffusion lengths of less than a micrometre. Here we demonstrate a photoactive (light-responsive) organic heterostructure comprising a thin fullerene channel sandwiched between an electron-blocking layer and a blended donor:C70 fullerene heterojunction that generates charges by dissociating excitons. Centimetre-scale diffusion of electrons is observed in the fullerene channel, and this can be fitted with a simple electron diffusion model. Our experiments enable the direct measurement of charge diffusivity in organic semiconductors, which is as high as 0.83 ± 0.07 square centimetres per second in a C60 channel at room temperature. The high diffusivity of the fullerene combined with the extraordinarily long charge-recombination time yields diffusion lengths of more than 3.5 centimetres, orders of magnitude larger than expected for an organic system.

Fibreoptic diffuse-light irradiators of biological tissues

International Nuclear Information System (INIS)

Volkov, Vladimir V; Loshchenov, V B; Konov, Vitalii I; Kononenko, Vitalii V

2010-01-01

We report techniques for the fabrication of laser radiation diffusers for interstitial photodynamic therapy. Using chemical etching of the distal end of silica fibre with a core diameter of 200 - 600 μm, we have obtained long (up to 40 mm) diffusers with good scattering uniformity. Laser ablation has been used to produce cylindrical diffusers with high emission contrast and a scattering uniformity no worse than ∼10 % in their middle part. The maximum length of the diffusers produced by this method is 20 - 25 mm. (laser applications and other topics in quantum electronics)

Quantifying brain microstructure with diffusion MRI

DEFF Research Database (Denmark)

Novikov, Dmitry S.; Jespersen, Sune N.; Kiselev, Valerij G.

2016-01-01

the potential to quantify the relevant length scales for neuronal tissue, such as the packing correlation length for neuronal fibers, the degree of neuronal beading, and compartment sizes. The second avenue corresponds to the long-time limit, when the observed signal can be approximated as a sum of multiple non......-exchanging anisotropic Gaussian components. Here the challenge lies in parameter estimation and in resolving its hidden degeneracies. The third avenue employs multiple diffusion encoding techniques, able to access information not contained in the conventional diffusion propagator. We conclude with our outlook...... on the future research directions which can open exciting possibilities for developing markers of pathology and development based on methods of studying mesoscopic transport in disordered systems....

Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

Czech Academy of Sciences Publication Activity Database

Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

2015-01-01

Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

Energy Technology Data Exchange (ETDEWEB)

Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

2017-11-01

In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

Radon diffusion studies in air, gravel, sand, soil and water

International Nuclear Information System (INIS)

Singh, B.; Singh, S.; Virk, H.S.

1993-01-01

Radon isotopes are practically inert and have properties of gases under conditions of geological interest. During their brief lives their atoms are capable of moving from sites of their generation. Radon diffusion studies were carried out in air, gravel, sand, soil and water using silicon diffused junction electronic detector, Alphameter-400. Diffusion constant and diffusion length is calculated for all these materials. (author)

Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

Science.gov (United States)

Matrane, I.; Mazroui, M.; Sbiaai, K.

2018-03-01

We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

Results on positron diffusion in Si

International Nuclear Information System (INIS)

Nielsen, B.; Lynn, K.G.; Vehanen, A.; Schultz, P.J.

1984-10-01

Positron diffusion in Si(100) and Si(111) has been measured using a variable energy positron beam. The diffusion related parameter, E 0 is found to be 4.2 +- 0.2 keV, significantly longer than previously reported values. The positron diffusion coefficient is estimated at D/sub +/ = 2.3 +- 0.4 cm 2 /sec, the uncertainty arising mainly from the characteristics of the assumed positron implantation profile. A drastic reduction in E 0 is found after heating the sample to 1300 0 K, showing that previously reported low values of E 0 are associated with the thermal history of the sample. A high sensitivity to defects introduced by low energy ion bombardment is found, and the defect recovery was followed during heat treatments. Reconstruction of the Si(111) surface into the so-called 7 x 7 structure had no detectable influence on the positron diffusion behavior. No changes in the positron diffusion was observed after covering the surface with atomic hydrogen. However the yield of positronium formation at the surface was enhanced, attributed to an increased density of states at the surface

Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

Science.gov (United States)

Holland, Joseph G; Geiger, Franz M

2012-06-07

The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

Diffusion of drag-reducing polymer solutions within a rough-walled turbulent boundary layer

Science.gov (United States)

Elbing, Brian R.; Dowling, David R.; Perlin, Marc; Ceccio, Steven L.

