WorldWideScience

Sample records for surface diffusion kinetics

  1. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  2. Diffusion Influenced Adsorption Kinetics.

    Science.gov (United States)

    Miura, Toshiaki; Seki, Kazuhiko

    2015-08-27

    When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

  3. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  5. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  6. Off-lattice self-learning kinetic Monte Carlo: application to 2D cluster diffusion on the fcc(111) surface

    International Nuclear Information System (INIS)

    Kara, Abdelkader; Yildirim, Handan; Rahman, Talat S; Trushin, Oleg

    2009-01-01

    We report developments of the kinetic Monte Carlo (KMC) method with improved accuracy and increased versatility for the description of atomic diffusivity on metal surfaces. The on-lattice constraint built into our recently proposed self-learning KMC (SLKMC) (Trushin et al 2005 Phys. Rev. B 72 115401) is released, leaving atoms free to occupy 'off-lattice' positions to accommodate several processes responsible for small-cluster diffusion, periphery atom motion and heteroepitaxial growth. This technique combines the ideas embedded in the SLKMC method with a new pattern-recognition scheme fitted to an off-lattice model in which relative atomic positions are used to characterize and store configurations. Application of a combination of the 'drag' and the repulsive bias potential (RBP) methods for saddle point searches allows the treatment of concerted cluster, and multiple- and single-atom, motions on an equal footing. This tandem approach has helped reveal several new atomic mechanisms which contribute to cluster migration. We present applications of this off-lattice SLKMC to the diffusion of 2D islands of Cu (containing 2-30 atoms) on Cu and Ag(111), using the interatomic potential from the embedded-atom method. For the hetero-system Cu/Ag(111), this technique has uncovered mechanisms involving concerted motions such as shear, breathing and commensurate-incommensurate occupancies. Although the technique introduces complexities in storage and retrieval, it does not introduce noticeable extra computational cost.

  7. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  8. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  9. Conformational Diffusion and Helix Formation Kinetics

    International Nuclear Information System (INIS)

    Hummer, Gerhard; Garcia, Angel E.; Garde, Shekhar

    2000-01-01

    The time, temperature, and sequence dependences of helix formation kinetics of fully atomistic peptide models in explicit solvent are described quantitatively by a diffusive search within the coil state with barrierless transitions into the helical state. Conformational diffusion leads to nonexponential kinetics and jump-width dependences in temperature jump experiments. (c) 2000 The American Physical Society

  10. Conformational Diffusion and Helix Formation Kinetics

    Energy Technology Data Exchange (ETDEWEB)

    Hummer, Gerhard [Laboratory of Chemical Physics, Building 5, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892-0520 (United States); Garcia, Angel E. [Theoretical Biology and Biophysics Group T-10, MS K710, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Garde, Shekhar [Department of Chemical Engineering, Rensselaer Polytechnic Institute, 110 8th Street, Troy, New York 12180 (United States)

    2000-09-18

    The time, temperature, and sequence dependences of helix formation kinetics of fully atomistic peptide models in explicit solvent are described quantitatively by a diffusive search within the coil state with barrierless transitions into the helical state. Conformational diffusion leads to nonexponential kinetics and jump-width dependences in temperature jump experiments. (c) 2000 The American Physical Society.

  11. Internal Diffusion-Controlled Enzyme Reaction: The Acetylcholinesterase Kinetics.

    Science.gov (United States)

    Lee, Sangyun; Kim, Ji-Hyun; Lee, Sangyoub

    2012-02-14

    Acetylcholinesterase is an enzyme with a very high turnover rate; it quenches the neurotransmitter, acetylcholine, at the synapse. We have investigated the kinetics of the enzyme reaction by calculating the diffusion rate of the substrate molecule along an active site channel inside the enzyme from atomic-level molecular dynamics simulations. In contrast to the previous works, we have found that the internal substrate diffusion is the determinant of the acetylcholinesterase kinetics in the low substrate concentration limit. Our estimate of the overall bimolecular reaction rate constant for the enzyme is in good agreement with the experimental data. In addition, the present calculation provides a reasonable explanation for the effects of the ionic strength of solution and the mutation of surface residues of the enzyme. The study suggests that internal diffusion of the substrate could be a key factor in understanding the kinetics of enzymes of similar characteristics.

  12. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  13. Mechanism and kinetics of hydrated electron diffusion

    International Nuclear Information System (INIS)

    Tay, Kafui A.; Coudert, Francois-Xavier; Boutin, Anne

    2008-01-01

    Molecular dynamics simulations are used to study the mechanism and kinetics of hydrated electron diffusion. The electron center of mass is found to exhibit Brownian-type behavior with a diffusion coefficient considerably greater than that of the solvent. As previously postulated by both experimental and theoretical works, the instantaneous response of the electron to the librational motions of surrounding water molecules constitutes the principal mode of motion. The diffusive mechanism can be understood within the traditional framework of transfer diffusion processes, where the diffusive step is akin to the exchange of an extramolecular electron between neighboring water molecules. This is a second-order process with a computed rate constant of 5.0 ps -1 at 298 K. In agreement with experiment the electron diffusion exhibits Arrhenius behavior over the temperature range of 298-400 K. We compute an activation energy of 8.9 kJ mol -1 . Through analysis of Arrhenius plots and the application of a simple random walk model it is demonstrated that the computed rate constant for exchange of an excess electron is indeed the phenomenological rate constant associated with the diffusive process

  14. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  15. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  16. Disordering kinetics in surface overlayers

    International Nuclear Information System (INIS)

    Jesina, A.; Tringides, M.C.

    1993-01-01

    The disordering kinetics of the O/W(110)-p(2x1)+p(2x2) overlayer, prepared initially in a well-ordered state, are studied with low-energy electron diffraction profile analysis. The decay of the peak intensity, used as a measure of the growing disorder, cannot be fitted to a power law as in the case of ordering processes. The full width at half maximum of the time-dependent structure factor S(q,t) is constant with time, which suggests that the average size remains constant. Diffusion activation energy extracted for the temperature dependence of the disordering is 1.0±0.05 eV, which is different from the value of 0.6 eV measured in ordering processes. The difference can be explained by the adsorbate-adsorbate interactions, which contribute differently to the diffusion barrier, in the two experiments

  17. Oxygen tracer diffusion and surface exchange kinetics in Ba0.5Sr0.5Co0.8Fe0.2O3-δ

    NARCIS (Netherlands)

    Berenov, A.; Atkinson, A.; Kilner, J.; Ananyev, M.; Eremin, V.; Porotnikova, N.; Farlenkov, A.; Kurumchin, E.; Bouwmeester, Henricus J.M.; Bucher, E.; Sitte, W.

    2014-01-01

    The oxygen tracer diffusion coefficient, Db⁎, and the oxygen tracer surface exchange coefficient, k, were measured in Ba0.5Sr0.5Co0.8Fe0.2O3 − δ (BSCF5582) over the temperature range of 310–800 °C and the oxygen partial pressure range of 1.3 × 10−3–0.21 bar. Several measurement techniques were used:

  18. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  19. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  20. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  1. Determination of oxygen diffusion kinetics during thin film ruthenium oxidation

    NARCIS (Netherlands)

    Coloma Ribera, R.; van de Kruijs, Robbert Wilhelmus Elisabeth; Yakshin, Andrey; Bijkerk, Frederik

    2015-01-01

    In situ X-ray reflectivity was used to reveal oxygen diffusion kinetics for thermal oxidation of polycrystalline ruthenium thin films and accurate determination of activation energies for this process. Diffusion rates in nanometer thin RuO2 films were found to show Arrhenius behaviour. However, a

  2. Surface- vs Diffusion-Limited Mechanisms of Anion Exchange in CsPbBr3 Nanocrystal Cubes Revealed through Kinetic Studies.

    Science.gov (United States)

    Koscher, Brent A; Bronstein, Noah D; Olshansky, Jacob H; Bekenstein, Yehonadav; Alivisatos, A Paul

    2016-09-21

    Ion-exchange transformations allow access to nanocrystalline materials with compositions that are inaccessible via direct synthetic routes. However, additional mechanistic insight into the processes that govern these reactions is needed. We present evidence for the presence of two distinct mechanisms of exchange during anion exchange in CsPbX3 nanocrystals (NCs), ranging in size from 6.5 to 11.5 nm, for transformations from CsPbBr3 to CsPbCl3 or CsPbI3. These NCs exhibit bright luminescence throughout the exchange, allowing their optical properties to be observed in real time, in situ. The iodine exchange presents surface-reaction-limited exchanges allowing all anionic sites within the NC to appear chemically identical, whereas the chlorine exchange presents diffusion-limited exchanges proceeding through a more complicated exchange mechanism. Our results represent the first steps toward developing a microkinetic description of the anion exchange, with implications not only for understanding the lead halide perovskites but also for nanoscale ion exchange in general.

  3. Fractional Diffusion Limit for Collisional Kinetic Equations

    KAUST Repository

    Mellet, Antoine

    2010-08-20

    This paper is devoted to diffusion limits of linear Boltzmann equations. When the equilibrium distribution function is a Maxwellian distribution, it is well known that for an appropriate time scale, the small mean free path limit gives rise to a diffusion equation. In this paper, we consider situations in which the equilibrium distribution function is a heavy-tailed distribution with infinite variance. We then show that for an appropriate time scale, the small mean free path limit gives rise to a fractional diffusion equation. © 2010 Springer-Verlag.

  4. Fractional Diffusion Limit for Collisional Kinetic Equations

    KAUST Repository

    Mellet, Antoine; Mischler, Sté phane; Mouhot, Clé ment

    2010-01-01

    This paper is devoted to diffusion limits of linear Boltzmann equations. When the equilibrium distribution function is a Maxwellian distribution, it is well known that for an appropriate time scale, the small mean free path limit gives rise to a

  5. Determination of oxygen diffusion kinetics during thin film ruthenium oxidation

    Energy Technology Data Exchange (ETDEWEB)

    Coloma Ribera, R., E-mail: r.colomaribera@utwente.nl; Kruijs, R. W. E. van de; Yakshin, A. E.; Bijkerk, F. [MESA+ Institute for Nanotechnology, University of Twente, P.O. Box 217, 7500 AE Enschede (Netherlands)

    2015-08-07

    In situ X-ray reflectivity was used to reveal oxygen diffusion kinetics for thermal oxidation of polycrystalline ruthenium thin films and accurate determination of activation energies for this process. Diffusion rates in nanometer thin RuO{sub 2} films were found to show Arrhenius behaviour. However, a gradual decrease in diffusion rates was observed with oxide growth, with the activation energy increasing from about 2.1 to 2.4 eV. Further exploration of the Arrhenius pre-exponential factor for diffusion process revealed that oxidation of polycrystalline ruthenium joins the class of materials that obey the Meyer-Neldel rule.

  6. Kinetic and diffusion evaporation of substances on sublimation in vacuum

    International Nuclear Information System (INIS)

    Martinson, I.G.

    2006-01-01

    Diffusion-kinetic model of sublimation of substances in vacuum determining fields of the evaporation according to temperature - kinetic and diffusion is performed. The model is experimentally confirmed in the tests with benzoic acid and naphthalene, by calculation of the rate of Zn, Co, V, W sublimation and the value of coefficient of evaporation α. The model provides an explanation for derivation of low values of evaporation coefficient α, to 10 -10 , for easy to fusible substances, and α=1 for substances with high temperature of fusion [ru

  7. Carbon diffusion and kinetics during the lath martensite formation

    International Nuclear Information System (INIS)

    Xu Zuyao

    1995-01-01

    Calculations verify that carbon diffusion may occur during the lath martensite formation. Accordingly, the diffusion of interstitial atoms or ions must be taken into account when martensitic transformation is defined as a diffusionless transformation. In derivation of the kinetics equation of the athermal martensitic transformation, regarding the carbon diffusion, i.e. the enrichment of the austenite during the lath martensite formation, and ΔG γ fehler being function of the temperature and the carbon content in austenite, the kinetics equation is modified to a general form as: f=1-exp[β(C1-C0)-α(Ms-Tq)] where C0 and C1 are carbon contents in the austenite before and after quenching respectively. Consequently, the alloying element not only influences Ms, but also the diffusibility of carbon and both factors govern the amount of retained austenite in quenched steel which dominates in determing the toughness of the steel. (orig.)

  8. Studies on the kinetics and intraparticle diffusivities of BOD, colour ...

    African Journals Online (AJOL)

    EJIRO

    The kinetics and intraparticle diffusivities of BOD, TSS and colour reduction from palm oil mill effluent (POME) using ... discharged (Asia et al., 2006). The oil palm ... biological treatment methods, anaerobic digestion is often the most ... and lower capital cost. ... was then rinsed with distilled water and air dried, ready for the.

  9. Facilitated diffusion in a crowded environment: from kinetics to stochastics

    International Nuclear Information System (INIS)

    Meroz, Yasmine; Klafter, Joseph; Eliazar, Iddo

    2009-01-01

    Facilitated diffusion is a fundamental search process used to describe the problem of a searcher protein finding a specific target site over a very large DNA strand. In recent years macromolecular crowding has been recognized to affect this search process. In this paper, we bridge between two different modelling methodologies of facilitated diffusion: the physics-oriented kinetic approach, which yields the reaction rate of the search process, and the probability-oriented stochastic approach, which yields the probability distribution of the search duration. We translate the former approach to the latter, ascertaining that the two approaches yield coinciding results, both with and without macromolecular crowding. We further show that the stochastic approach markedly generalizes the kinetic approach by accommodating a vast array of search mechanisms, including mechanisms having no reaction rates, and thus being beyond the realm of the kinetic approach.

  10. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  11. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  12. Bulk diffusion in a kinetically constrained lattice gas

    Science.gov (United States)

    Arita, Chikashi; Krapivsky, P. L.; Mallick, Kirone

    2018-03-01

    In the hydrodynamic regime, the evolution of a stochastic lattice gas with symmetric hopping rules is described by a diffusion equation with density-dependent diffusion coefficient encapsulating all microscopic details of the dynamics. This diffusion coefficient is, in principle, determined by a Green-Kubo formula. In practice, even when the equilibrium properties of a lattice gas are analytically known, the diffusion coefficient cannot be computed except when a lattice gas additionally satisfies the gradient condition. We develop a procedure to systematically obtain analytical approximations for the diffusion coefficient for non-gradient lattice gases with known equilibrium. The method relies on a variational formula found by Varadhan and Spohn which is a version of the Green-Kubo formula particularly suitable for diffusive lattice gases. Restricting the variational formula to finite-dimensional sub-spaces allows one to perform the minimization and gives upper bounds for the diffusion coefficient. We apply this approach to a kinetically constrained non-gradient lattice gas in two dimensions, viz. to the Kob-Andersen model on the square lattice.

  13. Kinetics of diffusion-controlled and ballistically-controlled reactions

    International Nuclear Information System (INIS)

    Redner, S.

    1995-01-01

    The kinetics of diffusion-controlled two-species annihilation, A+B → O and single-species ballistically-controlled annihilation, A+A → O are investigated. For two-species annihilation, we describe the basic mechanism that leads to the formation of a coarsening mosaic of A- and B-domains. The implications of this picture on the distribution of reactants is discussed. For ballistic annihilation, dimensional analysis shows that the concentration and rms velocity decay as c∼t -α and v∼t -β , respectively, with α+β = 1 in any spatial dimension. Analysis of the Boltzmann equation for the evolution of the velocity distribution yields accurate predictions for the kinetics. New phenomena associated with discrete initial velocity distributions and with mixed ballistic and diffusive reactant motion are also discussed. (author)

  14. Sorption kinetics of polycyclic aromatic hydrocarbons removal using granular activated carbon: Intraparticle diffusion coefficients

    International Nuclear Information System (INIS)

    Valderrama, C.; Gamisans, X.; Heras, X. de las; Farran, A.; Cortina, J.L.

    2008-01-01

    Granular activated carbon (GAC) was evaluated as a suitable sorbent for polycyclic aromatic hydrocarbons (PAHs) removal from aqueous solutions. For this purpose, kinetic measurements on the extraction of a family of six PAHs were taken. A morphology study was performed by means of a scanning electron microscopy (SEM) analysis of GAC samples. Analyses of the batch rate data for each PAH were carried out using two kinetic models: the homogenous particle diffusion model (HPDM) and the shell progressive model (SPM). The process was controlled by diffusion rate the solutes (PAHs) that penetrated the reacted layer at PAH concentrations in the range of 0.2-10 mg L -1 . The effective particle diffusion coefficients (D eff ) derived from the two models were determined from the batch rate data. The Weber and Morris intraparticle diffusion model made a double contribution to the surface and pore diffusivities in the sorption process. The D eff values derived from both the HPMD and SPM equations varied from 1.1 x 10 -13 to 6.0 x 10 -14 m 2 s -1 . The simplest model, the pore diffusion model, was applied first for data analysis. The model of the next level of complexity, the surface diffusion model, was applied in order to gain a deeper understanding of the diffusion process. This model is able to explain the data, and the apparent surface diffusivities are in the same order of magnitude as the values for the sorption of functionalized aromatic hydrocarbons (phenols and sulphonates) that are described in the literature

  15. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  16. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  17. Collective and tracer diffusion kinetics in the ternary random alloy

    International Nuclear Information System (INIS)

    Belova, I.V.; Murch, G.E.; Allnatt, A.R.

    2002-01-01

    In this study, collective and tracer diffusion kinetics is addressed for the ternary random alloy. A formal solution from the self-consistent theory of Moleko et al (Moleko L K, Allnatt A R and Allnatt E L 1989 Phil. Mag. A 59 141) is derived for collective diffusion and compared with the corresponding solution for the binary random alloy. Tracer diffusion in the ternary alloy is treated from the perspective of a special case of the quaternary random alloy. Results from Monte Carlo calculations for tracer and collective correlation factors (for the bcc ternary random alloy) are found to be in excellent agreement with this self-consistent theory but in only semi-quantitative agreement with the earlier theory of Manning (Manning J R 1971 Phys. Rev. B 4 1111). (author)

  18. Mesoscopic dynamics of diffusion-influenced enzyme kinetics.

    Science.gov (United States)

    Chen, Jiang-Xing; Kapral, Raymond

    2011-01-28

    A particle-based mesoscopic model for enzyme kinetics is constructed and used to investigate the influence of diffusion on the reactive dynamics. Enzymes and enzyme-substrate complexes are modeled as finite-size soft spherical particles, while substrate, product, and solvent molecules are point particles. The system is evolved using a hybrid molecular dynamics-multiparticle collision dynamics scheme. Both the nonreactive and reactive dynamics are constructed to satisfy mass, momentum, and energy conservation laws, and reversible reaction steps satisfy detailed balance. Hydrodynamic interactions among the enzymes and complexes are automatically accounted for in the dynamics. Diffusion manifests itself in various ways, notably in power-law behavior in the evolution of the species concentrations. In accord with earlier investigations, regimes where the product production rate exhibits either monotonic or nonmonotonic behavior as a function of time are found. In addition, the species concentrations display both t(-1/2) and t(-3/2) power-law behavior, depending on the dynamical regime under investigation. For high enzyme volume fractions, cooperative effects influence the enzyme kinetics. The time dependent rate coefficient determined from the mass action rate law is computed and shown to depend on the enzyme concentration. Lifetime distributions of substrate molecules newly released in complex dissociation events are determined and shown to have either a power-law form for rebinding to the same enzyme from which they were released or an exponential form for rebinding to different enzymes. The model can be used and extended to explore a variety of issues related concentration effects and diffusion on enzyme kinetics.

  19. Mesoscopic dynamics of diffusion-influenced enzyme kinetics

    Science.gov (United States)

    Chen, Jiang-Xing; Kapral, Raymond

    2011-01-01

    A particle-based mesoscopic model for enzyme kinetics is constructed and used to investigate the influence of diffusion on the reactive dynamics. Enzymes and enzyme-substrate complexes are modeled as finite-size soft spherical particles, while substrate, product, and solvent molecules are point particles. The system is evolved using a hybrid molecular dynamics-multiparticle collision dynamics scheme. Both the nonreactive and reactive dynamics are constructed to satisfy mass, momentum, and energy conservation laws, and reversible reaction steps satisfy detailed balance. Hydrodynamic interactions among the enzymes and complexes are automatically accounted for in the dynamics. Diffusion manifests itself in various ways, notably in power-law behavior in the evolution of the species concentrations. In accord with earlier investigations, regimes where the product production rate exhibits either monotonic or nonmonotonic behavior as a function of time are found. In addition, the species concentrations display both t^{-1/2} and t^{-3/2} power-law behavior, depending on the dynamical regime under investigation. For high enzyme volume fractions, cooperative effects influence the enzyme kinetics. The time dependent rate coefficient determined from the mass action rate law is computed and shown to depend on the enzyme concentration. Lifetime distributions of substrate molecules newly released in complex dissociation events are determined and shown to have either a power-law form for rebinding to the same enzyme from which they were released or an exponential form for rebinding to different enzymes. The model can be used and extended to explore a variety of issues related concentration effects and diffusion on enzyme kinetics.

  20. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  1. Neutralization kinetics of charged polymer surface

    Energy Technology Data Exchange (ETDEWEB)

    Mukherjee, S. [Surface Physics Division, Saha Institute of Nuclear Physics, 1/AF, Bidhannagar, Kolkata 700064 (India); Mukherjee, M. [Surface Physics Division, Saha Institute of Nuclear Physics, 1/AF, Bidhannagar, Kolkata 700064 (India)], E-mail: manabendra.mukherjee@saha.ac.in

    2008-04-15

    In case of photoemission spectroscopy of an insulating material the data obtained from the charged surface are normally distorted due to differential charging. Recently, we have developed a controlled surface neutralization technique to study the kinetics of the surface charging. Using this technique and the associated data analysis scheme with an effective charging model, quantitative information from the apparently distorted photoemission data from PTFE surfaces were extracted. The surface charging was controlled by tuning the electron flood current as well as the X-ray intensity. The effective model was found to describe the charging consistently for both the cases. It was shown that the non-linear neutralization response of differential charging around a critical neutralizing electron flux or a critical X-ray emission current was due to percolation of equipotential surface domains. The obtained value of the critical percolation exponent {gamma} close to unity indicates a percolation similar to that of avalanche breakdown or chain reaction.

  2. Evaporation kinetics of sessile water droplets on micropillared superhydrophobic surfaces.

    Science.gov (United States)

    Xu, Wei; Leeladhar, Rajesh; Kang, Yong Tae; Choi, Chang-Hwan

    2013-05-21

    Evaporation modes and kinetics of sessile droplets of water on micropillared superhydrophobic surfaces are experimentally investigated. The results show that a constant contact radius (CCR) mode and a constant contact angle (CCA) mode are two dominating evaporation modes during droplet evaporation on the superhydrophobic surfaces. With the decrease in the solid fraction of the superhydrophobic surfaces, the duration of a CCR mode is reduced and that of a CCA mode is increased. Compared to Rowan's kinetic model, which is based on the vapor diffusion across the droplet boundary, the change in a contact angle in a CCR (pinned) mode shows a remarkable deviation, decreasing at a slower rate on the superhydrophobic surfaces with less-solid fractions. In a CCA (receding) mode, the change in a contact radius agrees well with the theoretical expectation, and the receding speed is slower on the superhydrophobic surfaces with lower solid fractions. The discrepancy between experimental results and Rowan's model is attributed to the initial large contact angle of a droplet on superhydrophobic surfaces. The droplet geometry with a large contact angle results in a narrow wedge region of air along the contact boundary, where the liquid-vapor diffusion is significantly restricted. Such an effect becomes minor as the evaporation proceeds with the decrease in a contact angle. In both the CCR and CCA modes, the evaporative mass transfer shows the linear relationship between mass(2/3) and evaporation time. However, the evaporation rate is slower on the superhydrophobic surfaces, which is more significant on the surfaces with lower solid fractions. As a result, the superhydrophobic surfaces slow down the drying process of a sessile droplet on them.

  3. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  4. Diffusion-controlled interface kinetics-inclusive system-theoretic propagation models for molecular communication systems

    Science.gov (United States)

    Chude-Okonkwo, Uche A. K.; Malekian, Reza; Maharaj, B. T.

    2015-12-01

    Inspired by biological systems, molecular communication has been proposed as a new communication paradigm that uses biochemical signals to transfer information from one nano device to another over a short distance. The biochemical nature of the information transfer process implies that for molecular communication purposes, the development of molecular channel models should take into consideration diffusion phenomenon as well as the physical/biochemical kinetic possibilities of the process. The physical and biochemical kinetics arise at the interfaces between the diffusion channel and the transmitter/receiver units. These interfaces are herein termed molecular antennas. In this paper, we present the deterministic propagation model of the molecular communication between an immobilized nanotransmitter and nanoreceiver, where the emission and reception kinetics are taken into consideration. Specifically, we derived closed-form system-theoretic models and expressions for configurations that represent different communication systems based on the type of molecular antennas used. The antennas considered are the nanopores at the transmitter and the surface receptor proteins/enzymes at the receiver. The developed models are simulated to show the influence of parameters such as the receiver radius, surface receptor protein/enzyme concentration, and various reaction rate constants. Results show that the effective receiver surface area and the rate constants are important to the system's output performance. Assuming high rate of catalysis, the analysis of the frequency behavior of the developed propagation channels in the form of transfer functions shows significant difference introduce by the inclusion of the molecular antennas into the diffusion-only model. It is also shown that for t > > 0 and with the information molecules' concentration greater than the Michaelis-Menten kinetic constant of the systems, the inclusion of surface receptors proteins and enzymes in the models

  5. MASS TRANSFER KINETICS AND EFFECTIVE DIFFUSIVITIES DURING COCOA ROASTING

    Directory of Open Access Journals (Sweden)

    Y. M. BAGHDADI

    2017-01-01

    Full Text Available The current studies investigated the effects of temperature and moisture addition on the mass transfer kinetics of cocoa nibs during roasting. Experiments were carried out by roasting 500 gm of cocoa nibs inside an air ventilated oven at three temperature levels (120°C, 140°C and 160°C under medium air flowrate for one hour. Two types of samples were prepared namely the raw and soaked nib samples. The soaked nib samples were prepared by soaking the raw nibs in 200 ml of water at room temperature for 5 and 10 hours. Mathematical modelling was carried out to model the mass transfer process using semi-empirical models. Modelling showed that both Page and two-term models were able to give close fitting between the experimental and predicted values. Effective diffusivity values were estimated in the order of magnitude of 10-5 m2/s for the mass transfer process. Results obtained from these studies fill the current knowledge gap on the mass transfer kinetics of cocoa roasting.

  6. Application of finite difference method in the study of diffusion with chemical kinetics of first order

    Directory of Open Access Journals (Sweden)

    Beltrán-Prieto Juan Carlos

    2016-01-01

    Full Text Available The mathematical modelling of diffusion of a bleaching agent into a porous material is studied in the present paper. Law of mass conservation was applied to analize the mass transfer of a reactant from the bulk into the external surface of a solid geometrically described as a flat plate. After diffusion of the reactant, surface reaction following kinetics of first order was considered to take place. The solution of the differential equation that described the process leaded to an equation that represents the concentration profile in function of distance, porosity and Thiele modulus. The case of interfacial mass resistance is also discused. In this case, finite difference method was used for the solution of the differential equation taking into account the respective boundary conditions. The profile of concentration can be obtained after numerical especification of Thiele modulus and Biot number.

  7. 1D to 3D diffusion-reaction kinetics of defects in crystals

    DEFF Research Database (Denmark)

    Trinkaus, H.; Heinisch, H.L.; Barashev, A.V.

    2002-01-01

    Microstructural features evolving in crystalline solids from diffusion-reaction kinetics of mobile components depend crucially on the dimension of the underlying diffusion process which is commonly assumed to be three-dimensional (3D). In metals, irradiation-induced displacement cascades produce...... clusters of self-interstitials performing 1D diffusion. Changes between equivalent 1D diffusion paths and transversal diffusion result in diffusion-reaction kinetics between one and three dimensions. An analytical approach suggests a single-variable function (master curve) interpolating between the 1D...

  8. Desorption kinetics of ciprofloxacin in municipal biosolids determined by diffusion gradient in thin films.

    Science.gov (United States)

    D'Angelo, E; Starnes, D

    2016-12-01

    Ciprofloxacin (CIP) is a commonly-prescribed antibiotic that is largely excreted by the body, and is often found at elevated concentrations in treated sewage sludge (biosolids) at municipal wastewater treatment plants. When biosolids are applied to soils, they could release CIP to surface runoff, which could adversely affect growth of aquatic organisms that inhabit receiving water bodies. The hazard risk largely depends on the amount of antibiotic in the solid phase that can be released to solution (labile CIP), its diffusion coefficient, and sorption/desorption exchange rates in biosolids particles. In this study, these processes were evaluated in a Class A Exceptional Quality Biosolids using a diffusion gradient in thin films (DGT) sampler that continuously removed CIP from solution, which induced desorption and diffusion in biosolids. Mass accumulation of antibiotic in the sampler over time was fit by a diffusion transport and exchange model available in the software tool 2D-DIFS to derive the distribution coefficient of labile CIP (K dl ) and sorption/desorption rate constants in the biosolids. The K dl was 13 mL g -1 , which equated to 16% of total CIP in the labile pool. Although the proportion of labile CIP was considerable, release rates to solution were constrained by slow desorption kinetics (desorption rate constant = 4 × 10 -6 s -1 ) and diffusion rate (effective diffusion coefficient = 6 × 10 -9  cm 2  s -1 . Studies are needed to investigate how changes in temperature, water content, pH and other physical and chemical characteristics can influence antibiotic release kinetics and availability and mobility in biosolid-amended soils. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Surface exchange kinetics and chemical diffusivities of BaZr{sub 0.2}Ce{sub 0.65}Y{sub 0.15}O{sub 3−δ} by electrical conductivity relaxation

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Dae-Kwang; Jeon, Sang-Yun; Singh, Bhupendra [Ionics Lab, School of Materials Science and Engineering, Chonnam National University, 77 Yongbong-ro, Buk-gu, Gwang-Ju 500-757 (Korea, Republic of); Park, Jun-Young [Department of Advanced Materials Engineering, Sejong University, Seoul 143-747 (Korea, Republic of); Song, Sun-Ju, E-mail: song@chonnam.ac.kr [Ionics Lab, School of Materials Science and Engineering, Chonnam National University, 77 Yongbong-ro, Buk-gu, Gwang-Ju 500-757 (Korea, Republic of)

    2014-10-15

    Highlights: • Electrical conductivity relaxation in BaCe{sub 0.65}Zr{sub 0.2}Y{sub 0.15}O{sub 3−δ} was monitored. • Monotonic relaxation behavior was observed during oxidation/reduction. • Nonmonotonic twofold relaxation behavior was observed during hydration/dehydration. • Surface exchange coefficients and diffusivities of O and H were calculated. - Abstract: Perovskite-type oxide BaCe{sub 0.65}Zr{sub 0.2}Y{sub 0.15}O{sub 3−δ} (BCZY2015) was synthesized by a solid state reaction method. BCZY2015 samples were characterized by powder X-ray diffraction (XRD) and scanning electron microscopy (SEM). The time dependent variation in electrical conductivity of BCZY2015 was monitored during the oxidation/reduction in oxygen partial pressure (pO{sub 2}) range of −2.28 ⩽ log (pO{sub 2}/atm) ⩽ −0.68 at a fixed water vapor pressure (pH{sub 2}O), and during the hydration/dehydration in −3.15 ⩽ log (pH{sub 2}O/atm) ⩽ −2.35 range in air. The electrical conductivity showed a monotonic relaxation behavior by the ambipolar diffusion of V{sub o}{sup ··} and OH{sub o}{sup ·} during the oxidation/reduction and the relaxation process was governed by the diffusivity of oxygen (D-tilde{sub vO}). On the other hand, during the hydration/dehydration process, a non-monotonic twofold relaxation behavior was observed due to the decoupled diffusion of H and O components with the mediation of holes, and the conductivity relaxation process was governed by the diffusivities of both H (D-tilde{sub iH}) and O (D-tlde{sub vH}). The values of surface exchange coefficients and diffusivities of oxygen and hydrogen were calculated from Fick’s second law by the nonlinear least squares fitting of the conductivity data, as proposed by Yoo et al. (2008)

  10. Evaporation Kinetics of Polyol Droplets: Determination of Evaporation Coefficients and Diffusion Constants

    Science.gov (United States)

    Su, Yong-Yang; Marsh, Aleksandra; Haddrell, Allen E.; Li, Zhi-Ming; Reid, Jonathan P.

    2017-11-01

    In order to quantify the kinetics of mass transfer between the gas and condensed phases in aerosol, physicochemical properties of the gas and condensed phases and kinetic parameters (mass/thermal accommodation coefficients) are crucial for estimating mass fluxes over a wide size range from the free molecule to continuum regimes. In this study, we report measurements of the evaporation kinetics of droplets of 1-butanol, ethylene glycol (EG), diethylene glycol (DEG), and glycerol under well-controlled conditions (gas flow rates and temperature) using the previously developed cylindrical electrode electrodynamic balance technique. Measurements are compared with a model that captures the heat and mass transfer occurring at the evaporating droplet surface. The aim of these measurements is to clarify the discrepancy in the reported values of mass accommodation coefficient (αM, equals to evaporation coefficient based on microscopic reversibility) for 1-butanol, EG, and DEG and improve the accuracy of the value of the diffusion coefficient for glycerol in gaseous nitrogen. The uncertainties in the thermophysical and experimental parameters are carefully assessed, the literature values of the vapor pressures of these components are evaluated, and the plausible ranges of the evaporation coefficients for 1-butanol, EG, and DEG as well as uncertainty in diffusion coefficient for glycerol are reported. Results show that αM should be greater than 0.4, 0.2, and 0.4 for EG, DEG, and 1-butanol, respectively. The refined values are helpful for accurate prediction of the evaporation/condensation rates.

  11. Kinetics of particle deposition at heterogeneous surfaces

    Science.gov (United States)

    Stojiljković, D. Lj.; Vrhovac, S. B.

    2017-12-01

    The random sequential adsorption (RSA) approach is used to analyze adsorption of spherical particles of fixed diameter d0 on nonuniform surfaces covered by square cells arranged in a square lattice pattern. To characterize such pattern two dimensionless parameters are used: the cell size α and the cell-cell separation β, measured in terms of the particle diameter d0. Adsorption is assumed to occur if the particle (projected) center lies within a cell area. We focus on the kinetics of deposition process in the case when no more than a single disk can be placed onto any square cell (α deposition process is not consistent with the power law behavior. However, if the geometry of the pattern approaches towards ;noninteracting conditions; (β > 1), when adsorption on each cell can be decoupled, approach of the coverage fraction θ(t) to θJ becomes closer to the exponential law. Consequently, changing the pattern parameters in the present model allows to interpolate the deposition kinetics between the continuum limit and the lattice-like behavior. Structural properties of the jammed-state coverings are studied in terms of the radial distribution function g(r) and spatial distribution of particles inside the cell. Various, non-trivial spatial distributions are observed depending on the geometry of the pattern.

  12. Treatment of polymer surfaces in plasma Part I. Kinetic model

    International Nuclear Information System (INIS)

    Tabaliov, N A; Svirachev, D M

    2006-01-01

    The surface tension of the polymer materials depends on functional groups over its surface. As a result from the plasma treatment the kind and concentration of the functional groups can be changed. In the present work, the possible kinetic reactions are defined. They describe the interaction between the plasma and the polymer surface of polyethylene terephthalate (PET). Basing on these reactions, the systems of differential kinetic equations are suggested. The solutions are obtained analytically for the system kinetic equations at defined circumstances

  13. Growth kinetics of metastable (331) nanofacet on Au and Pt(110) surfaces

    International Nuclear Information System (INIS)

    Ndongmouo, U.T.; Houngninou, E.; Hontinfinde, F.

    2006-12-01

    A theoretical epitaxial growth model with realistic barriers for surface diffusion is investigated by means of kinetic Monte Carlo simulations to study the growth modes of metastable (331) nanofacets on Au and Pt(110) surfaces. The results show that under experimental atomic fluxes, the (331) nanofacets grow by 2D nucleation at low temperature in the submonolayer regime. A metastable growth phase diagram that can be useful to experimentalists is presented and looks similar to the one found for the stationary growth of the bcc(001) surface in the kinetic 6-vertex model. (author)

  14. Generation of a library of two-group diffusion and kinetics parameters for DYN3D

    International Nuclear Information System (INIS)

    Petkov, P.T.; Christoskov, I.D.; Kamenov, K.; Antov, A.

    2002-01-01

    A library of two-group diffusion and kinetics parameters has been generated for the neutron kinetics code DYN3D for analysis of reactivity initiated accidents for the WWER-440 reactors, based on the MAGRU approximation methodology for the diffusion and kinetics parameters. The accuracy of this methodology has been tested and the conclusion is that it is not adequate. A new approximation methodology, based on interpolation for the most widely varying parameters, i.e. the moderator temperature and density, and on approximation for all other independent parameters, is presented. The methodology of calculation of the kinetics parameters using primary data from ENDF-B/VI is described in detail (Authors)

  15. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  16. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  17. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  18. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  19. AUS diffusion module POW checkout - 1- and 2-dimensional kinetics calculations

    International Nuclear Information System (INIS)

    Pollard, J.P.

    1977-01-01

    POW is the diffusion module 'workhorse' of the AUS reactor neutronics modular code system; its steady state calculations have been checked out against other diffusion codes (particularly CRAM and GOG). Checkout of kinetic aspects, however, is difficult as kinetic codes are not freely available. In this report POW has been checked against three benchmark calculations as well as a calculation on the 100 KW Argonaut reactor Moata. (author)

  20. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  1. Surface Area, and Oxidation Effects on Nitridation Kinetics of Silicon Powder Compacts

    Science.gov (United States)

    Bhatt, R. T.; Palczer, A. R.

    1998-01-01

    Commercially available silicon powders were wet-attrition-milled from 2 to 48 hr to achieve surface areas (SA's) ranging from 1.3 to 70 sq m/g. The surface area effects on the nitridation kinetics of silicon powder compacts were determined at 1250 or 1350 C for 4 hr. In addition, the influence of nitridation environment, and preoxidation on nitridation kinetics of a silicon powder of high surface area (approximately equals 63 sq m/g) was investigated. As the surface area increased, so did the percentage nitridation after 4 hr in N2 at 1250 or 1350 C. Silicon powders of high surface area (greater than 40 sq m/g) can be nitrided to greater than 70% at 1250 C in 4 hr. The nitridation kinetics of the high-surface-area powder compacts were significantly delayed by preoxidation treatment. Conversely, the nitridation environment had no significant influence on the nitridation kinetics of the same powder. Impurities present in the starting powder, and those accumulated during attrition milling, appeared to react with the silica layer on the surface of silicon particles to form a molten silicate layer, which provided a path for rapid diffusion of nitrogen and enhanced the nitridation kinetics of high surface area silicon powder.

  2. Kinetic Monte Carlo Simulation of Oxygen and Cation Diffusion in Yttria-Stabilized Zirconia

    Science.gov (United States)

    Good, Brian

    2011-01-01

    Yttria-stabilized zirconia (YSZ) is of interest to the aerospace community, notably for its application as a thermal barrier coating for turbine engine components. In such an application, diffusion of both oxygen ions and cations is of concern. Oxygen diffusion can lead to deterioration of a coated part, and often necessitates an environmental barrier coating. Cation diffusion in YSZ is much slower than oxygen diffusion. However, such diffusion is a mechanism by which creep takes place, potentially affecting the mechanical integrity and phase stability of the coating. In other applications, the high oxygen diffusivity of YSZ is useful, and makes the material of interest for use as a solid-state electrolyte in fuel cells. The kinetic Monte Carlo (kMC) method offers a number of advantages compared with the more widely known molecular dynamics simulation method. In particular, kMC is much more efficient for the study of processes, such as diffusion, that involve infrequent events. We describe the results of kinetic Monte Carlo computer simulations of oxygen and cation diffusion in YSZ. Using diffusive energy barriers from ab initio calculations and from the literature, we present results on the temperature dependence of oxygen and cation diffusivity, and on the dependence of the diffusivities on yttria concentration and oxygen sublattice vacancy concentration. We also present results of the effect on diffusivity of oxygen vacancies in the vicinity of the barrier cations that determine the oxygen diffusion energy barriers.

  3. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  4. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  5. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  6. Kinetic isotopic fractionation during diffusion of ionic species in water

    Science.gov (United States)

    Richter, Frank M.; Mendybaev, Ruslan A.; Christensen, John N.; Hutcheon, Ian D.; Williams, Ross W.; Sturchio, Neil C.; Beloso, Abelardo D.

    2006-01-01

    Experiments specifically designed to measure the ratio of the diffusivities of ions dissolved in water were used to determine DLi/DK,D/D,D/D,D/D,andD/D. The measured ratio of the diffusion coefficients for Li and K in water (D Li/D K = 0.6) is in good agreement with published data, providing evidence that the experimental design being used resolves the relative mobility of ions with adequate precision to also be used for determining the fractionation of isotopes by diffusion in water. In the case of Li, we found measurable isotopic fractionation associated with the diffusion of dissolved LiCl (D/D=0.99772±0.00026). This difference in the diffusion coefficient of 7Li compared to 6Li is significantly less than that reported in an earlier study, a difference we attribute to the fact that in the earlier study Li diffused through a membrane separating the water reservoirs. Our experiments involving Mg diffusing in water found no measurable isotopic fractionation (D/D=1.00003±0.00006). Cl isotopes were fractionated during diffusion in water (D/D=0.99857±0.00080) whether or not the co-diffuser (Li or Mg) was isotopically fractionated. The isotopic fractionation associated with the diffusion of ions in water is much smaller than values we found previously for the isotopic fractionation of Li and Ca isotopes by diffusion in molten silicate liquids. A major distinction between water and silicate liquids is that water surrounds dissolved ions with hydration shells, which very likely play an important but still poorly understood role in limiting the isotopic fractionation associated with diffusion.

  7. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  8. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  9. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  10. Zirconium metal-water oxidation kinetics. III. Oxygen diffusion in oxide and alpha Zircaloy phases

    International Nuclear Information System (INIS)

    Pawel, R.E.