2010-04-01

The influence of surface roughness on diffusion of wall-injected, drag-reducing polymer solutions within a turbulent boundary layer was studied with a 0.94 m long flat-plate test model at speeds of up to 10.6 m s-1 and Reynolds numbers of up to 9×106. The surface was hydraulically smooth, transitionally rough, or fully rough. Mean concentration profiles were acquired with planar laser induced fluorescence, which was the primary flow diagnostic. Polymer concentration profiles with high injection concentrations (≥1000 wppm) had the peak concentration shifted away from the wall, which was partially attributed to a lifting phenomenon. The diffusion process was divided into three zones—initial, intermediate, and final. Studies of polymer injection into a polymer ocean at concentrations sufficient for maximum drag reduction indicated that the maximum initial zone length is of the order of 100 boundary layer thicknesses. The intermediate zone results indicate that friction velocity and roughness height are important scaling parameters in addition to flow and injection conditions. Lastly, the current results were combined with those in Petrie et al. ["Polymer drag reduction with surface roughness in flat-plate turbulent boundary layer flow," Exp. Fluids 35, 8 (2003)] to demonstrate that the influence of polymer degradation increases with increased surface roughness.

Real space mapping of ionic diffusion and electrochemical activity in energy storage and conversion materials

Science.gov (United States)

Kalinin, Sergei V; Balke, Nina; Kumar, Amit; Dudney, Nancy J; Jesse, Stephen

2014-05-06

A method and system for probing mobile ion diffusivity and electrochemical reactivity on a nanometer length scale of a free electrochemically active surface includes a control module that biases the surface of the material. An electrical excitation signal is applied to the material and induces the movement of mobile ions. An SPM probe in contact with the surface of the material detects the displacement of mobile ions at the surface of the material. A detector measures an electromechanical strain response at the surface of the material based on the movement and reactions of the mobile ions. The use of an SPM tip to detect local deformations allows highly reproducible measurements in an ambient environment without visible changes in surface structure. The measurements illustrate effective spatial resolution comparable with defect spacing and well below characteristic grain sizes of the material.

Measurements of cesium and strontium diffusion in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1988-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel

Diffusion measurements of cesium and strontium in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1985-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)

RHEED studies of the nucleation, growth, and mobility of Ag atoms on the Si(111)7 x 7 surface

Energy Technology Data Exchange (ETDEWEB)

Roos, Kelly Ryan [Iowa State Univ., Ames, IA (United States)

1993-07-01

The low temperature and flux dependent growth of ultrathin Ag films on the Si(111)7x7 surface is studied with Reflection High-Energy Electron Diffraction (RHEED). The grazing incidence geometry of RHEED allows for an incident molecular beam normal to the surface, and makes it an ideal surface probe for studying ultrathin film growth in real time. Short-lived oscillations in the diffracted intensity are observed during Ag deposition at 150 K, indicating quasi-layer-by-layer growth mediated by adatom mobility. When the 150 K growth is performed over a wide range of deposition rates F, the peak intensity is observed to scale, i.e. I(Ft) depends only on the total amount deposited, which implies thermally activated diffusion is absent at 150 K. Scaling is not obeyed at higher temperatures (T≥473 K) for the growth of the √3x√3 R30° (√3) superstructure. Testing for scaling of the diffracted intensity constitutes a new experimental method which can be applied generally to determine if thermal diffusion is active at a particular temperature. Scaling is consistent with a constant diffusion length R₀, independent of substrate temperature and deposition rate. The presence of a non-thermal diffusion mechanism (responsible for the constant diffusion length R₀) is confirmed by monitoring the flux dependence of the √3 superstructure growth during deposition at T≥473 K. At these temperatures the total diffusion length R is given by R=R₀+(4Dt)^1/2, where (4Dt)^1/2 is the thermal component. A non-zero intercept R₀ is found by plotting the peak intensity I_p^1/2 (a measure of the average domain size) vs. deposition rate F^-1/2 (F^-1 is proportional to the available diffusion time.) From the FWHM of a low coverage (0.2 ML) √3 spot, an estimation of 50 Å is made for a lower bound of the magnitude of R₀.