    1976-10-01

    The reaction of Zircaloy in steam at elevated temperature involves the growth of discrete layers of oxide and oxygen-rich alpha Zircaloy from the parent beta phase. The multiphase, moving boundary diffusion problem involved is encountered in a number of important reaction schemes in addition to that of Zircaloy-oxygen and can be completely (albeitly ideally) characterized through an appropriate model in terms of oxygen diffusion coefficients and equilibrium concentrations for the various phases. Conversely, kinetic data for phase growth and total oxygen consumption rates can be used to compute diffusion coefficients. Equations are developed that express the oxygen diffusion coefficients in the oxide and alpha phases in terms of the reaction rate constants and equilibrium solubility values. These equations were applied to recent experimental kinetic data on the steam oxidation of Zircaloy-4 to determine the effective oxygen diffusion coefficients in these phases over the temperature range 1000--1500 0 C

  11. Studies on the kinetics and intraparticle diffusivities of BOD, colour ...

    African Journals Online (AJOL)

    Therefore, this study reveals that boiler fly ash can effectively be used as an adsorbent for POME treatment and also established the kinetic and mechanisms of the sorption process. Also, the results of this study could serve as effective design parameters for a treatment plant to further reduce BOD, colour and TSS from ...

  12. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  13. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  14. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  15. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  16. CHEMICAL REACTIONS ON ADSORBING SURFACE: KINETIC LEVEL OF DESCRIPTION

    Directory of Open Access Journals (Sweden)

    P.P.Kostrobii

    2003-01-01

    Full Text Available Based on the effective Hubbard model we suggest a statistical description of reaction-diffusion processes for bimolecular chemical reactions of gas particles adsorbed on the metallic surface. The system of transport equations for description of particles diffusion as well as reactions is obtained. We carry out the analysis of the contributions of all physical processes to the formation of diffusion coefficients and chemical reactions constants.

  17. RESEARCH OF KINETIC AND DIFFUSIVE MECHANISMS IN THE ADSORPTION OF Cu (II IN SUGAR CANE BAGASSE ASH

    Directory of Open Access Journals (Sweden)

    Julio Omar Prieto García

    2016-10-01

    Full Text Available In this paper a kinetic and diffusive study regarding adsorption of ions Cu (II on a sample of sugar cane bagasse ash is made. The results show that the second-order kinetic model better adjusts the experimental data than the Elovich and first-order kinetic model. The diffusive mechanism study shows that the diffusion in the liquid pellicle and in the micro-pores of the adsorbent prevail in the adsorption phenomenon.

  18. On the asymptotic preserving property of the unified gas kinetic scheme for the diffusion limit of linear kinetic models

    International Nuclear Information System (INIS)

    Mieussens, Luc

    2013-01-01

    The unified gas kinetic scheme (UGKS) of K. Xu et al. (2010) [37], originally developed for multiscale gas dynamics problems, is applied in this paper to a linear kinetic model of radiative transfer theory. While such problems exhibit purely diffusive behavior in the optically thick (or small Knudsen) regime, we prove that UGKS is still asymptotic preserving (AP) in this regime, but for the free transport regime as well. Moreover, this scheme is modified to include a time implicit discretization of the limit diffusion equation, and to correctly capture the solution in case of boundary layers. Contrary to many AP schemes, this method is based on a standard finite volume approach, it does neither use any decomposition of the solution, nor staggered grids. Several numerical tests demonstrate the properties of the scheme

  19. An analytical solution of the one-dimensional neutron diffusion kinetic equation in cartesian geometry

    International Nuclear Information System (INIS)

    Ceolin, Celina; Vilhena, Marco T.; Petersen, Claudio Z.

    2009-01-01

    In this work we report an analytical solution for the monoenergetic neutron diffusion kinetic equation in cartesian geometry. Bearing in mind that the equation for the delayed neutron precursor concentration is a first order linear differential equation in the time variable, to make possible the application of the GITT approach to the kinetic equation, we introduce a fictitious diffusion term multiplied by a positive small value ε. By this procedure, we are able to solve this set of equations. Indeed, applying the GITT technique to the modified diffusion kinetic equation, we come out with a matrix differential equation which has a well known analytical solution when ε goes to zero. We report numerical simulations as well study of numerical convergence of the results attained. (author)

  20. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  1. An analytical solution for the two-group kinetic neutron diffusion equation in cylindrical geometry

    International Nuclear Information System (INIS)

    Fernandes, Julio Cesar L.; Vilhena, Marco Tullio; Bodmann, Bardo Ernst

    2011-01-01

    Recently the two-group Kinetic Neutron Diffusion Equation with six groups of delay neutron precursor in a rectangle was solved by the Laplace Transform Technique. In this work, we report on an analytical solution for this sort of problem but in cylindrical geometry, assuming a homogeneous and infinite height cylinder. The solution is obtained applying the Hankel Transform to the Kinetic Diffusion equation and solving the transformed problem by the same procedure used in the rectangle. We also present numerical simulations and comparisons against results available in literature. (author)

  2. Surface kinetic temperature mapping using satellite spectral data in ...

    African Journals Online (AJOL)

    The result revealed that despite the limited topographic differences of the rift lakes and their proximity, the surface kinetic temperature difference is high, mainly due to groundwater and surface water fluxes. From thermal signature analysis two hot springs below the lake bed of Ziway were discovered. The various hot springs ...

  3. Reaction diffusion and solid state chemical kinetics handbook

    CERN Document Server

    Dybkov, V I

    2010-01-01

    This monograph deals with a physico-chemical approach to the problem of the solid-state growth of chemical compound layers and reaction-diffusion in binary heterogeneous systems formed by two solids; as well as a solid with a liquid or a gas. It is explained why the number of compound layers growing at the interface between the original phases is usually much lower than the number of chemical compounds in the phase diagram of a given binary system. For example, of the eight intermetallic compounds which exist in the aluminium-zirconium binary system, only ZrAl3 was found to grow as a separate

  4. Second Harmonic Correlation Spectroscopy: Theory and Principles for Determining Surface Binding Kinetics.

    Science.gov (United States)

    Sly, Krystal L; Conboy, John C

    2017-06-01

    A novel application of second harmonic correlation spectroscopy (SHCS) for the direct determination of molecular adsorption and desorption kinetics to a surface is discussed in detail. The surface-specific nature of second harmonic generation (SHG) provides an efficient means to determine the kinetic rates of adsorption and desorption of molecular species to an interface without interference from bulk diffusion, which is a significant limitation of fluorescence correlation spectroscopy (FCS). The underlying principles of SHCS for the determination of surface binding kinetics are presented, including the role of optical coherence and optical heterodyne mixing. These properties of SHCS are extremely advantageous and lead to an increase in the signal-to-noise (S/N) of the correlation data, increasing the sensitivity of the technique. The influence of experimental parameters, including the uniformity of the TEM00 laser beam, the overall photon flux, and collection time are also discussed, and are shown to significantly affect the S/N of the correlation data. Second harmonic correlation spectroscopy is a powerful, surface-specific, and label-free alternative to other correlation spectroscopic methods for examining surface binding kinetics.

  5. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  6. Kinetic Monte Carlo Simulation of Cation Diffusion in Low-K Ceramics

    Science.gov (United States)

    Good, Brian

    2013-01-01

    Low thermal conductivity (low-K) ceramic materials are of interest to the aerospace community for use as the thermal barrier component of coating systems for turbine engine components. In particular, zirconia-based materials exhibit both low thermal conductivity and structural stability at high temperature, making them suitable for such applications. Because creep is one of the potential failure modes, and because diffusion is a mechanism by which creep takes place, we have performed computer simulations of cation diffusion in a variety of zirconia-based low-K materials. The kinetic Monte Carlo simulation method is an alternative to the more widely known molecular dynamics (MD) method. It is designed to study "infrequent-event" processes, such as diffusion, for which MD simulation can be highly inefficient. We describe the results of kinetic Monte Carlo computer simulations of cation diffusion in several zirconia-based materials, specifically, zirconia doped with Y, Gd, Nb and Yb. Diffusion paths are identified, and migration energy barriers are obtained from density functional calculations and from the literature. We present results on the temperature dependence of the diffusivity, and on the effects of the presence of oxygen vacancies in cation diffusion barrier complexes as well.

  7. LSM Microelectrodes: Kinetics and Surface Composition

    DEFF Research Database (Denmark)

    Hansen, Karin Vels; Norrman, Kion; Jacobsen, Torben

    2015-01-01

    spectroscopy and cyclic voltammetry were performed on electrodes with diameters of 20–100 μm in oxygen, air and nitrogen both at open circuit voltage and at anodic and cathodic polarization. In situ conductance mapping, ex situ surface analysis by time-of-flight secondary ion mass spectrometry, and scanning...

  8. Kinetic-energy functionals studied by surface calculations

    DEFF Research Database (Denmark)

    Vitos, Levente; Skriver, Hans Lomholt; Kollár, J.

    1998-01-01

    The self-consistent jellium model of metal surfaces is used to study the accuracy of a number of semilocal kinetic-energy functionals for independent particles. It is shown that the poor accuracy exhibited by the gradient expansion approximation and most of the semiempirical functionals in the lo...... density, high gradient limit may be subtantially improved by including locally a von Weizsacker term. Based on this, we propose a simple one-parameter Pade's approximation, which reproduces the exact Kohn-Sham surface kinetic energy over the entire range of metallic densities....

  9. Estimating kinetic parameters from dynamic contrast-enhanced T(1)-weighted MRI of a diffusable tracer: standardized quantities and symbols

    DEFF Research Database (Denmark)

    Tofts, P.S.; Brix, G; Buckley, D.L.

    1999-01-01

    We describe a standard set of quantity names and symbols related to the estimation of kinetic parameters from dynamic contrast-enhanced T(1)-weighted magnetic resonance imaging data, using diffusable agents such as gadopentetate dimeglumine (Gd-DTPA). These include a) the volume transfer constant K......-limited conditions K(trans) equals the blood plasma flow per unit volume of tissue; under permeability-limited conditions K(trans) equals the permeability surface area product per unit volume of tissue. We relate these quantities to previously published work from our groups; our future publications will refer...

  10. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  11. Phosphorus removal from aqueous solution in parent and aluminum-modified eggshells: thermodynamics and kinetics, adsorption mechanism, and diffusion process.

    Science.gov (United States)

    Guo, Ziyan; Li, Jiuhai; Guo, Zhaobing; Guo, Qingjun; Zhu, Bin

    2017-06-01

    Parent and aluminum-modified eggshells were prepared and characterized with X-ray diffraction, specific surface area measurements, infrared spectroscopy, zeta potential, and scanning electron microscope, respectively. Besides, phosphorus adsorptions in these two eggshells at different temperatures and solution pH were carried out to study adsorption thermodynamics and kinetics as well as the mechanisms of phosphorus adsorption and diffusion. The results indicated that high temperature was favorable for phosphorus adsorption in parent and aluminum-modified eggshells. Alkaline solution prompted phosphorus adsorption in parent eggshell, while the maximum adsorption amount was achievable at pH 4 in aluminum-modified eggshell. Adsorption isotherms of phosphorus in these eggshells could be well described by Langmuir and Freundlich models. Phosphorus adsorption amounts in aluminum-modified eggshell were markedly higher compared to those in parent eggshell. Adsorption heat indicated that phosphorus adsorption in parent eggshell was a typically physical adsorption process, while chemical adsorption mechanism of ion exchange between phosphorus and hydroxyl groups on the surface of eggshells was dominated in aluminum-modified eggshell. The time-resolved uptake curves showed phosphorus adsorption in aluminum-modified eggshell was significantly faster than that in parent eggshell. Moreover, there existed two clear steps in time-resolved uptake curves of phosphorus in parent eggshell. Based on pseudo-second order kinetic model and intraparticle diffusion model, we inferred more than one process affected phosphorus adsorption. The first process was the diffusion of phosphorus through water to external surface and the opening of pore channel in the eggshells, and the second process was mainly related to intraparticle diffusion.

  12. Rate kernel theory for pseudo-first-order kinetics of diffusion-influenced reactions and application to fluorescence quenching kinetics.

    Science.gov (United States)

    Yang, Mino

    2007-06-07

    Theoretical foundation of rate kernel equation approaches for diffusion-influenced chemical reactions is presented and applied to explain the kinetics of fluorescence quenching reactions. A many-body master equation is constructed by introducing stochastic terms, which characterize the rates of chemical reactions, into the many-body Smoluchowski equation. A Langevin-type of memory equation for the density fields of reactants evolving under the influence of time-independent perturbation is derived. This equation should be useful in predicting the time evolution of reactant concentrations approaching the steady state attained by the perturbation as well as the steady-state concentrations. The dynamics of fluctuation occurring in equilibrium state can be predicted by the memory equation by turning the perturbation off and consequently may be useful in obtaining the linear response to a time-dependent perturbation. It is found that unimolecular decay processes including the time-independent perturbation can be incorporated into bimolecular reaction kinetics as a Laplace transform variable. As a result, a theory for bimolecular reactions along with the unimolecular process turned off is sufficient to predict overall reaction kinetics including the effects of unimolecular reactions and perturbation. As the present formulation is applied to steady-state kinetics of fluorescence quenching reactions, the exact relation between fluorophore concentrations and the intensity of excitation light is derived.

  13. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  14. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  15. Kinetic theory of surface waves in plasma jets

    International Nuclear Information System (INIS)

    Shokri, B.

    2002-01-01

    The kinetic theory analysis of surface waves propagating along a semi-bounded plasma jet is presented. The frequency spectra and their damping rate are obtained in both the high and low frequency regions. Finally, the penetration of the static field in the plasma jet under the condition that the plasma jet velocity is smaller than the sound velocity is studied

  16. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  17. An Ab Initio and Kinetic Monte Carlo Simulation Study of Lithium Ion Diffusion on Graphene

    Directory of Open Access Journals (Sweden)

    Kehua Zhong

    2017-07-01

    Full Text Available The Li+ diffusion coefficients in Li+-adsorbed graphene systems were determined by combining first-principle calculations based on density functional theory with Kinetic Monte Carlo simulations. The calculated results indicate that the interactions between Li ions have a very important influence on lithium diffusion. Based on energy barriers directly obtained from first-principle calculations for single-Li+ and two-Li+ adsorbed systems, a new equation predicting energy barriers with more than two Li ions was deduced. Furthermore, it is found that the temperature dependence of Li+ diffusion coefficients fits well to the Arrhenius equation, rather than meeting the equation from electrochemical impedance spectroscopy applied to estimate experimental diffusion coefficients. Moreover, the calculated results also reveal that Li+ concentration dependence of diffusion coefficients roughly fits to the equation from electrochemical impedance spectroscopy in a low concentration region; however, it seriously deviates from the equation in a high concentration region. So, the equation from electrochemical impedance spectroscopy technique could not be simply used to estimate the Li+ diffusion coefficient for all Li+-adsorbed graphene systems with various Li+ concentrations. Our work suggests that interactions between Li ions, and among Li ion and host atoms will influence the Li+ diffusion, which determines that the Li+ intercalation dependence of Li+ diffusion coefficient should be changed and complex.

  18. Thermodynamics and kinetics of interstitial diffusion in a two-component system

    International Nuclear Information System (INIS)

    McKee, R.A.

    1980-01-01

    Diffusion theory is developed for a two-component system in which only the interstitial element is mobile. A thermodynamic formalism is used in direct parallel with a kinetic theory to construct a mechanism-independent relationship between tracer- and chemical-diffusion coefficients. It is found that D/sup I/=(D-italic*/f)(1+partiallnγ/partiallnC). D/sup I/ is the intrinsic- or chemical-diffusion coefficient for the interstitial, D* is the tracer-diffusion coefficient, f is the correlation factor, and γ is the activity coefficient. This expression accounts for site exclusion, correlation, and drift effects that occur as the interstitial content changes. Generalized phenomenological coefficients that are determined in this analysis can be used for standard representations of diffusion in electric fields and temperature gradients. Moreover, the forms that the phenomenological coefficients take for the interstitial system are the same as those previously derived for vacancy diffusion. A test of this predicted relationship between tracer- and chemical-diffusion coefficients is developed using a comparison between theory and experiment for carbon diffusion in fcc iron

  19. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  20. Surfaces of Microparticles in Colloids: Structure and Molecular Adsorption Kinetics

    Science.gov (United States)

    Dai, Hai-Lung

    2002-03-01

    Surfaces of micron and sub-micron size particles in liquid solution are probed by second harmonic generation (SHG) facilitated with femtosecond laser pulses. The particles probed include inorganic objects such as carbon black and color pigments, polymeric species like polystyrene beads, and biological systems such as blood cells and ecoli. In the experiments, dye molecules are first adsorbed onto the particle surface to allow generation of second harmonics upon light irradiation. Competition for adsorption between these surface dye molecules and the molecules of interest in the solution is then monitored by the SHG signal to reveal the molecular adsorption kinetics and surface structure. Specifically, surfactant adsorption on polymer surfaces, the structure of carbon black surface, and protein adsorption on biological surfaces, monitored by this technique, will be discussed.

  1. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  2. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  3. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  4. Transient atomic behavior and surface kinetics of GaN

    International Nuclear Information System (INIS)

    Moseley, Michael; Billingsley, Daniel; Henderson, Walter; Trybus, Elaissa; Doolittle, W. Alan

    2009-01-01

    An in-depth model for the transient behavior of metal atoms adsorbed on the surface of GaN is developed. This model is developed by qualitatively analyzing transient reflection high energy electron diffraction (RHEED) signals, which were recorded for a variety of growth conditions of GaN grown by molecular-beam epitaxy (MBE) using metal-modulated epitaxy (MME). Details such as the initial desorption of a nitrogen adlayer and the formation of the Ga monolayer, bilayer, and droplets are monitored using RHEED and related to Ga flux and shutter cycles. The suggested model increases the understanding of the surface kinetics of GaN, provides an indirect method of monitoring the kinetic evolution of these surfaces, and introduces a novel method of in situ growth rate determination.

  5. Transient atomic behavior and surface kinetics of GaN

    Science.gov (United States)

    Moseley, Michael; Billingsley, Daniel; Henderson, Walter; Trybus, Elaissa; Doolittle, W. Alan

    2009-07-01

    An in-depth model for the transient behavior of metal atoms adsorbed on the surface of GaN is developed. This model is developed by qualitatively analyzing transient reflection high energy electron diffraction (RHEED) signals, which were recorded for a variety of growth conditions of GaN grown by molecular-beam epitaxy (MBE) using metal-modulated epitaxy (MME). Details such as the initial desorption of a nitrogen adlayer and the formation of the Ga monolayer, bilayer, and droplets are monitored using RHEED and related to Ga flux and shutter cycles. The suggested model increases the understanding of the surface kinetics of GaN, provides an indirect method of monitoring the kinetic evolution of these surfaces, and introduces a novel method of in situ growth rate determination.

  6. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  7. Kinetic computer modeling of microwave surface-wave plasma production

    International Nuclear Information System (INIS)

    Ganachev, Ivan P.

    2004-01-01

    Kinetic computer plasma modeling occupies an intermediate position between the time consuming rigorous particle dynamic simulation and the fast but rather rough cold- or warm-plasma fluid models. The present paper reviews the kinetic modeling of microwave surface-wave discharges with accent on recent kinetic self-consistent models, where the external input parameters are reduced to the necessary minimum (frequency and intensity of the applied microwave field and pressure and geometry of the discharge vessel). The presentation is limited to low pressures, so that Boltzmann equation is solved in non-local approximation and collisional electron heating is neglected. The numerical results reproduce correctly the bi-Maxwellian electron energy distribution functions observed experimentally. (author)

  8. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  9. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  10. II. Inhibited Diffusion Driven Surface Transmutations

    Science.gov (United States)

    Chubb, Talbot A.

    2006-02-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

  11. II. Inhibited diffusion driven surface transmutations

    International Nuclear Information System (INIS)

    Cubb, Talbot A.

    2006-01-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  12. II. Inhibited diffusion driven surface transmutations

    Energy Technology Data Exchange (ETDEWEB)

    Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

    2006-07-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  13. The fractional diffusion limit of a kinetic model with biochemical pathway

    Science.gov (United States)

    Perthame, Benoît; Sun, Weiran; Tang, Min

    2018-06-01

    Kinetic-transport equations that take into account the intracellular pathways are now considered as the correct description of bacterial chemotaxis by run and tumble. Recent mathematical studies have shown their interest and their relations to more standard models. Macroscopic equations of Keller-Segel type have been derived using parabolic scaling. Due to the randomness of receptor methylation or intracellular chemical reactions, noise occurs in the signaling pathways and affects the tumbling rate. Then comes the question to understand the role of an internal noise on the behavior of the full population. In this paper we consider a kinetic model for chemotaxis which includes biochemical pathway with noises. We show that under proper scaling and conditions on the tumbling frequency as well as the form of noise, fractional diffusion can arise in the macroscopic limits of the kinetic equation. This gives a new mathematical theory about how long jumps can be due to the internal noise of the bacteria.

  14. Measurement and modeling of diffusion kinetics of a lipophilic molecule across rabbit cornea.

    Science.gov (United States)

    Gupta, Chhavi; Chauhan, Anuj; Mutharasan, Raj; Srinivas, Sangly P

    2010-04-01

    To develop a kinetic model for representing the diffusion and partitioning of Rhodamine B (RhB), a fluorescent lipophilic molecule, across the cornea for gaining insights into pharmacokinetics of topical drugs to the eye. Rabbit corneas mounted underneath a custom-built scanning microfluorometer were perfused with Ringers on both sides of the tissue. After a step change in RhB on the tear side, transients of trans-corneal fluorescence of RhB were measured at a depth resolution approximately 8 microm. RhB distribution exhibited discontinuities at the interface between epithelium and stroma, and between stroma and endothelium. In each of the layers, fluorescence was non-uniform. Fluorescence was elevated in the epithelium and endothelium relative to the stroma. Modeling of RhB transport by diffusion in each layer and stipulation of partitioning of RhB at the cellular interfaces were required to account for trans-corneal penetration kinetics of RhB. The model parameters, estimated using the unsteady state trans-corneal RhB profiles, were found to be sensitive, and the model predicted the experimental profiles accurately. Conventional pharmacokinetic models that depict cornea as a single compartment do not predict the depth-dependent kinetics of RhB penetration. The proposed model incorporates realistic transport mechanisms and thereby highlights the influence of physicochemical properties of drugs on trans-corneal kinetics.

  15. Kinetics of radiation-induced precipitation at the alloy surface

    Science.gov (United States)

    Lam, N. Q.; Nguyen, T.; Leaf, G. K.; Yip, S.

    1988-05-01

    Radiation-induced precipitation of a new phase at the surface of an alloy during irradiation at elevated temperatures was studied with the aid of a kinetic model of segregation. The preferential coupling of solute atoms with the defect fluxes gives rise to a strong solute enrichment at the surface, which, if surpassing the solute solubility limit, leads to the formation of a precipitate layer. The moving precipitate/matrix interface was accommodated by means of a mathematical scheme that transforms spatial coordinates into a reference frame in which the boundaries are immobile. Sample calculations were performed for precipitation of the γ'-Ni 3Si layer on Ni-Si alloys undergoing electron irradiation. The dependences of the precipitation kinetics on the defect-production rate, irradiation temperature, internal defect sink concentration and alloy composition were investigated systematically.

  16. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  17. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  18. A diffuse neutron scattering study of clustering kinetics in Cu-Ni alloys

    International Nuclear Information System (INIS)

    Vrijen, J.; Radelaar, S.; Schwahn, D.

    1977-01-01

    Diffuse scattering of thermal neutrons was used to investigate the kinetics of clustering in Cu-Ni alloys. In order to optimize the experimental conditions the isotopes 65 Cu and 62 Ni were alloyed. The time evolution of the diffuse scattered intensity at 400 0 C has been measured for eight Cu-Ni alloys, varying in composition between 30 and 80 at. pour cent Ni. The relaxation of the so called null matrix, containing 56.5 at. pour cent Ni has also been investigated at 320, 340, 425 and 450 0 C. Using Cook's model from all these measurements information has been deduced about diffusion at low temperatures and about thermodynamic properties of the Cu-Ni system. It turns out that Cook's model is not sufficiently detailed for an accurate description of the initial stages of these relaxations

  19. The role of surface oxides on hydrogen sorption kinetics in titanium thin films

    Science.gov (United States)

    Hadjixenophontos, Efi; Michalek, Lukas; Roussel, Manuel; Hirscher, Michael; Schmitz, Guido

    2018-05-01

    Titanium is presently discussed as a catalyst to accelerate the hydrogenation kinetics of hydrogen storage materials. It is however known that H absorption in Ti decisively depends on the surface conditions (presence or absence of the natural surface oxide). In this work, we use Ti thin films of controlled thickness (50-800 nm) as a convenient tool for quantifying the atomic transport. XRD and TEM investigations allow us to follow the hydrogenation progress inside the film. Hydrogenation of TiO2/Ti bi-layers is studied at 300 °C, for different durations (10 s to 600 min) and at varying pressures of pure H2 atmosphere. Under these conditions, the hydrogenation is found to be linear in time. By comparing films with and without TiO2, as well as by studying the pressure dependence of hydrogenation, it is demonstrated that hydrogen transport across the oxide represents the decisive kinetic barrier rather than the splitting of H2 molecules at the surface. Hydrogenation appears by a layer-like reaction initiated by heterogeneous nucleation at the backside interface to the substrate. The linear growth constant and the H diffusion coefficient inside the oxide are quantified, as well as a reliable lower bound to the hydrogen diffusion coefficient in Ti is derived. The pressure dependence of hydrogen absorption is quantitatively modelled.

  20. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  1. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  2. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  3. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  4. A numerical scheme for a kinetic model for mixtures in the diffusive limit using the moment method

    OpenAIRE

    Bondesan , Andrea; Boudin , Laurent; Grec , Bérénice

    2018-01-01

    In this article, we consider a multi-species kinetic model which leads to the Maxwell-Stefan equations under a standard diffusive scaling (small Knudsen and Mach numbers). We propose a suitable numerical scheme which approximates both the solution of the kinetic model in rarefied regime and the one in the diffusion limit. We prove some a priori estimates (mass conservation and nonnegativity) and well-posedness of the discrete problem. We also present numerical examples where we observe the as...

  5. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  6. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  7. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  8. Quantitative diffusion and swelling kinetic measurements using large-angle interferometric refractometry.

    Science.gov (United States)

    Saunders, John E; Chen, Hao; Brauer, Chris; Clayton, McGregor; Chen, Weijian; Barnes, Jack A; Loock, Hans-Peter

    2015-12-07

    The uptake and release of sorbates into films and coatings is typically accompanied by changes of the films' refractive index and thickness. We provide a comprehensive model to calculate the concentration of the sorbate from the average refractive index and the film thickness, and validate the model experimentally. The mass fraction of the analyte partitioned into a film is described quantitatively by the Lorentz-Lorenz equation and the Clausius-Mosotti equation. To validate the model, the uptake kinetics of water and other solvents into SU-8 films (d = 40-45 μm) were explored. Large-angle interferometric refractometry measurements can be used to characterize films that are between 15 μm to 150 μm thick and, Fourier analysis, is used to determine independently the thickness, the average refractive index and the refractive index at the film-substrate interface at one-second time intervals. From these values the mass fraction of water in SU-8 was calculated. The kinetics were best described by two independent uptake processes having different rates. Each process followed one-dimensional Fickian diffusion kinetics with diffusion coefficients for water into SU-8 photoresist film of 5.67 × 10(-9) cm(2) s(-1) and 61.2 × 10(-9) cm(2) s(-1).

  9. Assessment of sorption properties and kinetic reaction of phosphorus reactive material to limit diffuse pollution

    Directory of Open Access Journals (Sweden)

    Bus Agnieszka

    2017-09-01

    Full Text Available Assessment of sorption properties and kinetic reaction of phosphorus reactive material to limit diffuse pollution. Polonite® is an effective reactive material (manufactured from opoka rock for removing phosphorus from aqueous solutions. In conducted experiments, Polonite® of grain size of 2–5 mm was used as a potential reactive material which can be used as a filter fulfillment to reduce phosphorus diffuse pollution from agriculture areas. Kinetic and equilibrium studies (performed as a batch experiment were carried out as a function of time to evaluate the sorption properties of the material. The obtained results show that Polonite® effectively removes such contamination. All tested concentrations (0.998, 5.213, 10.965 mg P-PO4·L−1 are characterized by a better fit to pseudo-second kinetic order. The Langmuir isotherm the best reflects the mechanism of adsorption process in case of Polonite® and based on the isotherm, calculated maximum adsorption capacity equals 96.58 mg P-PO4·g−1.

  10. Diffusion-kinetic theories for LET effects on the radiolysis of water

    International Nuclear Information System (INIS)

    Pimblott, S.M.; LaVerne, J.A.

    1994-01-01

    Diffusion-kinetic methods are used to investigate the effects of incident particle linear energy transfer (LET) on the radiolysis of water and aqueous solutions. Chemically realistic deterministic diffusion-kinetic calculations examining the scavenging capacity dependences of the scavenged yield of e aq - and of OH demonstrate that the scavenged yields are related to the underlying time-dependent kinetics in the absence of the scavenger by a simple Laplace transform relationship. This relationship is also shown to link the effect of an e eq - scavenger on the formation of H 2 with the time dependence of H 2 production in the absence of the scavenger. The simple Laplace relationship does not work well when applied to H 2 O 2 formation in high-LET particle tracks even though such a relationship is valid with low-LET particles. It is found that while the secondary reaction of H 2 O 2 with e aq - can be neglected in low-LET particle radiolysis, it is of considerable significance in the tracks produced by high-LET particles. The increased importance of this reaction with increasing LET is the major reason for the failure of the Laplace relationship for H 2 O 2 . 55 refs., 9 figs., 2 tabs

  11. Synchronous parallel kinetic Monte Carlo for continuum diffusion-reaction systems

    International Nuclear Information System (INIS)

    Martinez, E.; Marian, J.; Kalos, M.H.; Perlado, J.M.

    2008-01-01

    A novel parallel kinetic Monte Carlo (kMC) algorithm formulated on the basis of perfect time synchronicity is presented. The algorithm is intended as a generalization of the standard n-fold kMC method, and is trivially implemented in parallel architectures. In its present form, the algorithm is not rigorous in the sense that boundary conflicts are ignored. We demonstrate, however, that, in their absence, or if they were correctly accounted for, our algorithm solves the same master equation as the serial method. We test the validity and parallel performance of the method by solving several pure diffusion problems (i.e. with no particle interactions) with known analytical solution. We also study diffusion-reaction systems with known asymptotic behavior and find that, for large systems with interaction radii smaller than the typical diffusion length, boundary conflicts are negligible and do not affect the global kinetic evolution, which is seen to agree with the expected analytical behavior. Our method is a controlled approximation in the sense that the error incurred by ignoring boundary conflicts can be quantified intrinsically, during the course of a simulation, and decreased arbitrarily (controlled) by modifying a few problem-dependent simulation parameters

  12. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  13. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  14. Effects of substrate anisotropy and edge diffusion on submonolayer growth during molecular beam epitaxy: A Kinetic Monte Carlo study

    International Nuclear Information System (INIS)

    Devkota, J.; Shrestha, S.P.

    2007-12-01

    We have performed Kinetic Monte Carlo simulation work to study the effect of diffusion anisotropy, bonding anisotropy and edge diffusion on island formation at different temperatures during the sub-monolayer film growth in Molecular Beam Epitaxy. We use simple cubic solid on solid model and event based Bortz, Kalos and Labowitch (BKL) algorithm on the Kinetic Monte Carlo method to simulate the physical phenomena. We have found that the island morphology and growth exponent are found to be influenced by substrate anisotropy as well as edge diffusion, however they do not play a significant role in island elongation. The growth exponent and island size distribution are observed to be influenced by substrate anisotropy but are negligibly influenced by edge diffusion. We have found fractal islands when edge diffusion is excluded and compact islands when edge diffusion is included. (author)

  15. Nonequilibrium transition and pattern formation in a linear reaction-diffusion system with self-regulated kinetics

    Science.gov (United States)

    Paul, Shibashis; Ghosh, Shyamolina; Ray, Deb Shankar

    2018-02-01

    We consider a reaction-diffusion system with linear, stochastic activator-inhibitor kinetics where the time evolution of concentration of a species at any spatial location depends on the relative average concentration of its neighbors. This self-regulating nature of kinetics brings in spatial correlation between the activator and the inhibitor. An interplay of this correlation in kinetics and disparity of diffusivities of the two species leads to symmetry breaking non-equilibrium transition resulting in stationary pattern formation. The role of initial noise strength and the linear reaction terms has been analyzed for pattern selection.

  16. Establishing the kinetics of ballistic-to-diffusive transition using directional statistics

    Science.gov (United States)

    Liu, Pai; Heinson, William R.; Sumlin, Benjamin J.; Shen, Kuan-Yu; Chakrabarty, Rajan K.

    2018-04-01

    We establish the kinetics of ballistic-to-diffusive (BD) transition observed in two-dimensional random walk using directional statistics. Directional correlation is parameterized using the walker's turning angle distribution, which follows the commonly adopted wrapped Cauchy distribution (WCD) function. During the BD transition, the concentration factor (ρ) governing the WCD shape is observed to decrease from its initial value. We next analytically derive the relationship between effective ρ and time, which essentially quantifies the BD transition rate. The prediction of our kinetic expression agrees well with the empirical datasets obtained from correlated random walk simulation. We further connect our formulation with the conventionally used scaling relationship between the walker's mean-square displacement and time.

  17. On the exact solution for the multi-group kinetic neutron diffusion equation in a rectangle

    International Nuclear Information System (INIS)

    Petersen, C.Z.; Vilhena, M.T.M.B. de; Bodmann, B.E.J.

    2011-01-01

    In this work we consider the two-group bi-dimensional kinetic neutron diffusion equation. The solution procedure formalism is general with respect to the number of energy groups, neutron precursor families and regions with different chemical compositions. The fast and thermal flux and the delayed neutron precursor yields are expanded in a truncated double series in terms of eigenfunctions that, upon insertion into the kinetic equation and upon taking moments, results in a first order linear differential matrix equation with source terms. We split the matrix appearing in the transformed problem into a sum of a diagonal matrix plus the matrix containing the remaining terms and recast the transformed problem into a form that can be solved in the spirit of Adomian's recursive decomposition formalism. Convergence of the solution is guaranteed by the Cardinal Interpolation Theorem. We give numerical simulations and comparisons with available results in the literature. (author)

  18. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  19. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  20. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  1. A first principles kinetic Monte Carlo investigation of the adsorption and mobility of gadolinium on the (100) surface of tungsten

    International Nuclear Information System (INIS)

    Samin, Adib J.; Zhang, Jinsuo

    2017-01-01

    An accurate characterization of lanthanide adsorption and mobility on tungsten surfaces is important for pyroprocessing. In the present study, the adsorption and diffusion of gadolinium on the (100) surface of tungsten was investigated. It was found that the hollow sites were the most energetically favorable for the adsorption. It was further observed that a magnetic moment was induced following the adsorption of gadolinium on the tungsten surface and that the system with adsorbed hollow sites had the largest magnetization. A pathway for the surface diffusion of gadolinium was determined to occur by hopping between the nearest neighbor hollow sites via the bridge site and the activation energy for the hop was calculated to be 0.75 eV. The surface diffusion process was further assessed using two distinct kinetic Monte Carlo models; one that accounted for lateral adsorbate interactions up to the second nearest neighbor and one that did not account for such interatomic interactions in the adlayer. When the lateral interactions were included in the simulations, the diffusivity was observed to have a strong dependence on coverage (for the coverage values being studied). The effects of lateral interactions were further observed in a one-dimensional simulation of the diffusion equation where the asymmetry in the surface coverage profile upon its approach to a steady state distribution was clear in comparison with the simulations which did not account for those interactions.

  2. A first principles kinetic Monte Carlo investigation of the adsorption and mobility of gadolinium on the (100) surface of tungsten

    Energy Technology Data Exchange (ETDEWEB)

    Samin, Adib J., E-mail: samin.2@osu.edu; Zhang, Jinsuo

    2017-05-15

    An accurate characterization of lanthanide adsorption and mobility on tungsten surfaces is important for pyroprocessing. In the present study, the adsorption and diffusion of gadolinium on the (100) surface of tungsten was investigated. It was found that the hollow sites were the most energetically favorable for the adsorption. It was further observed that a magnetic moment was induced following the adsorption of gadolinium on the tungsten surface and that the system with adsorbed hollow sites had the largest magnetization. A pathway for the surface diffusion of gadolinium was determined to occur by hopping between the nearest neighbor hollow sites via the bridge site and the activation energy for the hop was calculated to be 0.75 eV. The surface diffusion process was further assessed using two distinct kinetic Monte Carlo models; one that accounted for lateral adsorbate interactions up to the second nearest neighbor and one that did not account for such interatomic interactions in the adlayer. When the lateral interactions were included in the simulations, the diffusivity was observed to have a strong dependence on coverage (for the coverage values being studied). The effects of lateral interactions were further observed in a one-dimensional simulation of the diffusion equation where the asymmetry in the surface coverage profile upon its approach to a steady state distribution was clear in comparison with the simulations which did not account for those interactions.

  3. Diffusion influence on Michaelis Menten kinetics: II. The low substrate concentration limit

    Science.gov (United States)

    Kim, Hyojoon; Shin, Kook Joe

    2007-02-01

    The diffusion-influenced Michaelis-Menten kinetics in the low substrate concentration limit is studied in one and three dimensions. For the initial pair distribution of enzyme and substrate, we obtain the exact analytical results. We find that at short times the diffusion effect can make the reaction rate faster. The concentration deviations of the substrate and enzyme show t-1/2 and t-3/2 power-law behaviours in one and three dimensions, respectively, at long times. On the other hand, the average lifetime of the intermediate is independent of the initial state in one dimension, while it depends on the initial state in three dimensions. The ultimate production yield approaches unity in one dimension but it reaches a different value depending on other parameters in three dimensions. We also obtain the analytical results for the initial random distribution.

  4. Diffusion influence on Michaelis-Menten kinetics: II. The low substrate concentration limit

    International Nuclear Information System (INIS)

    Kim, Hyojoon; Shin, Kook Joe

    2007-01-01

    The diffusion-influenced Michaelis-Menten kinetics in the low substrate concentration limit is studied in one and three dimensions. For the initial pair distribution of enzyme and substrate, we obtain the exact analytical results. We find that at short times the diffusion effect can make the reaction rate faster. The concentration deviations of the substrate and enzyme show t -1/2 and t -3/2 power-law behaviours in one and three dimensions, respectively, at long times. On the other hand, the average lifetime of the intermediate is independent of the initial state in one dimension, while it depends on the initial state in three dimensions. The ultimate production yield approaches unity in one dimension but it reaches a different value depending on other parameters in three dimensions. We also obtain the analytical results for the initial random distribution

  5. High-Throughput Study of Diffusion and Phase Transformation Kinetics of Magnesium-Based Systems for Automotive Cast Magnesium Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Alan A [The Ohio State Univ., Columbus, OH (United States); Zhao, Ji-Cheng [The Ohio State Univ., Columbus, OH (United States); Riggi, Adrienne [National Energy Technology Lab. (NETL), Morgantown, WV (United States); Joost, William [US Dept. of Energy, Washington, DC (United States)

    2017-10-02

    The objective of the proposed study is to establish a scientific foundation on kinetic modeling of diffusion, phase precipitation, and casting/solidification, in order to accelerate the design and optimization of cast magnesium (Mg) alloys for weight reduction of U.S. automotive fleet. The team has performed the following tasks: 1) study diffusion kinetics of various Mg-containing binary systems using high-throughput diffusion multiples to establish reliable diffusivity and mobility databases for the Mg-aluminum (Al)-zinc (Zn)-tin (Sn)-calcium (Ca)-strontium (Sr)-manganese (Mn) systems; 2) study the precipitation kinetics (nucleation, growth and coarsening) using both innovative dual-anneal diffusion multiples and cast model alloys to provide large amounts of kinetic data (including interfacial energy) and microstructure atlases to enable implementation of the Kampmann-Wagner numerical model to simulate phase transformation kinetics of non-spherical/non-cuboidal precipitates in Mg alloys; 3) implement a micromodel to take into account back diffusion in the solid phase in order to predict microstructure and microsegregation in multicomponent Mg alloys during dendritic solidification especially under high pressure die-casting (HPDC) conditions; and, 4) widely disseminate the data, knowledge and information using the Materials Genome Initiative infrastructure (http://www.mgidata.org) as well as publications and digital data sharing to enable researchers to identify new pathways/routes to better cast Mg alloys.

  6. Lateral interactions and non-equilibrium in surface kinetics

    Science.gov (United States)

    Menzel, Dietrich

    2016-08-01

    Work modelling reactions between surface species frequently use Langmuir kinetics, assuming that the layer is in internal equilibrium, and that the chemical potential of adsorbates corresponds to that of an ideal gas. Coverage dependences of reacting species and of site blocking are usually treated with simple power law coverage dependences (linear in the simplest case), neglecting that lateral interactions are strong in adsorbate and co-adsorbate layers which may influence kinetics considerably. My research group has in the past investigated many co-adsorbate systems and simple reactions in them. We have collected a number of examples where strong deviations from simple coverage dependences exist, in blocking, promoting, and selecting reactions. Interactions can range from those between next neighbors to larger distances, and can be quite complex. In addition, internal equilibrium in the layer as well as equilibrium distributions over product degrees of freedom can be violated. The latter effect leads to non-equipartition of energy over molecular degrees of freedom (for products) or non-equal response to those of reactants. While such behavior can usually be described by dynamic or kinetic models, the deeper reasons require detailed theoretical analysis. Here, a selection of such cases is reviewed to exemplify these points.

  7. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  8. Kinetics of Isothermal Reactive Diffusion Between Solid Cu and Liquid Sn

    Science.gov (United States)

    O, M.; Suzuki, T.; Kajihara, M.

    2018-01-01

    The Cu/Sn system is one of the most fundamental and important metallic systems for solder joints in electric devices. To realize reliable solder joints, information on reactive diffusion at the solder joint is very important. In the present study, we experimentally investigated the kinetics of the reactive diffusion between solid Cu and liquid Sn using semi-infinite Cu/Sn diffusion couples prepared by an isothermal bonding technique. Isothermal annealing of the diffusion couple was conducted in the temperature range of 533-603 K for various times up to 172.8 ks (48 h). Using annealing, an intermetallic layer composed of Cu6Sn5 with scallop morphology and Cu3Sn with rather uniform thickness is formed at the original Cu/Sn interface in the diffusion couple. The growth of the Cu6Sn5 scallop occurs much more quickly than that of the Cu3Sn layer and thus predominates in the overall growth of the intermetallic layer. This tendency becomes more remarkable at lower annealing temperatures. The total thickness of the intermetallic layer is proportional to a power function of the annealing time, and the exponent of the power function is close to unity at all the annealing temperatures. This means that volume diffusion controls the intermetallic growth and the morphology of the Cu6Sn5/Sn interface influences the rate-controlling process. Adopting a mean value of 0.99 for the exponent, we obtain a value of 26 kJ/mol for the activation enthalpy of the intermetallic growth.