The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

Directory of Open Access Journals (Sweden)

K.A. Widi

2016-09-01

Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

Science.gov (United States)

Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

2017-05-17

A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

Heat transfer and forces on concave surfaces in free molecule flow.

Science.gov (United States)

Fan, C.

1971-01-01

A Monte Carlo modeling technique is described for mathematically simulating free molecular flows over a concave spherical surface and a concave cylindrical surface of finite length. The half-angle of the surfaces may vary from 0 to 90 degrees, and the incident flow may have an arbitrary speed ratio and an arbitrary angle of attack. Partial diffuse reflection and imperfect energy accommodation for molecules colliding with the surfaces are also considered. Results of heat transfer, drag and lift coefficients are presented for a variety of flow conditions. The present Monte Carlo results are shown to be in very good agreement with certain available theoretical solutions.

The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

Science.gov (United States)

Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

2013-06-01

In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

International Nuclear Information System (INIS)

Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

1985-06-01

A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

The structure of horizontal hydrogen-steam diffusion flames

International Nuclear Information System (INIS)

Chan, C.K.; Guerrero, A.

1997-01-01

This paper summarizes a systematic study on the stability, peak temperature and flame length of various horizontal hydrogen-steam diffusion flames in air. Results from this study are discussed in terms of their impact on hydrogen management in a nuclear containment building after a nuclear reactor accident. They show that, for a certain range of emerging hydrogen-steam compositions, a stable diffusion flame can anchor itself at the break in the primary heat transport system. The length of this flame can be up to 100 times the break diameter. This implies that creation of a stable diffusion flame at the break is a possible outcome of the deliberate ignition mitigation scheme. The high temperature and heat flux from a diffusion flame can threaten nearby equipment. However, due to the presence of steam and turbulent mixing with surrounding air, the peak temperatures of these diffusion flames are much lower than the adiabatic constant pressure combustion temperature of a stoichiometric hydrogen-air mixture. These results suggest that the threat of a diffusion flame anchored at the break may be less severe than conservative analysis would indicate. Furthermore, such a flame can remove hydrogen at the source and minimize the possibility of a global gas explosion. (author)

Simple computation of reaction–diffusion processes on point clouds

KAUST Repository

Macdonald, Colin B.

2013-05-20

The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

Simple computation of reaction–diffusion processes on point clouds

KAUST Repository

Macdonald, Colin B.; Merriman, Barry; Ruuth, Steven J.

2013-01-01

The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

Diffusion Under Geometrical Constraint

OpenAIRE

Ogawa, Naohisa

2014-01-01

Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

Science.gov (United States)

Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

2004-07-05

Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

On copper diffusion in silicon measured by glow discharge mass spectrometry.

Science.gov (United States)

Modanese, Chiara; Gaspar, Guilherme; Arnberg, Lars; Di Sabatino, Marisa

2014-11-01

Copper contamination occurs frequently in silicon for photovoltaic applications due to its very fast diffusion coupled with a low solid solubility, especially at room temperature. The combination of these properties exerts a challenge on the direct analysis of Cu bulk concentration in Si by sputtering techniques like glow discharge mass spectrometry (GDMS). This work aims at addressing the challenges in quantitative analysis of fast diffusing elements in Si matrix by GDMS. N-type, monocrystalline (Czochralski) silicon samples were intentionally contaminated with Cu after solidification and consequently annealed at 900 °C to ensure a homogeneous distribution of Cu in the bulk. The samples were quenched after annealing to control the extent of the diffusion to the surface prior to the GDMS analyses, which were carried out at different time intervals from within few minutes after cooling onward. The Cu profiles were measured by high-resolution GDMS operating in a continuous direct current mode, where the integration step length was set to ∼0.5 μm over a total sputtered depth of 8-30 μm. The temperature of the samples during the GDMS analyses was also measured in order to evaluate the diffusion. The Cu contamination of n-type Si samples was observed to be highly material dependent. The practical impact of Cu out-diffusion on the calculation of the relative sensitivity factor (RSF) of Cu in Si is discussed.