  9. Self-learning kinetic Monte Carlo simulations of Al diffusion in Mg

    International Nuclear Information System (INIS)

    Nandipati, Giridhar; Govind, Niranjan; Andersen, Amity; Rohatgi, Aashish

    2016-01-01

    Vacancy-mediated diffusion of an Al atom in the pure Mg matrix is studied using the atomistic, on-lattice self-learning kinetic Monte Carlo (SLKMC) method. Activation barriers for vacancy-Mg and vacancy-Al atom exchange processes are calculated on the fly using the climbing image nudged-elastic-band method and binary Mg–Al modified embedded-atom method interatomic potential. Diffusivities of an Al atom obtained from SLKMC simulations show the same behavior as observed in experimental and theoretical studies available in the literature; that is, an Al atom diffuses faster within the basal plane than along the c-axis. Although the effective activation barriers for an Al atom diffusion from SLKMC simulations are close to experimental and theoretical values, the effective prefactors are lower than those obtained from experiments. We present all the possible vacancy-Mg and vacancy-Al atom exchange processes and their activation barriers identified in SLKMC simulations. A simple mapping scheme to map an HCP lattice onto a simple cubic lattice is described, which enables simulation of the HCP lattice using the on-lattice framework. We also present the pattern recognition scheme which is used in SLKMC simulations to identify the local Al atom configuration around a vacancy. (paper)

  10. Drying kinetics of fermented grape pomace: Determination of moisture effective diffusivity

    Directory of Open Access Journals (Sweden)

    Kricelle M. Deamici

    Full Text Available ABSTRACT The aim of this study was to obtain the equilibrium moisture content of grape (variety ‘Tannat’ pomace through desorption isotherms, to evaluate the drying kinetics, determine the coefficient of effective diffusivity and physico-chemically characterize the grape pomace and the product obtained after drying. The desorption isotherms were determined at 50, 60 and 70 ºC and the experimental data were fitted using the GAB model (Gugghenheim, Anderson and de Boer. Drying was evaluated using a 22 factorial experimental design with three center points and effective diffusivity was obtained through the diffusion model of Fick’s second law. The grape pomace was characterized regarding the contents of moisture, protein, carbohydrates, lipids, ash and dietary crude fiber. The obtained isotherms showed sigmoid shape and the experimental data fitted well to the GAB model. The drying curves showed only a decreasing rate period. The effective diffusivity values were within the range for organic materials. Dry grape pomace showed high contents of protein and fiber and can be used in the development of new products, in order to increase the nutritional content and add value to this byproduct.

  11. Kinetics of conformational changes of fibronectin adsorbed onto model surfaces.

    Science.gov (United States)

    Baujard-Lamotte, L; Noinville, S; Goubard, F; Marque, P; Pauthe, E

    2008-05-01

    Fibronectin (FN), a large glycoprotein found in body fluids and in the extracellular matrix, plays a key role in numerous cellular behaviours. We investigate FN adsorption onto hydrophilic bare silica and hydrophobic polystyrene (PS) surfaces using Fourier transform infrared spectroscopy-attenuated total reflection (FTIR-ATR) in aqueous medium. Adsorption kinetics using different bulk concentrations of FN were followed for 2h and the surface density of adsorbed FN and its time-dependent conformational changes were determined. When adsorption occurs onto the hydrophilic surface, FN molecules keep their native conformation independent of the adsorption conditions, but the amount of adsorbed FN increases with time and the bulk concentration. Although the protein surface density is the same on the hydrophobic PS surface, this has a strong impact on the average conformation of the adsorbed FN layer. Indeed, interfacial hydration changes induced by adsorption onto the hydrophobic surface lead to a decrease in unhydrated beta-sheet content and cause an increase in hydrated beta-strand and hydrated random domain content of adsorbed FN. This conformational change is mainly dependent on the bulk concentration. Indeed, at low bulk concentrations, the secondary structures of adsorbed FN molecules undergo strong unfolding, allowing an extended and hydrated conformation of the protein. At high bulk concentrations, the molecular packing reduces the unfolding of the stereoregular structures of the FN molecules, preventing stronger spreading of the protein.

  12. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  13. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  14. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  15. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  16. MODELLING OF THIN LAYER SOLAR DRYING KINETICS AND EFFECTIVE DIFFUSIVITY OF Urtica dioica LEAVES

    Directory of Open Access Journals (Sweden)

    A. LAMHARRAR

    2017-08-01

    Full Text Available Urtica dioica is an endemic plant of Morocco used for its virtues in traditional medicine. The drying kinetics of Urtica dioica leaves in a convective solar dryer was studied. The kinetics of drying is studied for three temperatures (40, 50 and 60 °C, ambient air temperature ranged from 30 to 35 °C. The experimental results are used to determine the characteristic drying curve. Nine mathematical models have been used for the description of the drying curve. The Midilli-Kuck model was found to be the most suitable for describing the drying curves of Urtica dioica leaves. The drying parameters in this model were quantified as a function of the drying air temperature. Moisture transfer from Urtica dioica leaves was described by applying the Fick’s diffusion model. Effective moisture diffusivity of the product was in the range of 9.38 – 72.92×10-11 m2/s. A value of 88,49 kJ/mol was determined as activation energy.

  17. Quantitative modeling of the reaction/diffusion kinetics of two-chemistry photopolymers

    Science.gov (United States)

    Kowalski, Benjamin Andrew

    Optically driven diffusion in photopolymers is an appealing material platform for a broad range of applications, in which the recorded refractive index patterns serve either as images (e.g. data storage, display holography) or as optical elements (e.g. custom GRIN components, integrated optical devices). A quantitative understanding of the reaction/diffusion kinetics is difficult to obtain directly, but is nevertheless necessary in order to fully exploit the wide array of design freedoms in these materials. A general strategy for characterizing these kinetics is proposed, in which key processes are decoupled and independently measured. This strategy enables prediction of a material's potential refractive index change, solely on the basis of its chemical components. The degree to which a material does not reach this potential reveals the fraction of monomer that has participated in unwanted reactions, reducing spatial resolution and dynamic range. This approach is demonstrated for a model material similar to commercial media, achieving quantitative predictions of index response over three orders of exposure dose (~1 to ~103 mJ cm-2) and three orders of feature size (0.35 to 500 microns). The resulting insights enable guided, rational design of new material formulations with demonstrated performance improvement.

  18. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  19. Kinetic model for hydroxyapatite precipitation on human enamel surface by electrolytic deposition

    International Nuclear Information System (INIS)

    Lei Caixia; Liao Yingmin; Feng Zude

    2009-01-01

    The electrolytic deposition (ELD) of hydroxyapatite (HAP) coating on human enamel surface for different loading times at varied temperatures (ranging from 37 deg. C to 85 deg. C) and varied current densities (ranging from 0.05 mA cm -2 to 10 mA cm -2 ) was investigated in this study. Thin film x-ray diffraction, Fourier transform infrared and micro-Raman spectra analysis, as well as an environmental scanning electron microscope, were used to characterize the coating. The results showed that only the HAP phase occurred on the enamel surface after ELD experiments. The contents of HAP deposits on the enamel surface linearly changed proportional to the square root of the loading time, which was in good agreement with the kinetic model of ELD of HAP coating based on one-dimensional diffusion. The induction periods were observed on all the regression lines, and the rate of the HAP coating formation on enamel showed a linear relationship with the current density. It was implied that the diffusion process was the rate-determining step in the ELD of the HAP coating on human enamel.

  20. Kinetic model for hydroxyapatite precipitation on human enamel surface by electrolytic deposition

    Energy Technology Data Exchange (ETDEWEB)

    Lei Caixia; Liao Yingmin; Feng Zude, E-mail: zdfeng@xmu.edu.c [College of Materials, Xiamen University, Xiamen 361005 (China)

    2009-06-15

    The electrolytic deposition (ELD) of hydroxyapatite (HAP) coating on human enamel surface for different loading times at varied temperatures (ranging from 37 deg. C to 85 deg. C) and varied current densities (ranging from 0.05 mA cm{sup -2} to 10 mA cm{sup -2}) was investigated in this study. Thin film x-ray diffraction, Fourier transform infrared and micro-Raman spectra analysis, as well as an environmental scanning electron microscope, were used to characterize the coating. The results showed that only the HAP phase occurred on the enamel surface after ELD experiments. The contents of HAP deposits on the enamel surface linearly changed proportional to the square root of the loading time, which was in good agreement with the kinetic model of ELD of HAP coating based on one-dimensional diffusion. The induction periods were observed on all the regression lines, and the rate of the HAP coating formation on enamel showed a linear relationship with the current density. It was implied that the diffusion process was the rate-determining step in the ELD of the HAP coating on human enamel.

  1. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  2. Kinetic Monte Carlo Study of Ambipolar Lithium Ion and Electron-Polaron Diffusion into Nanostructured TiO2

    International Nuclear Information System (INIS)

    Yu, Jianguo; Sushko, Maria L.; Kerisit, Sebastien N.; Rosso, Kevin M.; Liu, Jun

    2012-01-01

    Nanostructured titania (TiO2) polymorphs have proved to be promising electrode materials for next generation lithium-ion batteries. However, there is still a lack of understanding of the fundamental microscopic processes that control charge transport in these materials. Here we present microscopic simulations of the collective dynamics of lithium-ion (Li+) and charge compensating electron polarons (e-) in rutile TiO2 nanoparticles in contact with idealized conductive matrix and electrolyte. Kinetic Monte Carlo simulations are used, parameterized by molecular dynamics-based predictions of activation energy barriers for Li+ and e- diffusion. Simulations reveal the central role of electrostatic coupling between Li+ and e- on their collective drift diffusion at the nanoscale. They also demonstrate that high contact area between conductive matrix and rutile nanoparticles leads to undesirable coupling-induced surface saturation effects during Li+ insertion, which limits the overall capacity and conductivity of the material. These results help provide guidelines for design of nanostructured electrode materials with improved electrochemical performance.

  3. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  4. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  5. Kinetic and mechanism studies of the adsorption of lead onto waste cow bone powder (WCBP) surfaces.

    Science.gov (United States)

    Cha, Jihoon; Cui, Mingcan; Jang, Min; Cho, Sang-Hyun; Moon, Deok Hyun; Khim, Jeehyeong

    2011-01-01

    This study examines the adsorption isotherms, kinetics and mechanisms of Pb²(+) sorption onto waste cow bone powder (WCBP) surfaces. The concentrations of Pb²(+) in the study range from 10 to 90 mg/L. Although the sorption data follow the Langmuir and Freundlich isotherm, a detailed examination reveals that surface sorption or complexation and co-precipitation are the most important mechanisms, along with possibly ion exchange and solid diffusion also contributing to the overall sorption process. The co-precipitation of Pb²(+) with the calcium hydroxyapatite (Ca-HAP) is implied by significant changes in Ca²(+) and PO₄³⁻ concentrations during the metal sorption processes. The Pb²(+) sorption onto the WCBP surface by metal complexation with surface functional groups such as ≡ POH. The major metal surface species are likely to be ≡ POPb(+). The sorption isotherm results indicated that Pb²(+) sorption onto the Langmuir and Freundlich constant q(max) and K( F ) is 9.52 and 8.18 mg g⁻¹, respectively. Sorption kinetics results indicated that Pb²(+) sorption onto WCBP was pseudo-second-order rate constants K₂ was 1.12 g mg⁻¹ h⁻¹. The main mechanism is adsorption or surface complexation (≡POPb(+): 61.6%), co-precipitation or ion exchange [Ca₃(.)₉₃ Pb₁(.)₀₇ (PO₄)₃ (OH): 21.4%] and other precipitation [Pb 50 mg L⁻¹ and natural pH: 17%). Sorption isotherms showed that WCBP has a much higher Pb²(+) removal rate in an aqueous solution; the greater capability of WCBP to remove aqueous Pb²(+) indicates its potential as another promising way to remediate Pb²(+)-contaminated media.

  6. CINESP - computational program of spatial kinetics for nuclear reactors in the one-two dimension multigroup diffusion theory

    International Nuclear Information System (INIS)

    Santos, R.S. dos

    1993-01-01

    This paper presents a computational program to solve numerically the reactor kinetics equations in the multigroup diffusion theory. One or two-dimensional problems in cylindrical or Cartesian geometries, with any number of energy and delayed-neutron precursors groups are dealt with. The main input and output of the program are briefly discussed. Various results demonstrate the accuracy and versatility of the program, when compared with other kinetics programs. (author)

  7. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  8. The diffusion of a Ga atom on GaAs(001)β2(2 × 4): Local superbasin kinetic Monte Carlo

    Science.gov (United States)

    Lin, Yangzheng; Fichthorn, Kristen A.

    2017-10-01

    We use first-principles density-functional theory to characterize the binding sites and diffusion mechanisms for a Ga adatom on the GaAs(001)β 2(2 × 4) surface. Diffusion in this system is a complex process involving eleven unique binding sites and sixteen different hops between neighboring binding sites. Among the binding sites, we can identify four different superbasins such that the motion between binding sites within a superbasin is much faster than hops exiting the superbasin. To describe diffusion, we use a recently developed local superbasin kinetic Monte Carlo (LSKMC) method, which accelerates a conventional kinetic Monte Carlo (KMC) simulation by describing the superbasins as absorbing Markov chains. We find that LSKMC is up to 4300 times faster than KMC for the conditions probed in this study. We characterize the distribution of exit times from the superbasins and find that these are sometimes, but not always, exponential and we characterize the conditions under which the superbasin exit-time distribution should be exponential. We demonstrate that LSKMC simulations assuming an exponential superbasin exit-time distribution yield the same diffusion coefficients as conventional KMC.

  9. Adsorption Kinetics and intra particulate diffusivities of Hg, As and Pb ions on unmodified and thiolated coconut fiber

    International Nuclear Information System (INIS)

    Igwe, J. C.; Abia, A. A.; Ibeh, C. A.

    2008-01-01

    As, Hg and Pb are examples of heavy metals which are present in different types of industrial effluents responsible for environmental pollution. Their removal is traditionally made by chemical precipitation, ion-exchange and so on. However, this is expensive and not completely feasible to reduce their concentrations to the levels as low as required by the environmental legislation. Bio sorption is a process in which solids of natural origin are employed for binding the heavy metal. It is a promising alternative method to treat industrial effluents, mainly because of its low cost and high metal binding capacity. The kinetics was studied for bio sorption experiments using coconut fiber for As (III), Hg (II) and Pb (II) ions adsorption. The specific surface area and surface charge density of the coconut fiber are 1.186x10 25 (m 2 /g) and 5.39 xI0 24 (meq/m 2 ), respectively. The maximum adsorption capacity was found to be the highest for Pb (II) followed by Hg (II) and As (Ill). The modification of the adsorbent by thiolation affected the adsorption capacity. Equilibrium sorption was reached for the metal ions at about 60 min. The equilibrium constant and free energy of the adsorption at 30 degree were calculated. The mechanism of sorption was found to obey the particle-diffusion model. The kinetic studies showed that the sorption rates could be described by both pseudo first-order and pseudo second-order models. The pseudo second-order model showed a better fit with a rate constant value of 1.16x10 -4 /min. for all three metal ions.Therefore, the results of this study show that coconut fiber, both modified and unmodified, is an efficient adsorbent for the removal of toxic and valuable metals from industrial effluents

  10. Effective moisture diffusivity, moisture sorption, thermo-physical properties and infrared drying kinetics of germinated paddy

    Directory of Open Access Journals (Sweden)

    Supawan Tirawanichakul

    2014-02-01

    Full Text Available Temperature and relative humidity (RH dependence of moisture sorption phenomena for agricultural products provide valuable information related to the thermodynamics of the system. So the equilibrium moisture contents (EMC, effective moisture diffusivity (Deff and thermo-physical properties in terms of void fraction, specific heat capacity, and the apparent density of germinated non-waxy Suphanburi 1 paddy were evaluated. Five commonly cited EMC equations were fitted to the experimental data among temperatures of 40-60°C correlating with RH of 0-90%. The results showed that the modified GAB equation was the best function for describing experimental results while those evaluated thermo-physical properties depended on moisture content. To determine drying kinetics model, the simulated values using Midilli et al. (2002 model and Page’s model was the best fitting to exact drying kinetics values for infrared (IR and hot air (HA drying, respectively. Finally, the Deff value of paddy dried with IR and HA sources were also evaluated and the calculated Deff value of both HA and IR drying was in order of 10-9 m2/s.

  11. Evaluation of energy collapsing effect on reactor kinetics parameters by diffusion theory

    International Nuclear Information System (INIS)

    Unesaki, Hironobu

    1989-01-01

    Reactor kinetics parameters play an important role as scaling factors between observed and calculated reactivities in the analysis of reactor physics experiments. In this report, energy collapsing errors in two kinetic parameters, the effective delayed neutron fraction and the neutron life time, are investigated by means of the diffusion theory. Coarse group calculations are made for various energy group structures. Cores of various moderator-to-fuel volume ratios are selected to investigate the influence of neutron spectrum changes on the energy collapsing error. The energy collapsing errors in the effective delayed neutron fraction and neutron life time are much larger than those in k eff . This might be because the former two parameters are functions of both the foward and adjoint flux, whereas the latter is a function of the forward flux alone. The use of coarse constants will cause errors in both fluxes, and the resulting errors in the former will be much more emphasized. As the effective delayed neutron fraction is sensitive to the treatment of an energy region in the vicinity of the fission spectrum peak, the coarse group error in it might differ between cores with different enrichment and composition. Inaccurate weighting of group constants leads to neutron spectra which do not conserve the fine group spectra, and those errors will be emphasized in calculated integral parameters. (N.K.)

  12. Atomistic Kinetic Monte Carlo studies of microchemical evolutions driven by diffusion processes under irradiation

    Science.gov (United States)

    Soisson, F.; Becquart, C. S.; Castin, N.; Domain, C.; Malerba, L.; Vincent, E.

    2010-11-01

    Atomistic Kinetic Monte Carlo (AKMC) simulations are a powerful tool to study the microstructural and microchemical evolution of alloys controlled by diffusion processes, under irradiation and during thermal ageing. In the framework of the FP6 Perfect program, two main approaches have been applied to binary and multicomponent iron based alloys. The first one is based on a diffusion model which takes into account vacancy and self-interstitial jumps, using simple rigid lattice approximation and broken-bond models to compute the point-defect jump frequencies. The corresponding parameters are fitted on ab initio calculations of a few typical configurations and migration barriers. The second method uses empirical potentials to compute a much larger number of migration barriers, including atomic relaxations, and Artificial Intelligence regression methods to predict the other ones. It is somewhat less rapid than the first one, but significantly more than simulations using "on-the-fly" calculations of all the barriers. We review here the recent advances and perspectives concerning these techniques.

  13. Atomistic Kinetic Monte Carlo studies of microchemical evolutions driven by diffusion processes under irradiation

    International Nuclear Information System (INIS)

    Soisson, F.; Becquart, C.S.; Castin, N.; Domain, C.; Malerba, L.; Vincent, E.

    2010-01-01

    Atomistic Kinetic Monte Carlo (AKMC) simulations are a powerful tool to study the microstructural and microchemical evolution of alloys controlled by diffusion processes, under irradiation and during thermal ageing. In the framework of the FP6 Perfect program, two main approaches have been applied to binary and multicomponent iron based alloys. The first one is based on a diffusion model which takes into account vacancy and self-interstitial jumps, using simple rigid lattice approximation and broken-bond models to compute the point-defect jump frequencies. The corresponding parameters are fitted on ab initio calculations of a few typical configurations and migration barriers. The second method uses empirical potentials to compute a much larger number of migration barriers, including atomic relaxations, and Artificial Intelligence regression methods to predict the other ones. It is somewhat less rapid than the first one, but significantly more than simulations using 'on-the-fly' calculations of all the barriers. We review here the recent advances and perspectives concerning these techniques.

  14. Nitric oxide kinetics in the afterglow of a diffuse plasma filament

    International Nuclear Information System (INIS)

    Burnette, D; Montello, A; Adamovich, I V; Lempert, W R

    2014-01-01

    A suite of laser diagnostics is used to study kinetics of vibrational energy transfer and plasma chemical reactions in a nanosecond pulse, diffuse filament electric discharge and afterglow in N 2 and dry air at 100 Torr. Laser-induced fluorescence of NO and two-photon absorption laser-induced fluorescence of O and N atoms are used to measure absolute, time-resolved number densities of these species after the discharge pulse, and picosecond coherent anti-Stokes Raman spectroscopy is used to measure time-resolved rotational temperature and ground electronic state N 2 (v = 0–4) vibrational level populations. The plasma filament diameter, determined from plasma emission and NO planar laser-induced fluorescence images, remains nearly constant after the discharge pulse, over a few hundred microseconds, and does not exhibit expansion on microsecond time scale. Peak temperature in the discharge and the afterglow is low, T ≈ 370 K, in spite of significant vibrational nonequilibrium, with peak N 2 vibrational temperature of T v  ≈ 2000 K. Significant vibrational temperature rise in the afterglow is likely caused by the downward N 2 –N 2 vibration–vibration (V–V) energy transfer. Simple kinetic modeling of time-resolved N, O, and NO number densities in the afterglow, on the time scale longer compared to relaxation and quenching time of excited species generated in the plasma, is in good agreement with the data. In nitrogen, the N atom density after the discharge pulse is controlled by three-body recombination and radial diffusion. In air, N, NO and O concentrations are dominated by the reverse Zel'dovich reaction, N + NO → N 2  + O, and ozone formation reaction, O + O 2  + M → O 3  + M, respectively. The effect of vibrationally excited nitrogen molecules and excited N atoms on NO formation kinetics is estimated to be negligible. The results suggest that NO formation in the nanosecond pulse discharge is dominated by reactions of

  15. Nitric oxide kinetics in the afterglow of a diffuse plasma filament

    Science.gov (United States)

    Burnette, D.; Montello, A.; Adamovich, I. V.; Lempert, W. R.

    2014-08-01

    A suite of laser diagnostics is used to study kinetics of vibrational energy transfer and plasma chemical reactions in a nanosecond pulse, diffuse filament electric discharge and afterglow in N2 and dry air at 100 Torr. Laser-induced fluorescence of NO and two-photon absorption laser-induced fluorescence of O and N atoms are used to measure absolute, time-resolved number densities of these species after the discharge pulse, and picosecond coherent anti-Stokes Raman spectroscopy is used to measure time-resolved rotational temperature and ground electronic state N2(v = 0-4) vibrational level populations. The plasma filament diameter, determined from plasma emission and NO planar laser-induced fluorescence images, remains nearly constant after the discharge pulse, over a few hundred microseconds, and does not exhibit expansion on microsecond time scale. Peak temperature in the discharge and the afterglow is low, T ≈ 370 K, in spite of significant vibrational nonequilibrium, with peak N2 vibrational temperature of Tv ≈ 2000 K. Significant vibrational temperature rise in the afterglow is likely caused by the downward N2-N2 vibration-vibration (V-V) energy transfer. Simple kinetic modeling of time-resolved N, O, and NO number densities in the afterglow, on the time scale longer compared to relaxation and quenching time of excited species generated in the plasma, is in good agreement with the data. In nitrogen, the N atom density after the discharge pulse is controlled by three-body recombination and radial diffusion. In air, N, NO and O concentrations are dominated by the reverse Zel'dovich reaction, N + NO → N2 + O, and ozone formation reaction, O + O2 + M → O3 + M, respectively. The effect of vibrationally excited nitrogen molecules and excited N atoms on NO formation kinetics is estimated to be negligible. The results suggest that NO formation in the nanosecond pulse discharge is dominated by reactions of excited electronic states of nitrogen, occurring on

  16. Effects of airway surface liquid height on the kinetics of extracellular nucleotides in airway epithelia.

    Science.gov (United States)

    Amarante, Tauanne D; da Silva, Jafferson K L; Garcia, Guilherme J M

    2014-12-21

    Experimental techniques aimed at measuring the concentration of signaling molecules in the airway surface liquid (ASL) often require an unrealistically large ASL volume to facilitate sampling. This experimental limitation, prompted by the difficulty of pipetting liquid from a very shallow layer (~15 μm), leads to dilution and the under-prediction of physiologic concentrations of signaling molecules that are vital to the regulation of mucociliary clearance. Here, we use a computational model to describe the effect of liquid height on the kinetics of extracellular nucleotides in the airway surface liquid coating respiratory epithelia. The model consists of a reaction-diffusion equation with boundary conditions that represent the enzymatic reactions occurring on the epithelial surface. The simulations reproduce successfully the kinetics of extracellular ATP following hypotonic challenge for ASL volumes ranging from 25 μl to 500 μl in a 12-mm diameter cell culture. The model reveals that [ATP] and [ADO] reach 1200 nM and 2200 nM at the epithelial surface, respectively, while their volumetric averages remain less than 200 nM at all times in experiments with a large ASL volume (500 μl). These findings imply that activation of P2Y2 and A2B receptors is robust after hypotonic challenge, in contrast to what could be concluded based on experimental measurements of volumetric concentrations in large ASL volumes. Finally, given the central role that ATP and ADO play in regulating mucociliary clearance, we investigated which enzymes, when inhibited, provide the greatest increase in ATP and ADO concentrations. Our findings suggest that inhibition of NTPDase1/highTNAP would cause the greatest increase in [ATP] after hypotonic challenge, while inhibition of the transporter CNT3 would provide the greatest increase in [ADO]. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  18. Diffusion kinetics of the glucose/glucose oxidase system in swift heavy ion track-based biosensors

    Science.gov (United States)

    Fink, Dietmar; Vacik, Jiri; Hnatowicz, V.; Muñoz Hernandez, G.; Garcia Arrelano, H.; Alfonta, Lital; Kiv, Arik

    2017-05-01

    For understanding of the diffusion kinetics and their optimization in swift heavy ion track-based biosensors, recently a diffusion simulation was performed. This simulation aimed at yielding the degree of enrichment of the enzymatic reaction products in the highly confined space of the etched ion tracks. A bunch of curves was obtained for the description of such sensors that depend only on the ratio of the diffusion coefficient of the products to that of the analyte within the tracks. As hitherto none of these two diffusion coefficients is accurately known, the present work was undertaken. The results of this paper allow one to quantify the previous simulation and hence yield realistic predictions of glucose-based biosensors. At this occasion, also the influence of the etched track radius on the diffusion coefficients was measured and compared with earlier prediction.

  19. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  20. Surface-Coating Regulated Lithiation Kinetics and Degradation in Silicon Nanowires for Lithium Ion Battery

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Langli; Yang, Hui; Yan, Pengfei; Travis, Jonathan J.; Lee, Younghee; Liu, Nian; Piper, Daniela M.; Lee, Se-Hee; Zhao, Peng; George, Steven M.; Zhang, Jiguang; Cui, Yi; Zhang, Sulin; Ban, Chunmei; Wang, Chong M.

    2015-05-26

    Silicon (Si)-based materials hold promise as the next-generation anodes for high-energy lithium (Li)-ion batteries. Enormous research efforts have been undertaken to mitigate the chemo-mechanical failure due to the large volume changes of Si during lithiation and delithiation cycles. It has been found nanostructured Si coated with carbon or other functional materials can lead to significantly improved cyclability. However, the underlying mechanism and comparative performance of different coatings remain poorly understood. Herein, using in situ transmission electron microscopy (TEM) through a nanoscale half-cell battery, in combination with chemo-mechanical simulation, we explored the effect of thin (~5 nm) alucone and Al2O3 coatings on the lithiation kinetics of Si nanowires (SiNWs). We observed that the alucone coating leads to a “V-shaped” lithiation front of the SiNWs , while the Al2O3 coating yields an “H-shaped” lithiation front. These observations indicate that the difference between the Li surface diffusivity and bulk diffusivity of the coatings dictates lithiation induced morphological evolution in the nanowires. Our experiments also indicate that the reaction rate in the coating layer can be the limiting step for lithiation and therefore critically influences the rate performance of the battery. Further, the failure mechanism of the Al2O3 coated SiNWs was also explored. Our studies shed light on the design of high capacity, high rate and long cycle life Li-ion batteries.

  1. Numerical nodal simulation of the axial power distribution within nuclear reactors using a kinetics diffusion model. I

    International Nuclear Information System (INIS)

    Barros, R.C. de.

    1992-05-01

    Presented here is a new numerical nodal method for the simulation of the axial power distribution within nuclear reactors using the one-dimensional one speed kinetics diffusion model with one group of delayed neutron precursors. Our method is based on a spectral analysis of the nodal kinetics equations. These equations are obtained by integrating the original kinetics equations separately over a time step and over a spatial node, and then considering flat approximations for the forward difference terms. These flat approximations are the only approximations that are considered in the method. As a result, the spectral nodal method for space - time reactor kinetics generates numerical solutions for space independent problems or for time independent problems that are completely free from truncation errors. We show numerical results to illustrate the method's accuracy for coarse mesh calculations. (author)

  2. Lithium-ions diffusion kinetic in LiFePO4/carbon nanoparticles synthesized by microwave plasma chemical vapor deposition for lithium-ion batteries

    Science.gov (United States)

    Gao, Chao; Zhou, Jian; Liu, Guizhen; Wang, Lin

    2018-03-01

    Olivine structure LiFePO4/carbon nanoparticles are synthesized successfully using a microwave plasma chemical vapor deposition (MPCVD) method. Microwave is an effective method to synthesize nanomaterials, the LiFePO4/carbon nanoparticles with high crystallinity can shorten diffusion routes for ionic transfer and electron tunneling. Meanwhile, a high quality, complete and homogenous carbon layer with appropriate thickness coating on the surface of LiFePO4 particles during in situ chemical vapor deposition process, which can ensure that electrons are able to transfer fast enough from all sides. Electrochemical impedance spectroscopy (EIS) is carried out to collect information about the kinetic behavior of lithium diffusion in LiFePO4/carbon nanoparticles during the charging and discharging processes. The chemical diffusion coefficients of lithium ions, DLi, are calculated in the range of 10-15-10-9 cm2s-1. Nanoscale LiFePO4/carbon particles show the longer regions of the faster solid-solution diffusion, and corresponding to the narrower region of the slower two-phase diffusion during the insertion/exaction of lithium ions. The CV and galvanostatic charge-discharge measurements show that the LiFePO4/carbon nanoparticles perform an excellent electrochemical performance, especially the high rate capacity and cycle life.

  3. Surface defect chemistry and oxygen exchange kinetics in La2-xCaxNiO4+δ

    Science.gov (United States)

    Tropin, E. S.; Ananyev, M. V.; Farlenkov, A. S.; Khodimchuk, A. V.; Berenov, A. V.; Fetisov, A. V.; Eremin, V. A.; Kolchugin, A. A.

    2018-06-01

    Surface oxygen exchange kinetics and diffusion in La2-xCaxNiO4+δ (x = 0; 0.1; 0.3) have been studied by the isotope exchange method with gas phase equilibration in the temperature range of 600-800 °C and oxygen pressure range 0.13-2.5 kPa. Despite an enhanced electrical conductivity of La2-xCaxNiO4+δ theirs oxygen surface exchange (k*) and oxygen tracer diffusion (D*) coefficients were significantly lower in comparison with La2NiO4+δ. The rates of the elementary stages of oxygen exchange have been calculated. Upon Ca doping the change of the rate-determining stage was observed. The surface of the oxides was found to be inhomogeneous towards oxygen exchange process according to the recently developed model. The reasons of such inhomogeneity are discussed as well as Ca influence on the surface defect chemistry and oxygen surface exchange and diffusivity.

  4. Modeling and simulation of spin-polarized transport at the kinetic and diffusive level

    International Nuclear Information System (INIS)

    Possanner, S.

    2012-01-01

    The aim of this thesis is to contribute to the understanding of spin-induced phenomena in electron motion. These phenomena arise when electrons move through a (partially) magnetic environment, in such a way that its magnetic moment (spin) may interact with the surroundings. The pure quantum nature of the spin requires transport models that deal with effects like quantum coherence, entanglement (correlation) and quantum dissipation. On the meso- and macroscopic level it is not yet clear under which circumstances these quantum effects may transpire. The purpose of this work is, on the one hand, to derive novel spin transport models from basic principles and, on the other hand, to develop numerical algorithms that allow for a solution of these new and other existing model equations. The thesis consists of four parts. The first part comprises an overview of fundamental spin-related concepts in electronic transport such as the giant-magneto-resistance (GMR) effect, the spin-transfer torque in metallic magnetic multilayers and the matrix-character of transport equations that take spin-coherent electron states into account. In particular, we consider the diffusive Zhang-Levy-Fert (ZLF) model, an exchange-torque model that consists of the Landau-Lifshitz equation and a heuristic matrix spin-diffusion equation. A finite difference scheme based on Strang operator splitting is developed that enables a numerical, self-consistent solution of this non-linear system within multilayer structures. Finally, the model is tested by comparison of numerical results to recent experimental data. In part two we propose a matrix-Boltzmann equation that allows for the description of spin-coherent electron transport on a kinetic level. The novelty here is a linear collision operator in which the transition rates from momentum k to momentum k' are modeled by a 2x2 Hermitian matrix; hence the mean-free paths of spin-up and spin-down electrons are represented by the eigenvalues of this

  5. A combined kinetic and diffusion model for pyrite oxidation in tailings - a change in controls with time

    International Nuclear Information System (INIS)

    Elberling, B.; Nicholson, R.V.; Scharer, J.M.

    1994-01-01

    Acidic drainage from the oxidation of mine tailing wastes is an important environmental problem. The purpose of this paper is to develop a model (1) to simulate the rate of oxidation of pyrite over time, (2) to verify the importance of chemical kinetic control and diffusion control on the oxidation rate with time and, (3) to evaluate the sensitivity of the model to critical parameters of the tailings, such as grain size, pyrite content and the effective diffusion coefficient. The source code comprises four main modules including parameter allocation (kinetics, transport), sulphide oxidation (shrinking particle), oxygen transport and pyrite mass balance. The results show that high oxidation rates are observed in the initial time after tailings deposition. During this initial period of high rates, an apparent shift occurs from kinetic to diffusional control over a period of time that depends on the composition and properties of the tailings. Based on the simulation results, it is evident that the overall rate of oxidation after a few years will be controlled dominantly by the diffusion of oxygen rather than by biological or non-biological kinetics in the tailings

  6. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  7. DISPL-1, 2. Order Nonlinear Partial Differential Equation System Solution for Kinetics Diffusion Problems

    International Nuclear Information System (INIS)

    Leaf, G.K.; Minkoff, M.

    1982-01-01

    1 - Description of problem or function: DISPL1 is a software package for solving second-order nonlinear systems of partial differential equations including parabolic, elliptic, hyperbolic, and some mixed types. The package is designed primarily for chemical kinetics- diffusion problems, although not limited to these problems. Fairly general nonlinear boundary conditions are allowed as well as inter- face conditions for problems in an inhomogeneous medium. The spatial domain is one- or two-dimensional with rectangular Cartesian, cylindrical, or spherical (in one dimension only) geometry. 2 - Method of solution: The numerical method is based on the use of Galerkin's procedure combined with the use of B-Splines (C.W.R. de-Boor's B-spline package) to generate a system of ordinary differential equations. These equations are solved by a sophisticated ODE software package which is a modified version of Hindmarsh's GEAR package, NESC Abstract 592. 3 - Restrictions on the complexity of the problem: The spatial domain must be rectangular with sides parallel to the coordinate geometry. Cross derivative terms are not permitted in the PDE. The order of the B-Splines is at most 12. Other parameters such as the number of mesh points in each coordinate direction, the number of PDE's etc. are set in a macro table used by the MORTRAn2 preprocessor in generating the object code

  8. TASK, 1-D Multigroup Diffusion or Transport Theory Reactor Kinetics with Delayed Neutron

    International Nuclear Information System (INIS)

    Buhl, A.R.; Hermann, O.W.; Hinton, R.J.; Dodds, H.L. Jr.; Robinson, J.C.; Lillie, R.A.

    1975-01-01

    1 - Description of problem or function: TASK solves the one-dimensional multigroup form of the reactor kinetics equations, using either transport or diffusion theory and allowing an arbitrary number of delayed neutron groups. The program can also be used to solve standard static problems efficiently such as eigenvalue problems, distributed source problems, and boundary source problems. Convergence problems associated with sources in highly multiplicative media are circumvented, and such problems are readily calculable. 2 - Method of solution: TASK employs a combination scattering and transfer matrix method to eliminate certain difficulties that arise in classical finite difference approximations. As such, within-group (inner) iterations are eliminated and solution convergence is independent of spatial mesh size. The time variable is removed by Laplace transformation. (A later version will permit direct time solutions.) The code can be run either in an outer iteration mode or in closed (non-iterative) form. The running mode is dictated by the number of groups times the number of angles, consistent with available storage. 3 - Restrictions on the complexity of the problem: The principal restrictions are available storage and computation time. Since the code is flexibly-dimensioned and has an outer iteration option there are no internal restrictions on group structure, quadrature, and number of ordinates. The flexible-dimensioning scheme allows optional use of core storage. The generalized cylindrical geometry option is not complete in Version I of the code. The feedback options and omega-mode search options are not included in Version I

  9. Determination of effective moisture diffusivity and drying kinetics for poplar sawdust by thermogravimetric analysis under isothermal condition.

    Science.gov (United States)

    Chen, Dengyu; Zheng, Yan; Zhu, Xifeng

    2012-03-01

    The current study presents a thermogravimetric method to determine the effective moisture diffusivity and drying kinetics of biomass. Drying experiments on poplar sawdust were performed at four temperatures (60, 70, 80, and 90°C) by a thermogravimetric analyzer (TGA). The major assumption in experimentally determining effective diffusivity by Fick's diffusion equation is that drying is mass transfer limited and temperature remains isothermal during drying. The results indicated that TGA could well achieve these determining conditions. The drying process of sawdust mostly took place in the falling rate period. Midilli-Kucuk model showed the best fit for all experimental data. The effective diffusivity values changed from 9.38 × 10(-10)m(2)/s to 1.38 × 10(-9)m(2)/s within the given temperature range, and the activation energy was calculated to be 12.3 kJ/mol. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Nucleation and growth kinetics of electrodeposited sulfate-doped polypyrrole: determination of the diffusion coefficient of SO(4)(2-) in the polymeric membrane.

    Science.gov (United States)

    Licona-Sánchez, T de J; Alvarez-Romero, G A; Mendoza-Huizar, L H; Galán-Vidal, C A; Palomar-Pardavé, M; Romero-Romo, M; Herrera-Hernández, H; Uruchurtu, J; Juárez-García, J M

    2010-08-05

    A kinetic study for the electrosynthesis of polypyrrole (Ppy) doped with SO(4)(2-) ions is presented. Ppy films were electrochemically polymerized onto a graphite-epoxy resin electrode. Experimental current density transients (j-t) were obtained for three different potentiometric behaviors: anionic, cationic, and a combination. Theoretical models were used to fit the experimental j-t data to determine the nucleation and growth processes controlling the polymer synthesis. It was encountered that, in all cases, pyrrole electropolimerization involves two concomitant processes, namely, a Ppy diffusion limited multiple 3D nucleation and growth and pyrrole electro-oxidation on the growing surface of the Ppy nuclei. SEM analysis of the electrodes surfaces reveals that Ppy deposition occurred over most of the electrode surface by multiple nucleation of hemispheres, as the theoretical model used for the analysis of the current transients required. Hemispherical particles formed the polymeric film displaying different sizes. The order for the particle size was as follows: anionic > anionic-cationic > cationic. These results are congruent with those obtained by theoretical analysis of the corresponding current transients. Analysis of the impedance measurements recorded on the anionic Ppy film, immersed in an aqueous solution with different sulfate ion concentrations evidenced that SO(4)(2-) ions diffuse through the Ppy film provoking a decrease of its electrical resistance and an increase of its dielectric constant. From the Warburg impedance coefficient, the sulfate coefficient of diffusion in the Ppy film was 1.38 x 10(-9) cm(2) s(-1).

  11. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  12. Kinetic energy dependence of carrier diffusion in a GaAs epilayer studied by wavelength selective PL imaging

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, S. [University of North Carolina at Charlotte, Charlotte, NC 28223 (United States); Providence High School, Charlotte, NC 28270 (United States); Su, L.Q.; Kon, J. [University of North Carolina at Charlotte, Charlotte, NC 28223 (United States); Gfroerer, T. [Davidson College, Davidson, NC 28035 (United States); Wanlass, M.W. [National Renewable Energy Laboratory, Golden, CO 80401 (United States); Zhang, Y., E-mail: yong.zhang@uncc.edu [University of North Carolina at Charlotte, Charlotte, NC 28223 (United States)

    2017-05-15

    Photoluminescence (PL) imaging has been shown to be an efficient technique for investigating carrier diffusion in semiconductors. In the past, the measurement was typically carried out by measuring at one wavelength (e.g., at the band gap) or simply the whole emission band. At room temperature in a semiconductor like GaAs, the band-to-band PL emission may occur in a spectral range over 200 meV, vastly exceeding the average thermal energy of about 26 meV. To investigate the potential dependence of the carrier diffusion on the carrier kinetic energy, we performed wavelength selective PL imaging on a GaAs double hetero-structure in a spectral range from about 70 meV above to 50 meV below the bandgap, extracting the carrier diffusion lengths at different PL wavelengths by fitting the imaging data to a theoretical model. The results clearly show that the locally generated carriers of different kinetic energies mostly diffuse together, maintaining the same thermal distribution throughout the diffusion process. Potential effects related to carrier density, self-absorption, lateral wave-guiding, and local heating are also discussed.

  13. Ozone-surface interactions: Investigations of mechanisms, kinetics, mass transport, and implications for indoor air quality

    Energy Technology Data Exchange (ETDEWEB)

    Morrison, Glenn Charles [Univ. of California, Berkeley, CA (United States)

    1999-12-01

    In this dissertation, results are presented of laboratory investigations and mathematical modeling efforts designed to better understand the interactions of ozone with surfaces. In the laboratory, carpet and duct materials were exposed to ozone and measured ozone uptake kinetics and the ozone induced emissions of volatile organic compounds. To understand the results of the experiments, mathematical methods were developed to describe dynamic indoor aldehyde concentrations, mass transport of reactive species to smooth surfaces, the equivalent reaction probability of whole carpet due to the surface reactivity of fibers and carpet backing, and ozone aging of surfaces. Carpets, separated carpet fibers, and separated carpet backing all tended to release aldehydes when exposed to ozone. Secondary emissions were mostly n-nonanal and several other smaller aldehydes. The pattern of emissions suggested that vegetable oils may be precursors for these oxidized emissions. Several possible precursors and experiments in which linseed and tung oils were tested for their secondary emission potential were discussed. Dynamic emission rates of 2-nonenal from a residential carpet may indicate that intermediate species in the oxidation of conjugated olefins can significantly delay aldehyde emissions and act as reservoir for these compounds. The ozone induced emission rate of 2-nonenal, a very odorous compound, can result in odorous indoor concentrations for several years. Surface ozone reactivity is a key parameter in determining the flux of ozone to a surface, is parameterized by the reaction probability, which is simply the probability that an ozone molecule will be irreversibly consumed when it strikes a surface. In laboratory studies of two residential and two commercial carpets, the ozone reaction probability for carpet fibers, carpet backing and the equivalent reaction probability for whole carpet were determined. Typically reaction probability values for these materials were 10

  14. Development of a thermo-kinetic diffusion model for UO2 and (U,Pu)O2 oxide fuels using the DICTRA code

    International Nuclear Information System (INIS)

    Moore, Emily Elaine

    2013-01-01

    model describing the thermodynamic and kinetic properties of (U,Pu)O 2±x is currently not in existence. The aim of this work is to construct a diffusion model with DICTRA, which considers the mobility of the oxide components across non-stoichiometric ranges described by experimentally and theoretically available data. The coupling of a purely thermodynamic description provided by Gibbs energies, to the mobility model developed here presents a complete basis for describing atomic transport. A vacancy and interstitial model of diffusion is applied to the U-O and Pu-O systems as a function of their defect structure derived from CALPHAD-type thermodynamic descriptions. Self-diffusion coefficients are assessed and compared to available data. A good agreement between our calculated values for self and chemical diffusion coefficients and literature data is achieved for the binary systems. The chemical diffusion coefficients in the (U,Pu)O 2±x are extrapolated using the binary databases and are on the same order of magnitude as literature data. We evaluate defect migration energies of oxygen as a function of stoichiometric deviation. The diffusion coefficients of the stoichiometric oxides provide information containing the activation energy for diffusion as well as Frenkel pair-formation, for which our extracted values are in good agreement with available literature data. Further validation of the model includes simulations of chemical gradients imposed either at the surface to simulate reduction kinetics (UO 2+x ) or by introducing a diffusion couple (MOX) where oxygen diffusion profiles are measured as a function of distance. Both examples are in agreement with the experimental data after which the simulation conditions were reproduced. (author) [fr

  15. Kinetic Monte Carlo studies of the reaction kinetics of crystal defects that diffuse one-dimensionally with occasional transverse migration

    DEFF Research Database (Denmark)

    Heinisch, H.L.; Trinkaus, H.; Singh, Bachu Narain

    2007-01-01

    The reaction kinetics of the various species of mobile defects in irradiated materials are crucially dependent on the dimensionality of their migration. Sink strengths for one-dimensionally (1D) gliding interstitial loops undergoing occasional direction changes have been described analytically...

  16. Diffusion kinetics of the glucose/glucose oxidase system in swift heavy ion track-based biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Fink, Dietmar, E-mail: fink@xanum.uam.mx [Nuclear Physics Institute, 25068 Řež (Czech Republic); Departamento de Fisica, Universidad Autónoma Metropolitana-Iztapalapa, PO Box 55-534, 09340 México, DF (Mexico); Vacik, Jiri; Hnatowicz, V. [Nuclear Physics Institute, 25068 Řež (Czech Republic); Muñoz Hernandez, G. [Departamento de Fisica, Universidad Autónoma Metropolitana-Iztapalapa, PO Box 55-534, 09340 México, DF (Mexico); Garcia Arrelano, H. [Departamento de Ciencias Ambientales, División de Ciencias Biológicas y de la Salud, Universidad Autónoma Metropolitana-Lerma, Av. de las Garzas No. 10, Col. El Panteón, Lerma de Villada, Municipio de Lerma, Estado de México CP 52005 (Mexico); Alfonta, Lital [Avram and Stella Goldstein-Goren Department of Biotechnology Engineering, Ben-Gurion University of the Negev, PO Box 653, Beer-Sheva 84105 (Israel); Kiv, Arik [Department of Materials Engineering, Ben-Gurion University of the Negev, PO Box 653, Beer-Sheva 84105 (Israel)

    2017-05-01

    Highlights: • Application of swift heavy ion tracks in biosensing. • Obtaining yet unknown diffusion coefficients of organic matter across etched ion tracks. • Obtaining diffusion coefficients of organics in etched ion tracks of biosensors. • Comparison with Renkin’s equation to predict the effective etched track diameter in the given experiments. - Abstract: For understanding of the diffusion kinetics and their optimization in swift heavy ion track-based biosensors, recently a diffusion simulation was performed. This simulation aimed at yielding the degree of enrichment of the enzymatic reaction products in the highly confined space of the etched ion tracks. A bunch of curves was obtained for the description of such sensors that depend only on the ratio of the diffusion coefficient of the products to that of the analyte within the tracks. As hitherto none of these two diffusion coefficients is accurately known, the present work was undertaken. The results of this paper allow one to quantify the previous simulation and hence yield realistic predictions of glucose-based biosensors. At this occasion, also the influence of the etched track radius on the diffusion coefficients was measured and compared with earlier prediction.

  17. Effect of stress on the diffusion kinetics of methane during gas desorption in coal matrix under different equilibrium pressures

    Science.gov (United States)

    Li, Chengwu; Xue, Honglai; Hu, Po; Guan, Cheng; Liu, Wenbiao

    2018-06-01

    Stress has a significant influence on gas diffusion, which is a key factor for methane recovery in coal mines. In this study, a series of experiments were performed to investigate effect of stress on the gas diffusivity during desorption in tectonic coal. Additionally, the desorbed data were modeled using the unipore and bidisperse models. The results show that the bidisperse model better describes the diffusion kinetics than the unipore model in this study. Additionally, the modeling results using the bidisperse approach suggest that the stress impact on the macropore diffusivity is greater than the stress on the micropore diffusivity. Under the same equilibrium pressure, the diffusivity varies with stress according to a four-stage function, which shows an ‘M-shape’. As the equilibrium gas pressure increased from 0.6 to 1.7 MPa, the critical point between stage 2 and stage 3 and between stage 3 and stage 4 transferred to a low stress. This difference is attributed to the gas pressure effects on the physical and mechanical properties of coal. These observations indicate that both the stress and gas pressure can significantly impact gas diffusion and may have significant implications on methane recovery in coal mines.

  18. A study of charge transfer kinetics in dye-sensitized surface conductivity solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Friedrich, Dennis

    2011-05-15

    The efficiency of the quasi-solid-state dye-sensitized solar cell developed by Junghaenel and Tributsch, the so-called Nano Surface Conductivity Solar Cell (NSCSC), was improved from 2% to 3.5% introducing a compact TiO{sub 2} underlayer, modifying the surface of the mesoporous TiO{sub 2} electrode, optimizing the deposition process of the electrolyte film, and replacing the platinum counter electrode by a carbon layer. Space-resolved photocurrent images revealed the importance of a homogeneous distribution of the electrolyte film. An uneven dispersion led to localized areas of high and low photocurrents, whereas the latter were attributed to an insufficient concentration of the redox couple. Impedance spectroscopy was performed on cells containing different concentrations of the redox couple. By modeling the spectra using an equivalent circuit with a transmission line of resistive and capacitive elements, the characteristic parameters of electron transport in the TiO{sub 2}, such as diffusion length and electron lifetime were obtained. The measurements indicated that the transport of the positive charge to the counter electrode is the main process limiting the efficiency of the cells. Excess charge carrier decay in functioning devices was analyzed by contactless transient photoconductance measurements in the microwave frequency range (TRMC). The lifetime of the photogenerated charge carriers was observed to decrease with increasing applied potential, reaching its maximum close to the opencircuit potential of the cell, where the photocurrent density was minimal, i.e. the potential dependent decay observed was limited by the injection of electrons into the front contact. The functioning of this NSCSC indicated that the transport of the positive charge occurs by solid-state diffusion at the surface of the TiO{sub 2} particles. TRMC measurements on subset devices in the form of sensitized TiO{sub 2} layers revealed charge carrier kinetics strongly dependent on the

  19. Palladium mixed-metal surface-modified AB5-type intermetallides enhance hydrogen sorption kinetics

    Directory of Open Access Journals (Sweden)

    Roman V. Denys

    2010-09-01

    Full Text Available Surface engineering approaches were adopted in the preparation of advanced hydrogen sorption materials, based on ‘low-temperature’, AB5-type intermetallides. The approaches investigated included micro-encapsulation with palladium and mixed-metal mantles using electroless plating. The influence of micro-encapsulation on the surface morphology and kinetics of hydrogen charging were investigated. It was found that palladium-nickel (Pd-Ni co-deposition by electroless plating significantly improved the kinetics of hydrogen charging of the AB5-type intermetallides at low hydrogen pressure and temperature, after long-term pre-exposure to air. The improvement in the kinetics of hydrogen charging was credited to a synergistic effect between the palladium and nickel atoms in the catalytic mantle and the formation of an ‘interfacial bridge’ for hydrogen diffusion by the nickel atoms in the deposited layer. The developed surface-modified materials may find application in highly selective hydrogen extraction, purification, and storage from impure hydrogen feeds.

  20. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  1. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  2. Mathematical model of the methane replacement by carbon dioxide in the gas hydrate reservoir taking into account the diffusion kinetics

    Science.gov (United States)

    Musakaev, N. G.; Khasanov, M. K.; Rafikova, G. R.

    2018-03-01

    The problem of the replacement of methane in its hydrate by carbon dioxide in a porous medium is considered. The gas-exchange kinetics scheme is proposed in which the intensity of the process is limited by the diffusion of CO2 through the hydrate layer formed between the gas mixture flow and the CH4 hydrate. Dynamics of the main parameters of the process is numerically investigated. The main characteristic stages of the process are determined.

  3. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  4. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  5. Charge-regularized swelling kinetics of polyelectrolyte gels: Elasticity and diffusion

    Science.gov (United States)

    Sen, Swati; Kundagrami, Arindam

    2017-11-01

    We apply a recently developed method [S. Sen and A. Kundagrami, J. Chem. Phys. 143, 224904 (2015)], using a phenomenological expression of osmotic stress, as a function of polymer and charge densities, hydrophobicity, and network elasticity for the swelling of spherical polyelectrolyte (PE) gels with fixed and variable charges in a salt-free solvent. This expression of stress is used in the equation of motion of swelling kinetics of spherical PE gels to numerically calculate the spatial profiles for the polymer and free ion densities at different time steps and the time evolution of the size of the gel. We compare the profiles of the same variables obtained from the classical linear theory of elasticity and quantitatively estimate the bulk modulus of the PE gel. Further, we obtain an analytical expression of the elastic modulus from the linearized expression of stress (in the small deformation limit). We find that the estimated bulk modulus of the PE gel decreases with the increase of its effective charge for a fixed degree of deformation during swelling. Finally, we match the gel-front locations with the experimental data, taken from the measurements of charged reversible addition-fragmentation chain transfer gels to show an increase in gel-size with charge and also match the same for PNIPAM (uncharged) and imidazolium-based (charged) minigels, which specifically confirms the decrease of the gel modulus value with the increase of the charge. The agreement between experimental and theoretical results confirms general diffusive behaviour for swelling of PE gels with a decreasing bulk modulus with increasing degree of ionization (charge). The new formalism captures large deformations as well with a significant variation of charge content of the gel. It is found that PE gels with large deformation but same initial size swell faster with a higher charge.

  6. Oxygen exchange at gas/oxide interfaces: how the apparent activation energy of the surface exchange coefficient depends on the kinetic regime.

    Science.gov (United States)

    Fielitz, Peter; Borchardt, Günter

    2016-08-10

    In the dedicated literature the oxygen surface exchange coefficient KO and the equilibrium oxygen exchange rate [Fraktur R] are considered to be directly proportional to each other regardless of the experimental circumstances. Recent experimental observations, however, contradict the consequences of this assumption. Most surprising is the finding that the apparent activation energy of KO depends dramatically on the kinetic regime in which it has been determined, i.e. surface exchange controlled vs. mixed or diffusion controlled. This work demonstrates how the diffusion boundary condition at the gas/solid interface inevitably entails a correlation between the oxygen surface exchange coefficient KO and the oxygen self-diffusion coefficient DO in the bulk ("on top" of the correlation between KO and [Fraktur R] for the pure surface exchange regime). The model can thus quantitatively explain the range of apparent activation energies measured in the different regimes: in the surface exchange regime the apparent activation energy only contains the contribution of the equilibrium exchange rate, whereas in the mixed or in the diffusion controlled regime the contribution of the oxygen self-diffusivity has also to be taken into account, which may yield significantly higher apparent activation energies and simultaneously quantifies the correlation KO ∝ DO(1/2) observed for a large number of oxides in the mixed or diffusion controlled regime, respectively.

  7. Automatic kinetic Monte-Carlo modeling for impurity atom diffusion in grain boundary structure of tungsten material

    Directory of Open Access Journals (Sweden)

    Atsushi M. Ito

    2017-08-01

    Full Text Available The diffusion process of hydrogen and helium in plasma-facing material depends on the grain boundary structures. Whether a grain boundary accelerates or limits the diffusion speed of these impurity atoms is not well understood. In the present work, we proposed the automatic modeling of a kinetic Monte-Carlo (KMC simulation to treat an asymmetric grain boundary structure that corresponds to target samples used in fusion material experiments for retention and permeation. In this method, local minimum energy sites and migration paths for impurity atoms in the grain boundary structure are automatically found using localized molecular dynamics. The grain boundary structure was generated with the Voronoi diagram. Consequently, we demonstrate that the KMC simulation for the diffusion process of impurity atoms in the generated grain boundary structure of tungsten material can be performed.

  8. Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

    Science.gov (United States)

    van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

    2014-05-01

    Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in surface waters is controlled strongly by biogeochemical nutrient cycling processes at the soil-water interface. The mechanisms and rates of the iron oxidation process with associated binding of phosphate during exfiltration of anaerobic Fe(II) bearing groundwater are among the key unknowns in P retention processes in surface waters in delta areas where the shallow groundwater is typically pH-neutral to slightly acid, anoxic, iron-rich. We developed an experimental field set-up to study the dynamics in Fe(II) oxidation and mechanisms of P immobilization at the groundwater-surface water interface in an agricultural experimental catchment of a small lowland river. We physically separated tube drain effluent from groundwater discharge before it entered a ditch in an agricultural field. The exfiltrating groundwater was captured in in-stream reservoirs constructed in the ditch. Through continuous discharge measurements and weekly water quality sampling of groundwater, tube drain water, exfiltrated groundwater, and ditch water, we quantified Fe(II) oxidation kinetics and P immobilization processes across the seasons. This study showed that seasonal changes in climatic conditions affect the Fe(II) oxidation process. In winter time the dissolved iron concentrations in the in-stream reservoirs reached the levels of the anaerobic groundwater. In summer time, the dissolved iron concentrations of the water in the reservoirs are low, indicating that dissolved Fe(II) is completely oxidized prior to inflow into the reservoirs. Higher discharges, lower temperatures and lower pH of the exfiltrated groundwater in winter compared to summer shifts the location of the redox transition zone

  9. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  10. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  11. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    Energy Technology Data Exchange (ETDEWEB)

    Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

    2015-12-28

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

  12. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    International Nuclear Information System (INIS)

    Mirigian, Stephen; Schweizer, Kenneth S.

    2015-01-01

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

  13. Roles of Bulk and Surface Chemistry in the Oxygen Exchange Kinetics and Related Properties of Mixed Conducting Perovskite Oxide Electrodes

    Directory of Open Access Journals (Sweden)

    Nicola H. Perry

    2016-10-01

    Full Text Available Mixed conducting perovskite oxides and related structures serving as electrodes for electrochemical oxygen incorporation and evolution in solid oxide fuel and electrolysis cells, respectively, play a significant role in determining the cell efficiency and lifetime. Desired improvements in catalytic activity for rapid surface oxygen exchange, fast bulk transport (electronic and ionic, and thermo-chemo-mechanical stability of oxygen electrodes will require increased understanding of the impact of both bulk and surface chemistry on these properties. This review highlights selected work at the International Institute for Carbon-Neutral Energy Research (I2CNER, Kyushu University, set in the context of work in the broader community, aiming to characterize and understand relationships between bulk and surface composition and oxygen electrode performance. Insights into aspects of bulk point defect chemistry, electronic structure, crystal structure, and cation choice that impact carrier concentrations and mobilities, surface exchange kinetics, and chemical expansion coefficients are emerging. At the same time, an understanding of the relationship between bulk and surface chemistry is being developed that may assist design of electrodes with more robust surface chemistries, e.g., impurity tolerance or limited surface segregation. Ion scattering techniques (e.g., secondary ion mass spectrometry, SIMS, or low energy ion scattering spectroscopy, LEIS with high surface sensitivity and increasing lateral resolution are proving useful for measuring surface exchange kinetics, diffusivity, and corresponding outer monolayer chemistry of electrodes exposed to typical operating conditions. Beyond consideration of chemical composition, the use of strain and/or a high density of active interfaces also show promise for enhancing performance.

  14. Thermal analyses to assess diffusion kinetics in the nano-sized interspaces between the growing crystals of a glass ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Fotheringham, Ulrich, E-mail: ulrich.fotheringham@schott.com [SCHOTT AG, 55014 Mainz (Germany); Wurth, Roman; Ruessel, Christian [Otto-Schott-Institut, Jena University, Jena (Germany)

    2011-08-10

    Highlights: {yields} Macroscopic, routine laboratory methods of the 'Thermal Analysis' type (DSC, DMA) allow a rough description of the kinetics in the nano-sized interstitial spaces of glass ceramics. {yields} These macroscopic measurements support the idea of a rigid zone around the crystals which builds up during ceramization and is part of a negative feedback loop which finally stops crystal growth and Ostwald ripening within the time window of observation. {yields} Ostwald ripening may be provoked by thermally softening said rigid zone. Under certain conditions, this gives rise to a characteristic peak in the DSC. - Abstract: According to a hypothesis by Ruessel and coworkers, the absence of Ostwald ripening during isothermal crystallization of lithium aluminosilicate (LAS) and other glass ceramics indicates the existence of a kinetic hindrance of atomic reorganization in the interstitial spaces between the crystals. Methods of Thermal Analysis (Differential Scanning Calorimetry (DSC), Dynamic Mechanical Analysis (DMA)) which are sensitive to the local atomic rearrangements in the interstitial spaces (including viscous flow) are applied to find support for the idea of kinetic hindrance and the formation of a core shell structure acting as diffusion barrier. Both the DSC-measured calorimetric glass transition and the DMA-measured viscoelastic properties indicate an increase in the time constants of atomic rearrangements and diffusion by at least two orders of magnitude during ceramization. This fits to the above idea. Based on these findings, thermo analytic studies have been performed in order to find out how Ostwald ripening may be provoked.

  15. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  16. Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

    NARCIS (Netherlands)

    van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

    2014-01-01

    Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in

  17. Dissociative diffusion mechanism in vacancy-rich materials according to mass action kinetics

    Directory of Open Access Journals (Sweden)

    N. J. Biderman

    2016-05-01

    Full Text Available Two sets of diffusion-reaction numerical simulations using a finite difference method (FDM were conducted to investigate fast impurity diffusion via interstitial sites in vacancy-rich materials such as Cu(In,GaSe2 (CIGS and Cu2ZnSn(S, Se4 (CZTSSe or CZTS via the dissociative diffusion mechanism where the interstitial diffuser ultimately reacts with a vacancy to produce a substitutional. The first set of simulations extends the standard interstitial-limited dissociative diffusion theory to vacancy-rich material conditions where vacancies are annihilated in large amounts, introducing non-equilibrium vacancy concentration profiles. The second simulation set explores the vacancy-limited dissociative diffusion where impurity incorporation increases the equilibrium vacancy concentration. In addition to diffusion profiles of varying concentrations and shapes that were obtained in all simulations, some of the profiles can be fitted with the constant- and limited-source solutions of Fick’s second law despite the non-equilibrium condition induced by the interstitial-vacancy reaction. The first set of simulations reveals that the dissociative diffusion coefficient in vacancy-rich materials is inversely proportional to the initial vacancy concentration. In the second set of numerical simulations, impurity-induced changes in the vacancy concentration lead to distinctive diffusion profile shapes. The simulation results are also compared with published data of impurity diffusion in CIGS. According to the characteristic properties of diffusion profiles from the two set of simulations, experimental detection of the dissociative diffusion mechanism in vacancy-rich materials may be possible.

  18. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  19. Description of jambolan (Syzygium cumini (L.)) anthocyanin extraction kinetics at different stirring frequencies of the medium using diffusion models

    Science.gov (United States)

    da Silva, Wilton Pereira; Nunes, Jarderlany Sousa; Gomes, Josivanda Palmeira; de Araújo, Auryclennedy Calou; e Silva, Cleide M. D. P. S.

    2018-05-01

    Anthocyanin extraction kinetics was described for jambolan fruits. The spherical granules obtained were dried at 40 °C and the average radius of the sphere equivalent to the granules was determined. Solid-solvent ratio was fixed at 1:20 and temperature at 35 °C. A mixture of ethyl alcohol and hydrochloric acid (85:15) was used as solvent. Experiments were conducted with the following stirring frequencies: 0, 50, 100 and 150 rpm. Two diffusion models were used to describe the extraction process. The first one used an analytical solution, with boundary condition of the first kind. The second one used a numerical solution, with boundary condition of the third kind. The second model was the most adequate, and its results were used to determine empirical equations relating the process parameters with the stirring frequency, allowing to simulate new extraction kinetics.

  20. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  1. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  2. Surface controlled dissolution rates of gypsum in aqueous solutions exhibit nonlinear dissolution kinetics

    Science.gov (United States)

    Jeschke, Alexander A.; Vosbeck, Katrin; Dreybrodt, Wolfgang

    2001-01-01

    The effective dissolution rates of gypsum are determined by mixed kinetics, where the rate constants of dissolution at the surface and the transport constant of molecular diffusion of dissolved material are similar. To obtain the surface reaction rate law it is necessary to know the transport constant. We have determined the surface rate law for monocrystalline selenite by using a rotating disc set-up, where the transport coefficients are well known. As a result, up to a calcium concentration of 0.6 · ceq, we find a nearly linear rate law Rs = ksl (1- cs/ ceq) n1, where cs is the total calcium concentration at the surface and ceq the equilibrium concentration with respect to gypsum, n1 = 1.2 ± 0.2, and ksl = 1.1 · 10 -4 mmol cm -2 s -1 ± 15%. We also employed batch-experiments for selenite, alabaster and gypsum rock samples. The result of these experiments were interpreted by using a transport constant determined by NaCl dissolution experiments under similar physical conditions. The batch experiments reveal a dissolution rate law Rs = ksl (1- cs/ ceq) n1, ksl = 1.3 · 10 -4 mmol · cm -2 s -1, n1 = 1.2 ± 0.2 for c ≤ 0.94 · ceq. Close to equilibrium a nonlinear rate law, Rs = ks2 (1- cs/ ceq) n2, is observed, where ks2 is in the order of 10 mmol · cm -2 s -1 and n2 ≈ 4.5. The experimentally observed gypsum dissolution rates from the batch experiments could be accurately fitted, with only minor variations of the surface reaction constant obtained from the rotating disk experiment and the transport coefficient from the NaCl dissolution batch experiment. Batch experiments on pure synthetic gypsum, reveal a linear rate law up to equilibrium. This indicates inhibition of dissolution in natural samples close to equilibrium, as is known also for calcite minerals.

  3. Magnetoresistance of films and strips with the diffuse surface scattering

    International Nuclear Information System (INIS)

    Aronov, A.G.

    1993-08-01

    Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs

  4. Kinetic energy distributions of ions after surface collisions

    International Nuclear Information System (INIS)

    Short, R.T.; Todd, P.J.; Grimm, C.C.

    1991-01-01

    As a part of the development of an organic ion microprobe, to be used for imaging of particular organic compounds in biological tissue, various methods of quadrupole-based tandem mass spectroscopy (MS/MS) have been investigated. High transmission efficiency is essential for the success of the organic ion microprobe, due to expected low analyte concentrations in biological tissue and the potential for sample damage from prolonged exposure to the primary ion beam. MS/MS is necessary for organic ion imaging because of the complex nature of the biological matrices. The goal of these studies of was to optimize the efficiency of daughter ion production and transmission by first determining daughter ion properties and then designing ion optics based on those properties. The properties of main interest are daughter ion kinetic energy and angular distribution. 1 fig

  5. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  6. Radionuclide behavior in water saturated porous media: Diffusion and infiltration coupling of thermodynamically and kinetically controlled radionuclide water - mineral interactions

    International Nuclear Information System (INIS)

    Spasennykh, M.Yu.; Apps, J.A.

    1995-05-01

    A model is developed describing one dimensional radionuclide transport in porous media coupled with locally reversible radionuclide water-mineral exchange reactions and radioactive decay. Problems are considered in which radionuclide transport by diffusion and infiltration processes occur in cases where radionuclide water-solid interaction are kinetically and thermodynamically controlled. The limits of Sr-90 and Cs-137 migration are calculated over a wide range of the problem variables (infiltration velocity, distribution coefficients, and rate constants of water-mineral radionuclide exchange reactions)

  7. X-ray diffuse scattering study of the kinetics of stacking fault growth and annihilation in boron-implanted silicon

    Science.gov (United States)

    Luebbert, D.; Arthur, J.; Sztucki, M.; Metzger, T. H.; Griffin, P. B.; Patel, J. R.

    2002-10-01

    Stacking faults in boron-implanted silicon give rise to streaks or rods of scattered x-ray intensity normal to the stacking fault plane. We have used the diffuse scattering rods to follow the growth of faults as a function of time when boron-implanted silicon is annealed in the range of 925 to 1025 degC. From the growth kinetics we obtain an activation energy for interstitial migration in silicon: EI=1.98plus-or-minus0.06 eV. Fault intensity and size versus time results indicate that faults do not shrink and disappear, but rather are annihilated by a dislocation reaction mechanism.

  8. Features of the kinetics of heterogeneous reactions with phase transformations on catalyst surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Berman, A D; Krylov, O V

    1978-01-01

    This paper presents a review of 41 bibliographic references to experiments on the adsorption of various gases (e.g., carbon monoxide, formic acid, ammonia, and oxygen) on metals (e.g., nickel, molybdenum, and platinum) and oxides covers observations of two-dimensional phases during adsorption; the kinetics of adsorption and catalysis associated with two-dimensional phase transitions; and several approximate models for describing the kinetics of heterogeneous catalysis which account for two-dimensional phase transformations on catalyst surfaces.

  9. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  10. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  11. Grown-in beryllium diffusion in indium gallium arsenide: An ab initio, continuum theory and kinetic Monte Carlo study

    International Nuclear Information System (INIS)

    Liu, Wenyuan; Sk, Mahasin Alam; Manzhos, Sergei; Martin-Bragado, Ignacio; Benistant, Francis; Cheong, Siew Ann

    2017-01-01

    A roadblock in utilizing InGaAs for scaled-down electronic devices is its anomalous dopant diffusion behavior; specifically, existing models are not able to explain available experimental data on beryllium diffusion consistently. In this paper, we propose a more comprehensive model, taking self-interstitial migration and Be interaction with Ga and In into account. Density functional theory (DFT) calculations are first used to calculate the energy parameters and charge states of possible diffusion mechanisms. Based on the DFT results, continuum modeling and kinetic Monte Carlo simulations are then performed. The model is able to reproduce experimental Be concentration profiles. Our results suggest that the Frank-Turnbull mechanism is not likely, instead, kick-out reactions are the dominant mechanism. Due to a large reaction energy difference, the Ga interstitial and the In interstitial play different roles in the kick-out reactions, contrary to what is usually assumed. The DFT calculations also suggest that the influence of As on Be diffusion may not be negligible.

  12. Improving malignancy prediction in breast lesions with the combination of apparent diffusion coefficient and dynamic contrast-enhanced kinetic descriptors

    International Nuclear Information System (INIS)

    Nogueira, Luisa; Brandão, Sofia; Matos, Eduarda; Gouveia Nunes, Rita; Ferreira, Hugo Alexandre; Loureiro, Joana; Ramos, Isabel

    2015-01-01

    Aim: To assess how the joint use of apparent diffusion coefficient (ADC) and kinetic parameters (uptake phase and delayed enhancement characteristics) from dynamic contrast-enhanced (DCE) can boost the ability to predict breast lesion malignancy. Materials and methods: Breast magnetic resonance examinations including DCE and diffusion-weighted imaging (DWI) were performed on 51 women. The association between kinetic parameters and ADC were evaluated and compared between lesion types. Models with binary outcome of malignancy were studied using generalized estimating equations (GEE), (GEE), and using kinetic parameters and ADC values as malignancy predictors. Model accuracy was assessed using the corrected maximum quasi-likelihood under the independence confidence criterion (QICC). Predicted probability of malignancy was estimated for the best model. Results: ADC values were significantly associated with kinetic parameters: medium and rapid uptake phase (p<0.001) and plateau and washout curve types (p=0.004). Comparison between lesion type showed significant differences for ADC (p=0.001), early phase (p<0.001), and curve type (p<0.001). The predicted probabilities of malignancy for the first ADC quartile (≤1.17×10 −3  mm 2 /s) and persistent, plateau and washout curves, were 54.6%, 86.9%, and 97.8%, respectively, and for the third ADC quartile (≥1.51×10 −3  mm 2 /s) were 3.2%, 15.5%, and 54.8%, respectively. The predicted probability of malignancy was less than 5% for 18.8% of the lesions and greater than 33% for 50.7% of the lesions (24/35 lesions, corresponding to a malignancy rate of 68.6%). Conclusion: The best malignancy predictors were low ADCs and washout curves. ADC and kinetic parameters provide differentiated information on the microenvironment of the lesion, with joint models displaying improved predictive performance. -- Highlights: •ADC and kinetic parameters provide diverse information regarding lesion environment. •The best predictors

  13. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  14. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  15. Thin film growth behaviors on strained fcc(111) surface by kinetic Monte Carlo

    International Nuclear Information System (INIS)

    Doi, Y; Matsunaka, D; Shibutani, Y

    2009-01-01

    We study Ag islands grown on strained Ag(111) surfaces using kinetic Monte Carlo (KMC) simulations. We employed KMC parameters of activation energy and attempt frequency estimated by nudged elastic band (NEB) method and vibration analyses. We investigate influences of surface strain and substrate temperature on film growth. As the biaxial surface strain increases, the island density increases. As temperature increases, the shape of the island changes from dendric to hexagonal and the island density increases.

  16. Controlling drug delivery kinetics from mesoporous titania thin films by pore size and surface energy

    Directory of Open Access Journals (Sweden)

    Karlsson J

    2015-07-01

    Full Text Available Johan Karlsson, Saba Atefyekta, Martin Andersson Department of Chemical and Biological Engineering, Chalmers University of Technology, Gothenburg, Sweden Abstract: The osseointegration capacity of bone-anchoring implants can be improved by the use of drugs that are administrated by an inbuilt drug delivery system. However, to attain superior control of drug delivery and to have the ability to administer drugs of varying size, including proteins, further material development of drug carriers is needed. Mesoporous materials have shown great potential in drug delivery applications to provide and maintain a drug concentration within the therapeutic window for the desired period of time. Moreover, drug delivery from coatings consisting of mesoporous titania has shown to be promising to improve healing of bone-anchoring implants. Here we report on how the delivery of an osteoporosis drug, alendronate, can be controlled by altering pore size and surface energy of mesoporous titania thin films. The pore size was varied from 3.4 nm to 7.2 nm by the use of different structure-directing templates and addition of a swelling agent. The surface energy was also altered by grafting dimethylsilane to the pore walls. The drug uptake and release profiles were monitored in situ using quartz crystal microbalance with dissipation (QCM-D and it was shown that both pore size and surface energy had a profound effect on both the adsorption and release kinetics of alendronate. The QCM-D data provided evidence that the drug delivery from mesoporous titania films is controlled by a binding–diffusion mechanism. The yielded knowledge of release kinetics is crucial in order to improve the in vivo tissue response associated to therapeutic treatments. Keywords: mesoporous titania, controlled drug delivery, release kinetics, alendronate, QCM-D

  17. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  18. Self-learning kinetic Monte Carlo simulations of diffusion in ferromagnetic α-Fe-Si alloys

    Science.gov (United States)

    Nandipati, Giridhar; Jiang, Xiujuan; Vemuri, Rama S.; Mathaudhu, Suveen; Rohatgi, Aashish

    2018-01-01

    Diffusion of Si atom and vacancy in the A2-phase of α-Fe-Si alloys in the ferromagnetic state, with and without magnetic order and in various temperature ranges, are studied using AKSOME, an on-lattice self-learning KMC code. Diffusion of the Si atom and the vacancy are studied in the dilute limit and up to 12 at.% Si, respectively, in the temperature range 350-700 K. Local Si neighborhood dependent activation energies for vacancy hops were calculated on-the-fly using a broken-bond model based on pairwise interaction. The migration barrier and prefactor for the Si diffusion in the dilute limit were obtained and found to agree with published data within the limits of uncertainty. Simulations results show that the prefactor and the migration barrier for the Si diffusion are approximately an order of magnitude higher, and a tenth of an electron-volt higher, respectively, in the magnetic disordered state than in the fully ordered state. However, the net result is that magnetic disorder does not have a significant effect on Si diffusivity within the range of parameters studied in this work. Nevertheless, with increasing temperature, the magnetic disorder increases and its effect on the Si diffusivity also increases. In the case of vacancy diffusion, with increasing Si concentration, its diffusion prefactor decreases while the migration barrier more or less remained constant and the effect of magnetic disorder increases with Si concentration. Important vacancy-Si/Fe atom exchange processes and their activation barriers were identified, and the effect of energetics on ordered phase formation in Fe-Si alloys are discussed.

  19. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  20. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  1. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  2. Kinetic electron emission from highly oriented pyrolytic graphite surfaces induced by singly charged ions

    CERN Document Server

    Cernusca, S; Winter, H; Aumayr, F; Loerincik, J; Sroubek, Z

    2002-01-01

    We present total electron yields determined by current measurements for normal impact of H sup + , H sub 2 sup + , H sub 3 sup + , C sup + , N sup + and O sup + ions (E<=10 keV) on a clean highly oriented pyrolytic graphite surface. The kinetic energy of the projectiles has been varied from near threshold up to 10 keV. By comparing the results to similar data obtained for a polycrystalline Au surface the role of different target properties for kinetic electron emission can be analysed.

  3. Realistic multisite lattice-gas modeling and KMC simulation of catalytic surface reactions: Kinetics and multiscale spatial behavior for CO-oxidation on metal (1 0 0) surfaces

    Science.gov (United States)

    Liu, Da-Jiang; Evans, James W.

    2013-12-01

    A realistic molecular-level description of catalytic reactions on single-crystal metal surfaces can be provided by stochastic multisite lattice-gas (msLG) models. This approach has general applicability, although in this report, we will focus on the example of CO-oxidation on the unreconstructed fcc metal (1 0 0) or M(1 0 0) surfaces of common catalyst metals M = Pd, Rh, Pt and Ir (i.e., avoiding regimes where Pt and Ir reconstruct). These models can capture the thermodynamics and kinetics of adsorbed layers for the individual reactants species, such as CO/M(1 0 0) and O/M(1 0 0), as well as the interaction and reaction between different reactant species in mixed adlayers, such as (CO + O)/M(1 0 0). The msLG models allow population of any of hollow, bridge, and top sites. This enables a more flexible and realistic description of adsorption and adlayer ordering, as well as of reaction configurations and configuration-dependent barriers. Adspecies adsorption and interaction energies, as well as barriers for various processes, constitute key model input. The choice of these energies is guided by experimental observations, as well as by extensive Density Functional Theory analysis. Model behavior is assessed via Kinetic Monte Carlo (KMC) simulation. We also address the simulation challenges and theoretical ramifications associated with very rapid diffusion and local equilibration of reactant adspecies such as CO. These msLG models are applied to describe adsorption, ordering, and temperature programmed desorption (TPD) for individual CO/M(1 0 0) and O/M(1 0 0) reactant adlayers. In addition, they are also applied to predict mixed (CO + O)/M(1 0 0) adlayer structure on the nanoscale, the complete bifurcation diagram for reactive steady-states under continuous flow conditions, temperature programmed reaction (TPR) spectra, and titration reactions for the CO-oxidation reaction. Extensive and reasonably successful comparison of model predictions is made with experimental

  4. Surface properties, solubility and dissolution kinetics of bamboo phytoliths

    Science.gov (United States)

    Fraysse, Fabrice; Pokrovsky, Oleg S.; Schott, Jacques; Meunier, Jean-Dominique

    2006-04-01

    Although phytoliths, constituted mainly by micrometric opal, exhibit an important control on silicon cycle in superficial continental environments, their thermodynamic properties and reactivity in aqueous solution are still poorly known. In this work, we determined the solubility and dissolution rates of bamboo phytoliths collected in the Réunion Island and characterized their surface properties via electrophoretic measurements and potentiometric titrations in a wide range of pH. The solubility product of "soil" phytoliths ( pKsp0=2.74 at 25 °C) is equal to that of vitreous silica and is 17 times higher than that of quartz. Similarly, the enthalpy of phytoliths dissolution reaction (ΔHr25-80°C=10.85kJ/mol) is close to that of amorphous silica but is significantly lower than the enthalpy of quartz dissolution. Electrophoretic measurements yield isoelectric point pH IEP = 1.2 ± 0.1 and 2.5 ± 0.2 for "soil" (native) and "heated" (450 °C heating to remove organic matter) phytoliths, respectively. Surface acid-base titrations allowed generation of a 2-p K surface complexation model. Phytoliths dissolution rates, measured in mixed-flow reactors at far from equilibrium conditions at 2 ⩽ pH ⩽ 12, were found to be intermediate between those of quartz and vitreous silica. The dissolution rate dependence on pH was modeled within the concept of surface coordination theory using the equation: R=k1·{>SiOH2+}n+k2·{>SiOH0}+k3·{>SiO-}m, where {> i} stands for the concentration of the surface species present at the SiO 2-H 2O interface, ki are the rate constants of the three parallel reactions and n and m represent the order of the proton- and hydroxy-promoted reactions, respectively. It follows from the results of this study that phytoliths dissolution rates exhibit a minimum at pH ˜ 3. This can explain their good preservation in the acidic soil horizons of Réunion Island. In terms of silicon biogeochemical cycle, phytoliths represent a large buffering reservoir

  5. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  6. The impact of surface coverage on the kinetics of electron transfer through redox monolayers on a silicon electrode surface

    International Nuclear Information System (INIS)

    Ciampi, Simone; Choudhury, Moinul H.; Ahmad, Shahrul Ainliah Binti Alang; Darwish, Nadim; Brun, Anton Le; Gooding, J.Justin

    2015-01-01

    Graphical abstract: The impact of surface coverage on the kinetics of electron transfer through redox monolayers on a silicon electrode surface. ABSTRACT: The impact of the coverage of ferrocene moieties, attached to a silicon electrode modified via hydrosilylation of a dialkyne, on the kinetics of electron transfer between the redox species and the electrode is explored. The coverage of ferrocene is controlled by varying the coupling time between azidomethylferrocene and the distal alkyne of the monolayer via the copper assisted azide-alkyne cycloaddition reaction. All other variables in the surface preparation are maintained identical. What is observed is that the higher the surface coverage of the ferrocene moieties the faster the apparent rates of electron transfer. This surface coverage-dependent kinetic effect is attributed to electrons hopping between ferrocene moieties across the redox film toward hotspots for the electron transfer event. The origin of these hotspots is tentatively suggested to result from minor amounts of oxide on the underlying silicon surface that reduce the barrier for the electron transfer.

  7. Oxygen self-diffusion mechanisms in monoclinic Zr O2 revealed and quantified by density functional theory, random walk analysis, and kinetic Monte Carlo calculations

    Science.gov (United States)

    Yang, Jing; Youssef, Mostafa; Yildiz, Bilge

    2018-01-01

    In this work, we quantify oxygen self-diffusion in monoclinic-phase zirconium oxide as a function of temperature and oxygen partial pressure. A migration barrier of each type of oxygen defect was obtained by first-principles calculations. Random walk theory was used to quantify the diffusivities of oxygen interstitials by using the calculated migration barriers. Kinetic Monte Carlo simulations were used to calculate diffusivities of oxygen vacancies by distinguishing the threefold- and fourfold-coordinated lattice oxygen. By combining the equilibrium defect concentrations obtained in our previous work together with the herein calculated diffusivity of each defect species, we present the resulting oxygen self-diffusion coefficients and the corresponding atomistically resolved transport mechanisms. The predicted effective migration barriers and diffusion prefactors are in reasonable agreement with the experimentally reported values. This work provides insights into oxygen diffusion engineering in Zr O2 -related devices and parametrization for continuum transport modeling.

  8. Kinetics of Microstructure Evolution during Gaseous Thermochemical Surface Treatment

    DEFF Research Database (Denmark)

    Somers, Marcel A.J.; Christiansen, Thomas

    2005-01-01

    The incorporation of nitrogen or carbon in steel is widely applied to provide major improvements in materials performance with respect to fatigue, wear, tribology and atmospheric corrosion. These improvements rely on a modification of the surface adjacent region of the material, by the (internal...... and the interplay with mechanical stress. In the present article a few examples, covering research on the interaction of carbon and/or nitrogen with iron-based metals, are included to illustrate the various aspects of gas-metal interactions....

  9. MODELING OF SUPERCRITICAL FLUID EXTRACTION KINETIC OF FLAXSEED OIL BY DIFFUSION CONTROL METHOD

    Directory of Open Access Journals (Sweden)

    Emir Zafer HOŞGÜN

    2013-06-01

    Full Text Available In this study, Flaxseed oil was extracted by Supercritical Carbondioxide Extraction, and extractionkinetics was modelled using diffusion controlled method.The effect of process parameters, such as pressure (20, 35, 55 MPa, temperature (323 and 343 K, and CO2 flow rate (1 and 3 L CO2 /min on the extraction yield and effective diffusivity (De was investigated. The effective diffusion coefficient varied between 2.4 x10-12 and 10.8 x10-12 m2s-1 for the entire range of experiments and increased with the pressure and flow rate. The model fitted well theexperimental data (ADD varied between 2.35 and 7.48%.