Diffusion coefficient for anomalous transport

International Nuclear Information System (INIS)

1986-01-01

A report on the progress towards the goal of estimating the diffusion coefficient for anomalous transport is given. The gyrokinetic theory is used to identify different time and length scale inherent to the characteristics of plasmas which exhibit anomalous transport

On the frequency distributions per unit area of the projected and etchable lengths of surface-intersecting fission tracks: influences of track revelation, observation and measurement

International Nuclear Information System (INIS)

Jonckheere, R.; Haute, P. van den

1999-01-01

In addition to the statistical bounds discussed, thermal history analysis based on the projected and etchable length distributions of surface intersecting fission tracks is limited by systematic factors related to track revelation, observation and measurement. The effects of track revelation, in particular, distort these distributions in the length intervals of interest. An observation threshold poses a problem if it is described by a critical angle θ c , but not if it is described by other criteria proposed in the literature. Measurement imprecisions, predictably, blur the thermal history information contained in these distributions. Measurements of semi-confined tracks, added as a result of surface etching, are a more promising alternative to confined track length measurements for accessing the thermal history record in the fission track length distribution. On the other hand, measurements of the projected lengths of surface intersecting tracks offer the theoretical possibility of determining the true volumetric density N and true mean length m of an arbitrary population of fission tracks, thus allowing direct determination of the corrected age of samples with complex thermal histories. On a methodical level, knowledge of N and m allows to determine the efficiency with which fission tracks are counted under the optical microscope under exactly the same conditions as those under which fission track counts for routine dating purposes are performed

Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

International Nuclear Information System (INIS)

Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

2016-01-01

A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

Fiberoptic microneedles: novel optical diffusers for interstitial delivery of therapeutic light.

Science.gov (United States)

Kosoglu, Mehmet A; Hood, Robert L; Rossmeisl, John H; Grant, David C; Xu, Yong; Robertson, John L; Rylander, Marissa Nichole; Rylander, Christopher G

2011-11-01

Photothermal therapies have limited efficacy and application due to the poor penetration depth of light inside tissue. In earlier work, we described the development of novel fiberoptic microneedles to provide a means to mechanically penetrate dermal tissue and deliver light directly into a localized target area.This paper presents an alternate fiberoptic microneedle design with the capability of delivering more diffuse, but therapeutically useful photothermal energy. Laser lipolysis is envisioned as a future clinical application for this design. A novel fiberoptic microneedle was developed using hydrofluoric acid etching of optical fiber to permit diffuse optical delivery. Microneedles etched for 10, 30, and 50 minutes, and an optical fiber control were compared with three techniques. First, red light delivery from the microneedles was evaluated by imaging the reflectance of the light from a white paper.Second, spatial temperature distribution of the paper in response to near-IR light (1,064 nm, 1 W CW) was recorded using infrared thermography. Third, ex vivo adipose tissue response during 1,064 nm, (5 W CW)irradiation was recorded with bright field microscopy. Acid etching exposed a 3 mm length of the fiber core, allowing circumferential delivery of light along this length. Increasing etching time decreased microneedle diameter, resulting in increased uniformity of red and 1,064 nm light delivery along the microneedle axis. For equivalent total energy delivery, thinner microneedles reduced carbonization in the adipose tissue experiments. We developed novel microscale optical diffusers that provided a more homogeneous light distribution from their surfaces, and compared performance to a flat-cleaved fiber, a device currently utilized in clinical practice. These fiberoptic microneedles can potentially enhance clinical laser procedures by providing direct delivery of diffuse light to target chromophores, while minimizing undesirable photothermal damage in adjacent

Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

Energy Technology Data Exchange (ETDEWEB)

Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

1990-04-01

A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

Au nanowire junction breakup through surface atom diffusion

Science.gov (United States)

Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

2018-01-01

Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

Radon diffusion studies in some building materials using solid state nuclear track detectors

CERN Document Server

Singh, S; Singh, B; Singh, J

1999-01-01

LR-115 plastic track detector has been used to study radon diffusion through some building materials, viz. cement, soil, marble chips, sand and lime as well as air. Diffusion constant and diffusion length is calculated for all these materials.

Determination of molecular configuration by debye length modulation.

Science.gov (United States)

Vacic, Aleksandar; Criscione, Jason M; Rajan, Nitin K; Stern, Eric; Fahmy, Tarek M; Reed, Mark A

2011-09-07

Silicon nanowire field effect transistors (FETs) have emerged as ultrasensitive, label-free biodetectors that operate by sensing bound surface charge. However, the ionic strength of the environment (i.e., the Debye length of the solution) dictates the effective magnitude of the surface charge. Here, we show that control of the Debye length determines the spatial extent of sensed bound surface charge on the sensor. We apply this technique to different methods of antibody immobilization, demonstrating different effective distances of induced charge from the sensor surface.

Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

Directory of Open Access Journals (Sweden)

Kaewploy Somsak

2015-01-01

Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

Science.gov (United States)

Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

2005-09-01

We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

Effect of the hydrophilic block length on the surface-active and micellar thermodynamic properties of oxyethylene-oxybutylene diblock copolymers in aqueous solution

International Nuclear Information System (INIS)

Khan, A.; Usman, M.; Siddiq, M.; Fatima, G.; Harrison, W.

2009-01-01

The effect of hydrophilic block length on the surface and micellar thermodynamic properties of aqueous solution of E/sub 40/B/sub 8/, E/sub 80/B/sub 8/ and E/sub 120/B/sub 8/ diblock copolymers, were studied by surface tension measurements over a wide concentration and temperature range; where E stands for an oxyethylene unit and B for an oxybutylene unit. Like conventional surfactants, two breaks (change in the slope) were observed in the surface tension vs logarithm of concentration curve for all the three copolymers. Surface tension measurements were used to estimate surface excess concentrations (r m), area per molecule at air/water interface a and thermodynamic parameters for all adsorption of the pre-micellar region in the temperature range 20 to 50 degree C. Likewise the critical micelle concentration, CMC and thermodynamic parameters for micellization were also calculated for the post-micellar solutions at all temperatures. For comparison the thermodynamic parameters of adsorption and micellization are discussed in detail. The impact of varying E-block length and temperature on all calculated parameters are also discussed. This study shows the importance of hydrophobic-hydrophilic-balance (HHB) of copolymers on various surface and micellar properties. (author)

Plasma Surface interaction in Controlled fusion devices

International Nuclear Information System (INIS)

1990-05-01

The subjects presented in the 9th conference on plasma surface interaction in controlled fusion devices were: the modifications of power scrape-off-length and power deposition during various configurations in Tore Supra plasmas; the effects observed in ergodic divertor experiments in Tore-Supra; the diffuse connexion induced by the ergodic divertor and the topology of the heat load patterns on the plasma facing components in Tore-Supra; the study of the influence of air exposure on graphite implanted by low energy high density deuterium plasma

Non-Gaussian diffusion in static disordered media

Science.gov (United States)

Luo, Liang; Yi, Ming

2018-04-01

Non-Gaussian diffusion is commonly considered as a result of fluctuating diffusivity, which is correlated in time or in space or both. In this work, we investigate the non-Gaussian diffusion in static disordered media via a quenched trap model, where the diffusivity is spatially correlated. Several unique effects due to quenched disorder are reported. We analytically estimate the diffusion coefficient Ddis and its fluctuation over samples of finite size. We show a mechanism of population splitting in the non-Gaussian diffusion. It results in a sharp peak in the distribution of displacement P (x ,t ) around x =0 , that has frequently been observed in experiments. We examine the fidelity of the coarse-grained diffusion map, which is reconstructed from particle trajectories. Finally, we propose a procedure to estimate the correlation length in static disordered environments, where the information stored in the sample-to-sample fluctuation has been utilized.

Matrix Diffusion for Performance Assessment - Experimental Evidence, Modelling Assumptions and Open Issues

Energy Technology Data Exchange (ETDEWEB)

Jakob, A

2004-07-01

In this report a comprehensive overview on the matrix diffusion of solutes in fractured crystalline rocks is presented. Some examples from observations in crystalline bedrock are used to illustrate that matrix diffusion indeed acts on various length scales. Fickian diffusion is discussed in detail followed by some considerations on rock porosity. Due to the fact that the dual-porosity medium model is a very common and versatile method for describing solute transport in fractured porous media, the transport equations and the fundamental assumptions, approximations and simplifications are discussed in detail. There is a variety of geometrical aspects, processes and events which could influence matrix diffusion. The most important of these, such as, e.g., the effect of the flow-wetted fracture surface, channelling and the limited extent of the porous rock for matrix diffusion etc., are addressed. In a further section open issues and unresolved problems related to matrix diffusion are mentioned. Since matrix diffusion is one of the key retarding processes in geosphere transport of dissolved radionuclide species, matrix diffusion was consequently taken into account in past performance assessments of radioactive waste repositories in crystalline host rocks. Some issues regarding matrix diffusion are site-specific while others are independent of the specific situation of a planned repository for radioactive wastes. Eight different performance assessments from Finland, Sweden and Switzerland were considered with the aim of finding out how matrix diffusion was addressed, and whether a consistent picture emerges regarding the varying methodology of the different radioactive waste organisations. In the final section of the report some conclusions are drawn and an outlook is given. An extensive bibliography provides the reader with the key papers and reports related to matrix diffusion. (author)

HNO₃-assisted polyol synthesis of ultralarge single-crystalline Ag microplates and their far propagation length of surface plasmon polariton.