  10. Efficient kinetic Monte Carlo method for reaction-diffusion problems with spatially varying annihilation rates

    Science.gov (United States)

    Schwarz, Karsten; Rieger, Heiko

    2013-03-01

    We present an efficient Monte Carlo method to simulate reaction-diffusion processes with spatially varying particle annihilation or transformation rates as it occurs for instance in the context of motor-driven intracellular transport. Like Green's function reaction dynamics and first-passage time methods, our algorithm avoids small diffusive hops by propagating sufficiently distant particles in large hops to the boundaries of protective domains. Since for spatially varying annihilation or transformation rates the single particle diffusion propagator is not known analytically, we present an algorithm that generates efficiently either particle displacements or annihilations with the correct statistics, as we prove rigorously. The numerical efficiency of the algorithm is demonstrated with an illustrative example.

  11. In situ NMR studies of hydrogen storage kinetics and molecular diffusion in clathrate hydrate at elevated hydrogen pressures

    Energy Technology Data Exchange (ETDEWEB)

    Okuchi, T. [Okayama Univ., Misasa, Tottori (Japan); Moudrakovski, I.L.; Ripmeester, J.A. [National Research Council of Canada, Ottawa, ON (Canada). Steacie Inst. for Molecular Sciences

    2008-07-01

    The challenge of storing high-density hydrogen into compact host media was investigated. The conventional storage scheme where an aqueous solution is frozen with hydrogen gas is too slow for practical use in a hydrogen-based society. Therefore, the authors developed a faster method whereby hydrogen was stored into gas hydrates. The hydrogen gas was directly charged into hydrogen-free, crystalline hydrate powders with partly empty lattices. The storage kinetics and hydrogen diffusion into the hydrate was observed in situ by nuclear magnetic resonance (NMR) in a pressurized tube cell. At pressures up to 20 MPa, the storage was complete within 80 minutes, as observed by growth of stored-hydrogen peak into the hydrate. Hydrogen diffusion within the crystalline hydrate media is the rate-determining step of current storage scheme. Therefore, the authors measured the diffusion coefficient of hydrogen molecules using the pulsed field gradient NMR method. The results show that the stored hydrogen is very mobile at temperatures down to 250 K. As such, the powdered hydrate media should work well even in cold environments. Compared with more prevailing hydrogen storage media such as metal hydrides, clathrate hydrates have the advantage of being free from hydrogen embrittlement, more chemically durable, more environmentally sound, and economically affordable. It was concluded that the powdered clathrate hydrate is suitable as a hydrogen storage media. 22 refs., 4 figs.

  12. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  13. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  14. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  15. Diffuse emission and control of copper in urban surface runoff.

    Science.gov (United States)

    Boller, M A; Steiner, M

    2002-01-01

    Copper washed off from roofs and roads is considered to be a major contribution to diffuse copper pollution of urban environments. In order to guarantee sustainable protection of soils and water, the long-term strategy is to avoid or replace copper containing materials on roofs and fagades. Until achievement of this goal, a special adsorber system is suggested to control the diffuse copper fluxes by retention of copper by a mixture of granulated iron-hydroxide (GEH) and calcium carbonate. Since future stormwater runoff concepts are based on decentralised runoff infiltration into the underground, solutions are proposed which provide for copper retention in infiltration sites using GEH adsorption layers. The example of a large copper façade of which the runoff is treated in an adsorption trench reveals the first full-scale data on façade runoff and adsorber performance. During the first year of investigation average façade runoff concentrations in the range of 1-10 mg Cu/l are reduced by 96-99% in the adsorption ditch.

  16. Kinetics of boride layers formed on the surface of AISI 4140 steel

    International Nuclear Information System (INIS)

    Sen, S.; Sen, U.; Bindal, C.

    2004-01-01

    The present study reports on boride layer growth kinetics of borided AISI 4140 steel. Steels were boronized in molten borax, boric acid and ferro-silicon bath at 1123 K 1173 K and 1223 K for 2, 4, 6 and 8 hours. Boride layer thickness ranged from 38.4 to 225 μm. Layer growth kinetics were analysed by measuring the extent of penetration of FeB and Fe 2 B sublayers as a function of boronizing time and temperature in the range of 1123-1223 K. The depth of the tips of the most deeply penetrated FeB and Fe 2 B needles are taken as measures for diffusion in the fast directions. The kinetics of the reaction, K=K 0 exp(-Q/RT) have also been determined by varying the boriding temperature and time. The results showed that K increase with boronizing temperature. Activation energy (Q) for present study was determined as 215 kj.mol -1 . The diffusion coefficient (K) ranged from 3 x 10 -9 cm 2 s -1 to 2 x 10 -8 cm 2 s -1 . Also temperature-dependent constant (K 0 ) at temperatures 1123 K, 1173 K and 1223 K was 179.4 cm 2 s -1 . (orig.)

  17. Kinetics of boride layers formed on the surface of AISI 4140 steel

    Energy Technology Data Exchange (ETDEWEB)

    Sen, S.; Sen, U. [Sakarya Univ., Dept. of Metal Education, Sakarya (Turkey); Bindal, C. [Sakarya Univ., Dept. of Materials and Metallurgy, Sakarya (Turkey)

    2004-07-01

    The present study reports on boride layer growth kinetics of borided AISI 4140 steel. Steels were boronized in molten borax, boric acid and ferro-silicon bath at 1123 K 1173 K and 1223 K for 2, 4, 6 and 8 hours. Boride layer thickness ranged from 38.4 to 225 {mu}m. Layer growth kinetics were analysed by measuring the extent of penetration of FeB and Fe{sub 2}B sublayers as a function of boronizing time and temperature in the range of 1123-1223 K. The depth of the tips of the most deeply penetrated FeB and Fe{sub 2}B needles are taken as measures for diffusion in the fast directions. The kinetics of the reaction, K=K{sub 0} exp(-Q/RT) have also been determined by varying the boriding temperature and time. The results showed that K increase with boronizing temperature. Activation energy (Q) for present study was determined as 215 kj.mol{sup -1}. The diffusion coefficient (K) ranged from 3 x 10{sup -9} cm{sup 2}s{sup -1} to 2 x 10{sup -8} cm{sup 2}s{sup -1}. Also temperature-dependent constant (K{sub 0}) at temperatures 1123 K, 1173 K and 1223 K was 179.4 cm{sup 2}s{sup -1}. (orig.)

  18. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  19. Determination of depths of multiple traps for interstitials and their influence on diffusion kinetics

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Jiří; Shan, Y. V.; Kozeschnik, E.; Fischer, F. D.

    2014-01-01

    Roč. 22, č. 6 (2014), Art. No. 065015 ISSN 0965-0393 R&D Projects: GA ČR(CZ) GA14-24252S Institutional support: RVO:68081723 Keywords : foreign atoms * trapping enthalpy * carbon diffusion * chemical potential * thermodynamic concept Subject RIV: BJ - Thermodynamics Impact factor: 2.167, year: 2014

  20. Diffusion kinetics in aluminium–gold bond contacts from first-principles density functional calculations

    Czech Academy of Sciences Publication Activity Database

    Ulrich, C. M.; Hashibon, A.; Svoboda, Jiří; Elsässer, C.; Helm, D.; Riedel, H.

    2011-01-01

    Roč. 59, č. 20 (2011), s. 7634-7644 ISSN 1359-6454 R&D Projects: GA ČR GAP204/10/1784 Institutional research plan: CEZ:AV0Z20410507 Keywords : Bonding * Diffusion * Intermetallic compounds Subject RIV: BJ - Thermodynamics Impact factor: 3.755, year: 2011

  1. Comparison of molecular dynamics and kinetic modeling of gas-surface interactions

    NARCIS (Netherlands)

    Frezzotti, A.; Gaastra - Nedea, S.V.; Markvoort, A.J.; Spijker, P.; Gibelli, L.

    2008-01-01

    The interaction of a dilute monatomic gas with a solid surface is studied byMolecular Dynamics (MD) simulations and by numerical solutions of a recently proposed kinetic model. Following previous investigations, the heat transport between parallel walls and Couette flow have been adopted as test

  2. Kinetic Monte Carlo study on the evolution of silicon surface roughness under hydrogen thermal treatment

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Gang; Wang, Yu; Wang, Junzhuan; Pan, Lijia; Yu, Linwei; Zheng, Youdou; Shi, Yi, E-mail: yshi@nju.edu.cn

    2017-08-31

    Highlights: • The KMC method is adopted to investigate the relationships between surface evolution and hydrogen thermal treatment conditions. • The reduction in surface roughness is divided into two stages at relatively low temperatures, both exhibiting exponential dependence on the time. • The optimized surface structure can be obtained by precisely adjusting thermal treatment temperatures and hydrogen pressures. - Abstract: The evolution of a two-dimensional silicon surface under hydrogen thermal treatment is studied by kinetic Monte Carlo simulations, focusing on the dependence of the migration behaviors of surface atoms on both the temperature and hydrogen pressure. We adopt different activation energies to analyze the influence of hydrogen pressure on the evolution of surface morphology at high temperatures. The reduction in surface roughness is divided into two stages, both exhibiting exponential dependence on the equilibrium time. Our results indicate that a high hydrogen pressure is conducive to obtaining optimized surfaces, as a strategy in the applications of three-dimensional devices.

  3. Making waves: Kinetic processes controlling surface evolution during low energy ion sputtering

    International Nuclear Information System (INIS)

    Chan, W.L.; Chason, Eric

    2007-01-01

    When collimated beams of low energy ions are used to bombard materials, the surface often develops a periodic pattern or ''ripple'' structure. Different types of patterns are observed to develop under different conditions, with characteristic features that depend on the substrate material, the ion beam parameters, and the processing conditions. Because the patterns develop spontaneously, without applying any external mask or template, their formation is the expression of a dynamic balance among fundamental surface kinetic processes, e.g., erosion of material from the surface, ion-induced defect creation, and defect-mediated evolution of the surface morphology. In recent years, a comprehensive picture of the different kinetic mechanisms that control the different types of patterns that form has begun to emerge. In this article, we provide a review of different mechanisms that have been proposed and how they fit together in terms of the kinetic regimes in which they dominate. These are grouped into regions of behavior dominated by the directionality of the ion beam, the crystallinity of the surface, the barriers to surface roughening, and nonlinear effects. In sections devoted to each type of behavior, we relate experimental observations of patterning in these regimes to predictions of continuum models and to computer simulations. A comparison between theory and experiment is used to highlight strengths and weaknesses in our understanding. We also discuss the patterning behavior that falls outside the scope of the current understanding and opportunities for advancement

  4. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  5. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  6. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  7. Surface modification of polyethylene by diffuse barrier discharge plasma

    Czech Academy of Sciences Publication Activity Database

    Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

    2013-01-01

    Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

  8. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  9. Culture of normal human blood cells in a diffusion chamber system II. Lymphocyte and plasma cell kinetics

    International Nuclear Information System (INIS)

    Chikkappa, G.; Carsten, A.L.; Chanana, A.D.; Cronkite, E.P.

    1979-01-01

    Normal human blood leukocytes were cultured in Millipore diffusion chambers implanted into the peritoneal cavities of irradiated mice. The evaluation of survival and proliferation kinetics of cells in lymphyocytic series suggested that the lymphoid cells are formed from transition of small and/or large lymphocytes, and the lymphoblasts from the lymphoid cells. There was also evidence indicating that some of the cells in these two compartments are formed by proliferation. The evaluation of plasmacytic series suggested that the plasma cells are formed from plasmacytoid-lymphocytes by transition, and the latter from the transition of lymphocytes. In addition, relatively a small fraction of cells in these two compartments are formed by proliferation. mature plasma cells do not and immature plasma cells do proliferate. Estimation of magnitude of plasma cells formed in the cultures at day 18 indicated that at least one plasma cell is formed for every 6 normal human blood lymphocytes introduced into the culture

  10. Analytical solution of spatial kinetics of the diffusion model for subcritical homogeneous systems driven by external source

    International Nuclear Information System (INIS)

    Oliveira, Fernando Luiz de

    2008-01-01

    This work describes an analytical solution obtained by the expansion method for the spatial kinetics using the diffusion model with delayed emission for source transients in homogeneous media. In particular, starting from simple models, and increasing the complexity, numerical results were obtained for different types of source transients. An analytical solution of the one group without precursors was solved, followed by considering one precursors family. The general case of G-groups with R families of precursor although having a closed form solution, cannot be solved analytically, since there are no explicit formulae for the eigenvalues, and numerical methods must be used to solve such problem. To illustrate the general solution, the multi-group (three groups) time-dependent problem without precursors was solved and the numerical results of a finite difference code were compared with the exact results for different transients. (author)

  11. Kinetics of final stages of spreading of melts on solid surfaces

    International Nuclear Information System (INIS)

    Khlynov, V.V.; Pastukhov, B.A.; Bokser, Eh.L.

    1978-01-01

    Kinetics of the spreading of Fe, Ni and Co melts over the surface of W-Re alloy (27% Re) was studied at 1580, 1500 and 1540 deg C, respectively. The time variant wetting spot radius and wetting angle were recorded using a modified Langmuir's method. Kinetic equations of the propagation of liquid interfacial layer and of the wetting, satisfactorily describing the obtained experimental data, have been derived. The melts have been found to spread by viscous flow and by migration atoms in small regions adjacent to the wetting perimeter

  12. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  13. Application of the TEOM reactor for adsorption, diffusion and kinetic studies[TEOM=Tapered Element Oscillating Microbalance

    Energy Technology Data Exchange (ETDEWEB)

    Rebo, Hans Petter

    1999-07-01

    In Norway, the limited offshore oil resources, the abundance of natural gas and the need to recover associated gas from the crude oil production have made the utilisation of natural gas the focus of increased attention. Most products from refineries and chemical industry are formed by gas phase reactions over solid materials like metals, metal oxides and zeolites. Heterogeneous catalysts are in addition frequently used for environmental purposes and energy production. In the work described in this thesis, an experimental set-up was built and used to study some typical processes in heterogeneous catalysis. The set-up included a tapered element oscillating microbalance (TEOM) for measuring mass changes. The following properties of the TEOM were found particularly useful: (1) Frequent frequency counting makes the TEOM suitable for recording transient uptake curves, (2) High sensitivity of the microbalance makes it possible to work with low catalyst loading and still obtain high signal to noise ratio, and (3) Reliable kinetic data are obtained due to the fixed bed characteristics of the TEOM. Adsorption and diffusion of o-xylene and toluene in a commercial HZSM-5 zeolite were studied at 30, 100 and 200 {sup o}C and at partial pressures in the range of 0.002-0.1 bar. The effect of coke on the adsorption and diffusion properties were studied by adsorption experiments at 30 {sup o}C of ethane, toluene and n-hexane before and after coke formation during ethene oligomerisation at 475 {sup o}C and at P(ethene)=0.8 bar. The oligomerisation of ethene over HZSM-5 was used as a model reaction for comparing coke formation in a gravimetric microbalance and in the TEOM. The work also includes a study of coke formation and the effect of coke on the kinetics of propene dehydrogenation over Pt-Sn/Al{sub 2}O{sub 3} catalysts at 500-580 {sup o}C.

  14. Effect of microwave-assisted heating on chalcopyrite leaching of kinetics, interface temperature and surface energy

    Directory of Open Access Journals (Sweden)

    Tong Wen

    Full Text Available The microwave-assisted leaching was a new approach to intensify the copper recovery from chalcopyrite by hydrometallurgy. In this work, the effect of microwave-assisted heating on chalcopyrite leaching of kinetics, interfacial reaction temperature and surface energy were investigated. The activation energy of chalcopyrite leaching was affected indistinctively by the microwave-assisted heating (39.1 kJ/mol compared with the conventional heating (43.9 kJ/mol. However, the boiling point of the leaching system increased through microwave-assisted heating. Because of the improved boiling point and the selective heating of microwave, the interfacial reaction temperature increased significantly, which gave rise to the increase of the leaching recovery of copper. Moreover, the surface energy of the chalcopyrite through microwave-assisted heating was also enhanced, which was beneficial to strengthen the leaching of chalcopyrite. Keywords: Microwave-assisted heating, Chalcopyrite, Leaching kinetics, Interface temperature, Surface energy

  15. Influence of radioactivity on surface charging and aggregation kinetics of particles in the atmosphere.

    Science.gov (United States)

    Kim, Yong-Ha; Yiacoumi, Sotira; Lee, Ida; McFarlane, Joanna; Tsouris, Costas

    2014-01-01

    Radioactivity can influence surface interactions, but its effects on particle aggregation kinetics have not been included in transport modeling of radioactive particles. In this research, experimental and theoretical studies have been performed to investigate the influence of radioactivity on surface charging and aggregation kinetics of radioactive particles in the atmosphere. Radioactivity-induced charging mechanisms have been investigated at the microscopic level, and heterogeneous surface potential caused by radioactivity is reported. The radioactivity-induced surface charging is highly influenced by several parameters, such as rate and type of radioactive decay. A population balance model, including interparticle forces, has been employed to study the effects of radioactivity on particle aggregation kinetics in air. It has been found that radioactivity can hinder aggregation of particles because of similar surface charging caused by the decay process. Experimental and theoretical studies provide useful insights into the understanding of transport characteristics of radioactive particles emitted from severe nuclear events, such as the recent accident of Fukushima or deliberate explosions of radiological devices.

  16. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  17. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  18. Nucleation and growth kinetics for intercalated islands during deposition on layered materials with isolated pointlike surface defects

    International Nuclear Information System (INIS)

    Han, Yong; Lii-Rosales, A.; Zhou, Y.; Wang, C.-J.

    2017-01-01

    Theory and stochastic lattice-gas modeling is developed for the formation of intercalated metal islands in the gallery between the top layer and the underlying layer at the surface of layered materials. Our model for this process involves deposition of atoms, some fraction of which then enter the gallery through well-separated pointlike defects in the top layer. Subsequently, these atoms diffuse within the subsurface gallery leading to nucleation and growth of intercalated islands nearby the defect point source. For the case of a single point defect, continuum diffusion equation analysis provides insight into the nucleation kinetics. However, complementary tailored lattice-gas modeling produces a more comprehensive and quantitative characterization. We analyze the large spread in nucleation times and positions relative to the defect for the first nucleated island. We also consider the formation of subsequent islands and the evolution of island growth shapes. The shapes reflect in part our natural adoption of a hexagonal close-packed island structure. As a result, motivation and support for the model is provided by scanning tunneling microscopy observations of the formation of intercalated metal islands in highly-ordered pyrolytic graphite at higher temperatures.

  19. One-dimensional model of interacting-step fluctuations on vicinal surfaces: Analytical formulas and kinetic Monte Carlo simulations

    Science.gov (United States)

    Patrone, Paul N.; Einstein, T. L.; Margetis, Dionisios

    2010-12-01

    We study analytically and numerically a one-dimensional model of interacting line defects (steps) fluctuating on a vicinal crystal. Our goal is to formulate and validate analytical techniques for approximately solving systems of coupled nonlinear stochastic differential equations (SDEs) governing fluctuations in surface motion. In our analytical approach, the starting point is the Burton-Cabrera-Frank (BCF) model by which step motion is driven by diffusion of adsorbed atoms on terraces and atom attachment-detachment at steps. The step energy accounts for entropic and nearest-neighbor elastic-dipole interactions. By including Gaussian white noise to the equations of motion for terrace widths, we formulate large systems of SDEs under different choices of diffusion coefficients for the noise. We simplify this description via (i) perturbation theory and linearization of the step interactions and, alternatively, (ii) a mean-field (MF) approximation whereby widths of adjacent terraces are replaced by a self-consistent field but nonlinearities in step interactions are retained. We derive simplified formulas for the time-dependent terrace-width distribution (TWD) and its steady-state limit. Our MF analytical predictions for the TWD compare favorably with kinetic Monte Carlo simulations under the addition of a suitably conservative white noise in the BCF equations.

  20. Kinetic Monte Carlo simulation of surface segregation in Pd–Cu alloys

    International Nuclear Information System (INIS)

    Cheng, Feng; He, Xiang; Chen, Zhao-Xu; Huang, Yu-Gai

    2015-01-01

    The knowledge of surface composition and atomic arrangement is prerequisite for understanding of catalytic properties of an alloy catalyst. Gaining such knowledge is rather difficult, especially for those possessing surface segregation. Pd–Cu alloy is used in many fields and possesses surface segregation. In this paper kinetic Monte Carlo method is used to explore the surface composition and structure and to examine the effects of bulk composition and temperature on the surface segregation of Pd–Cu alloys. It is shown that the segregation basically completes within 900 s at 500 K. Below 900 K and within 20 min the enriched surface Cu atoms mainly come from the top five layers. For the first time we demonstrate that there exists a “bulk-inside flocking” or clustering phenomenon (the same component element congregates in bulk) in Pd–Cu alloys. Our results indicate that for alloys with higher Cu content there are small Pd ensembles like monomers, dimers and trimers with contiguous subsurface Pd atoms. - Highlights: • Kinetic Monte Carlo was first used to study surface segregation of Pd–Cu alloys. • Bulk-inside flocking (the same component element congregates in bulk) was observed. • Small Pd ensembles with contiguous subsurface Pd exist on surfaces of Cu-rich alloys

  1. Kinetic Monte Carlo simulation of surface segregation in Pd–Cu alloys

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Feng [Institute of Theoretical and Computational Chemistry, School of Chemistry and Chemical Engineering, Key Laboratory of Mesoscopic Chemistry of MOE, Nanjing University (China); He, Xiang [Nanjing Institute of Geography and Limnology, Chinese Academy of Sciences, Nanjing 210008 (China); Chen, Zhao-Xu, E-mail: zxchen@nju.edu.cn [Institute of Theoretical and Computational Chemistry, School of Chemistry and Chemical Engineering, Key Laboratory of Mesoscopic Chemistry of MOE, Nanjing University (China); Huang, Yu-Gai [Institute of Theoretical and Computational Chemistry, School of Chemistry and Chemical Engineering, Key Laboratory of Mesoscopic Chemistry of MOE, Nanjing University (China); JiangSu Second Normal University, Nanjing (China)

    2015-11-05

    The knowledge of surface composition and atomic arrangement is prerequisite for understanding of catalytic properties of an alloy catalyst. Gaining such knowledge is rather difficult, especially for those possessing surface segregation. Pd–Cu alloy is used in many fields and possesses surface segregation. In this paper kinetic Monte Carlo method is used to explore the surface composition and structure and to examine the effects of bulk composition and temperature on the surface segregation of Pd–Cu alloys. It is shown that the segregation basically completes within 900 s at 500 K. Below 900 K and within 20 min the enriched surface Cu atoms mainly come from the top five layers. For the first time we demonstrate that there exists a “bulk-inside flocking” or clustering phenomenon (the same component element congregates in bulk) in Pd–Cu alloys. Our results indicate that for alloys with higher Cu content there are small Pd ensembles like monomers, dimers and trimers with contiguous subsurface Pd atoms. - Highlights: • Kinetic Monte Carlo was first used to study surface segregation of Pd–Cu alloys. • Bulk-inside flocking (the same component element congregates in bulk) was observed. • Small Pd ensembles with contiguous subsurface Pd exist on surfaces of Cu-rich alloys.

  2. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  3. Plasma surface functionalization and dyeing kinetics of Pan-Pmma copolymers

    OpenAIRE

    Labay, C.; Canal, C.; Rodríguez, C.; Caballero, G.; Canal, J.M.

    2013-01-01

    Fiber surface modification with air corona plasma has been studied through dyeing kinetics under isothermal conditions at 30 °C on an acrylic-fiber fabric with a cationic dye (CI Basic Blue 3) analyzing the absorption, desorption and fixing on the surface of molecules having defined cationic character. The initial dyeing rate in the first 60 s indicates an increase of 58.3% in the dyeing rate due to the effect of corona plasma on the acrylic fiber surface. At the end of the dyeing process...

  4. COMBINED THEORETICAL AND EXPERIMENTAL INVESTIGATION OF MECHANISMS AND KINETICS OF VAPOR-PHASE MERCURY UPTAKE BY CARBONACEOUS SURFACES; ANNUAL

    International Nuclear Information System (INIS)

    Radisav D. Vidic; Eric V. Borguet; Karl J. Johnson

    2000-01-01

    The overall goal of this research program is to gain fundamental understanding of the important chemistry and physics involved in mercury adsorption on carbonaceous surfaces. This knowledge will then be used to optimize adsorption processes and operating conditions to maximize the uptake of mercury within the required contact time. An additional long-term benefit of this research is the basic understanding of the Hg adsorption process, which may facilitate the design of new adsorbents for more efficient and cost-effective removal of Hg from a variety of effluent streams. Molecular modeling of the adsorption of Hg on carbonaceous surfaces will greatly increase the insight into the physics of the adsorption process and combined with in situ rate measurements of mercury adsorption and desorption (conventional and pulsed laser) on graphite using linear and nonlinear optical probes with real time optical resolution have the potential to provide fundamental insight into the process of mercury uptake by carbonaceous surfaces. Besides accurate assessment of key parameters influencing adsorption equilibrium, fundamental understanding of the kinetics of mercury adsorption, desorption, and diffusion will be developed in this study. These key physical and chemical processes postulated through molecular modeling efforts and verified by in situ measurements will be utilized to select (or develop) promising sorbents for mercury control, which will be tested under dynamic conditions using simulated flue gas

  5. Analytical solution of the multigroup neutron diffusion kinetic equation in one-dimensional cartesian geometry by the integral transform technique

    International Nuclear Information System (INIS)

    Ceolin, Celina

    2010-01-01

    The objective of this work is to obtain an analytical solution of the neutron diffusion kinetic equation in one-dimensional cartesian geometry, to monoenergetic and multigroup problems. These equations are of the type stiff, due to large differences in the orders of magnitude of the time scales of the physical phenomena involved, which make them difficult to solve. The basic idea of the proposed method is applying the spectral expansion in the scalar flux and in the precursor concentration, taking moments and solving the resulting matrix problem by the Laplace transform technique. Bearing in mind that the equation for the precursor concentration is a first order linear differential equation in the time variable, to enable the application of the spectral method we introduce a fictitious diffusion term multiplied by a positive value which tends to zero. This procedure opened the possibility to find an analytical solution to the problem studied. We report numerical simulations and analysis of the results obtained with the precision controlled by the truncation order of the series. (author)

  6. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  7. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  8. SurfKin: an ab initio kinetic code for modeling surface reactions.

    Science.gov (United States)

    Le, Thong Nguyen-Minh; Liu, Bin; Huynh, Lam K

    2014-10-05

    In this article, we describe a C/C++ program called SurfKin (Surface Kinetics) to construct microkinetic mechanisms for modeling gas-surface reactions. Thermodynamic properties of reaction species are estimated based on density functional theory calculations and statistical mechanics. Rate constants for elementary steps (including adsorption, desorption, and chemical reactions on surfaces) are calculated using the classical collision theory and transition state theory. Methane decomposition and water-gas shift reaction on Ni(111) surface were chosen as test cases to validate the code implementations. The good agreement with literature data suggests this is a powerful tool to facilitate the analysis of complex reactions on surfaces, and thus it helps to effectively construct detailed microkinetic mechanisms for such surface reactions. SurfKin also opens a possibility for designing nanoscale model catalysts. Copyright © 2014 Wiley Periodicals, Inc.

  9. A kinetic theory of diffusion in general relativity with cosmological scalar field

    International Nuclear Information System (INIS)

    Calogero, Simone

    2011-01-01

    A new model to describe the dynamics of particles undergoing diffusion in general relativity is proposed. The evolution of the particle system is described by a Fokker-Planck equation without friction on the tangent bundle of spacetime. It is shown that the energy-momentum tensor for this matter model is not divergence-free, which makes it inconsistent to couple the Fokker-Planck equation to the Einstein equations. This problem can be solved by postulating the existence of additional matter fields in spacetime or by modifying the Einstein equations. The case of a cosmological scalar field term added to the left hand side of the Einstein equations is studied in some details. For the simplest cosmological model, namely the flat Robertson-Walker spacetime, it is shown that, depending on the initial value of the cosmological scalar field, which can be identified with the present observed value of the cosmological constant, either unlimited expansion or the formation of a singularity in finite time will occur in the future. Future collapse into a singularity also takes place for a suitable small but positive present value of the cosmological constant, in contrast to the standard diffusion-free scenario

  10. Kinetics exoelectron emission phenomena confirmed mechanism of vacancy diffusion through dislocation

    International Nuclear Information System (INIS)

    Dus-Sitek, M.; Szymura, S.; Pisarek, J.

    1998-01-01

    On the basis on the data obtained during experiments regarding the kinetics of exoelectron emission phenomenon in deformed metal, a hypothesis concerning the dislocation mechanism of vacancies transport was confirmed. The nature and character of the exoelectron emission phenomenon accompanying a plastic deformation of thermally or mechanically prepared metals showed distinct relations between the exoelectron emission phenomenon and the defects of a crystalline structure produced during processing. On the basic of the result obtained for the Ni and stainless steels has been concluded that exoelectron emission intensity accompanying an uniaxial deformation appears at the yield strain ε 0 on the stress-strain curve, and that the sharp 'destruction' emission peak is associated with the sample failure strain ε f

  11. The kinetics of formation and transformation of silver atoms on solid surfaces subjected to ionizing irradiation

    International Nuclear Information System (INIS)

    Popovich, G.M.

    1988-01-01

    The paper discusses the results obtained in ESR-assisted studies of the kinetics of formation and transformation of silver atoms generated by γ-irradiation of silver-containing carriers. Three types of dependences have been established: (1) extreme; (2) saturation curves and (3) step-like. All the kinetic curves display, after a definite period of time, stable concentrations of adsorbed silver atoms per unit of the surface at a given temperature. Depending on the temperature of the experiment, the composition and nature of the carrier, the number of adsorbed silver ions, the irradiation dose and conditions of the experiment, a stable concentration of silver atoms at a given temperature may be equal to, higher or lower than the number of silver atoms measured immediately after γ-irradiation at a temperature of liquid nitrogen. A kinetic scheme is proposed to explain the obtained curves. The model suggests that the silver atoms adsorbed on the surface, as well as those formed after γ-irradiation, are bonded to the surface by various energies, which are related to heterogeneity of the carrier surface. (author)

  12. Scaling and diffusion of oil spills in the Ocean Surface

    Science.gov (United States)

    Tarquis, A. M.; Platonov, A.; Grau, J.; Sekula, E.

    2010-05-01

    The region of the Gulf of Lions at the northwestern Mediterranean Sea has been studied within a ten-year period from December 1996 until November 2006. More than 1000 synthetic aperture radar (SAR) images, which have been acquired by the Second European Remote Sensing Satellite (ERS 1/2) as well as from ENVISAT. We present statistical results of the structure of several features revealed by SAR such as oil spills and tensioactive slicks dynamic. We compare oil splils obtained from the projects Clean Seas,ENVA4/CT/0334, RC2003/005700, ESP2005/07551 and ESA/AO/IP2240. Since natural (caused by plankton, fish, etc.) slicks as well as man-made oil slicks dampen the small-scale surface waves, which are responsible for the radar backscattering from the ocean surface, both types of effects may be confused and give look/alike false oil spill detections. The early SAR images were processed at a resolution of 1 pixel=200m and were provided by the RApid Information Dissemination System (RAIDS) SAR processing facility in West Freugh, UK. Recent ENVISAT images directly from ESA allow a higher resolution of 1 pixel = 26 m, improving the detected turbulent scaling range. The occurrence of marine oil pollution as well as several dynamic features near Barcelona (frames 8-10, 19, 20; 200 SAR images)is itself a random multi-scale process. The use of different multifractal techniques, both using limits to the smallest and largest available scales, show that the scaling laws are very complex and depend strongly on intermittency of the assumed turbulent cascade, the shapes of the multifractal spectra functions are seen to deviate from an homogeneous multifractal and depend both on the initial conditions of the spill or slick, and on the transit time that the spill has been subjected to the local turbulence.

  13. Growth kinetics of the intermetallic phase in diffusion-soldered (Cu-5 at.%Ni)/Sn/(Cu-5 at.%Ni) interconnections

    NARCIS (Netherlands)

    Wierzbicka-Miernik, A.; Miernik, K.; Wojewoda-Budka, J.; Szyszkiewicz, K.; Filipek, R.; Litynska-Dobrzynska, L.; Kodentsov, A.; Zieba, P.

    2013-01-01

    A stereological analysis was carried out in order to obtain the kinetics parameters of the (Cu1-xNix)6Sn5 growth in the diffusion soldered (Cu–5 at.%Ni)/Sn/(Cu–5 at.%Ni) interconnections where previously anomalous fast growth of this phase was described. The n-parameter in the equation x = ktn was

  14. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  15. Diffusion kinetics and spinodal decay of quasi-equilibrium solid solutions

    International Nuclear Information System (INIS)

    Zakharov, M.A.

    2000-01-01

    Phenomenological theory for rearrangement of solid solutions with the hierarchy of the component atomic mobilities is elaborated in the approximation of the local equilibrium. The hydrodynamic stage of the evolution of these solutions is studied as a sequence of quasi-equilibrium states characterized by implementation of some conditions of the total equilibrium. On the basis of separation of fast and slow constituents of diffusion and on the basis of the method of reduced description one derived equation for evolution of separations of fast components in quasi-equilibrium solid solutions at the arbitrary stages of rearrangement in terms of the generalized lattice model taking account of the proper volumes of the components. The conditions of the stability of quasi-equilibrium solutions to the spinodal decomposition are determined and the equations of metastability boundaries of such systems are derived [ru

  16. Coverage dependent desorption dynamics of deuterium on Si(100) surfaces: interpretation with a diffusion-promoted desorption model.

    Science.gov (United States)

    Matsuno, T; Niida, T; Tsurumaki, H; Namiki, A

    2005-01-08

    We studied coverage dependence of time-of-flight (TOF) spectra of D2 molecules thermally desorbed from the D/Si(100) surface. The mean translational energies Et of desorbed D2 molecules were found to increase from 0.20+/-0.05 eV to 0.40+/-0.04 eV as the desorption coverage window was decreased from 1.0 ML> or =thetaD> or =0.9 ML to 0.2 ML> or =thetaD> or =0 ML, being consistent with the kinetics switch predicted in the interdimer mechanism. The measured TOF spectra were deconvoluted into 2H, 3H, and 4H components by a curve fitting method along the principle of detailed balance. As a result, it turned out that the desorption kinetics changes from the 4H to the 3H situation at high coverage above thetaD=0.9 ML, while the 2H desorption is dominant for a quite wide coverage region up to thetaD=0.8 ML. A dynamic desorption mechanism by which the desorption is promoted by D-atom diffusion to dangling bonds was proposed. 2005 American Institute of Physics.

  17. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  18. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  19. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  20. Plasma transport in stochastic magnetic fields. III. Kinetics of test-particle diffusion

    International Nuclear Information System (INIS)

    Krommes, J.A.; Oberman, C.; Kleva, R.G.

    1982-07-01

    A discussion is given of test particle transport in the presence of specified stochastic magnetic fields, with particular emphasis on the collisional limit. Certain paradoxes and inconsistencies in the literature regarding the form of the scaling laws are resolved by carefully distinguishing a number of physically distinct correlation lengths, and thus by identifying several collisional subregimes. The common procedure of averaging the conventional fluid equations over the statistics of a random field is shown to fail in some important cases because of breakdown of the Chapman-Enskog ordering in the presence of a stochastic field component with short autocorrelation length. A modified perturbation theory is introduced which leads to a Kubo-like formula valid in all collisionality regimes. The direct-interaction approximation is shown to fail in the interesting limit in which the orbit exponentiation length L/sub K/ appears explicitly. A higher order renormalized kinetic theory in which L/sub K/ appears naturally is discussed and used to rederive more systematically the results of the heuristic scaling arguments

  1. INTRODUCTION: Surface Dynamics, Phonons, Adsorbate Vibrations and Diffusion

    Science.gov (United States)

    Bruch, L. W.

    2004-07-01

    understanding of the underlying factors determining the optical quality of GaInNAs, such as composition, growth and annealing conditions. We are still far from establishing an understanding of the band structure and its dependence on composition. Fundamental electronic interactions such as electron-electron and electron-phonon scattering, dependence of effective mass on composition, strain and orientation, quantum confinement effects, effects of localized nitrogen states on high field transport and on galvanometric properties, and mechanisms for light emission in these materials, are yet to be fully understood. Nature and formation mechanisms of grown-in and processing-induced defects that are important for material quality and device performance are still unknown. Such knowledge is required in order to design strategies to efficiently control and eliminate harmful defects. For many potential applications (such as solar cells, HBTs) it is essential to get more information on the transport properties of dilute nitride materials. The mobility of minority carriers is known to be low in GaInNAs and related material. The experimental values are far from reaching the theoretical ones, due to defects and impurities introduced in the material during the growth. The role of the material inhomogeneities on the lateral carrier transport also needs further investigation. From the device's point of view most attention to date has been focused on the GaInNAs/GaAs system, mainly because of its potential for optoelectronic devices covering the 1.3-1.55 µm data and telecommunications wavelength bands. As is now widely appreciated, these GaAs-compatible structures allow monolithic integration of AlGaAs-based distributed Bragg reflector mirrors (DBRs) for vertical cavity surface-emitting lasers with low temperature sensitivity and compatibility with AlOx-based confinement techniques. In terms of conventional edge-emitting lasers (EELs), the next step is to extend the wavelength range for cw room

  2. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  3. The analytical benchmark solution of spatial diffusion kinetics in source driven systems for homogeneous media

    International Nuclear Information System (INIS)

    Oliveira, F.L. de; Maiorino, J.R.; Santos, R.S.

    2007-01-01

    This paper describes a closed form solution obtained by the expansion method for the general time dependent diffusion model with delayed emission for source transients in homogeneous media. In particular, starting from simple models, and increasing the complexity, numerical results were obtained for different types of source transients. Thus, first an analytical solution of the one group without precursors was solved, followed by considering one precursors family. The general case of G-groups with R families of precursor although having a closed form solution, cannot be solved analytically, since there are no explicit formulae for the eigenvalues, and numerical methods must be used to solve such problem. To illustrate the general solution, the multi-group (three groups) time-dependent without precursors was also solved and the results inter compared with results obtained by the previous one group models for a given fast homogeneous media, and different types of source transients. The results are being compared with the obtained by numerical methods. (author)

  4. Coarse-grained stochastic processes and kinetic Monte Carlo simulators for the diffusion of interacting particles

    Science.gov (United States)

    Katsoulakis, Markos A.; Vlachos, Dionisios G.

    2003-11-01

    We derive a hierarchy of successively coarse-grained stochastic processes and associated coarse-grained Monte Carlo (CGMC) algorithms directly from the microscopic processes as approximations in larger length scales for the case of diffusion of interacting particles on a lattice. This hierarchy of models spans length scales between microscopic and mesoscopic, satisfies a detailed balance, and gives self-consistent fluctuation mechanisms whose noise is asymptotically identical to the microscopic MC. Rigorous, detailed asymptotics justify and clarify these connections. Gradient continuous time microscopic MC and CGMC simulations are compared under far from equilibrium conditions to illustrate the validity of our theory and delineate the errors obtained by rigorous asymptotics. Information theory estimates are employed for the first time to provide rigorous error estimates between the solutions of microscopic MC and CGMC, describing the loss of information during the coarse-graining process. Simulations under periodic boundary conditions are used to verify the information theory error estimates. It is shown that coarse-graining in space leads also to coarse-graining in time by q2, where q is the level of coarse-graining, and overcomes in part the hydrodynamic slowdown. Operation counting and CGMC simulations demonstrate significant CPU savings in continuous time MC simulations that vary from q3 for short potentials to q4 for long potentials. Finally, connections of the new coarse-grained stochastic processes to stochastic mesoscopic and Cahn-Hilliard-Cook models are made.

  5. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  6. In situ studies of the kinetics of surface topography development during ion irradiation

    International Nuclear Information System (INIS)

    Levinskas, R.; Pranevicius, L.

    1996-01-01

    Studies of the mechanical properties of the materials affected by 25-200 keV H + , He + , Ne + and Ar + ion irradiation in the range of fluences up to 2 · 10 17 cm -2 based on the analysis of acoustic emission signals, kinetics of the surface deformations measured by laser interferometric technique and the variations of the surface acoustic waves propagation velocity are conducted. The acoustic emissions source mechanisms under various ion irradiation conditions are discussed and relative contribution various possible mechanism are indicated. The correlation of experimental results obtained by different methods of analysis is done. (author). 11 refs, 5 figs

  7. Final Report: Mechanisms of sputter ripple formation: coupling among energetic ions, surface kinetics, stress and composition

    Energy Technology Data Exchange (ETDEWEB)

    Chason, Eric; Shenoy, Vivek

    2013-01-22

    Self-organized pattern formation enables the creation of nanoscale surface structures over large areas based on fundamental physical processes rather than an applied template. Low energy ion bombardment is one such method that induces the spontaneous formation of a wide variety of interesting morphological features (e.g., sputter ripples and/or quantum dots). This program focused on the processes controlling sputter ripple formation and the kinetics controlling the evolution of surfaces and nanostructures in high flux environments. This was done by using systematic, quantitative experiments to measure ripple formation under a variety of processing conditions coupled with modeling to interpret the results.

  8. Scratching the surface of ice: Interfacial phase transitions and their kinetic implications

    Science.gov (United States)

    Limmer, David

    The surface structure of ice maintains a high degree of disorder down to surprisingly low temperatures. This is due to a number of underlying interfacial phase transitions that are associated with incremental changes in broken symmetry relative to the bulk crystal. In this talk I summarize recent work attempting to establish the nature and locations of these different phase transitions as well as how they depend on external conditions and nonequilibrium driving. The implications of this surface disorder is discussed in the context of simple kinetic processes that occur at these interfaces. Recent experimental work on the roughening transition is highlighted.

  9. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  10. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  11. Non-equilibrium Thermodynamic Dissolution Theory for Multi-Component Solid/Liquid Surfaces Involving Surface Adsorption and Radiolysis Kinetics

    International Nuclear Information System (INIS)

    Stout, R B

    2001-01-01

    A theoretical expression is developed for the dissolution rate response for multi-component radioactive materials that have surface adsorption kinetics and radiolysis kinetics when wetted by a multi-component aqueous solution. An application for this type of dissolution response is the performance evaluation of multi-component spent nuclear fuels (SNFs) for long term interim storage and for geological disposition. Typically, SNF compositions depend on initial composition, uranium oxide and metal alloys being most common, and on reactor burnup which results in a wide range of fission product and actinide concentrations that decay by alpha, beta, and gamma radiation. These compositional/burnup ranges of SNFs, whether placed in interim storage or emplaced in a geologic repository, will potentially be wetted by multi-component aqueous solutions, and these solutions may be further altered by radiolytic aqueous species due to three radiation fields. The solid states of the SNFs are not thermodynamically stable when wetted and will dissolve, with or without radiolysis. The following development of a dissolution theory is based on a non-equilibrium thermodynamic analysis of energy reactions and energy transport across a solid-liquid phase change discontinuity that propagates at a quasi-steady, dissolution velocity. The integral form of the energy balance equation is used for this spatial surface discontinuity analysis. The integral formulation contains internal energy functional of classical thermodynamics for both the SNFs' solid state and surface adsorption species, and the adjacent liquid state, which includes radiolytic chemical species. The steady-state concentrations of radiolytic chemical species are expressed by an approximate analysis of the decay radiation transport equation. For purposes of illustration a modified Temkin adsorption isotherm was assumed for the surface adsorption kinetics on an arbitrary, finite area of the solid-liquid dissolution interface. For

  12. Kinetic effects on the propagation of surface waves and their relevance to the heating of the solar corona

    International Nuclear Information System (INIS)

    Kuperus, M.; Heyvaerts, J.