Science.gov (United States)

Chang, Cheng-Wei; Lin, Fan-Cheng; Chiu, Chun-Ya; Su, Chung-Yi; Huang, Jer-Shing; Perng, Tsong-Pyng; Yen, Ta-Jen

2014-07-23

We developed a HNO3-assisted polyol reduction method to synthesize ultralarge single-crystalline Ag microplates routinely. The edge length of the synthesized Ag microplates reaches 50 μm, and their top facets are (111). The mechanism for dramatically enlarging single-crystalline Ag structure stems from a series of competitive anisotropic growths, primarily governed by carefully tuning the adsorption of Ag(0) by ethylene glycol and the desorption of Ag(0) by a cyanide ion on Ag(100). Finally, we measured the propagation length of surface plasmon polaritons along the air/Ag interface under 534 nm laser excitation. Our single-crystalline Ag microplate exhibited a propagation length (11.22 μm) considerably greater than that of the conventional E-gun deposited Ag thin film (5.27 μm).

The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

2016-04-15

We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

Enhanced separation of diffusing particles by chaotic advection

International Nuclear Information System (INIS)

Aref, H.; Jones, S.W.

1989-01-01

Combining the reversibility of advection by a Stokes flow with the irreversibility of diffusion leads to a separation strategy for diffusing substances. This basic idea goes back to Taylor and Heller. It is shown here that the sensitivity of the method can be greatly enhanced by making the advection chaotic. The separation is particularly efficient when the thinnest structures resulting from advection are made comparable in size to a diffusion length. Simple heuristic estimates based on an understanding of chaotic motion and diffusion lead to a certain scaling that is seen in numerical experiments on this separation method

AC surface photovoltage of indium phosphide nanowire networks

Energy Technology Data Exchange (ETDEWEB)

Lohn, Andrew J.; Kobayashi, Nobuhiko P. [California Univ., Santa Cruz, CA (United States). Baskin School of Engineering; California Univ., Santa Cruz, CA (US). Nanostructured Energy Conversion Technology and Research (NECTAR); NASA Ames Research Center, Moffett Field, CA (United States). Advanced Studies Laboratories

2012-06-15

Surface photovoltage is used to study the dynamics of photogenerated carriers which are transported through a highly interconnected three-dimensional network of indium phosphide nanowires. Through the nanowire network charge transport is possible over distances far in excess of the nanowire lengths. Surface photovoltage was measured within a region 10.5-14.5 mm from the focus of the illumination, which was chopped at a range of frequencies from 15 Hz to 30 kHz. Carrier dynamics were modeled by approximating the nanowire network as a thin film, then fitted to experiment suggesting diffusion of electrons and holes at approximately 75% of the bulk value in InP but with significantly reduced built-in fields, presumably due to screening by nanowire surfaces. (orig.)

Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

Directory of Open Access Journals (Sweden)

Louena Shtrepi

2017-02-01

Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

Science.gov (United States)

Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

2017-11-01

Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

Modeling of liquid–gas meniscus for textured surfaces: effects of curvature and local slip length

International Nuclear Information System (INIS)

Gaddam, Anvesh; Garg, Mayank; Agrawal, Amit; Joshi, Suhas S

2015-01-01

Surface texturing at the micro/nanolevel allows air to be trapped in sufficiently small cavities, thereby reducing the flow resistance over the surface in the laminar regime. The nature of the liquid–gas meniscus plays an important role in defining the boundary condition and it depends on the flow conditions and geometrical properties of textures. In the present work, we employ the unsteady volume of fluid model to investigate the behavior of the liquid–gas meniscus for ridges arranged normal to the flow direction to substantiate the frictional resistance of flow in a microchannel. It is found that the assumption of ‘zero shear stress’ at the liquid–gas interface grossly overpredicts the effective slip length with meniscus curvature and local partial slip length playing the dominant role. Numerical simulations performed in the laminar regime (20  <  Re  <  120) over single layered ridges normal to the flow direction revealed the effect of texture geometry on the reduction in pressure drop. In single layered structures, lotus-like geometries exhibited a greater reduction in drag (more than 30%) when compared to all other texture geometries. It is recognized that the flow experiences expansion and contraction cycles as it flows over the transverse ridges increasing the frictional resistance. Our findings will help to modify the boundary condition at the liquid–gas meniscus for accurate modeling in the laminar regime and to optimize the texture geometry to improve drag reduction. (paper)

Sonographic Measurement of Normal Splenic Length in Korean Adults

Energy Technology Data Exchange (ETDEWEB)

Shin, Sang Bum; Cheon, Byung Kook; Kim, Jong Min; Oh, Kyung Seoung; Jung, Gyoo Sik; Huh, Jin Do; Joh, Young Duk [Kosin University College of Medicine, Busan (Korea, Republic of)

1996-12-15

To establish upper limit of normal splenic length of Korean adults on ultrasonography and to determice the degree of interobserver and intraobserver variation. Ultrasonographic scans were performed to measure the maximum length of spleen in 105 of 150 adults selected by convenience sampling. Remained 45 cases with any conditions that could alter splenic size were excluded from this study. The maximum length of spleen was measured and correlated with body surface area, patient height, weight, age and sex. In 31 of the 105 adults we evaluated the interobserver and intraobserver variations in sonographic measurements of splenic length obtained by three radiologists in blind fashion. The mean splenic length in 105 adults was 8.56cm ({+-} 0.95). The splenic length positively correlated with body surface area, patient height and weight (P <0.001), and negatively correlated with patient age (P < 0.01). Male spleen (8.87 cm {+-} 1.07) was longer than female spleen (8.35 cm {+-} 0.81) (P < 0.05). The following guidelines are proposed for the upper limit of normal splenic length at different groups of body surface area: no longer than 10 cm at 1.20{approx}1.59 m{sup 2}, 11 cm at1.60{approx}1.79 m{sup 2}, and 12 cm at 1.80{approx}1.99 m{sup 2}. The mean interobserver variation between any two radiologists ranged from 0.32 cm ({+-} 0.29) to 0.39 cm ({+-} 0.33) and interobserver variations were within 1 cm in 96%. The mean intraobserver variations were within 0.5 cm in 91%. The splenic length closely correlated with body surface area, patient height, weight and age. Particularly the upper limit of normal splenic length changed according to body surface area. Interobserver variation about 1 cm and intraobserver variation about 0.5 cm should be considered in the measurement of the splenic length on ultrasonography

Multiscale diffusion of a molecular probe in a crowded environment: a concept

Science.gov (United States)

Currie, Megan; Thao, Chang; Timerman, Randi; Welty, Robb; Berry, Brenden; Sheets, Erin D.; Heikal, Ahmed A.

2015-08-01

Living cells are crowded with macromolecules and organelles. Yet, it is not fully understood how macromolecular crowding affects the myriad of biochemical reactions, transport and the structural stability of biomolecules that are essential to cellular function and survival. These molecular processes, with or without electrostatic interactions, in living cells are therefore expected to be distinct from those carried out in test tube in dilute solutions where excluded volumes are absent. Thus there is an urgent need to understand the macromolecular crowding effects on cellular and molecular biophysics towards quantitative cell biology. In this report, we investigated how biomimetic crowding affects both the rotational and translation diffusion of a small probe (rhodamine green, RhG). For biomimetic crowding agents, we used Ficoll-70 (synthetic polymer), bovine serum albumin and ovalbumin (proteins) at various concentrations in a buffer at room temperature. As a control, we carried out similar measurements on glycerolenriched buffer as an environment with homogeneous viscosity as a function of glycerol concentration. The corresponding bulk viscosity was measured independently to test the validity of the Stokes-Einstein model of a diffusing species undergoing a random walk. For rotational diffusion (ps-ns time scale), we used time-resolved anisotropy measurements to examine potential binding of RhG as a function of the crowding agents (surface structure and size). For translational diffusion (μs-s time scale), we used fluorescence correlation spectroscopy for single-molecule fluctuation analysis. Our results allow us to examine the diffusion model of a molecular probe in crowded environments as a function of concentration, length scale, homogeneous versus heterogeneous viscosity, size and surface structures. These biomimetic crowding studies, using non-invasive fluorescence spectroscopy methods, represent an important step towards understanding cellular biophysics and