    1980-01-01

    The MHD oscillations of the Alfven type running along surfaces of discontinuity generate motions in the discontinuity region which come rapidly out of phase. It is shown how the mathematical theory of this phase detuning predicts that surface wave should suffer dissipationless damping. Real damping is actually achieved by viscosity or kinetic effects. When detuning has grown to a large enough level, however, oscillations must be described by kinetic theory. Kinetic Alfven waves differ from perfect MHD Alfven waves in that they are able to propagate across the field. A theory of kinetic type oscillations in a finite thickness boundary is described, which predicts that surface waves generate intense kinetic Alfven waves in this boundary. The subsequent dissipation of these waves may be a powerful heating mechanism [fr

  13. Bubble extinction in Hele-Shaw flow with surface tension and kinetic undercooling regularization

    International Nuclear Information System (INIS)

    Dallaston, Michael C; McCue, Scott W

    2013-01-01

    We perform an analytic and numerical study of an inviscid contracting bubble in a two-dimensional Hele-Shaw cell, where the effects of both surface tension and kinetic undercooling on the moving bubble boundary are not neglected. In contrast to expanding bubbles, in which both boundary effects regularize the ill-posedness arising from the viscous (Saffman–Taylor) instability, we show that in contracting bubbles the two boundary effects are in competition, with surface tension stabilizing the boundary, and kinetic undercooling destabilizing it. This competition leads to interesting bifurcation behaviour in the asymptotic shape of the bubble in the limit it approaches extinction. In this limit, the boundary may tend to become either circular, or approach a line or ‘slit’ of zero thickness, depending on the initial condition and the value of a nondimensional surface tension parameter. We show that over a critical range of surface tension values, both these asymptotic shapes are stable. In this regime there exists a third, unstable branch of limiting self-similar bubble shapes, with an asymptotic aspect ratio (dependent on the surface tension) between zero and one. We support our asymptotic analysis with a numerical scheme that utilizes the applicability of complex variable theory to Hele-Shaw flow. (paper)

  14. Effect of Ingredient Loading on Surface Migration Kinetics of Additives in Vulcanized Natural Rubber Compounds

    Directory of Open Access Journals (Sweden)

    Bryan B. Pajarito

    2014-12-01

    Full Text Available Surface migration kinetics of chemical additives in vulcanized natural rubber compounds were studied as function of ingredient loading. Rubber sheets were compounded according to a 212-8 fractional factorial design of experiment, where ingredients were treated as factors varied at two levels of loading. Amount of migrated additives in surface of rubber sheets was monitored through time at ambient conditions. The maximum amount and estimated rate of additive migration were determined from weight loss kinetic curves. Attenuated total reflection–Fourier transform infrared (ATR-FTIR spectroscopy and optical microscopy were used to characterize the chemical structure and surface morphology of sheet specimens during additive migration. ANOVA results showed that increased loading of reclaimed rubber, CaCO3, and paraffin wax signif icantly decreased the maximum amount of additive migration; by contrast, increased loading of used oil, asphalt, and mercaptobenzothiazole disulphide (MBTS increased the maximum amount. Increased loading of sulfur, diphenylguanidine (DPG, and paraffin wax significantly decreased the additive migration rate; increased loading of used oil, asphalt, and stearic acid elicited an opposite effect. Comparison of ATRFTIR spectra of migrated and cleaned rubber surfaces showed signif icant variation in intensity of specif ic absorbance bands that are also present in infrared spectra of migrating chemicals. Paraffin wax, used oil, stearic acid, MBTS, asphalt, and zinc stearate were identified to bloom and bleed in the rubber sheets. Optical micrographs of migrated rubber surfaces revealed formation of white precipitates due to blooming and of semi-transparent wet patches due to bleeding.

  15. A general treatment of one- to three-dimensional diffusion reaction kinetics of interstitial clusters: Implications for the evolution of voids

    International Nuclear Information System (INIS)

    Trinkaus, H.; Singh, B.N.; Golubov, S.I.

    2008-05-01

    In recent years, it has been shown that a number of striking features in the microstructural evolution occurring in metals under cascade damage generating irradiation (e.g. enhanced swelling near grain boundaries, decoration of dislocations with SIA loops, saturation of void growth and void lattice formation) can be rationalised in terms of intra-cascade clustering of vacancies and self-interstitial atoms (SIAs), differences in the thermal stability and mobility of the resulting clusters and one-dimensional (1D) glide diffusion of SIA clusters ('production bias model'). The 1D diffusion of SIA clusters is generally disturbed by changes between equivalent 1D diffusion paths and by transversal diffusion by self-climb, resulting in diffusion reaction kinetics between the 1D and 3D limiting cases. In this paper, a general treatment of such kinetics operating in systems containing random distributions of sinks is presented. The complicated partial sink strengths of different components of the system for the annihilation of SIA clusters are expressed by those for the simple 1D and 3D limiting cases. The effects of direction changes and transversal diffusion are first considered separately and are then combined. The significance of the present treatment for damage accumulation under cascade damage conditions is illustrated by applying it to the discussion of void growth characteristics, particularly of the conditions for saturation of void growth. (au)

  16. A general treatment of one- to three-dimensional diffusion reaction kinetics of interstitial clusters: Implications for the evolution of voids

    Energy Technology Data Exchange (ETDEWEB)

    Trinkaus, H. (Inst. Festkoerperforschung, Forschungszentrum Juelich (Germany)); Singh, B.N. (Risoe DTU, Roskilde (Denmark)); Golubov, S.I. (Oak Ridge National Lab., Materials Science and Technology Div., TN (United States))

    2008-05-15

    In recent years, it has been shown that a number of striking features in the microstructural evolution occurring in metals under cascade damage generating irradiation (e.g. enhanced swelling near grain boundaries, decoration of dislocations with SIA loops, saturation of void growth and void lattice formation) can be rationalised in terms of intra-cascade clustering of vacancies and self-interstitial atoms (SIAs), differences in the thermal stability and mobility of the resulting clusters and one-dimensional (1D) glide diffusion of SIA clusters ('production bias model'). The 1D diffusion of SIA clusters is generally disturbed by changes between equivalent 1D diffusion paths and by transversal diffusion by self-climb, resulting in diffusion reaction kinetics between the 1D and 3D limiting cases. In this paper, a general treatment of such kinetics operating in systems containing random distributions of sinks is presented. The complicated partial sink strengths of different components of the system for the annihilation of SIA clusters are expressed by those for the simple 1D and 3D limiting cases. The effects of direction changes and transversal diffusion are first considered separately and are then combined. The significance of the present treatment for damage accumulation under cascade damage conditions is illustrated by applying it to the discussion of void growth characteristics, particularly of the conditions for saturation of void growth. (au)

  17. Plasma surface functionalization and dyeing kinetics of Pan-Pmma copolymers

    Science.gov (United States)

    Labay, C.; Canal, C.; Rodríguez, C.; Caballero, G.; Canal, J. M.

    2013-10-01

    Fiber surface modification with air corona plasma has been studied through dyeing kinetics under isothermal conditions at 30 °C on an acrylic-fiber fabric with a cationic dye (CI Basic Blue 3) analyzing the absorption, desorption and fixing on the surface of molecules having defined cationic character. The initial dyeing rate in the first 60 s indicates an increase of 58.3% in the dyeing rate due to the effect of corona plasma on the acrylic fiber surface. At the end of the dyeing process, the plasma-treated fabrics absorb 24.7% more dye, and the K/S value of the acrylic fabric increases by 8.8%. With selected dyestuff molecules, new techniques can be designed to amplify the knowledge about plasma-treated surface modifications of macromolecules.

  18. Surface kinetic roughening caused by dental erosion: An atomic force microscopy study

    Science.gov (United States)

    Quartarone, Eliana; Mustarelli, Piercarlo; Poggio, Claudio; Lombardini, Marco

    2008-05-01

    Surface kinetic roughening takes place both in case of growth and erosion processes. Teeth surfaces are eroded by contact with acid drinks, such as those used to supplement mineral salts during sporting activities. Calcium-phosphate based (CPP-ACP) pastes are known to reduce the erosion process, and to favour the enamel remineralization. In this study we used atomic force microscopy (AFM) to investigate the surface roughening during dental erosion, and the mechanisms at the basis of the protection role exerted by a commercial CPP-ACP paste. We found a statistically significant difference (p<0.01) in the roughness of surfaces exposed and not exposed to the acid solutions. The treatment with the CPP-ACP paste determined a statistically significant reduction of the roughness values. By interpreting the AFM results in terms of fractal scaling concepts and continuum stochastic equations, we showed that the protection mechanism of the paste depends on the chemical properties of the acid solution.

  19. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  20. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  1. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  2. Kinetics of interaction from low-energy-ion bombardment of surfaces

    International Nuclear Information System (INIS)

    Horton, C.C.

    1988-01-01

    The kinetics of interaction from low energy oxygen ion bombardment of carbon and Teflon surfaces have been investigated. The surfaces were bombarded with 4.5 to 93 eV oxygen ions and emitted species were observed with a mass spectrometer. To obtain the kinetic information, the ion beam was square pulse modulated and reaction products were observed as a function of time. The kinetic information is contained in the response of the emitted species to the pulsed ion beam. Oxygen bombardment of carbon produced CO in three parallel branches with each following an adsorption-desorption process. The fast branch, with a rate constants of 12,000/sec, appeared to be sputter induced an was absent below about 19 eV. The medium and slow branches, with rate constants of 850/sec and 45/sec respectively, has little energy dependence and appeared to be due to chemical sputtering from two sites. The ratio of the fraction of the medium branch to that of the slow was constant at 1:3. The bombardment of Teflon produced CF in two parallel branches, with one following a series process and the other an adsorb-desorb process. The rate constant of the other branch were 22,000/sec and 7,000/sec and the rate constant of the other branch was 90/sec. The total signal fell monotonically with decreasing ion energy with the fraction for each branch holding constant at 71% for the series and 29% for the adsorb-desorb

  3. Quantitative kinetics of proteolytic enzymes determined by a surface concentration-based assay using peptide arrays.

    Science.gov (United States)

    Jung, Se-Hui; Kong, Deok-Hoon; Park, Seoung-Woo; Kim, Young-Myeong; Ha, Kwon-Soo

    2012-08-21

    Peptide arrays have emerged as a key technology for drug discovery, diagnosis, and cell biology. Despite the promise of these arrays, applications of peptide arrays to quantitative analysis of enzyme kinetics have been limited due to the difficulty in obtaining quantitative information of enzymatic reaction products. In this study, we developed a new approach for the quantitative kinetics analysis of proteases using fluorescence-conjugated peptide arrays, a surface concentration-based assay with solid-phase peptide standards using dry-off measurements, and compared it with an applied concentration-based assay. For fabrication of the peptide arrays, substrate peptides of cMMP-3, caspase-3, caspase-9, and calpain-1 were functionalized with TAMRA and cysteine, and were immobilized onto amine-functionalized arrays using a heterobifunctional linker, N-[γ-maleimidobutyloxy]succinimide ester. The proteolytic activities of the four enzymes were quantitatively analyzed by calculating changes induced by enzymatic reactions in the concentrations of peptides bound to array surfaces. In addition, this assay was successfully applied for calculating the Michaelis constant (K(m,surf)) for the four enzymes. Thus, this new assay has a strong potential for use in the quantitative evaluation of proteases, and for drug discovery through kinetics studies including the determination of K(m) and V(max).

  4. MODELLING OF KINETICS OF FLUORINE ADSORPTION ONTO MODIFIED DIATOMITE

    Directory of Open Access Journals (Sweden)

    VEACESLAV ZELENTSOV

    2017-03-01

    Full Text Available The paper presents kinetics modelling of adsorption of fluorine onto modified diatomite, its fundamental characteristics and mathematical derivations. Three models of defluoridation kinetics were used to fit the experimental results on adsorption fluorine onto diatomite: the pseudo-first order model Lagergren, the pseudo-second order model G. McKay and H.S. Ho and intraparticle diffusion model of W.J. Weber and J.C. Morris. Kinetics studies revealed that the adsorption of fluorine followed second-order rate model, complimented by intraparticle diffusion kinetics. The adsorption mechanism of fluorine involved three stages – external surface adsorption, intraparticle diffusion and the stage of equilibrium.

  5. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  6. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  7. Comparison of skating kinetics and kinematics on ice and on a synthetic surface.

    Science.gov (United States)

    Stidwill, T J; Pearsall, David; Turcotte, Rene

    2010-03-01

    The recent popularization and technological improvements of synthetic or artificial ice surfaces provide an attractive alternative to real ice in venues where the latter is impractical to install. Potentially, synthetic ice (SI) may be installed in controlled laboratory settings to permit detailed biomechanical analysis of skating manoeuvres. Unknown, however, is the extent to which skating on SI replicates skating on traditional ice (ICE). Hence, the purpose of this study was to compare kinetic and kinematic forward skating parameters between SI and ICE surfaces. With 11 male hockey players, a portable strain gauge system adhered to the outside of the skate blade holder was used to measure skate propulsive force synchronized with electrogoniometers for tracking dynamic knee and ankle movements during forward skating acceleration. In general, the kinetic and kinematic variables investigated in this study showed minimal differences between the two surfaces (P > 0.06), and no individual variable differences were identified between the two surfaces (P > or = 0.1) with the exception of greater knee extension on SI than ICE (15.2 degrees to 11.0 degrees; P skating, and thus offer the potential for valid analogous conditions for in-lab testing and training.

  8. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  9. Cesium, manganese and cobalt water-sediment transfer kinetics and diffusion into mangrove sediments inferred by radiotracer experiments

    International Nuclear Information System (INIS)

    Machado, E.C.; Machado, W.; Patchineelam, S.R.

    2012-01-01

    A study on the trace elements transfer from tidal water to mangrove sediments from Guanabara Bay (southeastern Brazil) was performed in laboratory microcosms. Sediment cores were covered with tidal water spiked with 137 Cs, 54 Mn and 57 Co during 5-h experiments, and water samples were taken at regular intervals to measure uptake kinetics at the sediment-water interface. At the end of the experiments, the uptake and diffusional penetration into the sediments was evaluated. Half-removal times from water to sediments were slightly higher for 137 Cs (3.4 ± 1.7 h) than observed for 54 Mn (2.3 ± 0.2 h) and 57 Co (2.6 ± 1.1 h). After these experiments, all radioisotopes presented decreasing activities with increasing sediment depth, being the distribution of 137 Cs indicative of higher diffusion within the upper 2 cm. This study on the removal of 137 Cs, 54 Mn and 57 Co from tidal water by mangrove sediments suggests that while 57 Co and 54 Mn presented closer behaviors, there was a slightly higher mobility of 137 Cs. (author)

  10. Analytical representation of the solution of the space kinetic diffusion equation in a one-dimensional and homogeneous domain

    Energy Technology Data Exchange (ETDEWEB)

    Tumelero, Fernanda; Bodmann, Bardo E. J.; Vilhena, Marco T. [Universidade Federal do Rio Grande do Sul (PROMEC/UFRGS), Porto Alegre, RS (Brazil). Programa de Pos Graduacao em Engenharia Mecanica; Lapa, Celso M.F., E-mail: fernanda.tumelero@yahoo.com.br, E-mail: bardo.bodmann@ufrgs.br, E-mail: mtmbvilhena@gmail.com, E-mail: lapa@ien.gov.br [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil)

    2017-07-01

    In this work we solve the space kinetic diffusion equation in a one-dimensional geometry considering a homogeneous domain, for two energy groups and six groups of delayed neutron precursors. The proposed methodology makes use of a Taylor expansion in the space variable of the scalar neutron flux (fast and thermal) and the concentration of delayed neutron precursors, allocating the time dependence to the coefficients. Upon truncating the Taylor series at quadratic order, one obtains a set of recursive systems of ordinary differential equations, where a modified decomposition method is applied. The coefficient matrix is split into two, one constant diagonal matrix and the second one with the remaining time dependent and off-diagonal terms. Moreover, the equation system is reorganized such that the terms containing the latter matrix are treated as source terms. Note, that the homogeneous equation system has a well known solution, since the matrix is diagonal and constant. This solution plays the role of the recursion initialization of the decomposition method. The recursion scheme is set up in a fashion where the solutions of the previous recursion steps determine the source terms of the subsequent steps. A second feature of the method is the choice of the initial and boundary conditions, which are satisfied by the recursion initialization, while from the rst recursion step onward the initial and boundary conditions are homogeneous. The recursion depth is then governed by a prescribed accuracy for the solution. (author)

  11. The Effect of Temperature on Kinetics and Diffusion Coefficients of Metallocene Derivatives in Polyol-Based Deep Eutectic Solvents.

    Directory of Open Access Journals (Sweden)

    Laleh Bahadori

    Full Text Available The temperature dependence of the density, dynamic viscosity and ionic conductivity of several deep eutectic solvents (DESs containing ammonium-based salts and hydrogen bond donvnors (polyol type are investigated. The temperature-dependent electrolyte viscosity as a function of molar conductivity is correlated by means of Walden's rule. The oxidation of ferrocene (Fc/Fc+ and reduction of cobaltocenium (Cc+/Cc at different temperatures are studied by cyclic voltammetry and potential-step chronoamperometry in DESs. For most DESs, chronoamperometric transients are demonstrated to fit an Arrhenius-type relation to give activation energies for the diffusion of redox couples at different temperatures. The temperature dependence of the measured conductivities of DES1 and DES2 are better correlated with the Vogel-Tamman-Fulcher equation. The kinetics of the Fc/Fc+ and Cc+/Cc electrochemical systems have been investigated over a temperature range from 298 to 338 K. The heterogeneous electron transfer rate constant is then calculated at different temperatures by means of a logarithmic analysis. The glycerol-based DES (DES5 appears suitable for further testing in electrochemical energy storage devices.

  12. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  13. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  14. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  15. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  16. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  17. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  18. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  20. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  1. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  2. Salt effects on the air/solution interfacial properties of PEO-containing copolymers: equilibrium, adsorption kinetics and surface rheological behavior.

    Science.gov (United States)

    Llamas, Sara; Mendoza, Alma J; Guzmán, Eduardo; Ortega, Francisco; Rubio, Ramón G

    2013-06-15

    Lithium cations are known to form complexes with the oxygen atoms of poly(oxyethylene) chains. The effect of Li(+) on the surface properties of three block-copolymers containing poly(oxyethylene) (PEO) have been studied. Two types of copolymers have been studied, a water soluble one of the pluronic family, PEO-b-PPO-b-PEO, PPO being poly(propyleneoxyde), and two water insoluble ones: PEO-b-PS and PEO-b-PS-b-PEO, PS being polystyrene. In the case of the pluronic the adsorption kinetics, the equilibrium surface tension isotherm and the aqueous/air surface rheology have been measured, while for the two insoluble copolymers only the surface pressure and the surface rheology have been studied. In all the cases two different Li(+) concentrations have been used. As in the absence of lithium ions, the adsorption kinetics of pluronic solutions shows two processes, and becomes faster as [Li(+)] increases. The kinetics is not diffusion controlled. For a given pluronic concentration the equilibrium surface pressure increases with [Li(+)], and the isotherms show two surface phase transitions, though less marked than for [Li(+)]=0. A similar behavior was found for the equilibrium isotherms of PEO-b-PS and PEO-b-PS-b-PEO. The surface elasticity of these two copolymers was found to increase with [Li(+)] over the whole surface concentration and frequency ranges studied. A smaller effect was found in the case of the pluronic solutions. The results of the pluronic solutions were modeled using a recent theory that takes into account that the molecules can be adsorbed at the surface in two different states. The theory gives a good fit for the adsorption kinetics and a reasonably good prediction of the equilibrium isotherms for low and intermediate concentrations of pluronic. However, the theory is not able to reproduce the isotherm for [Li(+)]=0. Only a semi-quantitative prediction of the surface elasticity is obtained for [pluronic]≤1×10(-3) mM. Copyright © 2013 Elsevier Inc. All

  3. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

    2006-01-01

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  4. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  5. Carbon diffusion paths and segregation at high-angle tilt grain boundaries in α-Fe studied by using a kinetic activation-relation technique

    Science.gov (United States)

    Restrepo, Oscar A.; Mousseau, Normand; Trochet, Mickaël; El-Mellouhi, Fedwa; Bouhali, Othmane; Becquart, Charlotte S.

    2018-02-01

    Carbon diffusion and segregation in iron is fundamental to steel production but is also associated with corrosion. Using the kinetic activation-relaxation technique (k-ART), a kinetic Monte Carlo (KMC) algorithm with an on-the-fly catalog that allows to obtain diffusion properties over large time scales taking into account long-range elastic effects coupled with an EAM force field, we study the motion of a carbon impurity in four Fe systems with high-angle grain boundaries (GB), focusing on the impact of these extended defects on the long-time diffusion of C. Short and long-time stability of the various GBs is first analyzed, which allows us to conclude that the Σ 3 (1 1 1 ) θ =109 .53∘ GB is unstable, with Fe migration barriers of ˜0.1 eV or less, and C acts as a pinning center. Focusing on three stable GBs, in all cases, these extended defects trap C in energy states lower than found in the crystal. Yet, contrary to general understanding, we show, through simulations extending to 0.1 s, that even tough C diffusion takes place predominantly in the GB, it is not necessarily faster than in the bulk and can even be slower by one to two orders of magnitude depending on the GB type. Analysis of the energy landscape provided by k-ART also shows that the free cavity volume around the impurity is not a strong predictor of diffusion barrier height. Overall, results show rather complex diffusion kinetics intimately dependent on the local environment.

  6. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  7. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  8. Shaping optimal zinc coating on the surface of high-quality ductile iron casting. Part II – Technological formula and value of diffusion coefficient

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2017-03-01

    Full Text Available The completed research presented in the first part of the article has allowed linking the manufacturing technology of ductile iron castings with the process of hot dip galvanizing. On the basis of these data simulations were carried out to examine the behaviour of zinc diffusion coefficient D in the galvanized coating. The adopted model of zinc coating growth helped to explain the cases of excessive growth of the intermetallic phases in this type of coating. The paper analyzes covered the relationship between the roughness and phase composition of the top layer of product and the thickness and kinetics of zinc coating growth referred to individual sub-layers of the intermetallic phases.Roughness and phase composition in the surface layer of product were next related to the diffusion coefficient D examined in respective sublayers of the intermetallic phases.

  9. The surface blistering kinetics and the H-platelet evolution in H-implanted germanium

    International Nuclear Information System (INIS)

    Yang Fan; Zhang Xuanxiong; Ye Tianchun; Zhuang Songlin

    2012-01-01

    The surface blistering phenomenon produced in H-implanted Ge by a series of low temperature annealing processes was investigated. The kinetic plot of the onset of blistering contains a break point that separates the straight-line plot into two parts, with two distinct slopes based on the calculated activation energy from the different temperature regions for 3×10 16 cm -2 and 5×10 16 cm -2 H-implanted doses. This plot indicates the existence of distinct, temperature dependent mechanisms, probably caused by the release of different types of H-platelets. The turning direction (from low to high temperature) of the Arrhenius plot with the break point is contrary to that of other known materials. The formation and evolution of the H-platelets under the Ge surface was revealed by TEM (transmission electron microscopy). The TEM results demonstrate that the 〈0 0 1〉 platelets parallel to the sample surface are first produced by a low H implantation dose; however, the vertical 〈0 1 0〉 platelets perpendicular to the sample surface form later as the H implantation dose increases. The H-platelets combine with each other, becoming micro-cracks. The {1 1 1} and {3 1 1} micro-cracks serve as interconnections between the 〈0 0 1〉-oriented micro-cracks below the substrate surface. Finally, the accumulated H 2 pressure in the cracks deforms the surface to generate Ge surface exfoliation.

  10. Adsorption/desorption kinetics of Na atoms on reconstructed Si (111)-7 x 7 surface

    International Nuclear Information System (INIS)

    Chauhan, Amit Kumar Singh; Govind; Shivaprasad, S.M.

    2010-01-01

    Self-assembled nanostructures on a periodic template are fundamentally and technologically important as they put forward the possibility to fabricate and pattern micro/nano-electronics for sensors, ultra high-density memories and nanocatalysts. Alkali-metal (AM) nanostructure grown on a semiconductor surface has received considerable attention because of their simple hydrogen like electronic structure. However, little efforts have been made to understand the fundamental aspects of the growth mechanism of self-assembled nanostructures of AM on semiconductor surfaces. In this paper, we report organized investigation of kinetically controlled room-temperature (RT) adsorption/desorption of sodium (Na) metal atoms on clean reconstructed Si (111)-7 x 7 surface, by X-ray photoelectron spectroscopy (XPS). The RT uptake curve shows a layer-by-layer growth (Frank-vander Merve growth) mode of Na on Si (111)-7 x 7 surfaces and a shift is observed in the binding energy position of Na (1s) spectra. The thermal stability of the Na/Si (111) system was inspected by annealing the system to higher substrate temperatures. Within a temperature range from RT to 350 o C, the temperature induced mobility to the excess Na atoms sitting on top of the bilayer, allowing to arrange themselves. Na atoms desorbed over a wide temperature range of 370 o C, before depleting the Si (111) surface at temperature 720 o C. The acquired valence-band (VB) spectra during Na growth revealed the development of new electronic-states near the Fermi level and desorption leads the termination of these. For Na adsorption up to 2 monolayers, decrease in work function (-1.35 eV) was observed, whereas work function of the system monotonically increases with Na desorption from the Si surface as observed by other studies also. This kinetic and thermodynamic study of Na adsorbed Si (111)-7 x 7 system can be utilized in fabrication of sensors used in night vision devices.

  11. Analyzing the Molecular Kinetics of Water Spreading on Hydrophobic Surfaces via Molecular Dynamics Simulation.

    Science.gov (United States)

    Zhao, Lei; Cheng, Jiangtao

    2017-09-07

    In this paper, we report molecular kinetic analyses of water spreading on hydrophobic surfaces via molecular dynamics simulation. The hydrophobic surfaces are composed of amorphous polytetrafluoroethylene (PTFE) with a static contact angle of ~112.4° for water. On the basis of the molecular kinetic theory (MKT), the influences of both viscous damping and solid-liquid retarding were analyzed in evaluating contact line friction, which characterizes the frictional force on the contact line. The unit displacement length on PTFE was estimated to be ~0.621 nm and is ~4 times as long as the bond length of C-C backbone. The static friction coefficient was found to be ~[Formula: see text] Pa·s, which is on the same order of magnitude as the dynamic viscosity of water, and increases with the droplet size. A nondimensional number defined by the ratio of the standard deviation of wetting velocity to the characteristic wetting velocity was put forward to signify the strength of the inherent contact line fluctuation and unveil the mechanism of enhanced energy dissipation in nanoscale, whereas such effect would become insignificant in macroscale. Moreover, regarding a liquid droplet on hydrophobic or superhydrophobic surfaces, an approximate solution to the base radius development was derived by an asymptotic expansion approach.

  12. Cortical surface-based analysis reduces bias and variance in kinetic modeling of brain PET data

    DEFF Research Database (Denmark)

    Greve, Douglas N; Svarer, Claus; Fisher, Patrick M

    2014-01-01

    Exploratory (i.e., voxelwise) spatial methods are commonly used in neuroimaging to identify areas that show an effect when a region-of-interest (ROI) analysis cannot be performed because no strong a priori anatomical hypothesis exists. However, noise at a single voxel is much higher than noise...... in a ROI making noise management critical to successful exploratory analysis. This work explores how preprocessing choices affect the bias and variability of voxelwise kinetic modeling analysis of brain positron emission tomography (PET) data. These choices include the use of volume- or cortical surface...

  13. Wetting kinetics of nanodroplets on lyophilic nanopillar-arrayed surfaces: A molecular dynamics study

    Science.gov (United States)

    Zong, Diyuan; Yang, Zhen; Duan, Yuanyuan

    2017-10-01

    Wetting kinetics of water droplets on substrates with lyophilic nanopillars was investigated using molecular dynamics simulations. Early spreading of the droplet is hindered by the nanopillars because of the penetration of the liquid which induce an extra dissipation in the droplet. Droplet spreading is mainly controlled by liquid viscosity and surface tension and not dependent on solid wettability. Propagation of the fringe film is hindered by the enhanced solid wettability because of the energy barrier introduced by the interaction between water molecules and nanopillars which increase with solid wettability.

  14. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  15. Finite size effects in phase transformation kinetics in thin films and surface layers

    International Nuclear Information System (INIS)

    Trofimov, Vladimir I.; Trofimov, Ilya V.; Kim, Jong-Il

    2004-01-01

    In studies of phase transformation kinetics in thin films, e.g. crystallization of amorphous films, until recent time is widely used familiar Kolmogorov-Johnson-Mehl-Avrami (KJMA) statistical model of crystallization despite it is applicable only to an infinite medium. In this paper a model of transformation kinetics in thin films based on a concept of the survival probability for randomly chosen point during transformation process is presented. Two model versions: volume induced transformation (VIT) when the second-phase grains nucleate over a whole film volume and surface induced transformation (SIT) when they form on an interface with two nucleation mode: instantaneous nucleation at transformation onset and continuous one during all the process are studied. At VIT-process due to the finite film thickness effects the transformation profile has a maximum in a film middle, whereas that of the grains population reaches a minimum inhere, the grains density is always higher than in a volume material, and the thinner film the slower it transforms. The transformation kinetics in a thin film obeys a generalized KJMA equation with parameters depending on a film thickness and in limiting cases of extremely thin and thick film it reduces to classical KJMA equation for 2D- and 3D-system, respectively

  16. Ozone kinetics in low-pressure discharges: vibrationally excited ozone and molecule formation on surfaces

    Science.gov (United States)

    Marinov, Daniil; Guerra, Vasco; Guaitella, Olivier; Booth, Jean-Paul; Rousseau, Antoine

    2013-10-01

    A combined experimental and modeling investigation of the ozone kinetics in the afterglow of pulsed direct current discharges in oxygen is carried out. The discharge is generated in a cylindrical silica tube of radius 1 cm, with short pulse durations between 0.5 and 2 ms, pressures in the range 1-5 Torr and discharge currents ˜40-120 mA. Time-resolved absolute concentrations of ground-state atoms and ozone molecules were measured simultaneously in situ, by two-photon absorption laser-induced fluorescence and ultraviolet absorption, respectively. The experiments were complemented by a self-consistent model developed to interpret the results and, in particular, to evaluate the roles of vibrationally excited ozone and of ozone formation on surfaces. It is found that vibrationally excited ozone, O_3^{*} , plays an important role in the ozone kinetics, leading to a decrease in the ozone concentration and an increase in its formation time. In turn, the kinetics of O_3^{*} is strongly coupled with those of atomic oxygen and O2(a 1Δg) metastables. Ozone formation at the wall does not contribute significantly to the total ozone production under the present conditions. Upper limits for the effective heterogeneous recombination probability of O atoms into ozone are established.

  17. Ozone kinetics in low-pressure discharges: vibrationally excited ozone and molecule formation on surfaces

    International Nuclear Information System (INIS)

    Marinov, Daniil; Guaitella, Olivier; Booth, Jean-Paul; Rousseau, Antoine; Guerra, Vasco

    2013-01-01

    A combined experimental and modeling investigation of the ozone kinetics in the afterglow of pulsed direct current discharges in oxygen is carried out. The discharge is generated in a cylindrical silica tube of radius 1 cm, with short pulse durations between 0.5 and 2 ms, pressures in the range 1–5 Torr and discharge currents ∼40–120 mA. Time-resolved absolute concentrations of ground-state atoms and ozone molecules were measured simultaneously in situ, by two-photon absorption laser-induced fluorescence and ultraviolet absorption, respectively. The experiments were complemented by a self-consistent model developed to interpret the results and, in particular, to evaluate the roles of vibrationally excited ozone and of ozone formation on surfaces. It is found that vibrationally excited ozone, O 3 * , plays an important role in the ozone kinetics, leading to a decrease in the ozone concentration and an increase in its formation time. In turn, the kinetics of O 3 * is strongly coupled with those of atomic oxygen and O 2 (a 1 Δ g ) metastables. Ozone formation at the wall does not contribute significantly to the total ozone production under the present conditions. Upper limits for the effective heterogeneous recombination probability of O atoms into ozone are established. (paper)

  18. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  19. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  20. Kinetic energy of ions produced with first-, second-, and multi-shot femtosecond laser ablation on a solid surface

    International Nuclear Information System (INIS)

    Kobayashi, Tohru; Kato, Toshiyuki; Kurata-Nishimura, Mizuki; Matsuo, Yukari; Kawai, Jun; Motobayashi, Tohru; Hayashizaki, Yoshihide

    2007-01-01

    We report that the kinetic energy of samarium (Sm) atom and Sm + ion produced by femtosecond laser ablation of solid samarium is strongly dependent on the number of ablation laser shots in the range from 1 to 10. By ablating the fresh surface (i.e. 1st shot), we find the kinetic energy of both Sm and Sm + ion to be the largest (24 and 250 eV, respectively). Almost 10 times larger kinetic energy of Sm + ion than that of Sm clearly indicates the contribution of Coulomb explosion in the acceleration process. From the second shot, kinetic energies of Sm and Sm + ion are lower than those of the first shot and almost constant (ca. 12 and 80 eV, respectively). This behaviour suggests the change in the nature of the solid surface after femtosecond laser ablation, which can be explained by the amorphization of ablated sample surface reported in recent studies

  1. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  2. High temperature growth kinetics and texture of surface-oxidised NiO for coated superconductor applications

    Energy Technology Data Exchange (ETDEWEB)

    Kursumovic, A; Tomov, R; Huehne, R; Glowacki, B A; Everts, J E; Tuissi, A; Villa, E; Holzapfel, B

    2003-03-15

    Thick NiO films were grown in air, on biaxially textured (0 0 1) Ni and as-rolled Ni tapes, at temperatures from 1050 to 1350 deg. C. Ni diffusion through the NiO film mainly contributes to the growth since is much faster than oxygen diffusion and occurs by a vacancy diffusion mechanism in the lattice at high temperatures. Parabolic growth kinetics were found for both NiO film thickness and grain growth, and compared with the literature data. Competitive growth of (1 1 1) and (0 0 1) oriented grains establishes the final NiO orientation at temperatures below 1250 deg. C, while at higher temperatures leakage diffusion at/towards grain boundaries, grain coarsening and (1 1 0) oriented grains disrupt the (1 0 0) texture. Hence, development of epitaxy of NiO on textured Ni tapes was found to be largely due to growth kinetics depending on both, time and temperature. We report here a systematic study of the microstructure and kinetics of formation of textured NiO substrate for application as a buffer layer in coated conductor technology.

  3. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  4. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  5. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  6. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  7. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    International Nuclear Information System (INIS)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-01-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.

  8. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  9. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  10. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  11. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  12. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  13. Monte Carlo simulation of heavy ion induced kinetic electron emission from an Al surface

    CERN Document Server

    Ohya, K

    2002-01-01

    A Monte Carlo simulation is performed in order to study heavy ion induced kinetic electron emission from an Al surface. In the simulation, excitation of conduction band electrons by the projectile ion and recoiling target atoms is treated on the basis of the partial wave expansion method, and the cascade multiplication process of the excited electrons is simulated as well as collision cascade of the recoiling target atoms. Experimental electron yields near conventional threshold energies of heavy ions are simulated by an assumption of a lowering in the apparent surface barrier for the electrons. The present calculation derives components for electron excitations by the projectile ion, the recoiling target atoms and the electron cascades, from the calculated total electron yield. The component from the recoiling target atoms increases with increasing projectile mass, whereas the component from the electron cascade decreases. Although the components from the projectile ion and the electron cascade increase with...

  14. Enhanced charging kinetics of porous electrodes: surface conduction as a short-circuit mechanism.

    Science.gov (United States)

    Mirzadeh, Mohammad; Gibou, Frederic; Squires, Todd M

    2014-08-29

    We use direct numerical simulations of the Poisson-Nernst-Planck equations to study the charging kinetics of porous electrodes and to evaluate the predictive capabilities of effective circuit models, both linear and nonlinear. The classic transmission line theory of de Levie holds for general electrode morphologies, but only at low applied potentials. Charging dynamics are slowed appreciably at high potentials, yet not as significantly as predicted by the nonlinear transmission line model of Biesheuvel and Bazant. We identify surface conduction as a mechanism which can effectively "short circuit" the high-resistance electrolyte in the bulk of the pores, thus accelerating the charging dynamics and boosting power densities. Notably, the boost in power density holds only for electrode morphologies with continuous conducting surfaces in the charging direction.

  15. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  16. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  17. Adsorption of surfactants on sand surface in enhanced oil recovery: Isotherms, kinetics and thermodynamic studies

    Energy Technology Data Exchange (ETDEWEB)

    Bera, Achinta; Kumar, T.; Ojha, Keka; Mandal, Ajay, E-mail: mandal_ajay@hotmail.com

    2013-11-01

    Adsorption of surfactants onto reservoir rock surface may result in the loss and reduction of their concentrations in surfactant flooding, which may render them less efficient or ineffective in practical applications of enhanced oil recovery (EOR) techniques. Surfactant flooding for EOR received attraction due to its ability to increase the displacement efficiency by lowering the interfacial tension between oil and water and mobilizing the residual oil. This article highlights the adsorption of surfactants onto sand surface with variation of different influencing factors. It has been experimentally found that adsorption of cationic surfactant on sand surface is more and less for anionic surfactant, while non-ionic surfactant shows intermediate behaviour. X-ray diffraction (XRD) study of clean sand particles has been made to determine the main component present in the sand particles. The interaction between sand particles and surfactant has been studied by Fourier Transform Infrared (FTIR) Spectroscopy of the sand particles before and after aging with surfactant. Salinity plays an important role in adsorption of anionic surfactant. Batch experiments were also performed to understand the effects of pH and adsorbent dose on the sorption efficiency. The sand particles exhibited high adsorption efficiency at low pH for anionic and nonionic surfactants. But opposite trend was found for cationic surfactant. Adsorption data were analyzed by fitting with Langmuir, Freundlich, Redlich-Peterson, and Sips isotherm models. Results show that the Langmuir isotherm and pseudo-second order kinetics models suit the equilibrium and kinetics of adsorption on sand surface. Thermodynamics feasibility of the adsorption process was also studied to verify the spontaneity of the process.

  18. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  19. Physical kinetics

    International Nuclear Information System (INIS)

    Lifschitz, E.M.; Pitajewski, L.P.

    1983-01-01

    The textbook covers the subject under the following headings: kinetic gas theory, diffusion approximation, collisionless plasma, collisions within the plasma, plasma in the magnetic field, theory of instabilities, dielectrics, quantum fluids, metals, diagram technique for nonequilibrium systems, superconductors, and kinetics of phase transformations

  20. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  1. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  2. Growth kinetics of boride coatings formed at the surface AISI M2 during dehydrated paste pack boriding

    Energy Technology Data Exchange (ETDEWEB)

    Doñu Ruiz, M.A., E-mail: mdonur0800@alumno.ipn.mx [Universidad Politécnica del Valle de México UPVM, Grupo Ciencia e Ingeniería de Materiales, Av. Mexiquense S/N Esquina Av. Universidad Politécnica, Col Villa Esmeralda, 54910 Tultitlan (Mexico); López Perrusquia, N.; Sánchez Huerta, D. [Universidad Politécnica del Valle de México UPVM, Grupo Ciencia e Ingeniería de Materiales, Av. Mexiquense S/N Esquina Av. Universidad Politécnica, Col Villa Esmeralda, 54910 Tultitlan (Mexico); Torres San Miguel, C.R.; Urriolagoitia Calderón, G.M. [Instituto Politécnico Nacional, SEPI-ESIME, Unidad Profesional Adolfo López Mateos Zacatenco, Edificio 5, 2do. Piso, Col. Lindavista, CP 07738 México, D.F. (Mexico); Cerillo Moreno, E.A. [Universidad Politécnica del Valle de México UPVM, Grupo Ciencia e Ingeniería de Materiales, Av. Mexiquense S/N Esquina Av. Universidad Politécnica, Col Villa Esmeralda, 54910 Tultitlan (Mexico); Cortes Suarez, J.V. [Univerisdad Autónoma Metropolitana Unidad Azcapotzalco, Av. San Pablo 180 Azcapotzalco 02200, Área de Ciencia de los Materiales, México, D.F. (Mexico)

    2015-12-01

    The growth kinetics of the boride coatings (FeB and Fe{sub 2}B) at the surface of AISI M2 high speed steels were studied in this work. Boriding thermochemical treatment was carried out by dehydrated paste pack at three different temperatures 1173, 1223, and 1273 K and four exposure times 1, 3, 5, and 7 h, respectively. The presence of FeB and Fe{sub 2}B phases was identified by scanning electron microscopy with energy dispersive spectroscopy (SEM-EDS) and X-ray diffraction method. In order to obtain the boron diffusion coefficients at the FeB/Fe{sub 2}B boride coatings, a mathematical model based on the mass balance at the growing interfaces was proposed under certain assumptions. Likewise the parabolic growth constants and the boride incubation time were established as a function of the parameters η (T) and ε (T). The activation energy values estimated for the FeB and Fe{sub 2}B layers were 233.42 and 211.89 kJ mol{sup −1} respectively. A good agreement was obtained between the simulated values of boride layer thicknesses and the experimental results. Finally, empirical relationships of boride coating thickness as a function of boriding temperature and time are presented. - Highlights: • Formed boride coatings at the surface of AISI M2 high speed steels by new process dehydrated paste pack boriding. • The model was based on the mass balance equation at the FeB/Fe{sub 2}B and Fe{sub 2}B/Fe interfaces by considering the boride incubation time. • A good agreement was obtained between the simulated values of boride layers coatings and the experimental results.

  3. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  4. THE SURFACE-MEDIATED UNFOLDING KINETICS OF GLOBULAR PROTEINS IS DEPENDENT ON MOLECULAR WEIGHT AND TEMPERATURE

    Energy Technology Data Exchange (ETDEWEB)

    Patananan, A.N.; Goheen, S.C.

    2008-01-01

    The adsorption and unfolding pathways of proteins on rigid surfaces are essential in numerous complex processes associated with biomedical engineering, nanotechnology, and chromatography. It is now well accepted that the kinetics of unfolding are characterized by chemical and physical interactions dependent on protein deformability and structure, as well as environmental pH, temperature, and surface chemistry. Although this fundamental process has broad implications in medicine and industry, little is known about the mechanism because of the atomic lengths and rapid time scales involved. Therefore, the unfolding kinetics of myoglobin, β-glucosidase, and ovalbumin were investigated by adsorbing the globular proteins to non-porous cationic polymer beads. The protein fractions were adsorbed at different residence times (0, 9, 10, 20, and 30 min) at near-physiological conditions using a gradient elution system similar to that in high-performance liquid chromatography. The elution profi les and retention times were obtained by ultraviolet/visible spectrophotometry. A decrease in recovery was observed with time for almost all proteins and was attributed to irreversible protein unfolding on the non-porous surfaces. These data, and those of previous studies, fi t a positively increasing linear trend between percent unfolding after a fi xed (9 min) residence time (71.8%, 31.1%, and 32.1% of myoglobin, β-glucosidase, and ovalbumin, respectively) and molecular weight. Of all the proteins examined so far, only myoglobin deviated from this trend with higher than predicted unfolding rates. Myoglobin also exhibited an increase in retention time over a wide temperature range (0°C and 55°C, 4.39 min and 5.74 min, respectively) whereas ovalbumin and β-glucosidase did not. Further studies using a larger set of proteins are required to better understand the physiological and physiochemical implications of protein unfolding kinetics. This study confi rms that surface

  5. The surface oxidation kinetics of zirconium-niobium alloys and aα-Fe with prevailing cubical texture

    International Nuclear Information System (INIS)

    Mukhambetov, D.G.; Kargin, D.B.; Chalaya, O. V.; Berber, N.N.

    2002-01-01

    It is known, that the kinetics of oxidation of zirconium at formed heating is characterized by two consecutive stages. At the initial stage the thin protecting film will be derived. The relation of its depth from time h (t) is described predominantly by parabolic law. Some time later there can be a transition to the linear law of oxidation. The time moment divided these areas on the kinetic relation is called as a point of break. The film is formed at the second stage, has a developed grid of pores or cracks, can be flake away and be crumbled by losing its protective properties. At the oxidation of the surface shells of the heat generating elements and the technological channels of atomic boilers both stages are proceeded simultaneously. This phenomenon is called modular corrosion. Its consequences can be dangerous for the equipment. Its mechanism is not clear till now. Similar dependencies h(t), with the break point, beginning from which the thin film is transformed into the thick one were found by us at the oxidation α-Fe with prevailing cubical texture. The task of the work was to study the oxide film growth laws in order to clarify the mechanisms of transition of the thin film into the oxide layer on the α-Fe surface and Zr-Nb alloy modular corrosion emergence. Low-carbonate steel with contents 99.43 % of α-Fe was used as a model object of our research. In the texture of the steel surface planar direction [100] was prevalent. Its part accounted for about 40 %. The isothermal air oxidation was carried out in the interval of 450-500 deg. C . Phase composition of the film was determined with X-ray diffraction. The mathematical treatment of the dependencies h(t) obtained by experiment showed that the kinetics of the film growth can be conditionally divided into 4-stages. The initial stage is described by function logarithmic function, the other stages - by the power mode h n =A n ·t, namely, the second stage - is described by function close to cubical (n≅3

  6. Influence of diffusion on extraction kinetics in porous bodies. The case of uranium oxides; Influence de la diffusion sur la cinetique d'extraction dans un corps poreux. Cas des oxydes de l'uranium

    Energy Technology Data Exchange (ETDEWEB)

    Tinturier, B [Commissariat a l' Energie Atomique, Fontenay-Aux-Roses (France). Centre d' Etudes Nucleaires

    1966-12-01

    The study of the leaching of heaped uranium ore can be considered theoretically as the problem of the diffusion of liquids in porous bodies and in particular as that of its influence on the chemical reaction rates of conventional uranium oxides. Below a certain value of the pore diameter, it is diffusion which is responsible for mass transfer. The porous structure can be characterized by various physical constants which modify the free diffusion equation and, as long as the pores have a diameter greater than a few microns, it can be shown that the pore walls have a negligible effect on the diffusion. The diffusion coefficients for the nitrate, the sulfate, the chloride, the acetate and the perchlorate of uranium have been determined. In the case of the reaction of uranium trioxide with acids in a porous body, the reaction kinetics are governed by the arrival of the reagent by diffusion. The attack of uranium dioxide by an acid ferric iron solution has been studied under the same conditions and it has been found that the diffusion modifies the influence of the ferrous and ferric iron concentrations on the reaction kinetics. The same is true for the oxide U{sub 3}O{sub 8}. All the results concerning these reactions studied in the absence of the influence of diffusion should be modified to take this factor into account when it intervenes in an extraction process. (authors) [French] L'etude de la lixiviation en tas d'un minerai d'uranium peut se ramener theoriquement au probleme de la diffusion des liquides dans les corps poreux et en particulier a celui de son influence sur les vitesses de reaction chimique des oxydes classiques de l'uranium. En dessous d'une certaine limite de diametre des pores la diffusion est responsable du transfert de masse. La structure poreuse peut se caracteriser par differentes constantes physiques qui modifient l'equation de la diffusion libre et tant que les pores ont un diametre superieur a quelques microns, on a montre que l

  7. Surface Reaction Kinetics of Ga(1-x)In(x)P Growth During Pulsed Chemical Beam Epitaxy

    National Research Council Canada - National Science Library

    Dietz, N; Beeler, S. C; Schmidt, J. W; Tran, H. T

    2000-01-01

    ... into the surface reaction kinetics during an organometallic deposition process. These insights will allow us to move the control point closer to the point where the growth occurs, which in a chemical been epitaxy process is a surface reaction layer (SRL...

  8. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  9. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  10. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  11. Surface coverage of Pt atoms on PtCo nanoparticles and catalytic kinetics for oxygen reduction

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Rongzhong, E-mail: rongzhong.jiang@us.army.mi [Sensors and Electron Devices Directorate, U.S. Army Research Laboratory, 2800 Powder Mill Road, Adelphi, MD 20783-1197 (United States); Rong, Charles; Chu, Deryn [Sensors and Electron Devices Directorate, U.S. Army Research Laboratory, 2800 Powder Mill Road, Adelphi, MD 20783-1197 (United States)

    2011-02-01

    The surface coverage of Pt atoms on PtCo nanoparticles and its effect on catalytic kinetics for oxygen reduction were investigated. The PtCo nanoparticles with different surface coverage of Pt atoms were synthesized with various methods, including normal chemical method, microemulsion synthesis, and ultrasound-assisted microemulsion. A model of Pt atoms filling into a spherical nanoparticle was proposed to explain the relationship of surface metal atoms and nanoparticle size. The catalytic activity of the PtCo nano-particles is highly dependent on the synthetic methods, even if they have the same chemical composition. The PtCo nano-particles synthesized with ultrasound-assisted microemulsion showed the highest activity, which is attributed to an increase of active surface coverage of Pt atoms on the metal nanoparticles. The rate of oxygen reduction at 0.5 V (vs. SCE) catalyzed by the PtCo synthesized with ultrasound-assisted micro-emulsion was about four times higher than that of the PtCo synthesized with normal chemical method. As demonstrated with rotating-ring disk electrode measurement, the PtCo nano-particles can catalyze oxygen 4-electron reduction to water without intermediate H{sub 2}O{sub 2} detected.

  12. Simulation of surface crack initiation induced by slip localization and point defects kinetics

    International Nuclear Information System (INIS)

    Sauzay, Maxime; Liu, Jia; Rachdi, Fatima

    2014-01-01

    Crack initiation along surface persistent slip bands (PSBs) has been widely observed and modelled. Nevertheless, from our knowledge, no physically-based fracture modelling has been proposed and validated with respect to the numerous recent experimental data showing the strong relationship between extrusion and microcrack initiation. The whole FE modelling accounts for: - localized plastic slip in PSBs; - production and annihilation of vacancies induced by cyclic slip. If temperature is high enough, point defects may diffuse in the surrounding matrix due to large concentration gradients, allowing continuous extrusion growth in agreement with Polak's model. At each cycle, the additional atoms diffusing from the matrix are taken into account by imposing an incremental free dilatation; - brittle fracture at the interfaces between PSBs and their surrounding matrix which is simulated using cohesive zone modelling. Any inverse fitting of parameter is avoided. Only experimental single crystal data are used such as hysteresis loops and resistivity values. Two fracture parameters are required: the {111} surface energy which depends on environment and the cleavage stress which is predicted by the universal binding energy relationship. The predicted extrusion growth curves agree rather well with the experimental data published for copper and the 316L steel. A linear dependence with respect to PSB length, thickness and slip plane angle is predicted in agreement with recent AFM measurement results. Crack initiation simulations predict fairly well the effects of PSB length and environment for copper single and poly-crystals. (authors)

  13. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  14. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  15. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  16. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  17. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  18. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  19. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  20. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  1. Static and kinetic friction force and surface roughness of different archwire-bracket sliding contacts.

    Science.gov (United States)

    Carrion-Vilches, Francisco J; Bermudez, María-Dolores; Fructuoso, Paula

    2015-01-01

    The aim of this study was to determine the static and kinetic friction forces of the contact bracket-archwire with different dental material compositions in order to select those materials with lower resistance to sliding. We carried out sliding friction tests by means of a universal testing machine following an experimental procedure as described in ASTM D1894 standard. We determined the static and kinetic friction forces under dry and lubricating conditions using an artificial saliva solution at 36.5ºC. The bracket-archwire pairs studied were: stainless steel-stainless steel; stainless steel-glass fiber composite; stainless steel-Nitinol 60; sapphire-stainless steel; sapphire-glass fiber composite; and sapphire-Nitinol 60. The best performance is obtained for Nitinol 60 archwire sliding against a stainless steel bracket, both under dry and lubricated conditions. These results are in agreement with the low surface roughness of Nitinol 60 with respect to the glass fiber composite archwire. The results described here contribute to establishing selection criteria for materials for dental archwire-brackets.

  2. Drying Kinetics and Optimisation of Pectin Extraction from Banana Peels via Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Bee Lin Chua

    2018-01-01

    Full Text Available Banana peels which are the waste in abundance, are used to extract valuable pectin. The gelling ability of the pectin has gained attention in food and pharmaceutical industries. This research aims to select the best drying kinetic model for banana peels and also optimize the pectin extraction process using Box-Behnken response surface design (BBD. Determination of pectin gelling mechanism using degree of esterification (DE is also focused in this research. In this study, oven drying with temperature 50°C was chosen as the best drying temperature due to highest extraction yield. Furthermore, Page-Two-term model was selected as the best model to describe the drying kinetics of banana peels due to highest R2 value (0.9991 and lowest RMSE value (0.001. The optimal extraction conditions given by BBD were 75°C extraction temperature, 23 min extraction time and 1:33.3 g/ml solid-liquid ratio. Likewise, the DE for both pectins extracted using unoptimised and optimised conditions were 71.92±1.38% and 76.1±2.07% respectively. Both of the pectins were classified as high-methoxyl pectins. The pectin with higher DE also indicated that the rate of gel formation is higher. The results showed that the pectin yield and gelling time has successfully improved after optimised the pectin extraction process.

  3. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  4. Kinetics of CO2 diffusion in human carbonic anhydrase: a study using molecular dynamics simulations and the Markov-state model.

    Science.gov (United States)

    Chen, Gong; Kong, Xian; Lu, Diannan; Wu, Jianzhong; Liu, Zheng

    2017-05-10

    Molecular dynamics (MD) simulations, in combination with the Markov-state model (MSM), were applied to probe CO 2 diffusion from an aqueous solution into the active site of human carbonic anhydrase II (hCA-II), an enzyme useful for enhanced CO 2 capture and utilization. The diffusion process in the hydrophobic pocket of hCA-II was illustrated in terms of a two-dimensional free-energy landscape. We found that CO 2 diffusion in hCA-II is a rate-limiting step in the CO 2 diffusion-binding-reaction process. The equilibrium distribution of CO 2 shows its preferential accumulation within a hydrophobic domain in the protein core region. An analysis of the committors and reactive fluxes indicates that the main pathway for CO 2 diffusion into the active site of hCA-II is through a binding pocket where residue Gln 136 contributes to the maximal flux. The simulation results offer a new perspective on the CO 2 hydration kinetics and useful insights toward the development of novel biochemical processes for more efficient CO 2 sequestration and utilization.

  5. Development of kinetic models for photoassisted electrochemical process using Ti/RuO2 anode and carbon nanotube-based O2-diffusion cathode

    International Nuclear Information System (INIS)

    Akbarpour, Amaneh; Khataee, Alireza; Fathinia, Mehrangiz; Vahid, Behrouz

    2016-01-01

    Highlights: • Preparation and characterization of carbon nanotube-based O 2 -diffusion cathode. • Photoassisted electrochemical process using Ti/RuO 2 anode and O 2 -diffusion cathode. • Degradation of C.I. Basic Yellow 28 under recirculation mode. • Development of kinetic models for photoassisted electrochemical process. - Abstract: A coupled photoassisted electrochemical system was utilized for degradation of C.I. Basic Yellow 28 (BY28) as a cationic azomethine dye under recirculation mode. Experiments were carried out by utilizing active titanium/ruthenium oxide (Ti/RuO 2 ) anode and O 2 -diffusion cathode with carbon nanotubes (CNTs). Transmission electron microscopy (TEM) image of the CNTs demonstrated that CNTs had approximately an inner and outer diameter of 5 nm and 19 nm, respectively. Then, the dye degradation kinetics was experimentally examined under various operational parameters including BY28 initial concentration (mg/L), current density (mA/cm 2 ), flow rate (L/h) and pH. Based on the generally accepted intrinsic elementary reactions for photoassisted electrochemical process (PEP), a novel kinetic model was proposed and validated for predicting the k app . The developed kinetic model explicitly describes the dependency of the k app on BY28 initial concentration and current density. A good agreement was obtained between the predicted values of k app and experimental results (correlation coefficient (R 2 ) = 0.996, mean squared error (MSE) = 2.10 × 10 −4 and mean absolute error (MAE) = 1.10 × 10 −2 ). Finally, in order to profoundly evaluate and compare the accuracy of the suggested intrinsic kinetic model, an empirical kinetic model was also developed as a function of main operational parameters, and an artificial neural network model (ANN) by 3-layer feed-forward back propagation network with topology of 5:9:1. The performance of the mentioned models was compared based on the error functions and analysis of variance (ANOVA). A

  6. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  7. Solid oxide electrode kinetics in light of in situ surface studies

    DEFF Research Database (Denmark)

    Mogensen, Mogens Bjerg

    2014-01-01

    The combination of in situ and in particular in operando characterization methods such as electrochemical impedance spectroscopy (EIS) on both technical and model electrode are well known ways to gain some practical insight in electrode reaction kinetics. Yet, is has become clear that in spite...... of the strengths it is not sufficient to reveal much details of the electrode mechanisms mainly because it provide average values only. Therefore it has to be combined with surface science methods in order to reveal the interface structure and composition. Ex situ methods have been very useful over the latest....... Furthermore, it seems that detailed mathematical modeling using new tools like COMSOL is necessary for the synthesis of the large amount of data for a well-characterized electrode into one physical meaningful picture. A brief review of literature an own data will be presented with a practical example of SOFC...

  8. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients: Validated and tested for the adsorption of 1-Octanol at a microscopic air-water interface and its dissolution into water.

    Science.gov (United States)

    Kinoshita, Koji; Parra, Elisa; Needham, David

    2017-02-15

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain "dead time" at initial measurement. These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the "micropipette interfacial area-expansion method" was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion controlled molecular adsorption at the air-water interfaces. To validate the new technique, the diffusion coefficient of 1-Octanol in water was investigated with existing models: the Ward Tordai model for the long time adsorption regime (1-100s), and the Langmuir and Frumkin adsorption isotherm models for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2±0.8×10 -6 cm 2 /s, showed excellent agreement with the result from an alternative method, "single microdroplet catching method", to measure the diffusion coefficient from diffusion-controlled microdroplet dissolution, 7.3±0.1×10 -6 cm 2 /s. These new techniques for determining adsorption and diffusion coefficients can apply for a range of surface active molecules, especially the less-characterized ionic surfactants, and biological compounds such as lipids, peptides, and proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. The effect of the physical properties of the substrate on the kinetics of cell adhesion and crawling studied by an axisymmetric diffusion-energy balance coupled model.

    Science.gov (United States)

    Samadi-Dooki, Aref; Shodja, Hossein M; Malekmotiei, Leila

    2015-05-14

    In this paper an analytical approach to study the effect of the substrate physical properties on the kinetics of adhesion and motility behavior of cells is presented. Cell adhesion is mediated by the binding of cell wall receptors and substrate's complementary ligands, and tight adhesion is accomplished by the recruitment of the cell wall binders to the adhesion zone. The binders' movement is modeled as their axisymmetric diffusion in the fluid-like cell membrane. In order to preserve the thermodynamic consistency, the energy balance for the cell-substrate interaction is imposed on the diffusion equation. Solving the axisymmetric diffusion-energy balance coupled equations, it turns out that the physical properties of the substrate (substrate's ligand spacing and stiffness) have considerable effects on the cell adhesion and motility kinetics. For a rigid substrate with uniform distribution of immobile ligands, the maximum ligand spacing which does not interrupt adhesion growth is found to be about 57 nm. It is also found that as a consequence of the reduction in the energy dissipation in the isolated adhesion system, cell adhesion is facilitated by increasing substrate's stiffness. Moreover, the directional movement of cells on a substrate with gradients in mechanical compliance is explored with an extension of the adhesion formulation. It is shown that cells tend to move from soft to stiff regions of the substrate, but their movement is decelerated as the stiffness of the substrate increases. These findings based on the proposed theoretical model are in excellent agreement with the previous experimental observations.

  10. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  11. Thermodynamic and kinetic aspects on the selective surface oxidation of binary, ternary and quarternary model alloys

    International Nuclear Information System (INIS)

    Swaminathan, Srinivasan; Spiegel, Michael

    2007-01-01

    Segregation and selective oxidation phenomena of minor alloying elements during annealing of steel sheets lead to the formation of bare spots after hot dip galvanizing. In order to understand the influence of common alloying elements on the surface chemistry after annealing, model alloys of binary (Fe-2Si, Fe-2Mn and Fe-0.8Cr), ternary (Fe-2Mn-2Si, Fe-2Mn-0.8Cr and Fe-2Si-0.8Cr) and quarternary (Fe-2Mn-2Si-0.8Cr) systems were investigated. The specimens were annealed for 60 s at 820 deg. C in N 2 -5% H 2 gas atmospheres with different dew points -80 and -40 deg. C, respectively. Surface chemistry of the annealed specimens was obtained by using X-ray photoelectron spectroscopy (XPS). The field emission scanning electron microscopy (FE-SEM) was used to view surface morphology. At low dew point -80 deg. C, apart from the thermodynamical calculations such as solubility product of oxides and their critical solute concentrations, kinetics play a decisive role on the selective oxidation, i.e. oxygen competition. As expected, the amount of external selective oxidation of alloying elements are well pronounced at higher dew point -40 deg. C. An attempt has been made to explain the dominant process of Si and Mn on Cr-oxidation and segregation. It is observed that annealing of quarternary system at higher dew point shifts the Cr-oxidation from external to internal

  12. Thermodynamic and kinetic aspects on the selective surface oxidation of binary, ternary and quarternary model alloys

    Energy Technology Data Exchange (ETDEWEB)

    Swaminathan, Srinivasan [High Temperature Reactions Group, Department of Interface Chemistry and Surface Engineering, Max-Planck-Institut fuer Eisenforschung GmbH, Max-Planck-Str. 1, D-40237 Duesseldorf (Germany)]. E-mail: s.swaminathan@mpie.de; Spiegel, Michael [High Temperature Reactions Group, Department of Interface Chemistry and Surface Engineering, Max-Planck-Institut fuer Eisenforschung GmbH, Max-Planck-Str. 1, D-40237 Duesseldorf (Germany)

    2007-03-15

    Segregation and selective oxidation phenomena of minor alloying elements during annealing of steel sheets lead to the formation of bare spots after hot dip galvanizing. In order to understand the influence of common alloying elements on the surface chemistry after annealing, model alloys of binary (Fe-2Si, Fe-2Mn and Fe-0.8Cr), ternary (Fe-2Mn-2Si, Fe-2Mn-0.8Cr and Fe-2Si-0.8Cr) and quarternary (Fe-2Mn-2Si-0.8Cr) systems were investigated. The specimens were annealed for 60 s at 820 deg. C in N{sub 2}-5% H{sub 2} gas atmospheres with different dew points -80 and -40 deg. C, respectively. Surface chemistry of the annealed specimens was obtained by using X-ray photoelectron spectroscopy (XPS). The field emission scanning electron microscopy (FE-SEM) was used to view surface morphology. At low dew point -80 deg. C, apart from the thermodynamical calculations such as solubility product of oxides and their critical solute concentrations, kinetics play a decisive role on the selective oxidation, i.e. oxygen competition. As expected, the amount of external selective oxidation of alloying elements are well pronounced at higher dew point -40 deg. C. An attempt has been made to explain the dominant process of Si and Mn on Cr-oxidation and segregation. It is observed that annealing of quarternary system at higher dew point shifts the Cr-oxidation from external to internal.

  13. Kinetics of phase transformations

    International Nuclear Information System (INIS)

    Thompson, M.O.; Aziz, M.J.; Stephenson, G.B.

    1992-01-01

    This volume contains papers presented at the Materials Research Society symposium on Kinetics of Phase Transformations held in Boston, Massachusetts from November 26-29, 1990. The symposium provided a forum for research results in an exceptionally broad and interdisciplinary field. Presentations covered nearly every major class of transformations including solid-solid, liquid-solid, transport phenomena and kinetics modeling. Papers involving amorphous Si, a dominant topic at the symposium, are collected in the first section followed by sections on four major areas of transformation kinetics. The symposium opened with joint sessions on ion and electron beam induced transformations in conjunction with the Surface Chemistry and Beam-Solid Interactions: symposium. Subsequent sessions focused on the areas of ordering and nonlinear diffusion kinetics, solid state reactions and amorphization, kinetics and defects of amorphous silicon, and kinetics of melting and solidification. Seven internationally recognized invited speakers reviewed many of the important problems and recent results in these areas, including defects in amorphous Si, crystal to glass transformations, ordering kinetics, solid-state amorphization, computer modeling, and liquid/solid transformations

  14. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  15. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  16. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  17. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  18. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  19. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  20. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  1. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  2. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  3. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  4. Reaction kinetics of metal deposition via surface limited red-ox replacement of underpotentially deposited metal monolayers

    International Nuclear Information System (INIS)

    Gokcen, Dincer; Bae, Sang-Eun; Brankovic, Stanko R.

    2011-01-01

    The study of the kinetics of metal deposition via surface limited red-ox replacement of underpotentially deposited metal monolayers is presented. The model system was Pt submonolayer deposition on Au(1 1 1) via red-ox replacement of Pb and Cu UPD monolayers on Au(1 1 1). The kinetics of a single replacement reaction was studied using the formalism of the comprehensive analytical model developed to fit the open circuit potential transients from deposition experiments. The practical reaction kinetics parameters like reaction half life, reaction order and reaction rate constant are determined and discussed with their relevance to design and control of deposition experiments. The effects of transport limitation and the role of the anions/electrolyte on deposition kinetics are investigated and their significance to design of effective deposition process is discussed.

  5. [Treatment of surface burns with proteolytic enzymes: mathematic description of lysis kinetics].

    Science.gov (United States)

    Domogatskaia, A S; Domogatskiĭ, S P; Ruuge, E K

    2003-01-01

    The lysis of necrotic tissue by a proteolytic enzyme applied to the surface of a burn wound was studied. A mathematical model was proposed, which describes changes in the thickness of necrotic tissue as a function of the proteolytic activity of the enzyme. The model takes into account the inward-directed diffusion of the enzyme, the counterflow of interstitial fluid (exudates) containing specific inhibitors, and the extracellular matrix proteolysis. It was shown in terms of the quasi-stationary approach that the thickness of the necrotic tissue layer decreases exponentially with time; i.e., the lysis slows down as the thickness of the necrotic tissue layer decreases. The dependence of the characteristic time of this decrease on enzyme concentration was obtained. It was shown that, at high enzyme concentrations (more than 5 mg/ml), the entire time of lysis (after the establishment of quasi-stationary equilibrium) is inversely proportional to the concentration of the enzyme.

  6. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  7. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  8. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  9. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  10. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  11. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  12. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  13. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  14. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  15. Oxygen Reduction Kinetics Enhancement on a Heterostructured Oxide Surface for Solid Oxide Fuel Cells

    KAUST Repository

    Crumlin, Ethan J.

    2010-11-04

    Heterostructured interfaces of oxides, which can exhibit transport and reactivity characteristics remarkably different from those of bulk oxides, are interesting systems to explore in search of highly active cathodes for the oxygen reduction reaction (ORR). Here, we show that the ORR of ∼85 nm thick La0.8Sr0.2CoO3-δ (LSC113) films prepared by pulsed laser deposition on (001)-oriented yttria-stabilized zirconia (YSZ) substrates is dramatically enhanced (∼3-4 orders of magnitude above bulk LSC113) by surface decorations of (La 0.5Sr0.5)2CoO4±δ (LSC214) with coverage in the range from ∼0.1 to ∼15 nm. Their surface and atomic structures were characterized by atomic force, scanning electron, and scanning transmission electron microscopy, and the ORR kinetics were determined by electrochemical impedance spectroscopy. Although the mechanism for ORR enhancement is not yet fully understood, our results to date show that the observed ORR enhancement can be attributed to highly active interfacial LSC113/LSC214 regions, which were shown to be atomically sharp. © 2010 American Chemical Society.

  16. Oxygen Reduction Kinetics Enhancement on a Heterostructured Oxide Surface for Solid Oxide Fuel Cells

    KAUST Repository

    Crumlin, Ethan J.; Mutoro, Eva; Ahn, Sung-Jin; la O’ , Gerardo Jose; Leonard, Donovan N.; Borisevich, Albina; Biegalski, Michael D.; Christen, Hans M.; Shao-Horn, Yang

    2010-01-01

    Heterostructured interfaces of oxides, which can exhibit transport and reactivity characteristics remarkably different from those of bulk oxides, are interesting systems to explore in search of highly active cathodes for the oxygen reduction reaction (ORR). Here, we show that the ORR of ∼85 nm thick La0.8Sr0.2CoO3-δ (LSC113) films prepared by pulsed laser deposition on (001)-oriented yttria-stabilized zirconia (YSZ) substrates is dramatically enhanced (∼3-4 orders of magnitude above bulk LSC113) by surface decorations of (La 0.5Sr0.5)2CoO4±δ (LSC214) with coverage in the range from ∼0.1 to ∼15 nm. Their surface and atomic structures were characterized by atomic force, scanning electron, and scanning transmission electron microscopy, and the ORR kinetics were determined by electrochemical impedance spectroscopy. Although the mechanism for ORR enhancement is not yet fully understood, our results to date show that the observed ORR enhancement can be attributed to highly active interfacial LSC113/LSC214 regions, which were shown to be atomically sharp. © 2010 American Chemical Society.

  17. Twin-domain size and bulk oxygen in-diffusion kinetics of YBa 2Cu 3O 6+x studied by neutron powder diffraction and gas volumetry

    Science.gov (United States)

    Poulsen, H. F.; Andersen, N. H.; Lebech, B.

    1991-02-01

    We report experimental results of twin-domain size and bulk oxygen in-diffusion kinetics of YBa 2Cu 3O 6+ x, which supplement a previous and simultaneous study of the structural phase diagram and oxygen equilibrium partial pressure. Analysis of neutron powder diffraction peak broadening show features which are identified to result from temperature independent twin-domain formation in to different orthorhombic phases with domain sizes and 250 and 350Å, respectively. The oxygen in-diffusion flow shows simple relaxation type behaviour J=J 0 exp( {-t}/{τ}) despite a rather broad particle size distribution. At higher temperatures, τ is activated with activation energies 0.55 and 0.25 eV in the tetragonal and orthorhombic phases, respectively. Comparison between twin-domain sizes and bulk oxygen in-diffusion time constants indicates that the twin-domain boundaries may contribute to the effective bulk oxygen in-diffusion. All our results may be interpreted in terms of the 2D ASYNNNI model description of the oxygen basal plane ordering, and they suggest that recent first principles interaction parameters should be modified.

  18. Osteoclast cell-surface specializations and nuclear kinetics during egg-laying in Japanese quail

    International Nuclear Information System (INIS)

    Miller, S.C.

    1981-01-01

    Medullary bone deposits serve as a reservoir of labile calcium for egg-shell calcification in birds. Quantitative transmission-electron-microscope methods and light-microscope autoradiographic cell-population-kinetic analyses were used to determine changes in cell-surface specializations and population dynamics of medullary bone osteoclasts during egg-laying in Japanese quail. Prior to egg-shell formation, from 0 to about 8 hours after the previous oviposition, very few osteoclast profiles had ruffled borders. The appearance of ruffled borders coincided with the beginning of egg-shell calcification, about 9-10 hours after the previous oviposition. During egg-shell calcification, about 10-21 hours after the previous oviposition, most osteoclast profiles had ruffled borders. Ruffled borders disappeared at the completion of egg-shell calcification and commencement of egg-shell pigmentation. Thus, functional activities of medullary bone osteoclasts appear to be closely synchronized with egg-shell calcification during egg-laying. From 1 to 48 hours after a single injection of 3H-thymidine (3H-TdR), very few labeled osteoclast nuclei were seen during egg-laying. Following multiple injections of 3H-TdR, the percentage of labeled nuclei reached a peak at about 170 hours after the first injection. At this peak-labeling time, relatively few of the osteoclast profiles that had labeled nuclei had two or more; although the average number of nuclei per osteoclast profile was about 3.6. These kinetic data suggest that the medullary bone osteoclast population has a prolonged rate of turnover compared to rapid changes in cell activities associated with each 24-hour egg-laying cycle; and collectively they would suggest that rapid changes in osteoclast functions occur independently of changes in cell-population dynamics

  19. Guided asteroid deflection by kinetic impact: Mapping keyholes to an asteroid's surface

    Science.gov (United States)

    Chesley, S.; Farnocchia, D.

    2014-07-01

    The kinetic impactor deflection approach is likely to be the optimal deflection strategy in most real-world cases, given the likelihood of decades of warning time provided by asteroid search programs and the probable small size of the next confirmed asteroid impact that would require deflection. However, despite its straightforward implementation, the kinetic impactor approach can have its effectiveness limited by the astrodynamics that govern the impactor spacecraft trajectory. First, the deflection from an impact is maximized when the asteroid is at perihelion, while an impact near perihelion can in some cases be energetically difficult to implement. Additionally, the asteroid change in velocity Δ V should aligned with the target's heliocentric velocity vector in order to maximize the deflection at a potential impact some years in the future. Thus the relative velocity should be aligned with or against the heliocentric velocity, which implies that the impactor and asteroid orbits should be tangent at the point of impact. However, for natural bodies such as meteorites colliding with the Earth, the relative velocity vectors tend to cluster near the sunward or anti- sunward directions, far from the desired direction. This is because there is generally a significant crossing angle between the orbits of the impactor and target and an impact at tangency is unusual. The point is that hitting the asteroid is not enough, but rather we desire to hit the asteroid at a point when the asteroid and spacecraft orbits are nearly tangent and when the asteroid is near perihelion. However, complicating the analysis is the fact that the impact of a spacecraft on an asteroid would create an ejecta plume that is roughly normal to the surface at the point of impact. This escaping ejecta provides additional momentum transfer that generally adds to the effectiveness of a kinetic deflection. The ratio β between the ejecta momentum and the total momentum (ejecta plus spacecraft) can

  20. Iron oxidation kinetics and phosphate immobilization along the flow-path from groundwater into surface water

    Science.gov (United States)

    van der Grift, B.; Rozemeijer, J. C.; Griffioen, J.; van der Velde, Y.

    2014-11-01

    The retention of phosphorus in surface waters through co-precipitation of phosphate with Fe-oxyhydroxides during exfiltration of anaerobic Fe(II) rich groundwater is not well understood. We developed an experimental field set-up to study Fe(II) oxidation and P immobilization along the flow-path from groundwater into surface water in an agricultural experimental catchment of a small lowland river. We physically separated tube drain effluent from groundwater discharge before it entered a ditch in an agricultural field. Through continuous discharge measurements and weekly water quality sampling of groundwater, tube drain water, exfiltrated groundwater, and surface water, we investigated Fe(II) oxidation kinetics and P immobilization processes. The oxidation rate inferred from our field measurements closely agreed with the general rate law for abiotic oxidation of Fe(II) by O2. Seasonal changes in climatic conditions affected the Fe(II) oxidation process. Lower pH and lower temperatures in winter (compared to summer) resulted in low Fe oxidation rates. After exfiltration to the surface water, it took a couple of days to more than a week before complete oxidation of Fe(II) is reached. In summer time, Fe oxidation rates were much higher. The Fe concentrations in the exfiltrated groundwater were low, indicating that dissolved Fe(II) is completely oxidized prior to inflow into a ditch. While the Fe oxidation rates reduce drastically from summer to winter, P concentrations remained high in the groundwater and an order of magnitude lower in the surface water throughout the year. This study shows very fast immobilization of dissolved P during the initial stage of the Fe(II) oxidation process which results in P-depleted water before Fe(II) is completely depleted. This cannot be explained by surface complexation of phosphate to freshly formed Fe-oxyhydroxides but indicates the formation of Fe(III)-phosphate precipitates. The formation of Fe(III)-phosphates at redox gradients

  1. Kinetics and mechanism of heterogeneous oxidation of sulfur dioxide by ozone on surface of calcium carbonate

    Directory of Open Access Journals (Sweden)

    L. Li

    2006-01-01

    Full Text Available Sulfate particles play a key role in the air quality and the global climate, but the heterogeneous formation mechanism of sulfates on surfaces of atmospheric particles is not well established. Carbonates, which act as a reactive component in mineral dust due to their special chemical properties, may contribute significantly to the sulfate formation by heterogeneous processes. This paper presents a study on the oxidation of SO2 by O3 on CaCO3 particles. Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy (DRIFTS, the formation of sulfite and sulfate on the surface was identified, and the roles of O3 and water in oxidation processes were determined. The results showed that in the presence of O3, SO2can be oxidized to sulfate on the surface of CaCO3 particles. The reaction is first order in SO2 and zero order in O3. The reactive uptake coefficient for SO2 [(0.6–9.8×1014 molecule cm-3] oxidation by O3 [(1.2–12×1014 molecule cm-3] was determined to be (1.4±0.3×10-7 using the BET area as the reactive area and (7.7±1.6×10-4 using the geometric area. A two-stage mechanism that involves adsorption of SO2 followed by O3 oxidation is proposed and the adsorption of SO2 on the CaCO3 surface is the rate-determining step. The proposed mechanism can well explain the experiment results. The atmospheric implications were explored based on a box model calculation. It was found that the heterogeneous reaction might be an important pathway for sulfate formation in the atmosphere.

  2. ULTRASOUND PRETREATMENT OF ELEMENTAL IRON: KINETIC STUDIES OF DEHALOGENATION REACTION ENHANCEMENT AND SURFACE EFFECTS. (R828598C743)

    Science.gov (United States)

    This work presents data showing the kinetic improvement afforded by ultrasound pretreatment and illustrates the physical and chemical changes that take place at the iron surface. First-order rate constants improved as much as 78% with 2 h of ultrasound pretreatment. Scann...

  3. Kinetics and mechanisms of the oxide film growth on the surface of α-Fe in transitional domains

    International Nuclear Information System (INIS)

    Mukhambetov, D.G.; Berber, N.N.; Kargin, D.B.; Chalaya, O.V.

    2003-01-01

    The object of this work was to study the kinetics of the α-Fe surface oxidation with prevailing cubic texture at temperatures of 450-500 deg. C. The basic conformity to natural laws and mechanisms of the two-phase thin oxide films grows are determined. (author)

  4. A kinetic analysis of manual wheelchair propulsion during start-up on select indoor and outdoor surfaces

    NARCIS (Netherlands)

    Koontz, AM; Cooper, RA; Boninger, ML; Yang, YS; Impink, BG; van der Woude, LHV

    2005-01-01

    The objective of this study was to conduct a kinetic analysis of manual wheelchair propulsion during start-LIP on select indoor and Outdoor surfaces. Eleven manual wheelchairs were fitted with a SMART(Wheel) and their users were asked to Push on a Course consisting of high- and low-pile carpet,

  5. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  6. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  7. Influence of kinetics on the determination of the surface reactivity of oxide suspensions by acid-base titration.

    Science.gov (United States)

    Duc, M; Adekola, F; Lefèvre, G; Fédoroff, M

    2006-11-01

    The effect of acid-base titration protocol and speed on pH measurement and surface charge calculation was studied on suspensions of gamma-alumina, hematite, goethite, and silica, whose size and porosity have been well characterized. The titration protocol has an important effect on surface charge calculation as well as on acid-base constants obtained by fitting of the titration curves. Variations of pH versus time after addition of acid or base to the suspension were interpreted as diffusion processes. Resulting apparent diffusion coefficients depend on the nature of the oxide and on its porosity.

  8. Morphological evolution of dissolving feldspar particles with anisotropic surface kinetics and implications for dissolution rate normalization and grain size dependence: A kinetic modeling study

    Science.gov (United States)

    Zhang, Li; Lüttge, Andreas

    2009-11-01

    With previous two-dimensional (2D) simulations based on surface-specific feldspar dissolution succeeding in relating the macroscopic feldspar kinetics to the molecular-scale surface reactions of Si and Al atoms ( Zhang and Lüttge, 2008, 2009), we extended our modeling effort to three-dimensional (3D) feldspar particle dissolution simulations. Bearing on the same theoretical basis, the 3D feldspar particle dissolution simulations have verified the anisotropic surface kinetics observed in the 2D surface-specific simulations. The combined effect of saturation state, pH, and temperature on the surface kinetics anisotropy has been subsequently evaluated, found offering diverse options for morphological evolution of dissolving feldspar nanoparticles with varying grain sizes and starting shapes. Among the three primary faces on the simulated feldspar surface, the (1 0 0) face has the biggest dissolution rate across an extensively wide saturation state range and thus acquires a higher percentage of the surface area upon dissolution. The slowest dissolution occurs to either (0 0 1) or (0 1 0) faces depending on the bond energies of Si-(O)-Si ( ΦSi-O-Si/ kT) and Al-(O)-Si ( ΦAl-O-Si/ kT). When the ratio of ΦSi-O-Si/ kT to ΦAl-O-Si/ kT changes from 6:3 to 7:5, the dissolution rates of three primary faces change from the trend of (1 0 0) > (0 1 0) > (0 0 1) to the trend of (1 0 0) > (0 0 1) > (0 1 0). The rate difference between faces becomes more distinct and accordingly edge rounding becomes more significant. Feldspar nanoparticles also experience an increasing degree of edge rounding from far-from-equilibrium to close-to-equilibrium. Furthermore, we assessed the connection between the continuous morphological modification and the variation in the bulk dissolution rate during the dissolution of a single feldspar particle. Different normalization treatments equivalent to the commonly used mass, cube assumption, sphere assumption, geometric surface area, and reactive

  9. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  10. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  11. Determination of the effective diffusivity of water in a poly (methyl methacrylate) membrane containing carbon nanotubes using kinetic Monte Carlo simulations

    Energy Technology Data Exchange (ETDEWEB)

    Mermigkis, Panagiotis G.; Tsalikis, Dimitrios G. [Department of Chemical Engineering, University of Patras, GR 26500 Patras (Greece); Institute of Chemical Engineering and High Temperature Chemical Processes, GR 26500 Patras (Greece); Mavrantzas, Vlasis G., E-mail: vlasis@chemeng.upatras.gr [Department of Chemical Engineering, University of Patras, GR 26500 Patras (Greece); Institute of Chemical Engineering and High Temperature Chemical Processes, GR 26500 Patras (Greece); Particle Technology Laboratory, Department of Mechanical and Process Engineering, ETH-Z, CH-8092 Zurich (Switzerland)

    2015-10-28

    A kinetic Monte Carlo (kMC) simulation algorithm is developed for computing the effective diffusivity of water molecules in a poly(methyl methacrylate) (PMMA) matrix containing carbon nanotubes (CNTs) at several loadings. The simulations are conducted on a cubic lattice to the bonds of which rate constants are assigned governing the elementary jump events of water molecules from one lattice site to another. Lattice sites belonging to PMMA domains of the membrane are assigned different rates than lattice sites belonging to CNT domains. Values of these two rate constants are extracted from available numerical data for water diffusivity within a PMMA matrix and a CNT pre-computed on the basis of independent atomistic molecular dynamics simulations, which show that water diffusivity in CNTs is 3 orders of magnitude faster than in PMMA. Our discrete-space, continuum-time kMC simulation results for several PMMA-CNT nanocomposite membranes (characterized by different values of CNT length L and diameter D and by different loadings of the matrix in CNTs) demonstrate that the overall or effective diffusivity, D{sub eff}, of water in the entire polymeric membrane is of the same order of magnitude as its diffusivity in PMMA domains and increases only linearly with the concentration C (vol. %) in nanotubes. For a constant value of the concentration C, D{sub eff} is found to vary practically linearly also with the CNT aspect ratio L/D. The kMC data allow us to propose a simple bilinear expression for D{sub eff} as a function of C and L/D that can describe the numerical data for water mobility in the membrane extremely accurately. Additional simulations with two different CNT configurations (completely random versus aligned) show that CNT orientation in the polymeric matrix has only a minor effect on D{sub eff} (as long as CNTs do not fully penetrate the membrane). We have also extensively analyzed and quantified sublinear (anomalous) diffusive phenomena over small to moderate

  12. Determination of the effective diffusivity of water in a poly (methyl methacrylate) membrane containing carbon nanotubes using kinetic Monte Carlo simulations

    International Nuclear Information System (INIS)

    Mermigkis, Panagiotis G.; Tsalikis, Dimitrios G.; Mavrantzas, Vlasis G.