Symmetries and modelling functions for diffusion processes

International Nuclear Information System (INIS)

Nikitin, A G; Spichak, S V; Vedula, Yu S; Naumovets, A G

2009-01-01

A constructive approach to the theory of diffusion processes is proposed, which is based on application of both symmetry analysis and the method of modelling functions. An algorithm for construction of the modelling functions is suggested. This algorithm is based on the error function expansion (ERFEX) of experimental concentration profiles. The high-accuracy analytical description of the profiles provided by ERFEX approximation allows a convenient extraction of the concentration dependence of diffusivity from experimental data and prediction of the diffusion process. Our analysis is exemplified by its employment in experimental results obtained for surface diffusion of lithium on the molybdenum (1 1 2) surface precovered with dysprosium. The ERFEX approximation can be directly extended to many other diffusion systems.

Measuring methods of matrix diffusion

International Nuclear Information System (INIS)

Muurinen, A.; Valkiainen, M.

1988-03-01

In Finland the spent nuclear fuel is planned to be disposed of at large depths in crystalline bedrock. The radionuclides which are dissolved in the groundwater may be able to diffuse into the micropores of the porous rock matrix and thus be withdrawn from the flowing water in the fractures. This phenomenon is called matrix diffusion. A review over matrix diffusion is presented in the study. The main interest is directed to the diffusion of non-sorbing species. The review covers diffusion experiments and measurements of porosity, pore size, specific surface area and water permeability

Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

OpenAIRE

Bläckberg, Lisa

2011-01-01

This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

A tracer diffusion model derived from microstructure

International Nuclear Information System (INIS)

Lehikoinen, Jarmo; Muurinen, Arto; Olin, Markus

2012-01-01

Document available in extended abstract form only. Full text of publication follows: Numerous attempts have been made to explain the tracer diffusion of various solutes in compacted clays. These attempts have commonly suffered from an inability to describe the diffusion of uncharged and charged solutes with a single unified model. Here, an internally consistent approach to describing the diffusion of solutes in a heterogeneous porous medium, such as compacted bentonite, in terms of its microstructure is presented. The microstructure is taken to be represented by a succession of unit cells, which consist of two consecutive regions (Do, 1996). In the first region, the diffusion is viewed to occur in two parallel paths: one through microcrystalline units (micropores) and the other through meso-pores between the microcrystalline units. Solutes exiting these two paths are then joined together to continue diffusing through the second, disordered, region, connecting the two adjacent microcrystalline units. Adsorption (incl. co-ion exclusion) is thought to occur in the micropores, whereas meso-pores and the disordered region accommodate free species alone. Co-ions are also assumed to experience transfer resistance into and out of the micropores, which is characterized in the model by a transmission coefficient. Although the model is not new per se, its application to compacted clays has never been attempted before. It is shown that in the limit of strong adsorption, the effective diffusivity is limited from above only by the microstructural parameters of the model porous medium. As intuitive and logical as this result may appear, it has not been proven before. In the limit of vanishing disordered region, the effective diffusivity is no longer explicitly constrained by any of the model parameters. The tortuosity of the diffusion path, i.e. the quotient of the actual diffusion path length in the porous-medium coordinates and the characteristic length of the laboratory frame

Atmospheric turbulence and diffusion research

International Nuclear Information System (INIS)

Hosker, R.P. Jr.

1993-01-01

The Atmospheric Turbulence and Diffusion Division (well known in the atmospheric dispersion community as the Atmospheric Turbulence and Diffusion Laboratory, ATDL) is one of several field facilities of NOAAs Air Resources Laboratory, headquartered in Silver Spring, Maryland. The laboratory conducts research on matters of atmospheric diffusion and turbulent exchange, concerning air quality. ATDD focuses attention on the physics of the lower atmosphere, with special emphasis on the processes contributing to atmospheric transport, dispersion, deposition, and air-surface exchange, and on the development of predictive capabilities using the results of this research. Research is directed toward issues of national and global importance related to the missions of DOE, to DOE's Oak Ridge Field Office, and to NOAA. The program is divided into four major projects: plume transport and diffusion in the planetary boundary layer, complex topography, canopy micrometeorology, and air-surface exchange