    2015-01-01

    A kinetic Monte Carlo (kMC) simulation algorithm is developed for computing the effective diffusivity of water molecules in a poly(methyl methacrylate) (PMMA) matrix containing carbon nanotubes (CNTs) at several loadings. The simulations are conducted on a cubic lattice to the bonds of which rate constants are assigned governing the elementary jump events of water molecules from one lattice site to another. Lattice sites belonging to PMMA domains of the membrane are assigned different rates than lattice sites belonging to CNT domains. Values of these two rate constants are extracted from available numerical data for water diffusivity within a PMMA matrix and a CNT pre-computed on the basis of independent atomistic molecular dynamics simulations, which show that water diffusivity in CNTs is 3 orders of magnitude faster than in PMMA. Our discrete-space, continuum-time kMC simulation results for several PMMA-CNT nanocomposite membranes (characterized by different values of CNT length L and diameter D and by different loadings of the matrix in CNTs) demonstrate that the overall or effective diffusivity, D eff , of water in the entire polymeric membrane is of the same order of magnitude as its diffusivity in PMMA domains and increases only linearly with the concentration C (vol. %) in nanotubes. For a constant value of the concentration C, D eff is found to vary practically linearly also with the CNT aspect ratio L/D. The kMC data allow us to propose a simple bilinear expression for D eff as a function of C and L/D that can describe the numerical data for water mobility in the membrane extremely accurately. Additional simulations with two different CNT configurations (completely random versus aligned) show that CNT orientation in the polymeric matrix has only a minor effect on D eff (as long as CNTs do not fully penetrate the membrane). We have also extensively analyzed and quantified sublinear (anomalous) diffusive phenomena over small to moderate times and correlated

  13. Variations in calcite growth kinetics with surface topography: molecular dynamics simulations and process-based growth kinetics modelling

    NARCIS (Netherlands)

    Wolthers, M.; Di Tommaso, D.; Du, Zhimei; de Leeuw, Nora H.

    2013-01-01

    It is generally accepted that cation dehydration is the rate-limiting step to crystal growth from aqueous solution. Here we employ classical molecular dynamics simulations to show that the water exchange frequency at structurally distinct calcium sites in the calcite surface varies by about two

  14. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  15. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  16. Structure elucidation and degradation kinetic study of Ofloxacin using surface enhanced Raman spectroscopy

    Science.gov (United States)

    El-Zahry, Marwa R.; Lendl, Bernhard

    2018-03-01

    A simple, fast and sensitive surface enhanced Raman spectroscopy (SERS) method for quantitative determination of fluoroquinolone antibiotic Ofloxacin (OFX) is presented. Also the stability behavior of OFX was investigated by monitoring the SERS spectra of OFX after various degradation processes. Acidic, basic and oxidative force degradation processes were applied at different time intervals. The forced degradation conditions were conducted and followed using SERS method utilizing silver nanoparticles (Ag NPs) as a SERS substrate. The Ag NPs colloids were prepared by reduction of silver nitrate using polyethyelene glycol (PEG) as a reducing and stabilizing agent. Validation tests were done in accordance with International Conference on Harmonization (ICH) guidelines. The calibration curve with a correlation coefficient (R = 0.9992) was constructed as a relationship between the concentration range of OFX (100-500 ng/ml) and SERS intensity at 1394 cm- 1 band. LOD and LOQ values were calculated and found to be 23.5 ng/ml and 72.6 ng/ml, respectively. The developed method was applied successfully for quantitation of OFX in different pharmaceutical dosage forms. Kinetic parameters were calculated including rate constant of the degradation of the studied antibiotic.

  17. Convective drying of osmo-dehydrated apple slices: kinetics and spatial behavior of effective mass diffusivity and moisture content

    Science.gov (United States)

    de Farias Aires, Juarez Everton; da Silva, Wilton Pereira; de Almeida Farias Aires, Kalina Lígia Cavalcante; da Silva Júnior, Aluízio Freire; da Silva e Silva, Cleide Maria Diniz Pereira

    2018-04-01

    The main objective of this study is the presentation of a numerical model of liquid diffusion for the description of the convective drying of apple slices submitted to pretreatment of osmotic dehydration able of predicting the spatial distribution of effective mass diffusivity values in apple slabs. Two models that use numerical solutions of the two-dimensional diffusion equation in Cartesian coordinates with the boundary condition of third kind were proposed to describe drying. The first one does not consider the shrinkage of the product and assumes that the process parameters remain constant along the convective drying. The second one considers the shrinkage of the product and assumes that the effective mass diffusivity of water varies according to the local value of the water content in the apple samples. Process parameters were estimated from experimental data through an optimizer coupled to the numerical solutions. The osmotic pretreatment did not reduce the drying time in relation to the fresh fruits when the drying temperature was equal to 40 °C. The use of the temperature of 60 °C led to a reduction in the drying time. The model that considers the variations in the dimensions of the product and the variation in the effective mass diffusivity proved to be more adequate to describe the process.

  18. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  19. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  20. Oxygen diffusion kinetics and reactive lifetimes in bacterial and mammalian cells irradiated with nanosecond pulses of high intensity electrons

    International Nuclear Information System (INIS)

    Epp, E.R.; Weiss, H.; Ling, C.C.; Djordjevic, B.; Kessaris, N.D.

    1975-01-01

    Experiaments have been designed to gain information on the lifetime of oxygen-sensitive species suspected to be produced in critical molecules in irradiated cells and on the time-diffusion of oxygen in cells. An approach developed in this laboratory involves the delivery of two high intensity electron pulses each of 3 ns duration to a thin layer of cells equilibrated with a known concentration of oxygen. The first pulse serves to render the cells totally anoxic by the radiochemical depletion of oxygen; the second is delivered at a time electronically delayed after the first allowing for diffusion of oxygen during this time. Under these conditions the radiosensitivity of E coli B/r has been measured over six decades of interpulse time. Cellular time-diffusion curves constructed from the measurements show that oxygen establishes its sensitizing effect within 10 -4 s after the creation of intracellular anoxia establishing this time as an upper limit to the lifetime of the species. Unusual behaviour of the diffusion curve observed for longer delay times can be explained by a model wherein it is postulated that a radiation-induced inhibiting agent slows down diffusion. Application of this model to the experimental data yields a value of 0.4x10 -5 cm 2 s -1 for the cellular oxygen diffusion coefficient. Similar experiments recently carried out for Serratia marcescens will also be described. The oxygen effect in cultured HeLa cells exposed to single short electron pulses has been examined over a range of oxygen concentrations. A family of breaking survival curves was obtained similar to those previously measured for E coli B/r by this laboratory. The data appear to be reasonably consistent with a physicochemical mechanism involving the radiochemical depletion of oxygen previously invoked for bacteria. (author)

  1. Self-learning kinetic Monte Carlo simulations of diffusion in ferromagnetic α -Fe–Si alloys

    Energy Technology Data Exchange (ETDEWEB)

    Nandipati, Giridhar; Jiang, Xiujuan; Vemuri, Rama S.; Mathaudhu, Suveen; Rohatgi, Aashish

    2017-12-19

    Diffusion in α-Fe-Si alloys is studied using AKSOME, an on-lattice self-learning KMC code, in the ferromagnetic state. Si diffusivity in the α-Fe matrix were obtained with and without the magnetic disorder in various temperature ranges. In addition we studied vacancy diffusivity in ferromagnetic α-Fe at various Si concentrations up to 12.5at.% in the temperature range of 350–550 K. The results were compared with available experimental and theoretical values in the literature. Local Si-atom dependent activation energies for vacancy hops were calculated using a broken-model and were stored in a database. The migration barrier and prefactors for Si-diffusivity were found to be in reasonable agreement with available modeling results in the literature. Magnetic disorder has a larger effect on the prefactor than on the migration barrier. Prefactor was approximately an order of magnitude and the migration barrier a tenth of an electron-volt higher with magnetic disorder when compared to a fully ferromagnetic ordered state. In addition, the correlation between various have a larger effect on the Si-diffusivity extracted in various temperature range than the magnetic disorder. In the case of vacancy diffusivity, the migration barrier more or less remained constant while the prefactor decreased with increasing Si concentration in the disordered or A2-phase of Fe-Si alloy. Important vacancy-Si/Fe atom exchange processes and their activation barriers were also identified and discuss the effect of energetics on the formation of ordered phases in Fe-Si alloys.

  2. Effects of pressure, temperature and atomic exchanges on phase separation dynamics in Au/Ni(111) surface alloy: Kinetic Monte Carlo study

    Energy Technology Data Exchange (ETDEWEB)

    Zvejnieks, G. [Institute for Solid State Physics, University of Latvia, Kengaraga 8, LV-1063 Riga (Latvia); Ibenskas, A., E-mail: ibenskas@pfi.lt [Center for Physical Sciences and Technology, Semiconductor Physics Institute, Gostauto 11, LT-01108 Vilnius (Lithuania); Tornau, E.E. [Center for Physical Sciences and Technology, Semiconductor Physics Institute, Gostauto 11, LT-01108 Vilnius (Lithuania)

    2015-11-15

    Instability of the Au/Ni(111) surface alloy is studied in different CO gas pressure, p, and temperature limits using kinetic Monte Carlo simulations. We analyze the reaction front dynamics and formation of Au clusters using the model which takes into account surface adatom pair and three-body interactions, CO adsorption and desorption, catalytic carbonyl formation reaction, Au and Ni adatom diffusion and their concerted exchange. Variation of interaction parameters allows us to identify three possible reaction front propagation limits with different pressure dependencies: (i) slow channel-like flow in agreement with experimental data [1] (step flow rate, R, increases with p), (ii) intermediate regime (weak p–dependence), and (iii) fast homogeneous flow (R decreases with p). We find that only Au–Ni exchange, contrary to both Ni–CO and Au–CO exchanges, significantly reduces the number of screened Ni atoms inside the Au clusters and stimulates the occurrence of Ni-free Au clusters. The size of Au islands depends on both pressure and temperature. At a fixed temperature it decreases with pressure due to an increased step flow rate. In the high temperature limit, despite the step flow rate exponential increase with temperature, the cluster size increases due to an enhanced Au mobility. - Highlights: • Kinetic Monte Carlo study of Au–Ni surface alloy instability to CO pressure and temperature. • Three reaction front propagation regimes. • In channel-like regime, the step flow rate increases with CO pressure as in experiment. • Ni-free Au islands are obtained when Au-Ni adatom exchange mechanism is considered. • The size of Au islands decreases with pressure and increases with temperature.

  3. Effects of pressure, temperature and atomic exchanges on phase separation dynamics in Au/Ni(111) surface alloy: Kinetic Monte Carlo study

    International Nuclear Information System (INIS)

    Zvejnieks, G.; Ibenskas, A.; Tornau, E.E.

    2015-01-01

    Instability of the Au/Ni(111) surface alloy is studied in different CO gas pressure, p, and temperature limits using kinetic Monte Carlo simulations. We analyze the reaction front dynamics and formation of Au clusters using the model which takes into account surface adatom pair and three-body interactions, CO adsorption and desorption, catalytic carbonyl formation reaction, Au and Ni adatom diffusion and their concerted exchange. Variation of interaction parameters allows us to identify three possible reaction front propagation limits with different pressure dependencies: (i) slow channel-like flow in agreement with experimental data [1] (step flow rate, R, increases with p), (ii) intermediate regime (weak p–dependence), and (iii) fast homogeneous flow (R decreases with p). We find that only Au–Ni exchange, contrary to both Ni–CO and Au–CO exchanges, significantly reduces the number of screened Ni atoms inside the Au clusters and stimulates the occurrence of Ni-free Au clusters. The size of Au islands depends on both pressure and temperature. At a fixed temperature it decreases with pressure due to an increased step flow rate. In the high temperature limit, despite the step flow rate exponential increase with temperature, the cluster size increases due to an enhanced Au mobility. - Highlights: • Kinetic Monte Carlo study of Au–Ni surface alloy instability to CO pressure and temperature. • Three reaction front propagation regimes. • In channel-like regime, the step flow rate increases with CO pressure as in experiment. • Ni-free Au islands are obtained when Au-Ni adatom exchange mechanism is considered. • The size of Au islands decreases with pressure and increases with temperature

  4. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  5. Experimental and detailed kinetic modeling study of PAH formation in laminar co-flow methane diffusion flames

    DEFF Research Database (Denmark)

    Cuoci, Alberto; Frassoldati, Alessio; Faravelli, Tiziano

    2013-01-01

    In the present paper, synchrotron VUV photoionization mass spectrometry is used to study the detailed chemistry of co-flow methane diffusion flames with different dilution ratios. The experimental results constitute a comprehensive characterization of species important for PAH and soot formation...

  6. Diffusion of Oxygen in Alginate Gels Related to the Kinetics of Methanol Oxidation by Immobilized Hansenula polymorpha Cells

    NARCIS (Netherlands)

    Hiemstra, Harry; Dijkhuizen, Lubbert; Harder, Willem

    1983-01-01

    In the yeast Hansenula polymorpha an oxygen-requiring enzyme, alcohol oxidase, catalyzes the conversion of methanol into formaldehyde. After growth on methanol cells of the organism were harvested and entrapped in barium-alginate gels. The diffusion of oxygen towards these cells is seriously

  7. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  8. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  9. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  10. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  11. Translational kinetic energy induced oxidation on Ti(0001) surfaces using a supersonic O2 beam

    International Nuclear Information System (INIS)

    Ogawa, Shuichi; Takakuwa, Yuji; Ishidzuka, Shinji; Yoshigoe, Akitaka; Teraoka, Yuden; Moritani, Kousuke; Mizuno, Yoshiyuki

    2007-01-01

    The initial sticking probability S 0 of O 2 molecules on a Ti(0001)1x1 surface at room temperature was measured as a function of translational kinetic energy E t by real-time photoelectron spectroscopy. The O 1s photoelectron spectra can be fitted well with three components A, B and C, where the chemical shift of component B and C are +0.7 and +1.6 eV relative to the binding energy of component A (528.8 eV). Upon exposing to the O 2 beam, component A and C appear dominantly and component B grows with an incubation time, indicating that two kinds of chemical adsorption states are concerned with dissociative adsorption of O 2 molecules at the initial stage. The E t dependences of S 0 show quite different behaviors between component A and C: S 0 of component C decreases monotonously with E t and is almost constant above 0.6 eV, while S 0 of component A shows a rapid decrease followed by a gradual increase with a minimum at ∼0.5 eV and then decreases two small maxima at ∼0.9 and ∼1.8 eV. The observed E t dependences of S 0 for component A and C are discussed in terms of a trapping-mediated adsorption and an activated adsorption process and the chemical adsorption state corresponding to component A and C is also considered. (author)

  12. Adsorption of basic dye on high-surface-area activated carbon prepared from coconut husk: Equilibrium, kinetic and thermodynamic studies

    Energy Technology Data Exchange (ETDEWEB)

    Tan, I.A.W.; Ahmad, A.L. [School of Chemical Engineering, Universiti Sains Malaysia, Engineering Campus, 14300 Nibong Tebal, Penang (Malaysia); Hameed, B.H. [School of Chemical Engineering, Universiti Sains Malaysia, Engineering Campus, 14300 Nibong Tebal, Penang (Malaysia)], E-mail: chbassim@eng.usm.my

    2008-06-15

    Adsorption isotherm and kinetics of methylene blue on activated carbon prepared from coconut husk were determined from batch tests. The effects of contact time (1-30 h), initial dye concentration (50-500 mg/l) and solution temperature (30-50 {sup o}C) were investigated. Equilibrium data were fitted to Langmuir, Freundlich, Temkin and Dubinin-Radushkevich isotherm models. The equilibrium data were best represented by Langmuir isotherm model, showing maximum monolayer adsorption capacity of 434.78 mg/g. The kinetic data were fitted to pseudo-first-order, pseudo-second-order and intraparticle diffusion models, and was found to follow closely the pseudo-second-order kinetic model. Thermodynamic parameters such as standard enthalpy ({delta}H{sup o}), standard entropy ({delta}S{sup o}) and standard free energy ({delta}G{sup o}) were evaluated. The adsorption interaction was found to be exothermic in nature. Coconut husk-based activated carbon was shown to be a promising adsorbent for removal of methylene blue from aqueous solutions.

  13. A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

    Science.gov (United States)

    Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

    2016-01-01

    Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

  14. Heat and turbulent kinetic energy budgets for surface layer cooling induced by the passage of Hurricane Frances (2004)

    Science.gov (United States)

    Huang, Peisheng; Sanford, Thomas B.; Imberger, JöRg

    2009-12-01

    Heat and turbulent kinetic energy budgets of the ocean surface layer during the passage of Hurricane Frances were examined using a three-dimensional hydrodynamic model. In situ data obtained with the Electromagnetic-Autonomous Profiling Explorer (EM-APEX) floats were used to set up the initial conditions of the model simulation and to compare to the simulation results. The spatial heat budgets reveal that during the hurricane passage, not only the entrainment in the bottom of surface mixed layer but also the horizontal water advection were important factors determining the spatial pattern of sea surface temperature. At the free surface, the hurricane-brought precipitation contributed a negligible amount to the air-sea heat exchange, but the precipitation produced a negative buoyancy flux in the surface layer that overwhelmed the instability induced by the heat loss to the atmosphere. Integrated over the domain within 400 km of the hurricane eye on day 245.71 of 2004, the rate of heat anomaly in the surface water was estimated to be about 0.45 PW (1 PW = 1015 W), with about 20% (0.09 PW in total) of this was due to the heat exchange at the air-sea interface, and almost all the remainder (0.36 PW) was downward transported by oceanic vertical mixing. Shear production was the major source of turbulent kinetic energy amounting 88.5% of the source of turbulent kinetic energy, while the rest (11.5%) was attributed to the wind stirring at sea surface. The increase of ocean potential energy due to vertical mixing represented 7.3% of the energy deposited by wind stress.

  15. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  16. Analysis of atmospheric flow over a surface protrusion using the turbulence kinetic energy equation with reference to aeronautical operating systems

    Science.gov (United States)

    Frost, W.; Harper, W. L.

    1975-01-01

    Flow over surface obstructions can produce significantly large wind shears such that adverse flying conditions can occur for aeronautical systems (helicopters, STOL vehicles, etc.). Atmospheric flow fields resulting from a semi-elliptical surface obstruction in an otherwise horizontally homogeneous statistically stationary flow are modelled with the boundary-layer/Boussinesq-approximation of the governing equation of fluid mechanics. The turbulence kinetic energy equation is used to determine the dissipative effects of turbulent shear on the mean flow. Iso-lines of turbulence kinetic energy and turbulence intensity are plotted in the plane of the flow and highlight regions of high turbulence intensity in the stagnation zone and sharp gradients in intensity along the transition from adverse to favourable pressure gradient. Discussion of the effects of the disturbed wind field in CTOL and STOL aircraft flight path and obstruction clearance standards is given. The results indicate that closer inspection of these presently recommended standards as influenced by wind over irregular terrains is required.

  17. Ionic Diffusion and Kinetic Homogeneous Chemical Reactions in the Pore Solution of Porous Materials with Moisture Transport

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2009-01-01

    Results from a systematic continuum mixture theory will be used to establish the governing equations for ionic diffusion and chemical reactions in the pore solution of a porous material subjected to moisture transport. The theory in use is the hybrid mixture theory (HMT), which in its general form......’s law of diffusion and the generalized Darcy’s law will be used together with derived constitutive equations for chemical reactions within phases. The mass balance equations for the constituents and the phases together with the constitutive equations gives the coupled set of non-linear differential...... general description of chemical reactions among constituents is described. The Petrov – Galerkin approach are used in favour of the standard Galerkin weighting in order to improve the solution when the convective part of the problem is dominant. A modified type of Newton – Raphson scheme is derived...

  18. Diffusion kinetics of the glucose/glucose oxidase system in swift heavy ion track-based biosensors

    Czech Academy of Sciences Publication Activity Database

    Fink, Dietmar; Vacík, Jiří; Hnatowicz, Vladimír; Hernandez, G. M.; Arrelano, H. G.; Alfonta, L.; Kiv, A.

    2017-01-01

    Roč. 398, MAY (2017), s. 21-26 ISSN 0168-583X R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:61389005 Keywords : etched ion tracks * track radius * polymer * enzyme * diffusion * biosensors Subject RIV: EI - Biotechnology ; Bionics OBOR OECD: Bioremediation, diagnostic biotechnologies (DNA chips and biosensing devices) in environmental management Impact factor: 1.109, year: 2016

  19. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  20. Stochastic theory of interfacial enzyme kinetics: A kinetic Monte Carlo study

    International Nuclear Information System (INIS)

    Das, Biswajit; Gangopadhyay, Gautam

    2012-01-01

    Graphical abstract: Stochastic theory of interfacial enzyme kinetics is formulated. Numerical results of macroscopic phenomenon of lag-burst kinetics is obtained by using a kinetic Monte Carlo approach to single enzyme activity. Highlights: ► An enzyme is attached with the fluid state phospholipid molecules on the Langmuir monolayer. ► Through the diffusion, the enzyme molecule reaches the gel–fluid interface. ► After hydrolysing a phospholipid molecule it predominantly leaves the surface in the lag phase. ► The enzyme is strictly attached to the surface with scooting mode of motion and the burst phase appears. - Abstract: In the spirit of Gillespie’s stochastic approach we have formulated a theory to explore the advancement of the interfacial enzyme kinetics at the single enzyme level which is ultimately utilized to obtain the ensemble average macroscopic feature, lag-burst kinetics. We have provided a theory of the transition from the lag phase to the burst phase kinetics by considering the gradual development of electrostatic interaction among the positively charged enzyme and negatively charged product molecules deposited on the phospholipid surface. It is shown that the different diffusion time scales of the enzyme over the fluid and product regions are responsible for the memory effect in the correlation of successive turnover events of the hopping mode in the single trajectory analysis which again is reflected on the non-Gaussian distribution of turnover times on the macroscopic kinetics in the lag phase unlike the burst phase kinetics.

  1. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  2. Kinetics of intercalation of fluorescent probes in magnesium–aluminium layered double hydroxide within a multiscale reaction–diffusion framework

    Science.gov (United States)

    Saliba, Daniel

    2016-01-01

    We report the synthesis of magnesium–aluminium layered double hydroxide (LDH) using a reaction–diffusion framework (RDF) that exploits the multiscale coupling of molecular diffusion with chemical reactions, nucleation and growth of crystals. In an RDF, the hydroxide anions are allowed to diffuse into an organic gel matrix containing the salt mixture needed for the precipitation of the LDH. The chemical structure and composition of the synthesized magnesium–aluminium LDHs are determined using powder X-ray diffraction (PXRD), thermo-gravimetric analysis, differential scanning calorimetry, solid-state nuclear magnetic resonance (SSNMR), Fourier transform infrared and energy dispersive X-ray spectroscopy. This novel technique also allows the investigation of the mechanism of intercalation of some fluorescent probes, such as the neutral three-dimensional rhodamine B (RhB) and the negatively charged two-dimensional 8-hydroxypyrene-1,3,6-trisulfonic acid (HPTS), using in situ steady-state fluorescence spectroscopy. The incorporation of these organic dyes inside the interlayer region of the LDH is confirmed via fluorescence microscopy, solid-state lifetime, SSNMR and PXRD. The activation energies of intercalation of the corresponding molecules (RhB and HPTS) are computed and exhibit dependence on the geometry of the involved probe (two or three dimensions), the charge of the fluorescent molecule (anionic, cationic or neutral) and the cationic ratio of the corresponding LDH. This article is part of the themed issue ‘Multiscale modelling at the physics–chemistry–biology interface’. PMID:27698034

  3. Kinetics of intercalation of fluorescent probes in magnesium-aluminium layered double hydroxide within a multiscale reaction-diffusion framework

    Science.gov (United States)

    Saliba, Daniel; Al-Ghoul, Mazen

    2016-11-01

    We report the synthesis of magnesium-aluminium layered double hydroxide (LDH) using a reaction-diffusion framework (RDF) that exploits the multiscale coupling of molecular diffusion with chemical reactions, nucleation and growth of crystals. In an RDF, the hydroxide anions are allowed to diffuse into an organic gel matrix containing the salt mixture needed for the precipitation of the LDH. The chemical structure and composition of the synthesized magnesium-aluminium LDHs are determined using powder X-ray diffraction (PXRD), thermo-gravimetric analysis, differential scanning calorimetry, solid-state nuclear magnetic resonance (SSNMR), Fourier transform infrared and energy dispersive X-ray spectroscopy. This novel technique also allows the investigation of the mechanism of intercalation of some fluorescent probes, such as the neutral three-dimensional rhodamine B (RhB) and the negatively charged two-dimensional 8-hydroxypyrene-1,3,6-trisulfonic acid (HPTS), using in situ steady-state fluorescence spectroscopy. The incorporation of these organic dyes inside the interlayer region of the LDH is confirmed via fluorescence microscopy, solid-state lifetime, SSNMR and PXRD. The activation energies of intercalation of the corresponding molecules (RhB and HPTS) are computed and exhibit dependence on the geometry of the involved probe (two or three dimensions), the charge of the fluorescent molecule (anionic, cationic or neutral) and the cationic ratio of the corresponding LDH. This article is part of the themed issue 'Multiscale modelling at the physics-chemistry-biology interface'.

  4. Analysis and assessment for the intrapulmonary kinetics of N-isopropyl-I-123-p-iodoamphetamine (IMP) in diffuse respiratory diseases

    International Nuclear Information System (INIS)

    Fujishima, Seitaro

    1992-01-01

    We investigated intrapulmonary kinetics of N-isopropyl-I-123-p-iodoamphetamine (IMP) in patients with diffuse respiratory diseases. Subjects studied were 4 healthy nonsmoking controls (age≥40), 3 young healthy nonsmokers (age 1 ) was smaller than that to the slow compartment (A 2 ). There was no difference in the A 1 to A 2 ratio among the groups. We then analyzed the slopes of the fast and slow compartments (k 1 , k 2 ). There was no difference in k 1 among the groups. On the other hand, k 2 was larger in young healthy nonsmokers and smaller in healthy smokers, the patients with IPF, sarcoidosis and CPE than k 2 in nonsmoking controls. Furthermore, k 2 decreased in inverse proportion to age. We concluded that k 2 could be a valuable index to detect changes of IMP, a lipophilic amine, metabolism in the lungs. (author)

  5. Recursive solutions for multi-group neutron kinetics diffusion equations in homogeneous three-dimensional rectangular domains with time dependent perturbations

    Energy Technology Data Exchange (ETDEWEB)

    Petersen, Claudio Z. [Universidade Federal de Pelotas, Capao do Leao (Brazil). Programa de Pos Graduacao em Modelagem Matematica; Bodmann, Bardo E.J.; Vilhena, Marco T. [Universidade Federal do Rio Grande do Sul, Porto Alegre, RS (Brazil). Programa de Pos-graduacao em Engenharia Mecanica; Barros, Ricardo C. [Universidade do Estado do Rio de Janeiro, Nova Friburgo, RJ (Brazil). Inst. Politecnico

    2014-12-15

    In the present work we solve in analytical representation the three dimensional neutron kinetic diffusion problem in rectangular Cartesian geometry for homogeneous and bounded domains for any number of energy groups and precursor concentrations. The solution in analytical representation is constructed using a hierarchical procedure, i.e. the original problem is reduced to a problem previously solved by the authors making use of a combination of the spectral method and a recursive decomposition approach. Time dependent absorption cross sections of the thermal energy group are considered with step, ramp and Chebyshev polynomial variations. For these three cases, we present numerical results and discuss convergence properties and compare our results to those available in the literature.

  6. Design requirements for ERD in diffusion-dominated media: how do injection interval, bioactive zones and reaction kinetics affect remediation performance?

    DEFF Research Database (Denmark)

    Chambon, Julie Claire Claudia; Lemming, Gitte; Manoli, Gabriele

    is to get contact between the injected bacteria and electron donor and the contaminants trapped in the low-permeability matrix. Sampling of intact cores from the low-permeability matrix has shown that the bioactive zones (where degradation occurs) are limited in the matrix, due to the slow diffusion...... is developed to simulate ERD at a contaminated site, where the source area (mainly TCE) is located in a clayey till with fractures and interbedded sand lenses. Such contaminated sites are common in North America and Europe. Hydro-geological characterization provided information on geological heterogeneities...... experiments. The influence of the reaction kinetics on remediation efficiency is assessed by varying the biomass concentration of the specific degraders. The injected reactants (donor and bacteria) are assumed to spread in horizontal injection zones of various widths, depending on the development of bioactive...

  7. Design requirements for ERD in diffusion-dominated media: how do injection interval, bioactive zones and reaction kinetics affect remediation performance?

    Science.gov (United States)

    Chambon, J.; Lemming, G.; Manoli, G.; Broholm, M. M.; Bjerg, P.; Binning, P. J.

    2011-12-01

    Enhanced Reductive Dechlorination (ERD) has been successfully used in high permeability media, such as sand aquifers, and is considered to be a promising technology for low permeability settings. Pilot and full-scale applications of ERD at several sites in Denmark have shown that the main challenge is to get contact between the injected bacteria and electron donor and the contaminants trapped in the low-permeability matrix. Sampling of intact cores from the low-permeability matrix has shown that the bioactive zones (where degradation occurs) are limited in the matrix, due to the slow diffusion transport processes, and this affects the timeframes for the remediation. Due to the limited ERD applications and the complex transport and reactive processes occurring in low-permeability media, design guidelines are currently not available for ERD in such settings, and remediation performance assessments are limited. The objective of this study is to combine existing knowledge from several sites with numerical modeling to assess the effect of the injection interval, development of bioactive zones and reaction kinetics on the remediation efficiency for ERD in diffusion-dominated media. A numerical model is developed to simulate ERD at a contaminated site, where the source area (mainly TCE) is located in a clayey till with fractures and interbedded sand lenses. Such contaminated sites are common in North America and Europe. Hydro-geological characterization provided information on geological heterogeneities and hydraulic parameters, which are relevant for clay till sites in general. The numerical model couples flow and transport in the fracture network and low-permeability matrix. Sequential degradation of TCE to ethene is modeled using Monod kinetics, and the kinetic parameters are obtained from laboratory experiments. The influence of the reaction kinetics on remediation efficiency is assessed by varying the biomass concentration of the specific degraders. The injected

  8. Coupling of kinetic Monte Carlo simulations of surface reactions to transport in a fluid for heterogeneous catalytic reactor modeling

    International Nuclear Information System (INIS)

    Schaefer, C.; Jansen, A. P. J.

    2013-01-01

    We have developed a method to couple kinetic Monte Carlo simulations of surface reactions at a molecular scale to transport equations at a macroscopic scale. This method is applicable to steady state reactors. We use a finite difference upwinding scheme and a gap-tooth scheme to efficiently use a limited amount of kinetic Monte Carlo simulations. In general the stochastic kinetic Monte Carlo results do not obey mass conservation so that unphysical accumulation of mass could occur in the reactor. We have developed a method to perform mass balance corrections that is based on a stoichiometry matrix and a least-squares problem that is reduced to a non-singular set of linear equations that is applicable to any surface catalyzed reaction. The implementation of these methods is validated by comparing numerical results of a reactor simulation with a unimolecular reaction to an analytical solution. Furthermore, the method is applied to two reaction mechanisms. The first is the ZGB model for CO oxidation in which inevitable poisoning of the catalyst limits the performance of the reactor. The second is a model for the oxidation of NO on a Pt(111) surface, which becomes active due to lateral interaction at high coverages of oxygen. This reaction model is based on ab initio density functional theory calculations from literature.

  9. Impact of pre-equilibration and diffusion limited release kinetics on effluent concentration in column leaching tests: Insights from numerical simulations.

    Science.gov (United States)

    Finkel, Michael; Grathwohl, Peter

    2017-05-01

    Column leaching tests have become a standard method for assessing leaching of pollutants from materials used, e.g., for road and railway constructions and in landscaping measures. Column tests showed to be practical in laboratories yielding robust and reproducible results. However, considerable uncertainty still exists related particularly to the degree of equilibration of the pore water with the solids during preparation (pre-equilibration) and percolation of the column. We analyse equilibration time scales and sensitivity of concentrations in column leachate with respect to initial conditions in a series of numerical experiments covering a broad spectrum of material and solute properties. Slow release of pollutants from solid materials is described by a spherical diffusion model of kinetic sorption accounting for multiple grain size fractions and sorption capacities. Results show that the cumulative concentrations are rather independent of the pre-equilibration level for a broad spectrum of parameter settings, e.g. if intra-particle porosity is high, grain size is small, or if the sorption coefficient is large. Sensitivity increases with decreasing liquid solid ratios and contact time during percolation. Significant variations with initial column conditions are to be expected for material and compound properties leading to slow release kinetics. In these cases, sensitivity to initial conditions may have to be considered. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  11. Full-dimensional analytical potential energy surface describing the gas-phase Cl + C2H6 reaction and kinetics study of rate constants and kinetic isotope effects.

    Science.gov (United States)

    Rangel, Cipriano; Espinosa-Garcia, Joaquin

    2018-02-07

    Within the Born-Oppenheimer approximation a full-dimensional analytical potential energy surface, PES-2017, was developed for the gas-phase hydrogen abstraction reaction between the chlorine atom and ethane, which is a nine body system. This surface presents a valence-bond/molecular mechanics functional form dependent on 60 parameters and is fitted to high-level ab initio calculations. This reaction presents little exothermicity, -2.30 kcal mol -1 , with a low height barrier, 2.44 kcal mol -1 , and intermediate complexes in the entrance and exit channels. We found that the energetic description was strongly dependent on the ab initio level used and it presented a very flat topology in the entrance channel, which represents a theoretical challenge in the fitting process. In general, PES-2017 reproduces the ab initio information used as input, which is merely a test of self-consistency. As a first test of the quality of the PES-2017, a theoretical kinetics study was performed in the temperature range 200-1400 K using two approaches, i.e. the variational transition-state theory and quasi-classical trajectory calculations, with spin-orbit effects. The rate constants show reasonable agreement with experiments in the whole temperature range, with the largest differences at the lowest temperatures, and this behaviour agrees with previous theoretical studies, thus indicating the inherent difficulties in the theoretical simulation of the kinetics of the title reaction. Different sources of error were analysed, such as the limitations of the PES and theoretical methods, recrossing effects, and the tunnelling effect, which is negligible in this reaction, and the manner in which the spin-orbit effects were included in this non-relativistic study. We found that the variation of spin-orbit coupling along the reaction path, and the influence of the reactivity of the excited Cl( 2 P 1/2 ) state, have relative importance, but do not explain the whole discrepancy. Finally, the

  12. The Effect of Landing Surface on the Plantar Kinetics of Chinese Paratroopers Using Half-Squat Landing

    Science.gov (United States)

    Li, Yi; Wu, Ji; Zheng, Chao; Huang, Rong Rong; Na, Yuhong; Yang, Fan; Wang, Zengshun; Wu, Di

    2013-01-01

    The objective of the study was to determine the effect of landing surface on plantar kinetics during a half-squat landing. Twenty male elite paratroopers with formal parachute landing training and over 2 years of parachute jumping experience were recruited. The subjects wore parachuting boots in which pressure sensing insoles were placed. Each subject was instructed to jump off a platform with a height of 60 cm, and land on either a hard or soft surface in a half-squat posture. Outcome measures were maximal plantar pressure, time to maximal plantar pressure (T-MPP), and pressure-time integral (PTI) upon landing on 10 plantar regions. Compared to a soft surface, hard surface produced higher maximal plantar pressure in the 1st to 4th metatarsal and mid-foot regions, but lower maximal plantar pressure in the 5th metatarsal region. Shorter T- MPP was found during hard surface landing in the 1st and 2nd metatarsal and medial rear foot. Landing on a hard surface landing resulted in a lower PTI than a soft surface in the 1stphalangeal region. For Chinese paratroopers, specific foot prosthesis should be designed to protect the1st to 4thmetatarsal region for hard surface landing, and the 1stphalangeal and 5thmetatarsal region for soft surface landing. Key Points Understanding plantar kinetics during the half-squat landing used by Chinese paratroopers can assist in the design of protective footwear. Compared to landing on a soft surface, a hard surface produced higher maximal plantar pressure in the 1st to 4th metatarsal and mid-foot regions, but lower maximal plantar pressure in the 5th metatarsal region. A shorter time to maximal plantar pressure was found during a hard surface landing in the 1st and 2nd metatarsals and medial rear foot. Landing on a hard surface resulted in a lower pressure-time integral than landing on a soft surface in the 1st phalangeal region. For Chinese paratroopers, specific foot prosthesis should be designed to protect the 1st to 4th metatarsal

  13. The effect of surface-bulk potential difference on the kinetics of intercalation in core-shell active cathode particles

    Science.gov (United States)

    Kazemiabnavi, Saeed; Malik, Rahul; Orvananos, Bernardo; Abdellahi, Aziz; Ceder, Gerbrand; Thornton, Katsuyo

    2018-04-01

    Surface modification of active cathode particles is commonly observed in battery research as either a surface phase evolving during the cycling process, or intentionally engineered to improve capacity retention, rate capability, and/or thermal stability of the cathode material. Here, a continuum-scale model is developed to simulate the galvanostatic charge/discharge of a cathode particle with core-shell heterostructure. The particle is assumed to be comprised of a core material encapsulated by a thin layer of a second phase that has a different open-circuit voltage. The effect of the potential difference between the surface and bulk phases (Ω) on the kinetics of lithium intercalation and the galvanostatic charge/discharge profiles is studied at different values of Ω, C-rates, and exchange current densities. The difference between the Li chemical potential in the surface and bulk phases of the cathode particle results in a concentration difference between these two phases. This leads to a charge/discharge asymmetry in the galvanostatic voltage profiles, causing a decrease in the accessible capacity of the particle. These effects are more significant at higher magnitudes of surface-bulk potential difference. The proposed model provides detailed insight into the kinetics and voltage behavior of the intercalation/de-intercalation processes in core-shell heterostructure cathode particles.

  14. Kinetic analysis of a monoclonal therapeutic antibody and its single-chain homolog by surface plasmon resonance.

    Science.gov (United States)

    Patel, Rekha; Andrien, Bruce A

    2010-01-01

    Monoclonal antibodies (mAbs) and antibody fragments have become an emerging class of therapeutics since 1986. Their versatility enables them to be engineered for optimal efficiency and decreased immunogenicity, and the path to market has been set by recent regulatory approvals. One of the initial criteria for success of any protein or antibody therapeutic is to understand its binding characteristics to the target antigen. Surface plasmon resonance (SPR) has been widely used and is an important tool for ligand-antigen binding characterization. In this work, the binding kinetics of a recombinant mAb and its single-chain antibody homolog, single-chain variable fragment (scFv), was analyzed by SPR. These two proteins target the same antigen. The binding kinetics of the mAb (bivalent antibody) and scFv (monovalent scFv) for this antigen was analyzed along with an assessment of the thermodynamics of the binding interactions. Alternative binding configurations were investigated to evaluate potential experimental bias because theoretically experimental binding configuration should have no impact on binding kinetics. Self-association binding kinetics in the proteins' respective formulation solutions and antigen epitope mapping were also evaluated. Functional characterization of monoclonal and single-chain antibodies has become just as important as structural characterization in the biotechnology field.

  15. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, Rizwan M; Oral, Ebru; Muratoglu, Orhun K

    2014-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E

  16. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, R. M.; Oral, E.; Muratoglu, O. K.

    2013-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E. (author)

  17. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  18. The importance of kinetics and redox in the biogeochemical cycling of iron in the surface ocean.

    Directory of Open Access Journals (Sweden)

    Peter L. Croot

    2012-06-01

    Full Text Available It is now well established that Iron (Fe is a limiting element in many regions of the open ocean. Our current understanding of the key processes which control iron distribution in the open ocean have been largely based on thermodynamic measurements performed under the assumption of equilibrium conditions. Using this equilibrium approach, researchers have been able to detect and quantify organic complexing ligands in seawater and examine their role in increasing the overall solubility of iron. Our current knowledge about iron bioavailability to phytoplankton and bacteria is also based heavily on carefully controlled laboratory studies where it is assumed the chemical species are in equilibrium in line with the free ion association model (FIAM and/or its successor the biotic ligand model (BLM. Similarly most field work on Fe biogeochemistry generally consists of a single profile which is in essence a ‘snap-shot’ in time of the system under investigation. However it is well known that the surface ocean is an extremely dynamic environment and it is unlikely if thermodynamic equilibrium between all the iron species present is ever truly achieved. In sunlit waters this is mostly due to the daily passage of the sun across the sky leading to photoredox processes which alter Fe speciation by cycling between redox states and between inorganic and organic species. Episodic deposition events, are also important perturbations to iron cycling as they bring new iron to the system altering the equilibrium between species and phases. Over the last 20 years the mesoscale iron enrichment experiments (e.g. IronEx I /II, SOIREE, EisenEx, SOFeX, EIFeX, SAGE, SEEDS and SERIES I /II and the FeCycle (I/II experiments have provided the first insights into processes altering iron speciation and distribution which occur over temporal scales of days to weeks. Here we utilize new field data collected in the open ocean on the redox and complexation kinetics of iron in the

  19. Kinetics and thermodynamics studies on the BMP-2 adsorption onto hydroxyapatite surface with different multi-morphological features.

    Science.gov (United States)

    Lu, Zhiwei; Huangfu, Changxin; Wang, Yanying; Ge, Hongwei; Yao, Yao; Zou, Ping; Wang, Guangtu; He, Hua; Rao, Hanbing

    2015-01-01

    The effect of the surface topography on protein adsorption process is of great significance for designing hydroxyapatite (HA) ceramic material surfaces. In this work, three different topographies of HA materials HA-sheet, HA-rod, and HA-whisker were synthesized and testified by X-ray diffraction (XRD), Fourier transform infrared (FT-IR), Brunauer-Emmett-Teller (BET) and a field emission scanning electron microscopy (FE-SEM). We have systematically investigated the adsorption kinetics and thermodynamics of bone morphogenetic proteins (BMP-2) on the three different topography surfaces of HA, respectively. The results showed that the maximum adsorption capacities of HA-sheet, HA-rod and HA-whisker were (219.96 ± 10.18), (247.13 ± 12.35), and (354.67 ± 17.73) μg · g(-1), respectively. Kinetic parameters, rate constants, equilibrium adsorption capacities and related correlation coefficients, for each kinetic model were calculated as well as discussed. It demonstrated that the adsorption of BMP-2 onto HA could be described by the pseudo second-order equation. Adsorption of BMP-2 onto HA followed the Langmuir isotherm. It confirmed that compared with other samples HA-whisker had more adsorption sites for its high specific surface area which could provide more opportunities for protein molecules. The adsorption processes were endothermic (ΔH > 0), spontaneous (ΔG 0). A possible adsorption mechanism has been proposed. In addition, the BMP-2 could be adsorbed to the surface which existed slight conformational changes by FT-IR. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)